Next Article in Journal
Genetic Diversity of Promising Spring Wheat Accessions from Russia and Kazakhstan for Rust Resistance
Next Article in Special Issue
Endophytic Bacteria and Fungi Associated with Polygonum cuspidatum in the Russian Far East
Previous Article in Journal
Parental Effect on Agronomic and Olive Oil Traits in Olive Progenies from Reciprocal Crosses
Previous Article in Special Issue
Geographic Location Affects the Bacterial Community Composition and Diversity More than Species Identity for Tropical Tree Species
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Variation in Root-Associated Microbial Communities among Three Different Plant Species in Natural Desert Ecosystem

1
College of Ecology and Environmental, Xinjiang University, Urumqi 830046, China
2
Xinjiang Key Laboratory of Desert Plant Roots Ecology and Vegetation Restoration, Xinjiang Institute of Ecology and Geography, Chinese Academy of Sciences, Urumqi 830011, China
3
State Key Laboratory of Desert and Oasis Ecology, Key Laboratory of Ecological Safety and Sustainable Development in Arid Lands, Xinjiang Institute of Ecology and Geography, Chinese Academy of Sciences, Urumqi 830011, China
4
Cele National Station of Observation and Research for Desert-Grassland Ecosystems, Cele 848300, China
5
University of Chinese Academy of Sciences, Beijing 100049, China
*
Authors to whom correspondence should be addressed.
Submission received: 18 July 2024 / Revised: 21 August 2024 / Accepted: 2 September 2024 / Published: 3 September 2024
(This article belongs to the Special Issue Plant-Microbiome Interactions)

Abstract

:
The process and function that underlie the assembly of root-associated microbiomes may be strongly linked to the survival strategy of plants. However, the assembly and functional changes of root-associated microbial communities in different desert plants in natural desert ecosystems are still unclear. Thus, we studied the microbial communities and diversity of root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS) among three representative desert plants (Alhagi sparsifolia, Tamarix ramosissima, and Calligonum caput-medusae) in three Xinjiang desert regions {Taklimakan (CL), Gurbantünggüt (MSW), and Kumtag (TLF)} in China. This study found that the soil properties {electrical conductivity (EC), soil organic carbon (SOC), total nitrogen (TN) and phosphorus (TP), available nitrogen (AN) and phosphorus (AP)} of C. caput-medusae were significantly lower than those of A. sparsifolia and T. ramosissima, while the root nutrients (TN and TP) of A. sparsifolia were significantly higher compared to C. caput-medusae and T. ramosissima. The beta diversity of bacteria and fungi (RE) among the three desert plants was significantly different. The common OTU numbers of bacteria and fungi in three compartments (RE, RS, and BS) of the three desert plants were ranked as RS > BS > RE. The bacterial and fungal (RE) Shannon and Simpson indexes of C. caput-medusae were significantly lower as compared to those of A. sparsifolia and T. ramosissima. Additionally, bacterial and fungal (RE and RS) node numbers and average degree of C. caput-medusae were lower than those found in A. sparsifolia and T. ramosissima. Root and soil nutrients collectively contributed to the composition of root-associated bacterial (RE, 12.4%; RS, 10.6%; BS, 16.6%) and fungal communities (RE, 34.3%; RS, 1.5%; BS, 17.7%). These findings demonstrate variations in the bacterial and fungal populations across different plant species with distinct compartments (RE, RS, and BS) in arid environments. More importantly, the study highlights how much soil and plant nutrients contribute to root-associated microbial communities.

1. Introduction

A close reciprocal interplay exists between the microbial assemblage and the plant host, serving as a crucial factor in maintaining well-being and enhancing the yield of the plant [1,2]. Nevertheless, the root serves as the primary organ for nutrient acquisition in plants, facilitating direct interactions with soil microbes and the formation of symbiotic relationships with bacteria and fungi [3,4]. The formation of the rhizosphere is primarily facilitated through the root-induced modification of the soil’s physical architecture [4]. Plants release substances from their roots into the surrounding soil, which help to draw in and support microbial communities [5,6,7]. Diverse compositions of rhizo-deposits enable plants to shape rhizosphere microbial communities for their benefit [8,9]. Consequently, the rhizosphere functions as a focal point for microbial activity, nutrient circulation, and the transformation of organic substances [4,5,7,9].
The assemblage and heterogeneity of microbial communities within arid soils are affected by the presence of distinct plant species and seasonal environmental changes [10]. The fluctuation of soil microbial functional groups throughout the seasons is intricately intertwined with plant diversity, climatic factors, soil nutrient levels, and various other relevant elements [11]. Soil properties (total nitrogen (TN), available phosphorus (AP), and pH) play a significant role in determining how plant and soil microbial communities adapt to alterations in their surroundings [12,13,14]. The composition of soil bacterial communities was mainly impacted by the soil total phosphorus (TP), and a discernible trend of diminishing bacterial diversity was observed with increasing distance, suggesting that environmental factors exert a more substantial impact on the shifts in bacterial communities than geographical proximity within the Gurbantünggüt desert [15]. An investigation examining the bacterial taxa in the arid regions of central Mexico revealed that the relative abundance of some taxa (e.g., Actinomycetota, Pseudomonadota, and Acidobacteriota) accounted for a large proportion in the rhizosphere of cactus species [16,17].
In extreme arid desert ecosystems, the spatial distribution of desert plants is affected by the availability of soil nutrients and water [18]. However, compared to the interspace area, desert vegetation had a faster nutrient turnover [19]. These canopy patches can extremely easily form a cool microclimate [20,21]. Because they have higher and faster nutrient cycling and greater microbial turnover, they are described as ‘fertile islands’, which may serve to form the structural and functional dynamics of desert environments and slow down the desertification process [22,23]. Different plant species often form ‘dunes’ of varying magnitude, and these dunes usually have different degrees of fertile island effect in desert ecosystems [24]. Therefore, species-specific vegetation (e.g., Tamarix chinensis and Salix psammophila) could be used to reasonably explain variations in ‘fertile island’ formation and discrepancies between soil properties beneath the canopy versus the interspace area [23,25]. Research has indicated that the ‘fertile islands’ within the Taklimakan desert are consistent with canopy size, with T. ramosissima exhibiting the highest level of soil fertility, followed by Karelinia caspia and A. sparsifolia [26]. Also, it is suggested that the influence of fertile islands on microbial energy strategies and life-history strategies via soil organic carbon (SOC) availability could be one of the mechanisms that shape the spatial heterogeneity of soil and root microbial communities in desert plants [27]. Additionally, altered energy and life-history strategies may further affect the decomposition activity of microorganisms in soil labile and stable carbon pools [27,28].
Desert ecosystems are particularly harsh environments, characterized by low moisture availability, high temperatures, and limited nutrient resources [29,30]. Microbes from extreme environments, including bacteria and fungi, display unique genetic and physiological characteristics that allow them to survive in challenging conditions [31,32,33]. The Taklimakan, Gurbantünggüt, and Kumtag deserts are acknowledged for their natural formation as severe environmental conditions, marked by aridity, salinization, and elevated temperatures, which serve as the primary non-living stress factors [30,34,35]. Despite these challenges, certain plant species have adapted to thrive in these harsh environments, in part through symbiotic associations with specific microbial communities in their root systems [36,37,38]. The composition and diversity of the root-associated microbial communities are deemed essential for facilitating plant–microbial interactions, thereby ultimately shaping the growth and development of vegetation in arid environments [36,39,40]. A. sparsifolia, T. ramosissima, and Calligonum caput-medusae are key desert flora that contribute significantly to maintaining balance in desert environments, promoting biodiversity, impacting climate control, and containing healing properties [26,41,42]. Our goal was to understand how different plant species affect the diversity of root-associated microbial communities and their potential function in dry environments. Our hypothesis posits two key assertions: Firstly, we propose that the roots of various desert plants host a core microbiota, consisting of both bacterial and fungal assemblages, which collaboratively facilitate adaptation to the harsh arid conditions prevalent in desert environments. Secondly, we anticipate that the factors influencing the composition and diversity of these microbial communities (RE, RS, and BS) differ significantly across distinct desert plant species, thereby shaping unique bacterial and fungal community structures within their root systems.

2. Results

2.1. Variations in Soil and Root Nutrients among Three Desert Plants

C. caput-medusae exhibited significantly lower levels of soil physical and chemical properties (SOC, TN, TP, AN, AP, and EC) in comparison to A. sparsifolia and T. ramosissima (one-way ANOVA; Table 1). In contrast, soil TK content did not show significant variation among the three desert plants (one-way ANOVA; Table 1). Root nutrients (ROC, TN, TP, and TK) of T. ramosissima were found to be significantly lower than those of A. sparsifolia and C. caput-medusae (one-way ANOVA; Table 2). The height and crown width of A. sparsifolia were significantly lower compared to T. ramosissima and C. caput-medusae (Table S1). The soil nutrients (TP, TK, AN, AP, and AK) in three desert plants were higher than those in bare soil (Table 1 and Table S2).

2.2. Sequencing and OTU Number of Root-Associated Microbes among Three Desert Plants

Plant species and different compartments had significant effects on the sequencing and OTU number (bacteria and fungi) (two-way ANOVA; Table 3). Furthermore, the interaction of various species and compartments significantly impacted the sequencing (bacteria and fungi) and OTU number (bacteria), while no significant effect was observed on the OTU number (fungi) (two-way ANOVA; Table 3). C. caput-medusae had a significantly lower OTU number of bacterial communities (RE) compared to A. sparsifolia and T. ramosissima, but the bacterial communities (RS) of C. caput-medusae had a significantly higher OTU number compared to A. sparsifolia and T. ramosissima (Figure 1A,B). Furthermore, A. sparsifolia exhibited a significantly lower OTU number of bacterial communities (BS) compared to C. caput-medusae and T. ramosissima (Figure 1C). Additionally, the fungal communities (RE and BS) of A. sparsifolia had a significantly lower OTU number compared to C. caput-medusae and T. ramosissima (Figure 1D,F). There was no significant difference in the OTU number among three desert plants (Figure 1E). The relative abundance of Pseudomonadota (bacterial taxa) in the RE and RS of T. ramosissima was found to be higher compared to A. sparsifolia and C. caput-medusae (Figure 1G). Moreover, the relative abundance of Ascomycota (fungal taxa) in RS and BS was higher compared to that in the RE among all three desert plants (Figure 1H). In addition, the sequencing number (bacteria) of RE was higher than that of RS and BS among three desert plants, whereas the sequencing number (fungi) of RE was lower than that of RS and BS in two desert plants (T. ramosissima and C. caput-medusae) (Figure S1A,B).

