A Rapid Detection Method for H3 Avian Influenza Viruses Based on RT–RAA
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Source of Viruses and Clinical Samples
2.2. Design of RT–RAA Primer and Probe Design
2.3. Nucleic Acid Extraction
2.4. RT–RAA Amplification
2.5. RT–qPCR Assay
2.6. Specific Analysis
2.7. Sensitivity Analysis
2.8. Repeatability and Stability Analysis
2.9. Clinical Sample Testing
2.10. Statistical Analysis
3. Results
3.1. Optimal Primer Screening for RT–RAA
3.2. Specific Analysis
3.3. Sensitivity Analysis
3.4. Repeatability and Stability Analysis
3.5. Clinical Sample Testing
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wei-Wen Hsiao, W.; Fadhilah, G.; Lee, C.C.; Endo, R.; Lin, Y.J.; Angela, S.; Ku, C.C.; Chang, H.C.; Chiang, W.H. Nanomaterial-based biosensors for avian influenza virus: A new way forward. Talanta 2023, 265, 124892. [Google Scholar] [CrossRef] [PubMed]
- Eisfeld, A.J.; Neumann, G.; Kawaoka, Y. At the centre: Influenza A virus ribonucleoproteins. Nat. Rev. Microbiol. 2015, 13, 28–41. [Google Scholar] [CrossRef] [PubMed]
- Lycett, S.J.; Duchatel, F.; Digard, P. A brief history of bird flu. Philos. Trans. R. Soc. Lond. Ser. B Biol. Sci. 2019, 374, 20180257. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Song, T.; Li, K.; Jin, Y.; Yue, J.; Ren, H.; Liang, L. Different Subtypes of Influenza Viruses Target Different Human Proteins and Pathways Leading to Different Pathogenic Phenotypes. BioMed Res. Int. 2019, 2019, 4794910. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.H.; Chang, C.C.; Chen, C.W.; Wong, L.T.; Chu, Y.W. Conservation region finding for influenza A viruses by machine learning methods of N-linked glycosylation sites and B-cell epitopes. Math. Biosci. 2019, 315, 108217. [Google Scholar] [CrossRef]
- Wang, G.; Deng, G.; Shi, J.; Luo, W.; Zhang, G.; Zhang, Q.; Liu, L.; Jiang, Y.; Li, C.; Sriwilaijaroen, N.; et al. H6 influenza viruses pose a potential threat to human health. J. Virol. 2014, 88, 3953–3964. [Google Scholar] [CrossRef]
- Yang, J.; Yang, L.; Zhu, W.; Wang, D.; Shu, Y. Epidemiological and Genetic Characteristics of the H3 Subtype Avian Influenza Viruses in China. China CDC Wkly. 2021, 3, 929–936. [Google Scholar] [CrossRef]
- Bao, P.; Liu, Y.; Zhang, X.; Fan, H.; Zhao, J.; Mu, M.; Li, H.; Wang, Y.; Ge, H.; Li, S.; et al. Human infection with a reassortment avian influenza A H3N8 virus: An epidemiological investigation study. Nat. Commun. 2022, 13, 6817. [Google Scholar] [CrossRef]
- Yang, R.; Sun, H.; Gao, F.; Luo, K.; Huang, Z.; Tong, Q.; Song, H.; Han, Q.; Liu, J.; Lan, Y.; et al. Human infection of avian influenza A H3N8 virus and the viral origins: A descriptive study. Lancet Microbe 2022, 3, e824–e834. [Google Scholar] [CrossRef]
- Sun, H.; Li, H.; Tong, Q.; Han, Q.; Liu, J.; Yu, H.; Song, H.; Qi, J.; Li, J.; Yang, J.; et al. Airborne transmission of human-isolated avian H3N8 influenza virus between ferrets. Cell 2023, 186, 4074–4084.e4011. [Google Scholar] [CrossRef]
