Variation in Root-Associated Microbial Communities among Three Different Plant Species in Natural Desert Ecosystem
Abstract
:1. Introduction
2. Results
2.1. Variations in Soil and Root Nutrients among Three Desert Plants
2.2. Sequencing and OTU Number of Root-Associated Microbes among Three Desert Plants
2.3. Alpha Diversity of Root-Associated Microbes among Three Desert Plants
2.4. Beta Diversity of Root-Associated Microorganisms among Three Desert Plants
2.5. Core and Differential Microbiota of Root-Associated Microbes among Three Desert Plants
2.6. LEfSe Analysis of Root-Associated Microbes among Three Desert Plantss
2.7. Network of Root-Associated Microbes among Three Desert Plant Species
2.8. The Influence of Soil and Root Nutrients on the Root-Associated Microbial Communities among Three Desert Plants
3. Discussion
3.1. Dynamic Changes in Root and Soil Nutrients among Three Desert Plants
3.2. Variations in Root Microbial Communities and Diversity among Three Desert Plants
3.3. Network Stability and Phyla and Taxa Change Characteristics of Root Microbial Communities among Three Desert Plants
3.4. Effects of Environmental Factors on Root Microbial Communities among Three Desert Plants
4. Materials and Methods
4.1. Study Site Description and Sampling Design
4.2. Sample Collection from Different Compartments for Microbial Analysis
4.3. Assessment of the Physical and Chemical Properties of Soil and Root Samples
4.4. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bulgarelli, D.; Rott, M.; Schlaeppi, K.; van Themaat, E.V.L.; Ahmadinejad, N.; Assenza, F.; Rauf, P.; Huettel, B.; Reinhardt, R.; Schmelzer, E.; et al. Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature 2012, 488, 91–95. [Google Scholar] [CrossRef] [PubMed]
- Pankaj, T.; Jan, E.; Leach, S.G.T.; Tongmin, S.; Brajesh, K.S. Plant–microbiome interactions: From community assembly to plant health. Nat. Rev. Microbiol. 2020, 18, 607–621. [Google Scholar]
- Gukailin, A.; Qin, W.K.; Wang, X.D.; Yu, M.; Feng, J.G.; Han, M.G.; Zhu, B. Linking the rhizosphere effects of 12 woody species on soil microbial activities with soil and root nitrogen status. Rhizosphere 2023, 28, 100809. [Google Scholar]
- Mueller, C.W.; Baumert, V.; Carminati, A.; Germon, A.; Holz, M.; Kögel-Knabner, I.; Peth, S.; Schlüter, S.; Uteau, D.; Vetterlein, D.; et al. From rhizosphere to detritusphere-Soil structure formation driven by plant roots and the interactions with soil biota. Soil Biol. Biochem. 2024, 193, 109396. [Google Scholar] [CrossRef]
- Hirsch, P.R.; Mauchline, T.H. Who’s who in the plant root microbiome? Nat. Biotechnol. 2012, 30, 961–962. [Google Scholar] [CrossRef]
- Wang, D.L.; Bai, Y.H.; Qu, J.H. The Phragmites root-inhabiting microbiome: A critical review on its composition and environmental application. Engineering 2022, 9, 42–50. [Google Scholar] [CrossRef]
- Ulbrich, T.C.; Rivas-Ubach, A.; Tiemann, L.K.; Friesen, M.L.; Evans, S.E. Plant root exudates and rhizosphere bacterial communities shift with neighbor context. Soil Biol. Biochem. 2022, 172, 108753. [Google Scholar] [CrossRef]
- Li, P.F.; Liu, J.; Saleem, M.; Li, G.L.; Luan, L.; Wu, M.; Li, Z.P. Reduced chemodiversity suppresses rhizosphere microbiome functioning in the mono-cropped agroecosystems. Microbiome 2022, 10, 108. [Google Scholar] [CrossRef]
- Nannipieri, P.; Hannula, S.E.; Pietramellara, G.; Schloter, M.; Sizmur, T.; Shamina, I.P. Legacy effects of rhizodeposits on soil microbiomes: A perspective. Soil Biol. Biochem. 2023, 184, 109107. [Google Scholar] [CrossRef]
- Liu, Y.B.; Zhao, L.N.; Wang, Z.R.; Liu, L.C.; Zhang, P.; Sun, J.Y.; Wang, B.Y.; Song, G.; Li, X.R. Changes in functional gene structure and metabolic potential of the microbial community in biological soil crusts along a revegetation chronosequence in the Tengger Desert. Soil Biol. Biochem. 2018, 126, 40–48. [Google Scholar] [CrossRef]