2.3. Alpha Diversity of Root-Associated Microbes among Three Desert Plants

Bacteria (RE) in C. caput-medusae exhibited significantly lower alpha diversity (Chao1, Shannon, Pielou_e, and Simpson index) compared to A. sparsifolia and T. ramosissima (Figure 2A,D,G,J). However, the bacterial (RS) Chao1, Shannon, Pielou_e, and Simpson indexes of C. caput-medusae were significantly higher than those of T. ramosissima (Figure 2B,E,H,K). The bacterial (BS) Chao1 index in A. sparsifolia was significantly lower than that of C. caput-medusae and T. ramosissima (Figure 2C). Moreover, other bacterial (BS) Shannon, Pielou_e, and Simpson indexes in the three desert plants were not significantly different (Figure 2F,I,L).
The fungal (RE) Chao1 index in A. sparsifolia was significantly lower than that of C. caput-medusae and T. ramosissima (Figure S2A). Other fungal (RE) alpha diversity (Shannon, Simpson, and Pielou_e indexes) in T. ramosissima was significantly higher than that of C. caput-medusae (Figure S2D,G,J). The fungal (RS and BS) Chao1, Shannon, Pielou_e, and Simpson indexes in the three desert plants were not significantly different (Figure S2B,C,E,F,H,I,K,L).

2.4. Beta Diversity of Root-Associated Microorganisms among Three Desert Plants

The bacterial (RE) beta diversity among the three desert plants was significantly different (Figure 3A). However, there was no significant difference in the bacterial (BS) beta diversity among three desert plants (Figure 3C). The bacterial (RS) beta diversity in A. sparsifolia was significantly different than that of T. ramosissima and C. caput-medusae, but the bacterial (RS) beta diversity in T. ramosissima was not significantly different than C. caput-medusae (Figure 3B). The fungal (RE) beta diversity of the three desert plants was significantly different (Figure S3A). The fungal (RS and BS) beta diversity in T. ramosissima was significantly different than that in C. caput-medusae (Figure S3B,C).

2.5. Core and Differential Microbiota of Root-Associated Microbes among Three Desert Plants

The bacterial and fungal communities (RE, RS, and BS) of A. sparsifolia had 8909 and 1510, 12,783 and 3728, and 10,071 and 6149 unique OTUs, respectively (Figure 4A–F). The bacterial and fungal communities (RE, RS, and BS) of T. ramosissima had 7506 and 3745, 11,580 and 4344, and 13,521 and 7895 unique OTUs, respectively (Figure 4A–F). The bacterial and fungal communities (RE, RS, and BS) of C. caput-medusae had 4893 and 3570, 16,899 and 4577, and 19,002 and 7276 unique OTUs, respectively (Figure 4A–F). A total of 1647 and 250, 4470 and 877, and 4283 and 540 core OTUs were stable in the bacterial and fungal communities (RE, RS, and BS) among the three plants, respectively (Figure 4A–F).

2.6. LEfSe Analysis of Root-Associated Microbes among Three Desert Plantss

Through LEfse analysis, the taxonomic groups Halobacterota and Pseudomonadota were determined to be indicative of RE and RS (bacterial communities) linked to A. sparsifolia (Figure 5A,B). Additionally, Firmicuteota, Bacteroidota, and Pseudomonadota were identified as the biomarkers of BS (bacterial communities) in A. sparsifolia (Figure 5C). Conversely, the taxonomic groups Actinomycetota and Cyanobacteriota were recognized as biomarkers for RE (bacterial communities) in T. ramosissima (Figure 5A). Additionally, T. ramosissima showed Bacteroidota and Actinomycetota as biomarkers for RS (bacterial communities) (Figure 5B), with Actinomycetota acting as the indicator for BS (bacterial communities) (Figure 5C). Nitrospiraeota and Verrucomicrobaeota were recognized as biomarkers for RE (bacterial communities) in C. caput-medusae (Figure 5A), whereas Chloroflexi and Cyanobacteriota were determined to be biomarkers for RS and BS (bacterial communities) (Figure 5B,C). Moreover, Ascomycota and Fungi_phy_Incertae_sedis were identified as biomarkers for RE and BS (fungal communities) in T. ramosissima, while A. sparsifolia showed Ascomycota as a biomarker for BS (fungal communities) (Figure 5D–F).

2.7. Network of Root-Associated Microbes among Three Desert Plant Species

The bacterial (RE and RS) network characteristics (nodes, edges, and average degree) of C. caput-medusae were discovered to be lower than those of A. sparsifolia and T. ramosissima (Figure 6A–F). However, the bacterial and fungal (BS) network characteristics (nodes, edges, and average degree) of A. sparsifolia were higher than T. ramosissima and C. caput-medusae (Figure 6G–I; Figure S5H,I). The fungal (RE) network characteristics (nodes, edges, and average degree) of T. ramosissima were lower than those of A. sparsifolia and C. caput-medusae (Figure S4A–C). In C. caput-medusae, the fungal (RS) network properties (nodes, edges, and average degree) were determined to be lower than those of A. sparsifolia and T. ramosissima (Figure S4D–F). Similarly, the fungal (BS) network characteristics (nodes, edges, and average degree) of A. sparsifolia were higher than those of C. caput-medusae and T. ramosissima (Figure S4G–I).

2.8. The Influence of Soil and Root Nutrients on the Root-Associated Microbial Communities among Three Desert Plants

The interaction between root nutrients and soil physical and chemical properties influenced the root-associated bacterial (RE 12.4%; RS 10.6%; BS 16.6%) and fungal (RE 34.3%; RS 1.5%; BS 17.7%) communities differently, with root factors having a higher impact on fungal communities (RE and BS) than soil factors (Figure 7). Root TK contents had the highest contribution to root-associated bacterial (RE: 1.98%; RS: 1.72%; BS: 2.14%) and fungal communities (RE: 8.25%; BS: 2.26%). Soil pH had the greatest impact on fungal (RS) communities (0.43%), but the least on bacterial (RE) communities (0.63%) (Figure 7D,F). In comparison to bacterial and fungal communities (RE and RS), soil SOC contents had the smallest contribution to bacterial and fungal communities (BS) (Figure 7J,L). The contribution of soil AP contents to bacterial and fungal (RS) communities was also determined to be the smallest (Figure 7A,B). Similarly, soil TK contents were found to contribute the least to fungal (RE) communities (Figure 7H).

3. Discussion

3.1. Dynamic Changes in Root and Soil Nutrients among Three Desert Plants

Previous research findings have shown that the formation of ‘fertile islands’ under the shade of perennial desert plants helps slow down desertification that is crucial for maintaining the structure and function of desert ecosystems [19,43]. The desert plants in the Taklimakan desert showed a connection between the ‘fertile islands’ phenomenon and the size of the canopy, with T. ramosissima having the greatest impact followed by K. caspia and A. sparsifolia [26]. Moreover, soil microhabitats beneath shrubs, in conjunction with shrub characteristics, may play a role in supporting macro-fauna activities and enhancing soil nutrients and microbial diversity in shifting sand environments [44]. In this study, the results showed that soil properties (SOC, TN, TP, AN, AP, and EC) were significantly lower in C. caput-medusae when compared to A. sparsifolia and T. ramosissima. On the other hand, root nutrients (ROC, TN, TP, and TK) were significantly higher in A. sparsifolia and C. caput-medusae in comparison to T. ramosissima. Additionally, the height and crown width of A. sparsifolia were significantly lower compared to T. ramosissima and C. caput-medusae. This is inconsistent with the results of this study. Previous studies focused on the work at one site, and the results of this study were explored at a regional scale, which may be related to the differences brought about by the regional-scale environment [26,45]. In contrast, desert plants with small canopies are adept at forming a cool microclimate characterized by reduced wind and interference, resulting in lower temperatures and evaporation compared to other species (larger canopies) and bare areas [20,21]. As a result, these plants (small canopies) show higher nutrients, quicker element cycling, and greater microbial activity, providing important insights into the structure and function of ecosystems within arid desert environments [22,23]. C. caput-medusa surrounding soil is poor compared to the T. ramosissima although the root nutrient content is higher. This may be related to root exudates. Research has found that amino acids significantly influence the activity of nitrogenase and phosphatases, which may enhance the organic matter decomposition and thus improve nutrient recycling [46]. Different densities of Haloxylon ammodendron (single-plant, two-plant, and three-plant) planting revealed that the release of ecgonine, raucaffricine, and neohesperidin helps in recruiting Sphingomonadales and increasing soil nutrient availability at the expense of biomass [47]. Future work is needed to study root exudates among three desert plants and analyze their relationships with plants, soil, and microorganisms.