- Jackson, S.; Van Hoeven, N.; Chen, L.M.; Maines, T.R.; Cox, N.J.; Katz, J.M.; Donis, R.O. Reassortment between avian H5N1 and human H3N2 influenza viruses in ferrets: A public health risk assessment. J. Virol. 2009, 83, 8131–8140. [Google Scholar] [CrossRef] [PubMed]
- Luo, S.; Deng, X.; Xie, Z.; Huang, J.; Zhang, M.; Li, M.; Xie, L.; Li, D.; Fan, Q.; Wang, S.; et al. Production and identification of monoclonal antibodies and development of a sandwich ELISA for detection of the H3-subtype avian influenza virus antigen. AMB Express 2020, 10, 49. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Zhang, Y.; Yang, L.; Li, X.; Bo, H.; Liu, J.; Tan, M.; Zhu, W.; Shu, Y.; Wang, D. Evolution of Avian Influenza Virus (H3) with Spillover into Humans, China. Emerg. Infect. Dis. 2023, 29, 1191–1201. [Google Scholar] [CrossRef] [PubMed]
- Mirzaei, S.G.; Shoushtari, A.; Nouri, A. Development and Evaluation of Real-Time Reverse Transcription Polymerase Chain Reaction Test for Quantitative and Qualitative Recognition of H5 Subtype of Avian Influenza Viruses. Arch. Razi Inst. 2020, 75, 17–22. [Google Scholar] [CrossRef]
- Dziąbowska, K.; Czaczyk, E.; Nidzworski, D. Detection Methods of Human and Animal Influenza Virus-Current Trends. Biosensors 2018, 8, 94. [Google Scholar] [CrossRef]
- Zhao, Y.; Chen, F.; Li, Q.; Wang, L.; Fan, C. Isothermal Amplification of Nucleic Acids. Chem. Rev. 2015, 115, 12491–12545. [Google Scholar] [CrossRef]
- Ahn, S.J.; Baek, Y.H.; Lloren, K.K.S.; Choi, W.S.; Jeong, J.H.; Antigua, K.J.C.; Kwon, H.I.; Park, S.J.; Kim, E.H.; Kim, Y.I.; et al. Rapid and simple colorimetric detection of multiple influenza viruses infecting humans using a reverse transcriptional loop-mediated isothermal amplification (RT-LAMP) diagnostic platform. BMC Infect. Dis. 2019, 19, 676. [Google Scholar] [CrossRef]
- Wang, Y.; Cui, Y.; Yu, Z.; Li, Y.; Bai, C.; Sun, P.; Zhu, W.; Li, Y. Development of a recombinase-aided amplification assay for detection of orf virus. J. Virol. Methods 2020, 280, 113861. [Google Scholar] [CrossRef]
- Fan, X.; Li, L.; Zhao, Y.; Liu, Y.; Liu, C.; Wang, Q.; Dong, Y.; Wang, S.; Chi, T.; Song, F.; et al. Clinical Validation of Two Recombinase-Based Isothermal Amplification Assays (RPA/RAA) for the Rapid Detection of African Swine Fever Virus. Front. Microbiol. 2020, 11, 1696. [Google Scholar] [CrossRef]
- Jiao, J.; Qi, Y.; He, P.; Wan, W.; OuYang, X.; Yu, Y.; Wen, B.; Xiong, X. Development of a Lateral Flow Strip-Based Recombinase-Aided Amplification for Active Chlamydia psittaci Infection. Front. Microbiol. 2022, 13, 928025. [Google Scholar] [CrossRef]
- Wu, X.; Liu, Y.; Gao, L.; Yan, Z.; Zhao, Q.; Chen, F.; Xie, Q.; Zhang, X. Development and Application of a Reverse-Transcription Recombinase-Aided Amplification Assay for Porcine Epidemic Diarrhea Virus. Viruses 2022, 14, 591. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Wang, S.; Ma, Y.; Li, Y.; Deng, G.; Shi, J.; Wang, X. Rapid detection of avian influenza virus based on CRISPR-Cas12a. Virol. J. 2023, 20, 261. [Google Scholar] [CrossRef]