- Wakelin, S.A.; Colloff, M.J.; Harvey, P.R.; Marschner, P.; Gregg, A.L.; Rogers, S.L. The effects of stubble retention and nitrogen application on soil microbial community structure and functional gene abundance under irrigated maize. FEMS Microbiol. Ecol. 2007, 59, 661–670. [Google Scholar] [CrossRef] [PubMed]
- Zhalnina, K.; Dias, R.; de Quadros, P.D.; Davis-Richardson, A.; Camargo, F.A.O.; Clark, I.M.; McGrath, S.P.; Hirsch, P.R.; Triplett, E.W. Soil pH determines microbial diversity and composition in the park grass experiment. Microb. Ecol. 2015, 69, 395–406. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Q.C.; An, S.S.; Liu, Y. Soil bacterial community response to vegetation succession after fencing in the grassland of China. Sci. Total Environ. 2017, 609, 2–10. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Q.C.; An, S.S.; Liu, Y.; Wang, H.L.; Wang, Y. Biogeography and the driving factors affecting forest soil bacteria in an arid area. Sci. Total Environ. 2019, 680, 124–131. [Google Scholar] [CrossRef] [PubMed]
- Su, Y.G.; Liu, J.; Zhang, B.C.; Zhao, H.M.; Huang, G. Habitat-specific environmental factors regulate spatial variability of soil bacterial communities in biocrusts across northern China’s drylands. Sci. Total Environ. 2020, 719, 137479. [Google Scholar] [CrossRef]
- Aguirre-Garrido, J.F.; Montiel-Lugo, D.; Hernández-Rodríguez, C.; Torres-Cortes, G.; Millán, V.; Toro, N.; Martínez-Abarca, F.; Ramírez-Saad, H.C. Bacterial community structure in the rhizosphere of three cactus species from semi-arid highlands in central Mexico. Antonie Leeuwenhoek 2012, 101, 891–904. [Google Scholar] [CrossRef] [PubMed]
- Torres-Cortés, G.; Millán, V.; Fernández-González, A.J.; Aguirre-Garrido, J.F.; Ramírez-Saad, H.C.; Fernández-López, M.; Toro, N.; Martínez-Abarca, F. Bacterial community in the rhizosphere of the cactus species Mammillaria carnea during dry and rainy seasons assessed by deep sequencing. Plant Soil 2012, 357, 275–288. [Google Scholar] [CrossRef]
- Breshears, D.D.; Myers, O.B.; Barnes, F.J. Horizontal heterogeneity in the frequency of plant-available water with woodland intercanopy–canopy vegetation patch type rivals that occurring vertically by soil depth. Ecohydrology 2009, 2, 503–519. [Google Scholar] [CrossRef]
- Ochoa-Hueso, R.; Eldridge, D.J.; Delgado-Baquerizo, M.; Soliveres, S.; Bowker, M.A.; Gross, N.; Le Bagousse-Pinguet, Y.; Quero, J.L.; García-Gomez, M.; Valencia, E.; et al. Soil fungal abundance and plant functional traits drive fertile island formation in global drylands. J. Ecol. 2018, 106, 242–253. [Google Scholar] [CrossRef]
- Li, J.R.; Okin, G.S.; Alvarez, L.; Epstein, H. Effects of wind erosion on the spatial heterogeneity of soil nutrients in two desert grassland communities. Biogeochemistry 2008, 88, 73–88. [Google Scholar] [CrossRef]
- Kidron, G.J. The effect of shrub canopy upon surface temperatures and evaporation in the Negev Desert. Earth Surf. Proc. Landf. 2009, 34, 123–132. [Google Scholar] [CrossRef]
- Garcia, D.E.; Lopez, B.R.; de-Bashan, L.E.; Hirsch, A.M.; Maymon, M.; Bashan, Y. Functional metabolic diversity of the bacterial community in undisturbed resource island soils in the southern Sonoran Desert. Land Degrad. Dev. 2018, 29, 1467–1477. [Google Scholar] [CrossRef]
- Yao, Y.F.; Zhao, Z.N.; Wei, X.R.; Shao, M.G. Effects of shrub species on soil nitrogen mineralization in the desert loess transition zone. Catena 2019, 173, 330–338. [Google Scholar] [CrossRef]
- Meglioli, P.A.; Aranibar, J.N.; Villagra, P.E.; Riveros, C.V. Spatial patterns of soil resources under different land use in Prosopis woodlands of the Monte desert. Catena 2017, 149, 86–97. [Google Scholar] [CrossRef]
- Rong, Q.; Liu, J.; Cai, Y.; Lu, Z.; Zhao, Z.; Yue, W.; Xia, J. “Fertile island” effects of Tamarix chinensis Lour. on soil N and P stoichiometry in the coastal wetland of Laizhou Bay, China. J. Soils Sediments 2016, 16, 864–877. [Google Scholar] [CrossRef]