3.2. Variations in Root Microbial Communities and Diversity among Three Desert Plants

Plants’ growth and development result in variations among microbial assemblages linked to roots, which in turn affects plant adaptive capacity, including the capacity to diminish both biological and environmental stress factors [48,49,50]. Undeniably, the influence of these microbial assemblages on adaptability varies substantially among various species, thus playing a crucial role in regulating the plant’s capacity to withstand harsh environmental circumstances [32,51]. Studies have revealed that variations among thirty angiosperm species, with specific microbial communities (RE and RS) potentially influence interspecies competition [50,51]. Furthermore, notable changes were observed in microbial (RE and RS) communities and the diversity of desert plants, with alterations in species composition, different compartments (RE, RS, and BS), and soil nutrients [32,52,53]. Our research revealed that plant species and compartments (RE, RS, and BS) had a significant impact on the sequencing and OTU number. In C. caput-medusae, the OTU number and alpha diversity (Shannon and Simpson index) of bacteria and fungi (RE) were significantly lower in comparison to the other two desert plants (A. sparsifolia and T. ramosissima). The OTU number and Chao1 index of bacteria (RS) in C. caput-medusae were significantly higher compared to the other two species (A. sparsifolia and T. ramosissima). However, the OTU number and Chao1 index of bacteria and fungi (BS) of A. sparsifolia were significantly lower compared to the other two species (C. caput-medusae and T. ramosissima). Interestingly, A. sparsifolia forms the largest ‘fertile island’ effect, with high nutrient concentration but low microbial diversity in the RS and BS. Moreover, the RE microbial diversity of A. sparsifolia was increased. In contrast, the RE microbial diversity of the other two species (C. caput-medusae and T. ramosissima) diminished, with elevated RS and BS microbial diversity, fostering a complementary effect among distinct compartments (RE, RS, and BS) that aids in resilience against external environmental fluctuations in desert plants. One study found that in the ‘fertile island’ with higher SOC content, most microorganisms obtained energy mainly through the metabolism of organic matter, and these organic energy preferences were mostly eutrophic microorganisms. In the ‘fertile island’ with low organic carbon content, the proportion of groups obtaining energy by oxidizing inorganic trace gases increased, and the users of these trace gases were mostly oligotrophic microorganisms, which also indicated that the heterogeneity of SOC content caused by the ‘fertile island’ effect may affect microbial energy and life-history strategies [28]. Further, it was found that the establishment of fertile islands in the desert ecosystem shaped soil bacterial communities, affecting soil properties and plant–soil feedback loops [27]. Therefore, more studies are needed to verify the relationship between root microbial communities of desert plants, soil fertile island effect, and root exudates in extreme arid desert areas.

3.3. Network Stability and Phyla and Taxa Change Characteristics of Root Microbial Communities among Three Desert Plants

Moreover, the results revealed that the fungal and bacterial (RS) differential OTU numbers of C. caput-medusae were higher compared to A. sparsifolia and T. ramosissima. In contrast, the network characteristics (nodes, edges, and average degree) of the RS (bacterial and fungal communities) in C. caput-medusae were found to be lower than those of A. sparsifolia and T. ramosissima. Conversely, the bacterial and fungal (BS) differential OTU number of A. sparsifolia was determined to be less than that of T. ramosissima and C. caput-medusae, whereas the network properties (nodes, edges, and average degree) showed the opposite trend. The distinction between these species is readily apparent, indicating a robust capacity for co-existence among different species [32,50]. Reducing the OTU number in the three compartments (RE, RS, and BS) leads to a rise in network intricacy, while boosting the OTU number leads to a reduction in network intricacy. These results are intriguing, yet the variability in environmental conditions within desert regions introduces uncertainties regarding the survival of desert flora. The intimate association and synergistic impact between the microbial diversity within the root zones of various species underscore the mutual evolution of plants and their microenvironment, facilitating nutrient uptake or alleviating host stress, countering external environmental disturbances to desert flora, and securing the continuation of the plant population [30,38,54].
To acclimatize to the unique environmental circumstances prevalent in desert ecosystems, it is imperative for desert flora to harbor specialized microbial communities that enable them to harness resources efficiently [32,55,56,57]. Bacterial taxa (e.g., Actinomycetota, Pseudomonadota, Bacteroidota, and Firmicuteota) were recently discovered in the roots of Haloxylon [32]. Recent investigations have revealed a predominance of Actinomycetota, Pseudomonadota, and Firmicuteota within the rhizospheric soil of both Halostachys caspica and Salicornia alterniflora [58]. Additional phyla, including Nitrospirae and Synergistetes, were identified in the root-associated microorganisms of desert plants [57,58,59]. As the severity of drought intensifies, alterations in the aggregation process of soil microorganisms (bacteria and fungi) have been found, typically marked by an increase in Actinomycetota and Chloroflexi populations, while Pseudomonadota populations tend to decrease [60,61]. Desert plants typically inhabit arid and high-temperature environments, offering a unique habitat for microbial life, though significant variations in microbial species composition exist among different plant species [32,57,58,62]. Indeed, roots not only recruit microorganisms nearby but also have stable microbial species-specific genetic determinants [56]. This study used LEfSe analysis to find the root bacteria (Halobacterota, Pseudomonadota, Bacteroidota, and Firmicuteota) and fungi taxa (Ascomycota) in A. sparsifolia, the root bacteria taxa (Actinomycetota, Cyanobacteriota, and Bacteroidota) and fungi taxa (Ascomycota and Fungi_phy_Incertae_sedis) in T. ramosissima, and the root bacteria taxa (Nitrospiraeota, Verrucomicrobaeota, Chloroflexi, and Cyanobacteriota) in C. caput-medusae. Studies have shown that Halobacterota is extremely halophilic and Actinomycetota can live in an environment with extreme pH value, salinity, and nutrient scarcity [63,64]. Pseudomonadota produces diaminopimelic acid, a special component of the cell wall that resists environmental pressure [65]. It was also found that Bacteroidota can help to convert biomass-derived sugars into propionic acid, Ascomycota can use soluble carbohydrates, and Nitrospiraeota can biomineralize in the cell [66,67,68]. Chloroflexi may complete hydrolytic or oxidative degradation of various types of recalcitrant organic matter, including aromatic compounds (e.g., benzoate), polyaromatic hydrocarbons (e.g., fluorene), polychlorobiphenyl (e.g., 4-chlorobiphenyl), and organochlorine compounds (e.g., chloroalkanes, chlorocyclohexane) [69]. The variation in root-associated bacteria and fungi taxa among diverse desert deep-rooted plant species remains evident, facilitating enhanced absorption, conversion, and retention of essential nutrients for plant growth [32,57,70,71,72].

3.4. Effects of Environmental Factors on Root Microbial Communities among Three Desert Plants

The temporal fluctuations in certain taxa in both bulk and rhizosphere soils are influenced by soil nutrients, highlighting their significance as a key regulatory factor [73,74]. The soil factors explained 24.28% of the variability observed in the rhizosphere bacterial community structure of Ferula sinkiangensis [75]. In this study, the results suggest the total contribution of root and soil factors to impact the root-associated bacterial (RS 10.6%; RE 12.4%; BS 16.6%) and fungal (RS 1.5%; RE 34.3%; BS 17.7%) communities. The results indicate that soil-related factors and the way the host plant grows could play a crucial role in this phenomenon [76]. Additionally, plant nutrient acquisition strategies and soil nutrient status serve a crucial function in regulating plant rhizosphere effects on soil processes driven by microorganisms [3,77]. This study provides further evidence that local-scale factors, including microclimate, soil composition, and disturbance, may be more influential than broad-scale environmental factors in elucidating the drivers of plant community interactions [78]. Given the distinctive geographical attributes of desert ecosystems, such as climate variability, soil nutrient availability, and plant diversity, it is imperative for perennial deep-rooted desert plants to not only thrive autonomously for enhanced environmental resilience but also engage in mutualistic relationships with other species and symbiotic microorganisms to withstand unfavorable environmental conditions [36,41,79,80]. These results offer valuable illumination into the understanding of plants living in the desert, but follow-up research and monitoring are still needed.

4. Materials and Methods

4.1. Study Site Description and Sampling Design

The experiment took place at three desert locations, namely Cele Desert Research Station (Cele, CL; Taklimakan desert), Turpan Desert Botanical Garden (Turpan, TLF; Kumtag desert), and Mosuowan Desert Research Station (Mosuowan, MSW; Gurbantünggüt desert) (Figure 8 and Table 4).
In each of the three research sites, four homogeneous quadrats (each about 30 m × 30 m) were chosen, each with three types of desert plants (A. sparsifolia, T. ramosissima, and C. caput-medusae) (species that grow roughly the same) that exhibit strong development in their native environment [81]. A total of 12 research blocks were selected for this study. In 2022, field research was carried out during the spring (May), summer (July), and autumn (September) at three different long-term monitoring sites to gather root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS) samples from the three desert plants.

4.2. Sample Collection from Different Compartments for Microbial Analysis

Soil samples were collected from a depth of 0 to 2 m, and the collection of root samples was evenly distributed within this depth range. We use the detailed approach of Edwards (2015) [82] to differentiate compartments {RE, RS, and BS}. To mitigate the risk of contamination, gloves were replaced and hand sanitization was performed with cotton swabs saturated in alcohol. Fine roots were employed for the examination of both physical and chemical properties through the extraction of loosely bound soil (bulk soil compartment was composed of >1 mm of soil tightly adhering to the rhizosphere that was easily shaken from the rhizosphere compartment), while the rhizosphere soil (rhizosphere compartment was composed of ~1 mm of soil tightly adhering to the root surface that was not easily shaken from the root) that was firmly attached to these roots was meticulously gathered by subjecting it to vortex agitation within a sterile centrifuge tube. The roots were submerged in a 95% alcohol solution and underwent three rounds of oscillation, each lasting 15 s. Afterward, the samples underwent three rinses with sterile water, followed by their transfer into sterile centrifuge tubes, which were subsequently stored at a temperature of −80 °C. There were 324 samples (consisting of three species, three compartments, three basins, three seasons, and four replicates) in total for the root-associated microbial communities of three desert plants. There were three species of plants in each quadrat, 36 samples of each plant in each localization, and each plant was treated individually. The samples were stored at −80 °C until the extraction of genomic DNA and subsequent analysis (see Supplementary Materials for detailed methods of determination; Section S1.1 DNA extraction, PCR, and Illumina sequencing; Table 5).