- Rolando, J.C.; Melkonian, A.V.; Walt, D.R. The Present and Future Landscapes of Molecular Diagnostics. Annu. Rev. Anal. Chem. 2024, 17, 459–474. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Yao, Q.; Liu, J.; Zhou, Y.; Huo, M.; Ge, Y. Concern regarding H3-subtype avian influenza virus. Front. Microbiol. 2023, 14, 1327470. [Google Scholar] [CrossRef] [PubMed]
- Cui, H.; Tu, F.; Zhang, C.; Zhang, C.; Zhao, K.; Liu, J.; Dong, S.; Chen, L.; Liu, J.; Guo, Z. Real-Time Reverse Transcription Recombinase-Aided Amplification Assay for Rapid Amplification of the N Gene of SARS-CoV-2. Int. J. Mol. Sci. 2022, 23, 15269. [Google Scholar] [CrossRef]
- Wen, F.; Wang, C.; Guo, J.; Yu, H.; Yuan, S.; Li, Y.; Li, Z.; Huang, S.; Liang, Z. Development and application of a triplex real-time PCR assay for the detection of H3, H4, and H5 subtypes of avian influenza virus. Poult. Sci. 2024, 103, 103333. [Google Scholar] [CrossRef] [PubMed]
- Song, M.S.; Oh, T.K.; Moon, H.J.; Yoo, D.W.; Lee, E.H.; Lee, J.S.; Kim, C.J.; Yoo, G.J.; Kim, H.; Choi, Y.K. Ecology of H3 avian influenza viruses in Korea and assessment of their pathogenic potentials. J. Gen. Virol. 2008, 89, 949–957. [Google Scholar] [CrossRef]
- Cui, P.; Shi, J.; Yan, C.; Wang, C.; Zhang, Y.; Zhang, Y.; Xing, X.; Chen, Y.; Zhang, J.; Liu, L.; et al. Analysis of avian influenza A (H3N8) viruses in poultry and their zoonotic potential, China, September 2021 to May 2022. Eurosurveillance Bull. Eur. sur les Mal. Transm. = Eur. Commun. Dis. Bull. 2023, 28, 2200871. [Google Scholar] [CrossRef]
- Zhu, W.; Chen, Q.; Xu, X.; Wei, H.; Tan, M.; Yang, L.; Zou, S.; Li, Z.; Lin, S.; Wang, D. Biological features of human influenza A(H3N8) viruses in China. J. Med. Virol. 2023, 95, e28912. [Google Scholar] [CrossRef]
- Kang, M.; Wang, L.F.; Sun, B.W.; Wan, W.B.; Ji, X.; Baele, G.; Bi, Y.-H.; Suchard, M.A.; Lai, A.; Zhang, M.; et al. Zoonotic infections by avian influenza virus: Changing global epidemiology, investigation, and control. Lancet Infect. Dis. 2024, 24, e522–e531. [Google Scholar] [CrossRef]
- Osazuwa, F.; Grobler, H.S.; Johnson, W. Phylogenetic lineage of GII.17 norovirus identified among children in South-South, Nigeria. BMC Res. Notes 2020, 13, 347. [Google Scholar] [CrossRef] [PubMed]
- Pourakbari, R.; Gholami, M.; Shakerimoghaddam, A.; Khiavi, F.M.; Mohammadimehr, M.; Khomartash, M.S. Comparison of RT-LAMP and RT-qPCR assays for detecting SARS-CoV-2 in the extracted RNA and direct swab samples. J. Virol. Methods 2024, 324, 114871. [Google Scholar] [CrossRef] [PubMed]
- Qin, Z.; Xue, L.; Cai, W.; Gao, J.; Jiang, Y.; Yang, J.; Liang, Y.; Wang, L.; Zhang, J.; Hu, Y.; et al. Development of a recombinase-aided amplification assay for rapid detection of human norovirus GII.4. BMC Infect. Dis. 2021, 21, 248. [Google Scholar] [CrossRef]