- Gao, Y.J.; Tariq, A.; Zeng, F.J.; Sardans, J.; Peñuelas, J.; Zhang, Z.H.; Islam, W.; Xu, M.Q. “Fertile islands” beneath three desert vegetation on soil phosphorus fractions, enzymatic activities, and microbial biomass in the desert-oasis transition zone. Catena 2022, 212, 106090. [Google Scholar] [CrossRef]
- Li, S.Y.; Chen, W.M.; Li, Z.B.; Bu, L.Y.; Jin, Z.X.; Wei, G.H.; Li, Z.F. Fertile islands lead to more conspicuous spatial heterogeneity of bacteria than soil physicochemical properties in a desert ecosystem. Catena 2021, 206, 105526. [Google Scholar] [CrossRef]
- Li, S.Y.; Yang, S.S.; Wei, X.M.; Jiao, S.; Luo, W.; Chen, W.M.; Wei, G.H. Reduced trace gas oxidizers as a response to organic carbon availability linked to oligotrophs in desert fertile islands. ISME J. 2023, 17, 1257–1266. [Google Scholar] [CrossRef] [PubMed]
- Li, C.J.; Fu, B.J.; Wang, S.; Stringer, L.C.; Wang, Y.P.; Li, Z.D.; Liu, Y.X.; Zhou, W.X. Drivers and impacts of changes in China’s drylands. Nat. Rev. Earth Environ. 2021, 2, 858–873. [Google Scholar] [CrossRef]
- Tariq, A.; Sardans, J.; Zeng, F.J.; Graciano, C.; Hughes, A.C.; Farré-Armengol, G.; Peñuelas, J. Impact of aridity rise and arid lands expansion on carbon-storing capacity, biodiversity loss, and ecosystem services. Glob. Change Biol. 2014, 30, e17292. [Google Scholar] [CrossRef]
- Langumaran, G.; Smith, D.L. Plant growth promoting rhizobacteria in amelioration of salinity stress: A systems biology perspective. Front. Plant Sci. 2017, 8, 1768. [Google Scholar]
- Mukhtar, S.; Mehnaz, S.; Malik, K.A. Comparative study of the rhizosphere and root endosphere microbiomes of Cholistan desert plants. Front. Microbiol. 2021, 12, 618742. [Google Scholar] [CrossRef] [PubMed]
- Allison, S.D. Microbial drought resistance may destabilize soil carbon. Trends Microbiol. 2023, 31, 780–787. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.B.; Zhang, Y.M.; Downing, A. Non-linear response of microbial activity across a gradient of nitrogen addition to a soil from the Gurbantunggut Desert, northwestern China. Soil Biol. Biochem. 2012, 47, 67–77. [Google Scholar] [CrossRef]
- Liu, Z.H.; Wang, J.J.; Ding, J.L.; Xie, X.L. Analysis of spatial–temporal evolution trends and influential factors of desert-oasis thermal environment in typical arid zone: The case of Turpan–Hami region. Ecol. Indic. 2023, 154, 110747. [Google Scholar] [CrossRef]
- Islam, W.; Ullah, A.; Zeng, F.J. Response of total belowground soil biota in Alhagi sparsifolia monoculture at different soil vertical profiles in desert ecosystem. Sci. Total Environ. 2023, 901, 166027. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.F.; van der Heijden, M.G.A.; Bethany, K.D.; Thi, B.N.; Jelle, S.; Valzano-Held, A.; Marco, C.; Berendsen, R.L. A tripartite bacterial-fungal-plant symbiosis in the mycorrhiza-shaped microbiome drives plant growth and mycorrhization. Microbiome 2024, 12, 13. [Google Scholar]
- Tariq, A.; Graciano, C.; Sardans, J.; Zeng, F.J.; Hughes, A.C.; Ahmed, Z.; Ullah, A.; Ali, S.; Gao, Y.J.; Peñuelas, J. Plant root mechanisms and their effects on carbon and nutrient accumulation in desert ecosystems under changes in land use and climate. New Phytol. 2024, 242, 916–934. [Google Scholar] [CrossRef] [PubMed]
- Islam, W.; Zeng, F.J.; Ahmed, D.A.; Sohail, Y.M. Dynamics of soil biota and nutrients at varied depths in a Tamarix ramosissima-dominated natural desert ecosystem: Implications for nutrient cycling and desertification management. J. Environ. Manag. 2024, 354, 120217. [Google Scholar] [CrossRef]
- Zhang, Y.L.; Du, Y.; Zhang, Z.H.; Islam, W.; Zeng, F.J. Unveiling the diversity, composition, and dynamics of phyllosphere microbial communities in Alhagi sparsifolia across desert basins and seasons in Xinjiang, China. Front. Microbiol. 2024, 15, 1361756. [Google Scholar] [CrossRef]