4.3. Assessment of the Physical and Chemical Properties of Soil and Root Samples

Soil pH, electrical conductivity (EC), soil organic carbon (SOC), total nitrogen (TN), total phosphorus (TP), total potassium (TK), available nitrogen (AN), available phosphorus (AP), and available potassium (AK) were measured. In root samples, we measured root organic carbon (ROC), TN, TP, and TK (see Supplementary Materials for detailed methods of determination; Section S1.2 Measurement of soil and root physical and chemical properties).

4.4. Statistical Analyses

Data analysis was performed using R version 4.1.0 (R Core Team, 2021) [83]. In this study, the ‘stats’, ‘agricolae’, ‘ggplot2’, ‘microeco’, ‘vegan’, and ‘rdacca. hp’ packages were used [84,85,86,87,88]. The relative abundance of bacterial and fungal taxa (top 10 phyla) was determined (using the ggplot2 package). The impact of species and compartments (RE, RS, and BS) on sequencing and OTU number of bacteria and fungi was analyzed using two-way ANOVA. One-way ANOVA was used to assess the variation in species based on OTU number, alpha diversity (Chao1, Shannon, Pielou_e, and Shannon index), root and soil nutrients, and plant growth characteristics (height and crown width) {stats and agricolae packages, using the aov() function, Shapiro–Wilk normality test, least significant difference (LSD) test, mean ± standard error, and p < 0.05} [87]. Beta diversity was represented using NMDS (non-metric multidimensional scaling) and the Bray–Curtis dissimilarity matrix, conducting PERMANOVA (permutational multivariate analysis of variance) (using the vegan package, stress values, ANOSIM, and ADONIS tests) [86]. The core and differential microbiota of bacteria and fungi (at the OTU level) (RE, RS, and BS) in different desert plants were compared and visualized using the microeco and ggplot2 packages, respectively. Utilizing the microeco package, a LEfSe analysis (linear discriminant analysis effect size) was executed to identify specific biomarkers indicative of phylum-level variations in bacterial and fungal communities (RE, RS, and BS) across diverse desert plant species [84]. Gephi software (version 0.9.2) was employed to construct co-occurrence networks, utilizing Spearman’s correlation matrix that featured an absolute correlation coefficient exceeding 0.7 and an FDR-adjusted (false discovery rate) value below 0.001. Furthermore, redundancy analysis (RDA) was conducted with the vegan and rdacca.hp packages to explore the relationship between the microbial communities {bacterial and fungal (RE, RS, and BS), at the OTU level} associated with environmental factors (soil and root nutrients) [85,88].

5. Conclusions

In our research, it was found that A. sparsifolia’s plant height and crown width were significantly lower than those of T. ramosissima and C. caput-medusae, but it had the highest soil and root nutrient levels. Furthermore, the RS (rhizosphere soil) and BS (bulk soil) bacterial and fungal diversity of A. sparsifolia was significantly lower but increased in RE (rhizosphere endosphere). Conversely, T. ramosissima and C. caput-medusae showed a high bacterial and fungal variety in RS and BS, while having less diversity in RE. At the same time, the lower the OTU number in the three compartments (RE, RS, and BS), the higher the complexity of the network; conversely, the higher the OTU number, the smaller the complexity of the network. Significant differences were observed in the root-associated (RE, RS, and BS) bacterial and fungal communities due to the combined effects of root nutrients and soil physical and chemical properties. Safeguarding the synergistic development of pivotal microbial populations and host plants is crucial for alleviating the negative impacts of future global environmental changes on desert plants.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/plants13172468/s1. Figure S1: Sequence number of root endosphere, rhizosphere soil, and bulk soil bacteria and fungi in three desert plants; Figure S2: Alpha diversity (Chao1, Shannon, Pielou_e, and Simpson index) of root endosphere, rhizosphere soil, and bulk soil fungi in three desert plants; Figure S3: Beta diversity (Bray–Curtis) of root endosphere, rhizosphere soil, and bulk soil fungi of three desert plants; Figure S4: Co-occurrence network of root endosphere, rhizosphere soil, and bulk soil fungi of three desert plants; Table S1: Plant growth characteristics; Table S2: Bare soil physical and chemical properties. References [89,90,91,92,93,94,95,96,97,98,99,100] are cited in the supplementary materials.

Author Contributions

Conceptualization, F.Z.; methodology, F.Z. and Z.Z.; software, Y.D., Y.Z. and Z.Z.; validation, F.Z. and W.I.; formal analysis, Y.D., Y.Z. and W.I.; investigation, Y.D., Y.Z. and W.I.; data curation, Y.D. and Y.Z.; writing—original draft preparation, Y.Z. and Y.D.; writing—review and editing, F.Z. and W.I.; visualization, Y.D. and Y.Z.; supervision, F.Z.; project administration, F.Z.; funding acquisition, F.Z. All authors discussed the design, analyses, and results of the study and participated in the writing of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

Funding for this study was provided by the National Natural Science Foundation of China (F.Z.; 42271071), the Natural Science Foundation of Xinjiang Uygur Autonomous Region (F.Z.; 2021D01D02), the National Key Research and Development Project of China (F.Z.; 2022YFF1302504), and the Tianshan Talents Program of Xinjiang Autonomous Region (F.Z.; 2023TSYCLJ0046).

Data Availability Statement

For any data requests, please contact the first and corresponding authors directly.

Acknowledgments

The authors are thankful to Susan Sen (native English speaker from Edinburgh, United Kingdom), English Lecturer at Rongqiao International School, Fuzhou, for her great support and help in revising the English writing of the article. We further thank all the departmental colleagues for their help and support, and would like to thank all the reviewers who participated in the review during the preparation of this manuscript.

Conflicts of Interest

There are no competing interests among the authors.