- Cui, H.; Zhang, C.; Tu, F.; Zhao, K.; Kong, Y.; Pu, J.; Zhang, L.; Chen, Z.; Sun, Y.; Wei, Y.; et al. Rapid detection of influenza A viruses using a real-time reverse transcription recombinase-aided amplification assay. Front. Cell. Infect. Microbiol. 2022, 12, 1071288. [Google Scholar] [CrossRef]
- Jang, W.S.; Lim, D.H.; Nam, J.; Mihn, D.C.; Sung, H.W.; Lim, C.S.; Kim, J. Development of a multiplex isothermal amplification molecular diagnosis method for on-site diagnosis of influenza. PLoS ONE 2020, 15, e0238615. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Shang, J.; Luo, J.; Yin, X.; Yu, X.; Jiang, W.; Li, J.; Yuan, L.; Hou, G.; Liu, H.; et al. Development of a recombinase-aided amplification combined with a lateral flow dipstick assay for rapid detection of H7 subtype avian influenza virus. Front. Microbiol. 2023, 14, 1286713. [Google Scholar] [CrossRef]
Primers/Probe | Sequences (5’→3’) | Position |
---|---|---|
H3-F1 | CAAAAGTGGATCTATGGTCTTATAATGCAG | 1295–1324 |
H3-F2 | GGTCTTATAATGCAGAGCTTCTTGTTGCTC | 1310–1339 |
H3-F3 | CTGACTCAGAAATGAACAAACTGTTTGAAAA | 1367–1397 |
H3-F4 | GTTTGAAAAGACCAGAAGGCAGCTAAGAGA | 1389–1418 |
H3-F5 | AAAAGACCAGAAGGCAGCTAAGAGAGAATG | 1394–1423 |
H3-R1 | GCAAAGGAAATCCATAGGATCCAATCTTTG | 1581–1610 |
H3-R2 | CAATACAACACAAAGCAAAAAGCATGATAT | 1612–1641 |
H3-R3 | GCCCACATAATGAACCCCAACAATACAACA | 1632–1661 |
H3-R4 | CTTTCTGGCAAGCCCACATAATGAACCCCA | 1643–1672 |
H3-R5 | TGCACCTAATGTTGCCTTTCTGGCAAGCCC | 1658–1687 |
H3-probe | CTGAGGATATGGGCAATGGTTGTTTCAAAA(FAM-dT)(THF)(BHQ1-dT)ACCACAAATGTGACA [C3-spacer] | 1424–1471 |
Plasmid Concentration | Repeatability (Intra-Batch Assay) | Reproducibility (Inter-Batch Assay) | ||||
---|---|---|---|---|---|---|
Mean | SD | CV (%) | Mean | SD | CV (%) | |
High (107) | 95.67 | 4.04 | 4.22 | 102.67 | 5.69 | 5.54 |
Medium (105) | 184.00 | 8.54 | 4.64 | 182.33 | 11.37 | 6.23 |
Low (103) | 356.67 | 20.50 | 5.75 | 365.33 | 23.29 | 6.37 |
Assay | RT–qPCR | Sensitivity | Specificity | Kappa | ||
---|---|---|---|---|---|---|
Positive | Negative | |||||
Real-time RT–RAA (via real-time fluorescence read-out) | Positive | 35 | 0 | 100% | 100% | 1 |
Negative | 0 | 33 | ||||
Total (68) | 35 | 33 | ||||
Real-time RT–RAA (via visual detection) | Positive | 32 | 0 | 91.43% | 100% | 0.91 |
Negative | 3 | 33 | ||||
Total (68) | 35 | 33 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, J.; Cui, H.; Zhang, Y.; Wang, X.; Liu, H.; Mu, Y.; Wang, H.; Chen, X.; Dong, T.; Zhang, C.; et al. A Rapid Detection Method for H3 Avian Influenza Viruses Based on RT–RAA. Animals 2024, 14, 2601. https://doi.org/10.3390/ani14172601
Li J, Cui H, Zhang Y, Wang X, Liu H, Mu Y, Wang H, Chen X, Dong T, Zhang C, et al. A Rapid Detection Method for H3 Avian Influenza Viruses Based on RT–RAA. Animals. 2024; 14(17):2601. https://doi.org/10.3390/ani14172601
Chicago/Turabian StyleLi, Jiaqi, Huan Cui, Yuxin Zhang, Xuejing Wang, Huage Liu, Yingli Mu, Hongwei Wang, Xiaolong Chen, Tongchao Dong, Cheng Zhang, and et al. 2024. "A Rapid Detection Method for H3 Avian Influenza Viruses Based on RT–RAA" Animals 14, no. 17: 2601. https://doi.org/10.3390/ani14172601