- Zhang, Z.H.; Tariq, A.; Zeng, F.J.; Graciano, C.; Sun, F.; Chai, X.T.; Ahmed, Z. Nitrogen and water addition regulate fungal community and microbial co-occurrence network complexity in the rhizosphere of Alhagi sparsifolia seedlings. Appl. Soil Ecol. 2021, 164, 103940. [Google Scholar] [CrossRef]
- Gao, Y.J.; Tariq, A.; Zeng, F.J.; Sardans, J.; Graciano, C.; Li, X.Y.; Wang, W.Q.; Peñuelas, J. Soil microbial functional profiles of P-cycling reveal drought-induced constraints on P-transformation in a hyper-arid desert ecosystem. Sci. Total Environ. 2024, 925, 171767. [Google Scholar] [CrossRef]
- Wang, H.F.; Cai, Y.; Yang, Q.; Gong, Y.M.; Lv, G.H. Factors that alter the relative importance of abiotic and biotic drivers on the fertile island in a desert-oasis ecotone. Sci. Total Environ. 2019, 697, 134096. [Google Scholar] [CrossRef]
- Liu, R.T.; Zhao, H.L.; Zhao, X.Y.; Drake, S. Facilitative effects of shrubs in shifting sand on soil macro-faunal community in Horqin Sand Land of Inner Mongolia, Northern China. Eur. J. Soil Biol. 2011, 47, 316–321. [Google Scholar] [CrossRef]
- Luo, Y.; Peng, Q.W.; Li, K.H.; Gong, Y.M.; Liu, Y.Y.; Han, W.X. Patterns of nitrogen and phosphorus stoichiometry among leaf, stem and root of desert plants and responses to climate and soil factors in Xinjiang, China. Catena 2021, 199, 105100. [Google Scholar] [CrossRef]
- Coleman-Derr, D.; Desgarennes, D.; Fonseca-Garcia, C.; Gross, S.; Clingenpeel, S.; Woyke, T.; North, G.; Visel, A.; Partida-Martinez, L.P.; Tringe, S.G. Plant compartment and biogeography affect microbiome composition in cultivated and native Agave species. New Phytol. 2016, 209, 798–811. [Google Scholar] [CrossRef] [PubMed]
- Rosa, G.M.; García-Oliva, F.; López-Lozano, N.E. Arginine and methionine increase the enzymatic activity of microbes involved in N and P cycles in arid soil from the Chihuahuan desert. Eur. J. Soil Biol. 2023, 117, 103517. [Google Scholar]
- Ji, S.W.; Wu, D.Y.; Li, W.J.; Lv, G.H.; He, X.M. Mediating role of root-exuded secondary metabolites in intraspecific interactions with Haloxylon ammodendron. Plant Soil 2024, 1–20. [Google Scholar] [CrossRef]
- Fitzpatrick, C.R.; Copeland, J.; Wang, P.W.; Guttman, D.S.; Kotanen, P.M.; Johnson, M.T.J. Assembly and ecological function of the root microbiome across angiosperm plant species. Proc. Natl. Acad. Sci. USA 2018, 115, E1157–E1165. [Google Scholar] [CrossRef]
- Allsup, C.M.; George, I.; Lankau, R.A. Shifting microbial communities can enhance tree tolerance to changing climates. Science 2023, 380, 835–840. [Google Scholar] [CrossRef]
- Camarena-Pozos, D.A.; Flores-Núñez, V.M.; López, M.G.; Partida-Martínez, L.P. Fungal volatiles emitted by members of the microbiome of desert plants are diverse and capable of promoting plant growth. Environ. Microbiol. 2021, 23, 2215–2229. [Google Scholar] [CrossRef]
- Egidi, E.; Delgado-Baquerizo, M.; Plett, J.M.; Wang, J.; Eldridge, D.J.; Bardgett, R.D.; Maestre, F.T.; Singh, B.K. A few Ascomycota taxa dominate soil fungal communities worldwide. Nat. Commun. 2019, 10, 2369. [Google Scholar] [CrossRef] [PubMed]
- Aslam, M.M.; Eyalira, J.O.; Aisha, L.I.; Zhang, Q.; Xu, W.F.; Joseph, K.K.; Shabir, H.W.; Yuan, W. Rhizosphere microbiomes can regulate plant drought tolerance. Pedosphere 2022, 32, 61–74. [Google Scholar] [CrossRef]
- Zhong, Y.Q.W.; Sorensen, P.O.; Zhu, G.Y.; Jia, X.Y.; Liu, J.; Shangguan, Z.P.; Wang, R.W.; Yan, W.M. Differential microbial assembly processes and co-occurrence networks in the soil-root continuum along an environmental gradient. iMeta 2022, 2, e18. [Google Scholar] [CrossRef] [PubMed]
- Bulgarelli, D.; Klaus, S.; Stijn, S.; van Themaat, E.V.L.; Schulze-Lefert, P. Structure and Functions of the Bacterial Microbiota of Plants. Annu. Rev. Plant Biol. 2013, 64, 807–838. [Google Scholar] [CrossRef] [PubMed]