References

  1. Bulgarelli, D.; Rott, M.; Schlaeppi, K.; van Themaat, E.V.L.; Ahmadinejad, N.; Assenza, F.; Rauf, P.; Huettel, B.; Reinhardt, R.; Schmelzer, E.; et al. Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature 2012, 488, 91–95. [Google Scholar] [CrossRef] [PubMed]
  2. Pankaj, T.; Jan, E.; Leach, S.G.T.; Tongmin, S.; Brajesh, K.S. Plant–microbiome interactions: From community assembly to plant health. Nat. Rev. Microbiol. 2020, 18, 607–621. [Google Scholar]
  3. Gukailin, A.; Qin, W.K.; Wang, X.D.; Yu, M.; Feng, J.G.; Han, M.G.; Zhu, B. Linking the rhizosphere effects of 12 woody species on soil microbial activities with soil and root nitrogen status. Rhizosphere 2023, 28, 100809. [Google Scholar]
  4. Mueller, C.W.; Baumert, V.; Carminati, A.; Germon, A.; Holz, M.; Kögel-Knabner, I.; Peth, S.; Schlüter, S.; Uteau, D.; Vetterlein, D.; et al. From rhizosphere to detritusphere-Soil structure formation driven by plant roots and the interactions with soil biota. Soil Biol. Biochem. 2024, 193, 109396. [Google Scholar] [CrossRef]
  5. Hirsch, P.R.; Mauchline, T.H. Who’s who in the plant root microbiome? Nat. Biotechnol. 2012, 30, 961–962. [Google Scholar] [CrossRef]
  6. Wang, D.L.; Bai, Y.H.; Qu, J.H. The Phragmites root-inhabiting microbiome: A critical review on its composition and environmental application. Engineering 2022, 9, 42–50. [Google Scholar] [CrossRef]
  7. Ulbrich, T.C.; Rivas-Ubach, A.; Tiemann, L.K.; Friesen, M.L.; Evans, S.E. Plant root exudates and rhizosphere bacterial communities shift with neighbor context. Soil Biol. Biochem. 2022, 172, 108753. [Google Scholar] [CrossRef]
  8. Li, P.F.; Liu, J.; Saleem, M.; Li, G.L.; Luan, L.; Wu, M.; Li, Z.P. Reduced chemodiversity suppresses rhizosphere microbiome functioning in the mono-cropped agroecosystems. Microbiome 2022, 10, 108. [Google Scholar] [CrossRef]
  9. Nannipieri, P.; Hannula, S.E.; Pietramellara, G.; Schloter, M.; Sizmur, T.; Shamina, I.P. Legacy effects of rhizodeposits on soil microbiomes: A perspective. Soil Biol. Biochem. 2023, 184, 109107. [Google Scholar] [CrossRef]
  10. Liu, Y.B.; Zhao, L.N.; Wang, Z.R.; Liu, L.C.; Zhang, P.; Sun, J.Y.; Wang, B.Y.; Song, G.; Li, X.R. Changes in functional gene structure and metabolic potential of the microbial community in biological soil crusts along a revegetation chronosequence in the Tengger Desert. Soil Biol. Biochem. 2018, 126, 40–48. [Google Scholar] [CrossRef]
  11. Wakelin, S.A.; Colloff, M.J.; Harvey, P.R.; Marschner, P.; Gregg, A.L.; Rogers, S.L. The effects of stubble retention and nitrogen application on soil microbial community structure and functional gene abundance under irrigated maize. FEMS Microbiol. Ecol. 2007, 59, 661–670. [Google Scholar] [CrossRef] [PubMed]
  12. Zhalnina, K.; Dias, R.; de Quadros, P.D.; Davis-Richardson, A.; Camargo, F.A.O.; Clark, I.M.; McGrath, S.P.; Hirsch, P.R.; Triplett, E.W. Soil pH determines microbial diversity and composition in the park grass experiment. Microb. Ecol. 2015, 69, 395–406. [Google Scholar] [CrossRef] [PubMed]
  13. Zeng, Q.C.; An, S.S.; Liu, Y. Soil bacterial community response to vegetation succession after fencing in the grassland of China. Sci. Total Environ. 2017, 609, 2–10. [Google Scholar] [CrossRef] [PubMed]
  14. Zeng, Q.C.; An, S.S.; Liu, Y.; Wang, H.L.; Wang, Y. Biogeography and the driving factors affecting forest soil bacteria in an arid area. Sci. Total Environ. 2019, 680, 124–131. [Google Scholar] [CrossRef] [PubMed]
  15. Su, Y.G.; Liu, J.; Zhang, B.C.; Zhao, H.M.; Huang, G. Habitat-specific environmental factors regulate spatial variability of soil bacterial communities in biocrusts across northern China’s drylands. Sci. Total Environ. 2020, 719, 137479. [Google Scholar] [CrossRef]
  16. Aguirre-Garrido, J.F.; Montiel-Lugo, D.; Hernández-Rodríguez, C.; Torres-Cortes, G.; Millán, V.; Toro, N.; Martínez-Abarca, F.; Ramírez-Saad, H.C. Bacterial community structure in the rhizosphere of three cactus species from semi-arid highlands in central Mexico. Antonie Leeuwenhoek 2012, 101, 891–904. [Google Scholar] [CrossRef] [PubMed]
  17. Torres-Cortés, G.; Millán, V.; Fernández-González, A.J.; Aguirre-Garrido, J.F.; Ramírez-Saad, H.C.; Fernández-López, M.; Toro, N.; Martínez-Abarca, F. Bacterial community in the rhizosphere of the cactus species Mammillaria carnea during dry and rainy seasons assessed by deep sequencing. Plant Soil 2012, 357, 275–288. [Google Scholar] [CrossRef]
  18. Breshears, D.D.; Myers, O.B.; Barnes, F.J. Horizontal heterogeneity in the frequency of plant-available water with woodland intercanopy–canopy vegetation patch type rivals that occurring vertically by soil depth. Ecohydrology 2009, 2, 503–519. [Google Scholar] [CrossRef]
  19. Ochoa-Hueso, R.; Eldridge, D.J.; Delgado-Baquerizo, M.; Soliveres, S.; Bowker, M.A.; Gross, N.; Le Bagousse-Pinguet, Y.; Quero, J.L.; García-Gomez, M.; Valencia, E.; et al. Soil fungal abundance and plant functional traits drive fertile island formation in global drylands. J. Ecol. 2018, 106, 242–253. [Google Scholar] [CrossRef]
  20. Li, J.R.; Okin, G.S.; Alvarez, L.; Epstein, H. Effects of wind erosion on the spatial heterogeneity of soil nutrients in two desert grassland communities. Biogeochemistry 2008, 88, 73–88. [Google Scholar] [CrossRef]
  21. Kidron, G.J. The effect of shrub canopy upon surface temperatures and evaporation in the Negev Desert. Earth Surf. Proc. Landf. 2009, 34, 123–132. [Google Scholar] [CrossRef]
  22. Garcia, D.E.; Lopez, B.R.; de-Bashan, L.E.; Hirsch, A.M.; Maymon, M.; Bashan, Y. Functional metabolic diversity of the bacterial community in undisturbed resource island soils in the southern Sonoran Desert. Land Degrad. Dev. 2018, 29, 1467–1477. [Google Scholar] [CrossRef]
  23. Yao, Y.F.; Zhao, Z.N.; Wei, X.R.; Shao, M.G. Effects of shrub species on soil nitrogen mineralization in the desert loess transition zone. Catena 2019, 173, 330–338. [Google Scholar] [CrossRef]
  24. Meglioli, P.A.; Aranibar, J.N.; Villagra, P.E.; Riveros, C.V. Spatial patterns of soil resources under different land use in Prosopis woodlands of the Monte desert. Catena 2017, 149, 86–97. [Google Scholar] [CrossRef]
  25. Rong, Q.; Liu, J.; Cai, Y.; Lu, Z.; Zhao, Z.; Yue, W.; Xia, J. “Fertile island” effects of Tamarix chinensis Lour. on soil N and P stoichiometry in the coastal wetland of Laizhou Bay, China. J. Soils Sediments 2016, 16, 864–877. [Google Scholar] [CrossRef]
  26. Gao, Y.J.; Tariq, A.; Zeng, F.J.; Sardans, J.; Peñuelas, J.; Zhang, Z.H.; Islam, W.; Xu, M.Q. “Fertile islands” beneath three desert vegetation on soil phosphorus fractions, enzymatic activities, and microbial biomass in the desert-oasis transition zone. Catena 2022, 212, 106090. [Google Scholar] [CrossRef]
  27. Li, S.Y.; Chen, W.M.; Li, Z.B.; Bu, L.Y.; Jin, Z.X.; Wei, G.H.; Li, Z.F. Fertile islands lead to more conspicuous spatial heterogeneity of bacteria than soil physicochemical properties in a desert ecosystem. Catena 2021, 206, 105526. [Google Scholar] [CrossRef]
  28. Li, S.Y.; Yang, S.S.; Wei, X.M.; Jiao, S.; Luo, W.; Chen, W.M.; Wei, G.H. Reduced trace gas oxidizers as a response to organic carbon availability linked to oligotrophs in desert fertile islands. ISME J. 2023, 17, 1257–1266. [Google Scholar] [CrossRef] [PubMed]
  29. Li, C.J.; Fu, B.J.; Wang, S.; Stringer, L.C.; Wang, Y.P.; Li, Z.D.; Liu, Y.X.; Zhou, W.X. Drivers and impacts of changes in China’s drylands. Nat. Rev. Earth Environ. 2021, 2, 858–873. [Google Scholar] [CrossRef]
  30. Tariq, A.; Sardans, J.; Zeng, F.J.; Graciano, C.; Hughes, A.C.; Farré-Armengol, G.; Peñuelas, J. Impact of aridity rise and arid lands expansion on carbon-storing capacity, biodiversity loss, and ecosystem services. Glob. Change Biol. 2014, 30, e17292. [Google Scholar] [CrossRef]
  31. Langumaran, G.; Smith, D.L. Plant growth promoting rhizobacteria in amelioration of salinity stress: A systems biology perspective. Front. Plant Sci. 2017, 8, 1768. [Google Scholar]
  32. Mukhtar, S.; Mehnaz, S.; Malik, K.A. Comparative study of the rhizosphere and root endosphere microbiomes of Cholistan desert plants. Front. Microbiol. 2021, 12, 618742. [Google Scholar] [CrossRef] [PubMed]
  33. Allison, S.D. Microbial drought resistance may destabilize soil carbon. Trends Microbiol. 2023, 31, 780–787. [Google Scholar] [CrossRef] [PubMed]
  34. Zhou, X.B.; Zhang, Y.M.; Downing, A. Non-linear response of microbial activity across a gradient of nitrogen addition to a soil from the Gurbantunggut Desert, northwestern China. Soil Biol. Biochem. 2012, 47, 67–77. [Google Scholar] [CrossRef]
  35. Liu, Z.H.; Wang, J.J.; Ding, J.L.; Xie, X.L. Analysis of spatial–temporal evolution trends and influential factors of desert-oasis thermal environment in typical arid zone: The case of Turpan–Hami region. Ecol. Indic. 2023, 154, 110747. [Google Scholar] [CrossRef]
  36. Islam, W.; Ullah, A.; Zeng, F.J. Response of total belowground soil biota in Alhagi sparsifolia monoculture at different soil vertical profiles in desert ecosystem. Sci. Total Environ. 2023, 901, 166027. [Google Scholar] [CrossRef] [PubMed]