- Foesel, B.U.; Nägele, V.; Naether, A. Determinants of Acidobacteria activity inferred from the relative abundances of 16S rRNA transcripts in german grassland and forest soils. Environ. Microbiol. 2014, 16, 658–675. [Google Scholar] [CrossRef]
- Marasco, R.; Mapelli, F.; Rolli, E.; Mosqueira, M.J.; Fusi, M.; Bariselli, P.; Reddy, M.; Cherif, A.; Tsiamis, G.; Borin, S.; et al. Salicornia strobilacea (synonym of Halocnemum strobilaceum) grown under different tidal regimes selects rhizosphere bacteria capable of promoting plant growth. Front. Microbiol. 2016, 7, 1286. [Google Scholar] [CrossRef] [PubMed]
- Yan, N.; Marschner, P.; Cao, W.H.; Zuo, C.Q.; Qin, W. Influence of salinity and water content on soil microorganisms. ISWCR 2015, 3, 316–323. [Google Scholar] [CrossRef]
- Mukhtar, S.; Mirza, B.S.; Mehnaz, S.; Mirza, M.S.; Mclean, J.; Malik, K.A. Impact of soil salinity on the structure and composition of rhizosphere microbiome. World J. Microbiol. Biotechnol. 2018, 34, 136. [Google Scholar] [CrossRef] [PubMed]
- Knief, C.; Bol, R.; Amelung, W.; Kusch, S.; Frindte, K.; Eckmeier, E.; Jaeschke, A.; Tibor, D.; Barbara, F.; Ramona, M.; et al. Tracing elevational changes in microbial life and organic carbon sources in soils of the Atacama Desert. Glob. Planet. Change 2020, 184, 103078. [Google Scholar] [CrossRef]
- Leung, P.M.; Bay, S.K.; Meier, D.V.; Chiri, E.; Cowan, D.A.; Gillor, O.; Woebken, D.; Greening, C. Energetic basis of microbial growth and persistence in desert ecosystems. mSystems 2020, 5, e00495-19. [Google Scholar] [CrossRef] [PubMed]
- Hakobyan, A.; Velte, S.; Sickel, W.; Quandt, D.; Stoll, A.; Knief, C. Tillandsia landbeckii phyllosphere and laimosphere as refugia for bacterial life in a hyperarid desert environment. Microbiome 2023, 11, 246. [Google Scholar] [CrossRef] [PubMed]
- Oren, A.; Arahal, D.R.; Ventosa, A. Emended descriptions of genera of the family Halobacteriaceae. Int. J. Syst. Evol. Microbiol. 2009, 59, 637–642. [Google Scholar] [CrossRef]
- Aguilar, C.; Alwali, A.; Mair, M.; Rodriguez-Orduña, L.; Contreras-Peruyero, H.; Modi, R.; Roberts, C.; Sélem-Mojica, N.; Licona-Cassani, C.; Parkinson, E.I. Actinomycetota bio-prospecting from ore-forming environments. Microb. Genom. 2024, 10, 001253. [Google Scholar] [PubMed]
- Zheng, L.Y.; Liu, N.H.; Zhong, S.; Yu, Y.; Zhang, X.Y.; Qin, Q.L.; Song, X.Y.; Zhang, Y.Z.; Fu, H.H.; Wang, M.; et al. Diaminopimelic Acid Metabo-lism by Pseudomonadota in the Ocean. Microbiol. Spectr. 2022, 10, e00691-22. [Google Scholar] [CrossRef] [PubMed]
- Döring, C.; Basen, M. Propionate production by Bacteroidia gut bacteria and its de-pendence on substrate concentrations differs among species. Biotechnol. Biofuels Bioprod. 2024, 17, 95. [Google Scholar] [CrossRef] [PubMed]
- Barrera, V.A.; Martin, M.E.; Aulicino, M.; Martínez, S.; Chiessa, G.; Saparrat, M.C.N.; Gasoni, A.L. Carbon-substrate utilization profiles by Cladorrhinum (Ascomycota). Rev. Argent. Microbiol. 2019, 51, 302–306. [Google Scholar] [CrossRef]
- Li, J.H.; Menguy, N.; Gatel, C.; Boureau, V.; Snoeck, E.; Patriarche, G.; Leroy, E.; Pan, Y.X. Crystal growth of bullet-shaped magnetite in magnetotactic bacteria of the Nitrospirae phylum. J. R. Soc. Interface 2015, 12, 20141288. [Google Scholar] [CrossRef]
- Liu, R.L.; Wei, X.; Song, W.Z.; Wang, L.; Cao, J.W.; Wu, J.X.; Thomas, T.; Jin, T.; Wang, Z.X.; Wei, W.X.; et al. Novel Chloroflexi genomes from the deepest ocean reveal metabolic strategies for the adaptation to deep-sea habitats. Microbiome 2022, 10, 75. [Google Scholar] [CrossRef]
- Kenji, M.; Laurent-Webb, L.; Adeline, D.; Amélia, B.; Stéphane, B.; Hassan, B.; Marc-André, S.; Marc, D. Fertility islands, keys to the establishment of plant and microbial diversity in a highly alkaline hot desert. J. Arid Environ. 2023, 219, 105074. [Google Scholar]
- Jiao, S.; Peng, Z.H.; Qi, J.J.; Gao, J.M.; Wei, G.H. Linking bacterial-fungal relationships to microbial diversity and soil nutrient cycling. mSystems 2021, 6, e01052-20. [Google Scholar] [CrossRef] [PubMed]
- Berrios, L.; Yeam, J.; Holm, L.; Robinson, W.; Pellitier, P.T.; Chin, M.L.; Henkel, T.W.; Peay, K.G. Positive interactions between mycorrhizal fungi and bacteria are widespread and benefit plant growth. Curr. Biol. 2023, 33, 2878–2887.e4. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Li, Y.M.; Luo, W.; Liu, S.; Chen, W.M.; Chen, C.; Jiao, S.; Wei, G.H. Soil potassium is correlated with root secondary metabolites and root-associated core bacteria in licorice of different ages. Plant Soil 2020, 456, 61–79. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Wang, H.; Peng, Z.H.; Li, D.; Chen, W.M.; Jiao, S.; Wei, G.H. Regulation of root secondary metabolites by partial root-associated microbiotas under the shaping of licorice ecotypic differentiation in northwest China. J. Integr. Plant Biol. 2021, 63, 2093–2109. [Google Scholar] [CrossRef]
- Zhang, T.; Wang, Z.K.; Lv, X.H.; Dang, H.L.; Zhuang, L. Variation of rhizosphere bacterial community diversity in the desert ephemeral plant Ferula sinkiangensis across environmental gradients. Sci. Rep. 2020, 10, 18442. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.H.; Chai, X.T.; Gao, Y.J.; Zhang, B.; Lu, Y.; Du, Y.; Zhang, Y.L.; Ding, Y.; Tariq, A.; Ullah, A.; et al. Alhagi sparsifolia harbors a different root-associated mycobiome during different development stages. Microorganisms 2022, 10, 2376. [Google Scholar] [CrossRef]
- Han, M.G.; Chen, Y.; Sun, L.J.; Yu, M.; Li, R.; Li, S.F.; Su, J.R.; Zhu, B. Linking rhizosphere soil microbial activity and plant resource acquisition strategy. J. Ecol. 2023, 111, 875–888. [Google Scholar] [CrossRef]
- Yang, X.; Gómez-Aparicio, L.; Lortie, C.J.; Verdú, M.; Cavieres, L.A.; Huang, Z.; Gao, R.; Liu, R.; Zhao, Y.; Cornelissen, J.H.C. Net plant interactions are highly variable and weakly dependent on climate at the global scale. Ecol. Lett. 2022, 25, 1580–1593. [Google Scholar] [CrossRef]
- Tariq, A.; Ullah, A.; Graciano, C.; Zeng, F.J.; Gao, Y.J.; Sardans, J.; Hughes, A.C.; Zhang, Z.H.; Peñuelas, J. Combining different species in restoration is not always the right decision: Monocultures can provide higher ecological functions than intercropping in a desert ecosystem. J. Environ. Manag. 2024, 357, 120807. [Google Scholar] [CrossRef]
- Islam, W.; Zeng, F.J.; Alwutayd, K.M.; Khan, K.A. Beneath the surface: Investigating soil microbial and metazoa communities at various depths in a natural desert ecosystem inhabited by Karelinia caspia. Ecol. Indic. 2024, 159, 111745. [Google Scholar] [CrossRef]
- Du, Y.; Zhang, Y.L.; Zhang, Z.H.; Islam, W.; Zeng, F.J. Comparing root-associated microbial communities in Tamarix ramosissima across three Xinjiang basins, China. Appl. Soil Ecol. 2024, 200, 105440. [Google Scholar] [CrossRef]
- Edwards, J.; Johnson, C.; Santos-Medellín, C.; Lurie, E.; Podishetty, N.K.; Bhatnagar, S.; Eisen, J.A.; Sundaresan, V. Structure, variation, and assembly of the root-associated microbiomes of rice. Proc. Natl. Acad. Sci. USA 2015, 112, E911–E920. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing; R Core Team: Vienna, Austria, 2021. [Google Scholar]
- Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. Metagenomic biomarker discovery and explanation. Genome Biol. 2011, 12, R60. [Google Scholar] [CrossRef] [PubMed]
- Oksanen, J.; Blanchet, F.G.; Friendly, M.; Kindt, R.; Legendre, P.; McGlinn, D.; Minchin, P.R.; O’Hara, R.B.; Simpson, G.L.; Solymos, P.; et al. Vegan: Community Ecology Package. Ordination Methods, Diversity Analysis and Other Functions for Community and Vegetation Ecologists, Version 2.3-1. 2012. Available online: https://cran.r-project.org/package=vegan (accessed on 20 August 2023).