  37. Zhang, C.F.; van der Heijden, M.G.A.; Bethany, K.D.; Thi, B.N.; Jelle, S.; Valzano-Held, A.; Marco, C.; Berendsen, R.L. A tripartite bacterial-fungal-plant symbiosis in the mycorrhiza-shaped microbiome drives plant growth and mycorrhization. Microbiome 2024, 12, 13. [Google Scholar]
  38. Tariq, A.; Graciano, C.; Sardans, J.; Zeng, F.J.; Hughes, A.C.; Ahmed, Z.; Ullah, A.; Ali, S.; Gao, Y.J.; Peñuelas, J. Plant root mechanisms and their effects on carbon and nutrient accumulation in desert ecosystems under changes in land use and climate. New Phytol. 2024, 242, 916–934. [Google Scholar] [CrossRef] [PubMed]
  39. Islam, W.; Zeng, F.J.; Ahmed, D.A.; Sohail, Y.M. Dynamics of soil biota and nutrients at varied depths in a Tamarix ramosissima-dominated natural desert ecosystem: Implications for nutrient cycling and desertification management. J. Environ. Manag. 2024, 354, 120217. [Google Scholar] [CrossRef]
  40. Zhang, Y.L.; Du, Y.; Zhang, Z.H.; Islam, W.; Zeng, F.J. Unveiling the diversity, composition, and dynamics of phyllosphere microbial communities in Alhagi sparsifolia across desert basins and seasons in Xinjiang, China. Front. Microbiol. 2024, 15, 1361756. [Google Scholar] [CrossRef]
  41. Zhang, Z.H.; Tariq, A.; Zeng, F.J.; Graciano, C.; Sun, F.; Chai, X.T.; Ahmed, Z. Nitrogen and water addition regulate fungal community and microbial co-occurrence network complexity in the rhizosphere of Alhagi sparsifolia seedlings. Appl. Soil Ecol. 2021, 164, 103940. [Google Scholar] [CrossRef]
  42. Gao, Y.J.; Tariq, A.; Zeng, F.J.; Sardans, J.; Graciano, C.; Li, X.Y.; Wang, W.Q.; Peñuelas, J. Soil microbial functional profiles of P-cycling reveal drought-induced constraints on P-transformation in a hyper-arid desert ecosystem. Sci. Total Environ. 2024, 925, 171767. [Google Scholar] [CrossRef]
  43. Wang, H.F.; Cai, Y.; Yang, Q.; Gong, Y.M.; Lv, G.H. Factors that alter the relative importance of abiotic and biotic drivers on the fertile island in a desert-oasis ecotone. Sci. Total Environ. 2019, 697, 134096. [Google Scholar] [CrossRef]
  44. Liu, R.T.; Zhao, H.L.; Zhao, X.Y.; Drake, S. Facilitative effects of shrubs in shifting sand on soil macro-faunal community in Horqin Sand Land of Inner Mongolia, Northern China. Eur. J. Soil Biol. 2011, 47, 316–321. [Google Scholar] [CrossRef]
  45. Luo, Y.; Peng, Q.W.; Li, K.H.; Gong, Y.M.; Liu, Y.Y.; Han, W.X. Patterns of nitrogen and phosphorus stoichiometry among leaf, stem and root of desert plants and responses to climate and soil factors in Xinjiang, China. Catena 2021, 199, 105100. [Google Scholar] [CrossRef]
  46. Coleman-Derr, D.; Desgarennes, D.; Fonseca-Garcia, C.; Gross, S.; Clingenpeel, S.; Woyke, T.; North, G.; Visel, A.; Partida-Martinez, L.P.; Tringe, S.G. Plant compartment and biogeography affect microbiome composition in cultivated and native Agave species. New Phytol. 2016, 209, 798–811. [Google Scholar] [CrossRef] [PubMed]
  47. Rosa, G.M.; García-Oliva, F.; López-Lozano, N.E. Arginine and methionine increase the enzymatic activity of microbes involved in N and P cycles in arid soil from the Chihuahuan desert. Eur. J. Soil Biol. 2023, 117, 103517. [Google Scholar]
  48. Ji, S.W.; Wu, D.Y.; Li, W.J.; Lv, G.H.; He, X.M. Mediating role of root-exuded secondary metabolites in intraspecific interactions with Haloxylon ammodendron. Plant Soil 2024, 1–20. [Google Scholar] [CrossRef]
  49. Fitzpatrick, C.R.; Copeland, J.; Wang, P.W.; Guttman, D.S.; Kotanen, P.M.; Johnson, M.T.J. Assembly and ecological function of the root microbiome across angiosperm plant species. Proc. Natl. Acad. Sci. USA 2018, 115, E1157–E1165. [Google Scholar] [CrossRef]
  50. Allsup, C.M.; George, I.; Lankau, R.A. Shifting microbial communities can enhance tree tolerance to changing climates. Science 2023, 380, 835–840. [Google Scholar] [CrossRef]
  51. Camarena-Pozos, D.A.; Flores-Núñez, V.M.; López, M.G.; Partida-Martínez, L.P. Fungal volatiles emitted by members of the microbiome of desert plants are diverse and capable of promoting plant growth. Environ. Microbiol. 2021, 23, 2215–2229. [Google Scholar] [CrossRef]
  52. Egidi, E.; Delgado-Baquerizo, M.; Plett, J.M.; Wang, J.; Eldridge, D.J.; Bardgett, R.D.; Maestre, F.T.; Singh, B.K. A few Ascomycota taxa dominate soil fungal communities worldwide. Nat. Commun. 2019, 10, 2369. [Google Scholar] [CrossRef] [PubMed]
  53. Aslam, M.M.; Eyalira, J.O.; Aisha, L.I.; Zhang, Q.; Xu, W.F.; Joseph, K.K.; Shabir, H.W.; Yuan, W. Rhizosphere microbiomes can regulate plant drought tolerance. Pedosphere 2022, 32, 61–74. [Google Scholar] [CrossRef]
  54. Zhong, Y.Q.W.; Sorensen, P.O.; Zhu, G.Y.; Jia, X.Y.; Liu, J.; Shangguan, Z.P.; Wang, R.W.; Yan, W.M. Differential microbial assembly processes and co-occurrence networks in the soil-root continuum along an environmental gradient. iMeta 2022, 2, e18. [Google Scholar] [CrossRef] [PubMed]
  55. Bulgarelli, D.; Klaus, S.; Stijn, S.; van Themaat, E.V.L.; Schulze-Lefert, P. Structure and Functions of the Bacterial Microbiota of Plants. Annu. Rev. Plant Biol. 2013, 64, 807–838. [Google Scholar] [CrossRef] [PubMed]
  56. Foesel, B.U.; Nägele, V.; Naether, A. Determinants of Acidobacteria activity inferred from the relative abundances of 16S rRNA transcripts in german grassland and forest soils. Environ. Microbiol. 2014, 16, 658–675. [Google Scholar] [CrossRef]
  57. Marasco, R.; Mapelli, F.; Rolli, E.; Mosqueira, M.J.; Fusi, M.; Bariselli, P.; Reddy, M.; Cherif, A.; Tsiamis, G.; Borin, S.; et al. Salicornia strobilacea (synonym of Halocnemum strobilaceum) grown under different tidal regimes selects rhizosphere bacteria capable of promoting plant growth. Front. Microbiol. 2016, 7, 1286. [Google Scholar] [CrossRef] [PubMed]
  58. Yan, N.; Marschner, P.; Cao, W.H.; Zuo, C.Q.; Qin, W. Influence of salinity and water content on soil microorganisms. ISWCR 2015, 3, 316–323. [Google Scholar] [CrossRef]
  59. Mukhtar, S.; Mirza, B.S.; Mehnaz, S.; Mirza, M.S.; Mclean, J.; Malik, K.A. Impact of soil salinity on the structure and composition of rhizosphere microbiome. World J. Microbiol. Biotechnol. 2018, 34, 136. [Google Scholar] [CrossRef] [PubMed]
  60. Knief, C.; Bol, R.; Amelung, W.; Kusch, S.; Frindte, K.; Eckmeier, E.; Jaeschke, A.; Tibor, D.; Barbara, F.; Ramona, M.; et al. Tracing elevational changes in microbial life and organic carbon sources in soils of the Atacama Desert. Glob. Planet. Change 2020, 184, 103078. [Google Scholar] [CrossRef]
  61. Leung, P.M.; Bay, S.K.; Meier, D.V.; Chiri, E.; Cowan, D.A.; Gillor, O.; Woebken, D.; Greening, C. Energetic basis of microbial growth and persistence in desert ecosystems. mSystems 2020, 5, e00495-19. [Google Scholar] [CrossRef] [PubMed]
  62. Hakobyan, A.; Velte, S.; Sickel, W.; Quandt, D.; Stoll, A.; Knief, C. Tillandsia landbeckii phyllosphere and laimosphere as refugia for bacterial life in a hyperarid desert environment. Microbiome 2023, 11, 246. [Google Scholar] [CrossRef] [PubMed]
  63. Oren, A.; Arahal, D.R.; Ventosa, A. Emended descriptions of genera of the family Halobacteriaceae. Int. J. Syst. Evol. Microbiol. 2009, 59, 637–642. [Google Scholar] [CrossRef]
  64. Aguilar, C.; Alwali, A.; Mair, M.; Rodriguez-Orduña, L.; Contreras-Peruyero, H.; Modi, R.; Roberts, C.; Sélem-Mojica, N.; Licona-Cassani, C.; Parkinson, E.I. Actinomycetota bio-prospecting from ore-forming environments. Microb. Genom. 2024, 10, 001253. [Google Scholar] [PubMed]
  65. Zheng, L.Y.; Liu, N.H.; Zhong, S.; Yu, Y.; Zhang, X.Y.; Qin, Q.L.; Song, X.Y.; Zhang, Y.Z.; Fu, H.H.; Wang, M.; et al. Diaminopimelic Acid Metabo-lism by Pseudomonadota in the Ocean. Microbiol. Spectr. 2022, 10, e00691-22. [Google Scholar] [CrossRef] [PubMed]
  66. Döring, C.; Basen, M. Propionate production by Bacteroidia gut bacteria and its de-pendence on substrate concentrations differs among species. Biotechnol. Biofuels Bioprod. 2024, 17, 95. [Google Scholar] [CrossRef] [PubMed]
  67. Barrera, V.A.; Martin, M.E.; Aulicino, M.; Martínez, S.; Chiessa, G.; Saparrat, M.C.N.; Gasoni, A.L. Carbon-substrate utilization profiles by Cladorrhinum (Ascomycota). Rev. Argent. Microbiol. 2019, 51, 302–306. [Google Scholar] [CrossRef]
  68. Li, J.H.; Menguy, N.; Gatel, C.; Boureau, V.; Snoeck, E.; Patriarche, G.; Leroy, E.; Pan, Y.X. Crystal growth of bullet-shaped magnetite in magnetotactic bacteria of the Nitrospirae phylum. J. R. Soc. Interface 2015, 12, 20141288. [Google Scholar] [CrossRef]
  69. Liu, R.L.; Wei, X.; Song, W.Z.; Wang, L.; Cao, J.W.; Wu, J.X.; Thomas, T.; Jin, T.; Wang, Z.X.; Wei, W.X.; et al. Novel Chloroflexi genomes from the deepest ocean reveal metabolic strategies for the adaptation to deep-sea habitats. Microbiome 2022, 10, 75. [Google Scholar] [CrossRef]
  70. Kenji, M.; Laurent-Webb, L.; Adeline, D.; Amélia, B.; Stéphane, B.; Hassan, B.; Marc-André, S.; Marc, D. Fertility islands, keys to the establishment of plant and microbial diversity in a highly alkaline hot desert. J. Arid Environ. 2023, 219, 105074. [Google Scholar]
  71. Jiao, S.; Peng, Z.H.; Qi, J.J.; Gao, J.M.; Wei, G.H. Linking bacterial-fungal relationships to microbial diversity and soil nutrient cycling. mSystems 2021, 6, e01052-20. [Google Scholar] [CrossRef] [PubMed]
  72. Berrios, L.; Yeam, J.; Holm, L.; Robinson, W.; Pellitier, P.T.; Chin, M.L.; Henkel, T.W.; Peay, K.G. Positive interactions between mycorrhizal fungi and bacteria are widespread and benefit plant growth. Curr. Biol. 2023, 33, 2878–2887.e4. [Google Scholar] [CrossRef] [PubMed]
  73. Liu, Y.; Li, Y.M.; Luo, W.; Liu, S.; Chen, W.M.; Chen, C.; Jiao, S.; Wei, G.H. Soil potassium is correlated with root secondary metabolites and root-associated core bacteria in licorice of different ages. Plant Soil 2020, 456, 61–79. [Google Scholar] [CrossRef] [PubMed]
  74. Liu, Y.; Wang, H.; Peng, Z.H.; Li, D.; Chen, W.M.; Jiao, S.; Wei, G.H. Regulation of root secondary metabolites by partial root-associated microbiotas under the shaping of licorice ecotypic differentiation in northwest China. J. Integr. Plant Biol. 2021, 63, 2093–2109. [Google Scholar] [CrossRef]
  75. Zhang, T.; Wang, Z.K.; Lv, X.H.; Dang, H.L.; Zhuang, L. Variation of rhizosphere bacterial community diversity in the desert ephemeral plant Ferula sinkiangensis across environmental gradients. Sci. Rep. 2020, 10, 18442. [Google Scholar] [CrossRef] [PubMed]
  76. Zhang, Z.H.; Chai, X.T.; Gao, Y.J.; Zhang, B.; Lu, Y.; Du, Y.; Zhang, Y.L.; Ding, Y.; Tariq, A.; Ullah, A.; et al. Alhagi sparsifolia harbors a different root-associated mycobiome during different development stages. Microorganisms 2022, 10, 2376. [Google Scholar] [CrossRef]
  77. Han, M.G.; Chen, Y.; Sun, L.J.; Yu, M.; Li, R.; Li, S.F.; Su, J.R.; Zhu, B. Linking rhizosphere soil microbial activity and plant resource acquisition strategy. J. Ecol. 2023, 111, 875–888. [Google Scholar] [CrossRef]
  78. Yang, X.; Gómez-Aparicio, L.; Lortie, C.J.; Verdú, M.; Cavieres, L.A.; Huang, Z.; Gao, R.; Liu, R.; Zhao, Y.; Cornelissen, J.H.C. Net plant interactions are highly variable and weakly dependent on climate at the global scale. Ecol. Lett. 2022, 25, 1580–1593. [Google Scholar] [CrossRef]
  79. Tariq, A.; Ullah, A.; Graciano, C.; Zeng, F.J.; Gao, Y.J.; Sardans, J.; Hughes, A.C.; Zhang, Z.H.; Peñuelas, J. Combining different species in restoration is not always the right decision: Monocultures can provide higher ecological functions than intercropping in a desert ecosystem. J. Environ. Manag. 2024, 357, 120807. [Google Scholar] [CrossRef]
  80. Islam, W.; Zeng, F.J.; Alwutayd, K.M.; Khan, K.A. Beneath the surface: Investigating soil microbial and metazoa communities at various depths in a natural desert ecosystem inhabited by Karelinia caspia. Ecol. Indic. 2024, 159, 111745. [Google Scholar] [CrossRef]
  81. Du, Y.; Zhang, Y.L.; Zhang, Z.H.; Islam, W.; Zeng, F.J. Comparing root-associated microbial communities in Tamarix ramosissima across three Xinjiang basins, China. Appl. Soil Ecol. 2024, 200, 105440. [Google Scholar] [CrossRef]
  82. Edwards, J.; Johnson, C.; Santos-Medellín, C.; Lurie, E.; Podishetty, N.K.; Bhatnagar, S.; Eisen, J.A.; Sundaresan, V. Structure, variation, and assembly of the root-associated microbiomes of rice. Proc. Natl. Acad. Sci. USA 2015, 112, E911–E920. [Google Scholar] [CrossRef]
  83. R Core Team. R: A Language and Environment for Statistical Computing; R Core Team: Vienna, Austria, 2021. [Google Scholar]
  84. Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. Metagenomic biomarker discovery and explanation. Genome Biol. 2011, 12, R60. [Google Scholar] [CrossRef] [PubMed]
  85. Oksanen, J.; Blanchet, F.G.; Friendly, M.; Kindt, R.; Legendre, P.; McGlinn, D.; Minchin, P.R.; O’Hara, R.B.; Simpson, G.L.; Solymos, P.; et al. Vegan: Community Ecology Package. Ordination Methods, Diversity Analysis and Other Functions for Community and Vegetation Ecologists, Version 2.3-1. 2012. Available online: https://cran.r-project.org/package=vegan (accessed on 20 August 2023).
  86. Anderson, M.J.; Walsh, D.C.I. PERMANOVA, ANOSIM, and the Mantel test in the face of heterogeneous dispersions: What null hypothesis are you testing? Ecol. Monogr. 2013, 83, 557–574. [Google Scholar] [CrossRef]
  87. Mendiburu, F. Agricolae: Statistical Procedures for Agricultural Research. R Package, Version 1.3-3. 2020. Available online: https://cran.r-project.org/package=agricolae (accessed on 20 August 2023).
  88. Lai, J.S.; Zou, Y.; Zhang, J.L.; Peres-Neto, P.R. Generalizing hierarchical and variation partitioning in multiple regression and canonical analyses using the rdacca.hp R package. Methods Ecol. Evol. 2022, 13, 782–788. [Google Scholar] [CrossRef]
  89. Magoč, T.; Salzberg, S.L. FLASH: Fast length adjustment of short reads to improve genome assemblies. Bioinformatics 2011, 27, 2957–2963. [Google Scholar] [CrossRef] [PubMed]
  90. Bokulich, N.A.; Subramanian, S.; Faith, J.J.; Gevers, D.; Gordon, J.I.; Knight, R.; Mills, D.A.; Caporaso, J.G. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nat. Methods 2013, 10, 57–59. [Google Scholar] [CrossRef]
  91. Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahé, F. VSEARCH: A versatile open source tool for metagenomics. PeerJ 2016, 4, e2584. [Google Scholar] [CrossRef]
  92. Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef]
  93. Edgar, R.C. UPARSE: Highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 2013, 10, 996–998. [Google Scholar] [CrossRef]
  94. Wang, Q.; Garrity, G.M.; Tiedje, J.M.; Cole, J.R. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microbiol. 2007, 73, 5261–5267. [Google Scholar] [CrossRef] [PubMed]
  95. Quast, C.; Pruesse, E.; Yilmaz, P.; Gerken, J.; Schweer, T.; Yarza, P.; Peplies, J.; Glöckner, F.O. The SILVA ribosomal RNA gene database project: Improved data processing and web-based tools. Nucleic Acids Res. 2013, 41, D590–D596. [Google Scholar] [CrossRef]
  96. Abarenkov, K.; Nilsson, R.H.; Karl-Henrik, L.; Taylor, A.F.S.; May, T.W.; Frøslev, T.G.; Pawlowska, J.; Lindahl, B.; Põldmaa, K.; Truong, C.; et al. The UNITE database for molecular identification and taxonomic communication of fungi and other eukaryotes: Sequences, taxa and classifications reconsidered. Nucleic Acids Res. 2024, 52, D791–D797. [Google Scholar] [CrossRef] [PubMed]
  97. Hooper, D.U.; Vitousek, P.M. Effects of plant composition and diversity on nutrient cycling. Ecol. Monogr. 1998, 68, 121–149. [Google Scholar] [CrossRef]
  98. Neff, J.C.; Reynolds, R.L.; Belnap, J.; Lamothe, P.J. Multi-decadal impacts of grazing on soil physical and biogeochemical properties in southeast Utah. Ecol. Appl. 2005, 15, 87–95. [Google Scholar] [CrossRef]
  99. Warra, H.H.; Ahmed, M.A.; Nicolau, M.D. Impact of land cover changes and topography on soil quality in the Kasso catchment, Bale Mountains of southeastern Ethiopia. Singap. J. Trop. Geogr. 2015, 36, 357–375. [Google Scholar] [CrossRef]
  100. Lu, X.Y.; Yan, Y.; Sun, J.; Zhang, X.K.; Chen, Y.C.; Wang, X.D.; Cheng, G.W. Carbon, nitrogen, and phosphorus storage in alpine grassland ecosystems of Tibet: Effects of grazing exclusion. Ecol. Evol. 2015, 5, 4492–4504. [Google Scholar] [CrossRef]
Figure 1. The OTU number (bacteria and fungi) and relative abundance {dominant bacteria and fungi taxa (top 10 phyla)} of root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS) in three desert plants. Different lowercase letters (a and b) indicate significant differences among species at the p < 0.05 level (ANOVA and Duncan’s test). (AC) OTUs number of the bacteria, (DF) OTUs number of the fungi, and (G) relative abundance of dominant bacteria and (H) relative abundance of dominant fungi.
Figure 1. The OTU number (bacteria and fungi) and relative abundance {dominant bacteria and fungi taxa (top 10 phyla)} of root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS) in three desert plants. Different lowercase letters (a and b) indicate significant differences among species at the p < 0.05 level (ANOVA and Duncan’s test). (AC) OTUs number of the bacteria, (DF) OTUs number of the fungi, and (G) relative abundance of dominant bacteria and (H) relative abundance of dominant fungi.
Plants 13 02468 g001
Figure 2. Alpha diversity {(AC) Chao1, (DF) Shannon, (GI) Pielou_e, and (JL) Simpson indexes} of root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS) bacteria in three desert plants. Different lowercase letters (a–c) indicate significant differences among species at the p < 0.05 level and the ns indicate no significant differences among species at the p > 0.05 level (ANOVA and Duncan’s test).
Figure 2. Alpha diversity {(AC) Chao1, (DF) Shannon, (GI) Pielou_e, and (JL) Simpson indexes} of root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS) bacteria in three desert plants. Different lowercase letters (a–c) indicate significant differences among species at the p < 0.05 level and the ns indicate no significant differences among species at the p > 0.05 level (ANOVA and Duncan’s test).
Plants 13 02468 g002
Figure 3. Beta diversity {(AC) Bray–Curtis and (DF) nonmetric multidimensional scaling} of root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS) bacteria of three desert plants. ** p < 0.01.
Figure 3. Beta diversity {(AC) Bray–Curtis and (DF) nonmetric multidimensional scaling} of root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS) bacteria of three desert plants. ** p < 0.01.