- Anderson, M.J.; Walsh, D.C.I. PERMANOVA, ANOSIM, and the Mantel test in the face of heterogeneous dispersions: What null hypothesis are you testing? Ecol. Monogr. 2013, 83, 557–574. [Google Scholar] [CrossRef]
- Mendiburu, F. Agricolae: Statistical Procedures for Agricultural Research. R Package, Version 1.3-3. 2020. Available online: https://cran.r-project.org/package=agricolae (accessed on 20 August 2023).
- Lai, J.S.; Zou, Y.; Zhang, J.L.; Peres-Neto, P.R. Generalizing hierarchical and variation partitioning in multiple regression and canonical analyses using the rdacca.hp R package. Methods Ecol. Evol. 2022, 13, 782–788. [Google Scholar] [CrossRef]
- Magoč, T.; Salzberg, S.L. FLASH: Fast length adjustment of short reads to improve genome assemblies. Bioinformatics 2011, 27, 2957–2963. [Google Scholar] [CrossRef] [PubMed]
- Bokulich, N.A.; Subramanian, S.; Faith, J.J.; Gevers, D.; Gordon, J.I.; Knight, R.; Mills, D.A.; Caporaso, J.G. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nat. Methods 2013, 10, 57–59. [Google Scholar] [CrossRef]
- Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahé, F. VSEARCH: A versatile open source tool for metagenomics. PeerJ 2016, 4, e2584. [Google Scholar] [CrossRef]
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef]
- Edgar, R.C. UPARSE: Highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 2013, 10, 996–998. [Google Scholar] [CrossRef]
- Wang, Q.; Garrity, G.M.; Tiedje, J.M.; Cole, J.R. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microbiol. 2007, 73, 5261–5267. [Google Scholar] [CrossRef] [PubMed]
- Quast, C.; Pruesse, E.; Yilmaz, P.; Gerken, J.; Schweer, T.; Yarza, P.; Peplies, J.; Glöckner, F.O. The SILVA ribosomal RNA gene database project: Improved data processing and web-based tools. Nucleic Acids Res. 2013, 41, D590–D596. [Google Scholar] [CrossRef]
- Abarenkov, K.; Nilsson, R.H.; Karl-Henrik, L.; Taylor, A.F.S.; May, T.W.; Frøslev, T.G.; Pawlowska, J.; Lindahl, B.; Põldmaa, K.; Truong, C.; et al. The UNITE database for molecular identification and taxonomic communication of fungi and other eukaryotes: Sequences, taxa and classifications reconsidered. Nucleic Acids Res. 2024, 52, D791–D797. [Google Scholar] [CrossRef] [PubMed]
- Hooper, D.U.; Vitousek, P.M. Effects of plant composition and diversity on nutrient cycling. Ecol. Monogr. 1998, 68, 121–149. [Google Scholar] [CrossRef]
- Neff, J.C.; Reynolds, R.L.; Belnap, J.; Lamothe, P.J. Multi-decadal impacts of grazing on soil physical and biogeochemical properties in southeast Utah. Ecol. Appl. 2005, 15, 87–95. [Google Scholar] [CrossRef]
- Warra, H.H.; Ahmed, M.A.; Nicolau, M.D. Impact of land cover changes and topography on soil quality in the Kasso catchment, Bale Mountains of southeastern Ethiopia. Singap. J. Trop. Geogr. 2015, 36, 357–375. [Google Scholar] [CrossRef]
- Lu, X.Y.; Yan, Y.; Sun, J.; Zhang, X.K.; Chen, Y.C.; Wang, X.D.; Cheng, G.W. Carbon, nitrogen, and phosphorus storage in alpine grassland ecosystems of Tibet: Effects of grazing exclusion. Ecol. Evol. 2015, 5, 4492–4504. [Google Scholar] [CrossRef]
Index | A. sparsifolia | T. ramosissima | C. caput-medusae |
---|---|---|---|
SOC (g·kg−1) | 3.05 ± 0.24 a | 3.59 ± 0.35 a | 1.59 ± 0.08 b |
TN (g·kg−1) | 0.25 ± 0.02 a | 0.32 ± 0.04 a | 0.12 ± 0.01 b |
TP (g·kg−1) | 0.80 ± 0.03 a | 0.80 ± 0.03 a | 0.65 ± 0.04 b |
TK (g·kg−1) | 19.64 ± 0.19 a | 20.39 ± 0.52 a | 19.74 ± 0.23 a |
AN (mg·kg−1) | 16.83 ± 1.32 b | 22.03 ± 1.5 a | 6.97 ± 0.47 c |
AP (mg·kg−1) | 3.42 ± 0.39 b | 4.48 ± 0.36 a | 2.30 ± 0.10 c |
AK (mg·kg−1) | 344.58 ± 33.11 a | 304.14 ± 18.18 a | 198.19 ± 8.26 b |
pH | 8.68 ± 0.05 b | 8.58 ± 0.02 b | 8.89 ± 0.05 a |
EC (μs·cm−1) | 1831.36 ± 257.43 a | 1137.28 ± 160.66 b | 343.24 ± 37.04 c |
Index | A. sparsifolia | T. ramosissima | C. caput-medusae |
---|---|---|---|
ROC (g·kg−1) | 462.37 ± 2.70 b | 446.67 ± 2.37 c | 471.82 ± 3.42 a |
TN (g·kg−1) | 11.68 ± 0.35 a | 4.37 ± 0.17 c | 7.80 ± 0.51 b |
TP (g·kg−1) | 0.56 ± 0.06 a | 0.22 ± 0.03 b | 0.57 ± 0.07 a |
TK (g·kg−1) | 6.89 ± 0.29 a | 2.53 ± 0.09 c | 3.34 ± 0.12 b |
Index | Species | Compartment | Species × Compartment | |
---|---|---|---|---|
Bacteria | Sequencing number | 6.17 ** | 26.49 *** | 2.29 ** |
OTU number | 6.60 ** | 114.86 *** | 16.06 *** | |
Fungi | Sequencing number | 9.06 *** | 36.25 *** | 9.99 *** |
OTU number | 16.40 *** | 60.49 *** | 1.15 |
Characteristics | Site | |||
---|---|---|---|---|
Cele | Mosuowan | Turpan | ||
Geographic | Latitude (° N) | 35°00′57″ | 45°07′27″ | 42°51′59″ |
Longitude (° E) | 80°43′45″ | 86°01′31″ | 89°12′01″ | |
Climatic | MAT (°C) | 11.9 | 6.6 | 13.9 |
MAP (mm) | 35.1 | 117.0 | 16.4 | |
PEP (mm) | 2595.3 | 1979.5 | 3000 | |
AI | 0.01 | 0.06 | 0.005 | |
Soil type | ST | aeolian sandy soil | gray desert soil | grayish brown desert soil |
Target Group | Primer | Sequence (5′–3′) | PCR Conditions |
---|---|---|---|
Bacterial 16S_V3V4 | 341F | CCTAYGGGRBGCASCAG | All PCR reactions were carried out with 15 µL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA, USA), 0.2 µM of forward and reverse primers, and about 10 ng template DNA. Thermal cycling consisted of initial denaturation at 98 °C for 1 min, followed by 30 cycles of denaturation at 98 °C for 10 s, annealing at 50 °C for 30 s, and elongation at 72 °C for 30 s and 72 °C for 5 min. |
806R | GGACTACNNGGGTATCT AAT | ||
Fungal ITS_1-5 F | 5-1737F | GGAAGTAAAAGTCGTAACAAGG | |
2-2043R | GCTGCGTTCTTCATCGATGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Du, Y.; Zhang, Z.; Islam, W.; Zeng, F. Variation in Root-Associated Microbial Communities among Three Different Plant Species in Natural Desert Ecosystem. Plants 2024, 13, 2468. https://doi.org/10.3390/plants13172468
Zhang Y, Du Y, Zhang Z, Islam W, Zeng F. Variation in Root-Associated Microbial Communities among Three Different Plant Species in Natural Desert Ecosystem. Plants. 2024; 13(17):2468. https://doi.org/10.3390/plants13172468
Chicago/Turabian StyleZhang, Yulin, Yi Du, Zhihao Zhang, Waqar Islam, and Fanjiang Zeng. 2024. "Variation in Root-Associated Microbial Communities among Three Different Plant Species in Natural Desert Ecosystem" Plants 13, no. 17: 2468. https://doi.org/10.3390/plants13172468