Plants 13 02468 g003
Figure 4. Core and differential microbiota {(AC) OTUs number of the bacteria and (DF) OTUs number of the fungi} of root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS) bacteria and fungi among three desert plants.
Figure 4. Core and differential microbiota {(AC) OTUs number of the bacteria and (DF) OTUs number of the fungi} of root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS) bacteria and fungi among three desert plants.
Plants 13 02468 g004
Figure 5. Linear discriminant analysis effect size (LEfSe) {(AC) LEfSe analysis of the bacteria and (DF) LEfSe analysis of the fungi} of root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS) bacteria and fungi among three desert plants.
Figure 5. Linear discriminant analysis effect size (LEfSe) {(AC) LEfSe analysis of the bacteria and (DF) LEfSe analysis of the fungi} of root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS) bacteria and fungi among three desert plants.
Plants 13 02468 g005
Figure 6. Co-occurrence network {(A,D,G) Network characteristics of the A. sparsifolia, (B,E,H) Network characteristics of the T. ramosissima, and (C,F,I) Network characteristics of the C. caput-medusae} of root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS) bacteria of three desert plants.
Figure 6. Co-occurrence network {(A,D,G) Network characteristics of the A. sparsifolia, (B,E,H) Network characteristics of the T. ramosissima, and (C,F,I) Network characteristics of the C. caput-medusae} of root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS) bacteria of three desert plants.
Plants 13 02468 g006
Figure 7. The main drivers of different bacterial and fungal communities {root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS)} at the OTU level. The RDA plots show soil and root nutrients that significantly affect bacterial and fungal communities, according to the reduced model with 999 permutations. The results of HP analysis indicated the relative importance of environmental factors (soil and root) on bacterial and fungal communities. The column diagram shows the individual effect of each environmental factor (from hierarchical partitioning). SOC, soil organic carbon (g·kg−1); ROC, root organic carbon (g·kg−1); EC, electrical conductivity (mS·cm−1); TN, total nitrogen (g·kg−1); TP, total phosphorus (g·kg−1); TK, total potassium (g·kg−1); AN, available nitrogen (mg·kg−1); AP, available phosphorus (mg·kg−1); AK, available potassium (mg·kg−1). {(A) Redundancy analysis and (B) HP analysis of the root endosphere, (E) Redundancy analysis and (F) HP analysis of the rhizosphere soil, and (I) Redundancy analysis and (J) HP analysis of the bulk soil} of the bacteria and {(C) Redundancy analysis and (D) HP analysis of the root endosphere, (G) Redundancy analysis and (H) HP analysis of the rhizosphere soil, and (K) Redundancy analysis and (L) HP analysis of the bulk soil} of the fungi. Note: Significance codes, “*” p < 0.05; “**” p < 0.01; “***” p < 0.001.
Figure 7. The main drivers of different bacterial and fungal communities {root endosphere (RE), rhizosphere soil (RS), and bulk soil (BS)} at the OTU level. The RDA plots show soil and root nutrients that significantly affect bacterial and fungal communities, according to the reduced model with 999 permutations. The results of HP analysis indicated the relative importance of environmental factors (soil and root) on bacterial and fungal communities. The column diagram shows the individual effect of each environmental factor (from hierarchical partitioning). SOC, soil organic carbon (g·kg−1); ROC, root organic carbon (g·kg−1); EC, electrical conductivity (mS·cm−1); TN, total nitrogen (g·kg−1); TP, total phosphorus (g·kg−1); TK, total potassium (g·kg−1); AN, available nitrogen (mg·kg−1); AP, available phosphorus (mg·kg−1); AK, available potassium (mg·kg−1). {(A) Redundancy analysis and (B) HP analysis of the root endosphere, (E) Redundancy analysis and (F) HP analysis of the rhizosphere soil, and (I) Redundancy analysis and (J) HP analysis of the bulk soil} of the bacteria and {(C) Redundancy analysis and (D) HP analysis of the root endosphere, (G) Redundancy analysis and (H) HP analysis of the rhizosphere soil, and (K) Redundancy analysis and (L) HP analysis of the bulk soil} of the fungi. Note: Significance codes, “*” p < 0.05; “**” p < 0.01; “***” p < 0.001.
Plants 13 02468 g007
Figure 8. The three sampling sites at Cele, Turpan, and Mosuowan are located in Tarim Basin, Turpan Basin, and Junggar Basin, respectively.
Figure 8. The three sampling sites at Cele, Turpan, and Mosuowan are located in Tarim Basin, Turpan Basin, and Junggar Basin, respectively.
Plants 13 02468 g008
Table 1. Soil physical and chemical properties.
Table 1. Soil physical and chemical properties.
IndexA. sparsifoliaT. ramosissimaC. caput-medusae
SOC (g·kg−1)3.05 ± 0.24 a3.59 ± 0.35 a1.59 ± 0.08 b
TN (g·kg−1)0.25 ± 0.02 a0.32 ± 0.04 a0.12 ± 0.01 b
TP (g·kg−1)0.80 ± 0.03 a0.80 ± 0.03 a0.65 ± 0.04 b
TK (g·kg−1)19.64 ± 0.19 a20.39 ± 0.52 a19.74 ± 0.23 a
AN (mg·kg−1)16.83 ± 1.32 b22.03 ± 1.5 a6.97 ± 0.47 c
AP (mg·kg−1)3.42 ± 0.39 b4.48 ± 0.36 a2.30 ± 0.10 c
AK (mg·kg−1)344.58 ± 33.11 a304.14 ± 18.18 a198.19 ± 8.26 b
pH8.68 ± 0.05 b8.58 ± 0.02 b8.89 ± 0.05 a
EC (μs·cm−1)1831.36 ± 257.43 a1137.28 ± 160.66 b343.24 ± 37.04 c
Note: Different lowercase letters (a, b, and c) indicate that the different plants have significant differences (LSD test, p < 0.05). EC, electrical conductivity; SOC, soil organic carbon; TN, total nitrogen; TP, total phosphorus; TK, total potassium; AN, available nitrogen; AP, available phosphorus; AK, available potassium.
Table 2. Root physical and chemical properties.
Table 2. Root physical and chemical properties.
IndexA. sparsifoliaT. ramosissimaC. caput-medusae
ROC (g·kg−1)462.37 ± 2.70 b446.67 ± 2.37 c471.82 ± 3.42 a
TN (g·kg−1)11.68 ± 0.35 a4.37 ± 0.17 c7.80 ± 0.51 b
TP (g·kg−1)0.56 ± 0.06 a0.22 ± 0.03 b0.57 ± 0.07 a
TK (g·kg−1)6.89 ± 0.29 a2.53 ± 0.09 c3.34 ± 0.12 b
Note: Different lowercase letters (a, b, and c) indicate that the same site and plants and different seasons have significant differences (LSD test, p < 0.05). ROC, root organic carbon; TN, total nitrogen; TP, total phosphorus; TK, total potassium.
Table 3. Effects of species, compartments, and their interactions on sequencing and OTU number.
Table 3. Effects of species, compartments, and their interactions on sequencing and OTU number.
IndexSpeciesCompartmentSpecies × Compartment
BacteriaSequencing number6.17 **26.49 ***2.29 **
OTU number6.60 **114.86 ***16.06 ***
FungiSequencing number9.06 ***36.25 ***9.99 ***
OTU number16.40 ***60.49 ***1.15
Note: Values indicate results of F value. ** p < 0.01; *** p < 0.001.
Table 4. Geographic and climatic characteristics in the three study sites {Xinjiang Institute of Ecology and Geography, Chinese Academy of Sciences (XIEG, CAS)}.
Table 4. Geographic and climatic characteristics in the three study sites {Xinjiang Institute of Ecology and Geography, Chinese Academy of Sciences (XIEG, CAS)}.
CharacteristicsSite
CeleMosuowanTurpan
GeographicLatitude (° N)35°00′57″45°07′27″42°51′59″
Longitude (° E)80°43′45″86°01′31″89°12′01″
ClimaticMAT (°C)11.96.613.9
MAP (mm)35.1117.016.4
PEP (mm)2595.31979.53000
AI0.010.060.005
Soil typeSTaeolian sandy soilgray desert soilgrayish brown desert soil
Note: MAT, mean annual temperature; MAP, mean annual precipitation; PEP, potential evapotranspiration; AI, aridity index, calculated as AI = MAP/PEP; ST, soil type.
Table 5. Primer sets and thermal profiles used in PCR amplification.
Table 5. Primer sets and thermal profiles used in PCR amplification.
Target GroupPrimerSequence (5′–3′)PCR Conditions
Bacterial 16S_V3V4341FCCTAYGGGRBGCASCAGAll PCR reactions were carried out with 15 µL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA, USA), 0.2 µM of forward and reverse primers,
and about 10 ng template DNA. Thermal cycling consisted of initial denaturation at 98 °C for
1 min, followed by 30 cycles of denaturation at 98 °C for 10 s, annealing at 50 °C for 30 s, and
elongation at 72 °C for 30 s and 72 °C for 5 min.
806RGGACTACNNGGGTATCT AAT
Fungal
ITS_1-5 F
5-1737FGGAAGTAAAAGTCGTAACAAGG
2-2043RGCTGCGTTCTTCATCGATGC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, Y.; Du, Y.; Zhang, Z.; Islam, W.; Zeng, F. Variation in Root-Associated Microbial Communities among Three Different Plant Species in Natural Desert Ecosystem. Plants 2024, 13, 2468. https://doi.org/10.3390/plants13172468

AMA Style

Zhang Y, Du Y, Zhang Z, Islam W, Zeng F. Variation in Root-Associated Microbial Communities among Three Different Plant Species in Natural Desert Ecosystem. Plants. 2024; 13(17):2468. https://doi.org/10.3390/plants13172468

Chicago/Turabian Style

Zhang, Yulin, Yi Du, Zhihao Zhang, Waqar Islam, and Fanjiang Zeng. 2024. "Variation in Root-Associated Microbial Communities among Three Different Plant Species in Natural Desert Ecosystem" Plants 13, no. 17: 2468. https://doi.org/10.3390/plants13172468

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop