Next Article in Journal
Effects of Dietary Protein Intake on Cutaneous and Systemic Inflammation in Mice with Acute Experimental Psoriasis
Next Article in Special Issue
Amino Acid-Induced Impairment of Insulin Signaling and Involvement of G-Protein Coupling Receptor
Previous Article in Journal
Significance of Adipose Tissue Maintenance in Patients Undergoing Hemodialysis
Previous Article in Special Issue
Alcohol Acutely Antagonizes Refeeding-Induced Alterations in the Rag GTPase-Ragulator Complex in Skeletal Muscle
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Nutrients
Volume 13
Issue 6
10.3390/nu13061896
nutrients-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Amino Acid-Based Diet Prevents Lethal Infectious Diarrhea by Maintaining Body Water Balance in a Murine Citrobacter rodentium Infection Model

by
Tatsuki Kimizuka
1,2,
Natsumi Seki
1,2,
Genki Yamaguchi
1,2,
Masahiro Akiyama
1,
Seiichiro Higashi
3,
Koji Hase
2 and
Yun-Gi Kim
1,*
1
Research Center for Drug Discovery, Faculty of Pharmacy and Graduate School of Pharmaceutical Sciences, Keio University, Tokyo 105-8512, Japan
2
Division of Biochemistry, Faculty of Pharmacy and Graduate School of Pharmaceutical Sciences, Keio University, Tokyo 105-8512, Japan
3
Co-Creation Center, Meiji Holdings Co., Ltd., Tokyo 192-0919, Japan
*
Author to whom correspondence should be addressed.
Nutrients 2021, 13(6), 1896; https://doi.org/10.3390/nu13061896
Submission received: 12 May 2021 / Revised: 23 May 2021 / Accepted: 27 May 2021 / Published: 31 May 2021
(This article belongs to the Special Issue Amino Acid Nutrition and Metabolism Related to Health and Well Being)
Browse Figures
Versions Notes

Abstract

:
Infectious diarrhea is one of the most important health problems worldwide. Although nutritional status influences the clinical manifestation of various enteric pathogen infections, the effect of diet on enteric infectious diseases remains unclear. Using a fatal infectious diarrheal model, we found that an amino acid-based diet (AD) protected susceptible mice infected with the enteric pathogen Citrobacter rodentium. While the mice fed other diets, including a regular diet, were highly susceptible to C. rodentium infection, AD-fed mice had an increased survival rate. An AD did not suppress C. rodentium colonization or intestinal damage; instead, it prevented diarrhea-induced dehydration by increasing water intake. An AD altered the plasma and fecal amino acid levels and changed the gut microbiota composition. Treatment with glutamate, whose level was increased in the plasma and feces of AD-fed mice, promoted water intake and improved the survival of C. rodentium-infected mice. Thus, an AD changes the systemic amino acid balance and protects against lethal infectious diarrhea by maintaining total body water content.

Graphical Abstract

1. Introduction

The World Health Organization defines diarrhea as the passage of three or more loose or liquid stools per day (or more frequent passage than is normal for the individual). Acute diarrheal illness is presently one of the most important health problems worldwide, particularly in young children in developing countries. Bacterial infectious diarrhea is the most prevalent diarrheal disease worldwide [1,2,3,4]. Commonly reported enteric bacterial diarrhea and causative agents include Escherichia coli gastroenteritis, Salmonellosis (various Salmonella serovars), Shigellosis (Shigella spp.), Campylobacter gastroenteritis (Campylobacter jejuni), cholera (Vibrio cholerae), staphylococcal food poisoning (Staphylococcus aureus enterotoxins), and botulism (Clostridium botulinum) [5,6]. Enteropathogenic and enterohemorrhagic E. coli (EPEC and EHEC, respectively) are among the most important bacterial causes of diarrhea worldwide [7,8,9]. These pathogens employ a type-III secretion system (T3SS) and induce ultrastructural changes characterized by intimate bacterial adhesion to the apical surface of enterocytes, microvilli effacement, and pedestal formation, which are called “attaching and effacing” (A/E) lesions [10].
Citrobacter rodentium, a mouse pathogen that harbors a homologous T3SS and induces A/E lesions, has been extensively used as a model for studying human EPEC and EHEC infection [11,12]. C. rodentium typically causes self-limiting epithelial hyperplasia with a variable degree of inflammation in the distal colon of most laboratory mouse lines [13,14]. In contrast, suckling animals or C3H strains demonstrate severe colonic inflammation, diarrhea, and high mortality after infection with C. rodentium [15,16,17].
Nutritional status influences morbidity and mortality in diarrheal and enteric diseases [18,19]. For example, the nutritional management of dietary protein is effective for persistent diarrhea and the reduction of stool output [20,21]. In addition, an increasing number of studies indicate that dietary amino acids play important roles in suppressing intestinal inflammation [22,23]. Furthermore, several dietary factors have been shown to regulate C. rodentium colonization and infection-induced intestinal inflammation. Dietary quercetin and chitosan increase gut microbial diversity and attenuate colitis severity in C. rodentium-infected mice [24,25]. Diet-derived galacturonic acid suppresses virulence factor expression and inhibits intestinal C. rodentium colonization [26]. In contrast, a Western-style diet and insufficient dietary choline induce gut dysbiosis and severe pathology in response to C. rodentium infection [27,28]. However, only a few dietary factors that improve mortality in bacterial infectious diarrhea have been identified.
In this study, we identified a diet that can impact mortality in susceptible mice infected with C. rodentium.

2. Materials and Methods

2.1. Mice

Four-week-old female C3H/HeN mice were purchased from CLEA Japan Inc. (Tokyo, Japan). After a 2 week acclimatization period, the mice were given ad libitum access. to one of four diets: regular natural diet (RD; CE2, CLEA Japan Inc.), regular purified diet (PD; AIN93G, Research Diets; New Brunswick, NJ, USA), amino acid-based purified diet (AD; an original diet A07060801, Research Diets), and purified high-fat diet (FD; D12492, Research Diets) (Table 1). All mice were housed at the Keio University Faculty of Pharmacy, Tokyo.

2.2. C. rodentium Infection

The kanamycin-resistant WT C. rodentium strain DBS120 (pCRP1:: Tn5) was used [29]. For inoculation, bacteria were grown overnight in 50 μg/mL kanamycin-supplemented Luria–Bertani (LB) broth with shaking at 37 °C. Mice were infected by oral gavage with 0.2 mL phosphate-buffered saline (PBS) containing approximately 1 × 109 colony-forming unit (CFU) C. rodentium. To determine the bacterial load in the feces or tissues, fecal pellets were collected from individual mice, homogenized in cold PBS, plated at serial dilutions on McConkey agar containing 50 μg/mL Kan, and the CFUs was determined after overnight incubation at 37 °C. The mice were sacrificed at various time points post-infection.

2.3. Hematoxylin and Eosin Staining of the Colonic Tissue

Colonic tissue samples were fixed in 10% formalin neutral buffer solution (Mildform 10N, Wako Pure Chemical Industries, Osaka, Japan) overnight. After fixation, the samples were embedded in paraffin and then cut into 3 μm sections. The sections were deparaffinized, rehydrated, and stained with hematoxylin (Agilent Technologies, Inc.; Santa Clara, CA, USA) and eosin (Wako Pure Chemical Industries) and then mounted with Mount-Quick (Daido Sangyo Co., Ltd., Saitama, Japan).

2.4. Glutamate Administration

Elix water was used to dissolve sodium L-glutamate monohydrate (1% solution; TCI; Tokyo, Japan) and sterilized through a 0.22 μm filter. PD-fed mice were treated with or without glutamate in drinking water from 10 days prior to C. rodentium infection until the end of the study.

2.5. Amino Acid Concentration

Plasma and fecal free amino acids were determined using an LC/MS system (TQD, Waters Corporation; Milford, MA, USA), with pre-column 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate derivatization [30]. The analytes were initially deproteinized with 5% trichloroacetic acid. After mixing, the samples were centrifuged at 12,000 rpm for 10 min at 4 °C. The supernatant from each sample was assayed for free amino acids. Data were analyzed using the Waters TargetLinksTM software.

2.6. Fecal Lipocalin-2

We measured the fecal lipocalin-2 level as a non-invasive intestinal inflammation biomarker [31]. Mouse fecal pellets were collected in sterile 1.5 mL microcentrifuge tubes, and 100 mg/mL suspensions in sterile 0.1% Tween-20/D-PBS (–) were prepared. Samples were shaken using a vortex mixer at maximum speed for 20 min, followed by centrifugation. The supernatants were assayed for lipocalin-2 using mouse Lipocalin-2/NGAL DuoSet ELISA (R&D Systems; Minneapolis, MN, USA).

2.7. Reverse Transcription and Quantitative PCR

Total RNA from mouse tissue was extracted using the PureLink RNA Mini Kit (Thermo Fisher Scientific; Waltham, MA, USA) according to the manufacturer’s instructions. RNA was reverse-transcribed to obtain cDNA using the ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO; Osaka, Japan). RT-qPCR was performed using StepOnePlus (Thermo Fisher Scientific) with THUNDERBIRD SYBR qPCR Mix (TOYOBO). Oligonucleotide primers were purchased from Integrated DNA Technologies (IA, USA). Primer sequences for Ctnnb1 and Mmp7 are listed in Table 2.

2.8. Colonic Epithelial Barrier Permeability

Fluorescein isothiocyanate (FITC)-dextran (4 kDa; Sigma-Aldrich; St. Louis, MO, USA) was dissolved in PBS at a concentration of 50 mg/mL. Mice were fasted for 4 h prior to gavage with 60 mg FITC-dextran/100 g body weight. Mice were anesthetized 4 h after gavage, and blood was taken from the heart and centrifuged at 1100× g for 15 min at 4 °C. Plasma was collected and the fluorescence at an 485 nm excitation wavelength and 528 nm emission wavelength was quantified.

2.9. Plasma IgA ELISA

The plasma samples were subjected to IgA ELISA using a mouse IgA ELISA Quantitation Set (Bethyl Laboratories, Inc.; Montgomery, TX, USA), following the manufacturer’s instructions.

2.10. Fecal Pellet DNA Extraction and 16S rRNA Gene Sequencing and Analysis

Bacterial DNA was extracted from the feces using an E.Z.N.A® Stool DNA kit (Omega Bio-Tek, Inc.; Norcross, GA, USA) and purified using magLEAD 12gc (Precision System Science Co., Ltd.; Chiba, Japan). PCR was performed using KAPA HiFi HotStart ReadyMix (Nippon Genetics Co.,Ltd.; Tokyo, Japan) and the primer set (forward: 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3′, and reverse: 5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3′) for the V3–V4 regions of 16S rRNA. The amplicons were purified using AMPure XP (Beckman Coulter; Brea, CA, USA). DNA from each sample was added to different index sequences using the Nextera XT index kit (Illumina; San Diego, CA, USA). Mixed samples were prepared by pooling approximately equal amounts of each amplified DNA and sequenced using Miseq Reagent Kit V3 (600 cycle) and a MiSeq sequencer (Illumina), in accordance with the manufacturer’s instructions.
The sequencing data were analyzed using Qiime2 (version 2020.11) [32]. To trim the primer region from the raw sequences, Cutadapt in the Qiime2 plugin was used (https://doi.org/10.14806/ej.17.1.200, accessed on 27 May 2021). The sequences without primer regions were processed for quality control, paired-end read joining, chimera filtering, and amplicon sequence varient (ASV) table construction using the DADA2 algorithm [33]. For each ASV-representative sequence, BLAST [34] was used to assign the taxonomy based on the SILVA database (version 138) [35]. After randomly sampling 4100 reads using a feature table [36], the compositional data were converted, and diversity analysis was performed.

2.11. Statistical Analyses

Statistical analyses were performed using GraphPad Prism software (version 9.0.2; GraphPad Software Inc.; San Diego, CA, USA). Differences between two groups were evaluated using the D’Agostino and Pearson test and F-test followed by the Student’s t-test, Welch’s t-test, or Mann–Whitney U test. Differences were considered significant at p < 0.05.

3. Results

3.1. AD Protects the Mice from Lethal C. rodentium Infection

To assess the impact of diets on lethal infectious diarrhea, AD, FD, PD, and RD-fed mice were infected with C. rodentium, and their survival was monitored over time. More than 90% of RD, PD, and FD-fed mice succumbed to infection, compared to only 20% of AD-fed mice (Figure 1A). Since only the protein sources of the PD and AD differed (casein vs. amino acids), we next focused on PD and AD-fed mice. Body weight loss was significantly greater in PD-fed mice than in AD-fed mice throughout the duration of infection (Figure 1B). Wnt signaling activation is one of the hallmarks of diarrheal C. rodentium infection susceptibility [37]. Therefore, we compared the expressions of β-catenin (Ctnnb1), the principal canonical Wnt signaling downstream mediator, and MMP-7 (Mmp7), which is transcriptionally regulated by β-catenin. The expression of Wnt target genes Ctnnb1 and Mmp7 was significantly lower in the AD-fed mice colon than that in PD-fed mice colon (Figure 1C). These results indicate that an AD protects mice from lethal C. rodentium infection.

3.2. AD neither Promotes Pathogen Clearance nor Suppresses Intestinal Damage

Next, we examined whether an AD influences pathogen clearance and gut barrier function. Fecal C. rodentium shedding was detected as early as 1 day post-infection and was not significantly different between PD and AD-fed mice 9 days post-infection (Figure 2A). The bacterial burden in the liver and spleen of PD and AD-fed mice was also similar (Figure 2B). After the C. rodentium infection, severe epithelial hyperplasia and a loss of crypt morphology were observed, but the histological changes of the colon were not apparently different between the mice fed a PD and AD (Figure 2C). Consistently, the fecal level of lipocalin-2, an inflammatory marker, was comparable in both groups 9 days post-infection (Figure 2D). We then assessed the intestinal barrier function in PD and AD-fed mice by measuring the plasma level of the orally administered permeability marker FITC-dextran. The plasma level of FITC-dextran was not different between the groups 7 days post-infection (Figure 2E). In addition, the colonic expression of inflammatory cytokines, Il1b, Il6, Il17a, Il22, and Slc26a3, which encode the major Cl−/HCO3− exchanger that drives water absorption [38], was comparable between the infected mice fed a PD and AD (Figure 2F). Furthermore, the levels of fecal (intestinal) IgA, which prevents enteric pathogen invasion [39], and plasma IgA, which protects against polymicrobial sepsis [40], were not significantly different between PD and AD-fed mice prior to the infection (Figure 2G,H). Collectively, we concluded that an AD neither promotes pathogen elimination nor suppresses C. rodentium-induced intestinal damage, inflammation, and sepsis.

3.3. AD Promotes Water Intake, Thereby Protecting from Lethal Infectious Diarrhea

Mortality in C. rodentium-infected mice is associated with fatal fluid loss and dehydration [16]. Therefore, we assessed whether a PD prevents C. rodentium infection-induced dehydration. We found that the level of blood urea nitrogen (BUN), a dehydration status marker, was significantly lower in AD-fed mice than that in PD-fed mice (Figure 3A). Moreover, peritoneal saline treatment protected the PD-fed mice from C. rodentium infection, and the survival rate was comparable to that of AD-fed mice (Figure 3B). Notably, AD-fed mice had a higher water intake than PD-fed mice, although the amount of food consumed was not different (Figure 3C,D). These results indicate that an AD promotes water intake, which protects the mice from C. rodentium infection-induced dehydration and death.

3.4. AD Changes Plasma and Fecal Amino Acid Levels

Dietary protein composition and plasma amino acid concentration are associated with water intake [41,42]. Therefore, we compared plasma amino acid concentrations between PD and AD-fed mice. Plasma glutamate levels were higher and the levels of isoleucine, leucine, valine, and phenylalanine were lower in the AD-fed mice than those in the PD-fed mice (Figure 4). Dietary protein composition is one of the primary factors contributing to the composition, structure, and function of gut microbes, which can in turn provide amino acids to the host [43,44]. Thus, we examined whether an AD influences the composition of the gut microbial communities. Although it did not affect the total bacterial number (Figure 5A), an AD changed the gut microbiota composition (Figure 5B) by significantly increasing and decreasing the abundance of Erysipelotrichaceae and Streptococcaceae families, respectively (Figure 5C). Furthermore, the fecal histidine, arginine, glutamate, tyrosine, and phenylalanine concentrations were higher in AD-fed mice than in PD-fed mice (Figure 5D). Collectively, these results indicate that an AD alters plasma and fecal amino acid levels, which may maintain the total body water content, thereby protecting the mice from lethal diarrheal C. rodentium infection.

3.5. Oral Glutamate Treatment Protects Mice from Lethal Diarrheal C. rodentium Infection

Since an AD increased both plasma and fecal glutamate levels, we hypothesized that glutamate influences water intake and protects the mice from diarrheal C. rodentium infection-induced dehydration. Therefore, we assessed whether glutamate treatment prevents C. rodentium infection-induced lethal diarrhea. Water intake increased in glutamate-treated mice compared to that in the untreated mice (Figure 6A). Although glutamate treatment did not suppress C. rodentium colonization (Figure 6B), it prevented C. rodentium-induced dehydration, as assessed by BUN levels (Figure 6C). Consistently, glutamate administration significantly improved the survival of C. rodentium-infected mice (Figure 6D). These results indicate that glutamate treatment promotes water intake, prevents diarrheal C. rodentium infection-induced dehydration, and improves mouse survival.

4. Discussion

Murine C. rodentium infection is an excellent model for studying important disease processes, including infectious diarrhea. This infection model is characterized by colonic hyperplasia, inflammation, and diarrhea, depending on the age, diet, microbiological status, and genetic background of the host. Using the C. rodentium infection model, we have shown that an AD protects mice from fatal infectious diarrhea by promoting water intake.
A previous report has shown that chronic monosodium glutamate administration increases water intake [45]. In addition, glutamine stimulates water and sodium absorption in enterocytes [46]. Oral glutamate treatment also increased water intake, prevented dehydration, and improved the survival of C. rodentium-infected mice. Therefore, an AD may protect against C. rodentium infection-induced dehydration, partly by increasing the plasma and intestinal glutamate levels. We used a glutamic acid sodium salt for oral glutamate treatment. Water ionizes sodium glutamate into free sodium ions and glutamic acids. Therefore, sodium may increase water intake. However, sodium solution intake was decreased in C3H mice compared to water intake [47]. Thus, the increased water intake was caused by glutamic acid, and not sodium. In contrast, the plasma concentrations of branched-chain amino acids (BCAAs; isoleucine, leucine, and valine) were higher in PD-fed mice than those in AD-fed mice. The BCAA-enriched diet reduced water intake [48]. Furthermore, severe dehydration due to gastroenteritis often causes metabolic acidosis, which increases plasma BCAA concentrations due to the hypermetabolic states of proteolysis [49]. Therefore, increased plasma BCAAs may be detrimental to diarrhea-related dehydration.
Wnt/β-catenin signaling promotes intestinal epithelial proliferation and the generation of a poorly differentiated epithelium, leading to the downregulation of ion transporters such as Slc26a3, which is exclusively expressed in differentiated enterocytes, thereby reducing water absorption and inducing dehydration [37]. The expression of Ctnnb1 and Mmp7 was significantly lower in the colon of the mice fed an AD than the mice fed a PD, suggesting that the activation of Wnt signaling pathways is suppressed by an AD. However, the expression of Slc26a3 was comparable in the infected mice fed a PD and AD. Thus, an AD may protect the mice from lethal infection diarrhea by promoting water intake rather than improving water absorption. Further work will reveal the mechanism by which an AD promotes water intake.
An AD increased the fecal concentration of several amino acids. The distribution of free amino acids in the intestine, brain, and serum of germ-free mice was different from that in conventionalized mice [50,51], suggesting that gut microbiota contributes to host amino acid balance. Clostridia, Peptostreptococci, Bacillus–Lactobacillus–Streptococcus groups, and Proteobacteria are the most prevalent species involved in amino acid fermentation in the human intestine [52,53,54]. Such bacteria are likely to influence the amino acid pools in the gut. Accordingly, the abundance of Streptococcaceae, which contains Streptococcus, decreased in the gut of AD-fed mice. Therefore, changes in gut microbiota composition due to an AD may also affect fecal and plasma amino acid levels. An AD increased the abundance of Erysipelotrichaceae, which belongs to Clostridium Cluster XVI, which includes Gram-positive filamentous rods and both facultative and obligate anaerobes. High-protein diets increase Erysipelotrichaceae abundance and upregulate the genes involved in amino acid metabolism and transport, as well as proteolysis [55]. Therefore, an AD may supply the free amino acids utilized by Erysipelotrichaceae for growth.
In conclusion, we observed that an AD prevents fatal infectious diarrhea by regulating body water balance. Our findings provide new insight into current oral rehydration therapy by providing glucose and electrolyte solutions to prevent and/or correct diarrhea-induced dehydration.

Author Contributions

T.K. and Y.-G.K. conceived the study and designed the experiments; T.K., N.S., G.Y., M.A., S.H. and Y.-G.K. collected samples and conducted the experiments; T.K., N.S., G.Y., M.A., S.H., K.H. and Y.-G.K. analyzed the data; T.K., N.S., G.Y., M.A. and Y.-G.K. prepared the manuscript; and Y.-G.K. supervised the project. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by research grants from JSPS KAKENHI (JP17H05068 and JP20H03490 to Y.-G.K.), AMED (JP18gm6010004h0003 to Y.-G.K.), and Yakult Bio-Science Foundation (to Y.-G.K.).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the ethics committee of the Keio University (approved number: 17014).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

We thank our laboratory members for helpful discussions. Graphical abstract was created using www.biorender.io (accessed on 27 May 2021).

Conflicts of Interest

Seiichiro Higashi is an employee of Co-Creation Center, Meiji Holdings Co., Ltd.,Tokyo, Japan. This study was funded by Meiji Holdings Co.

References

  1. Kotloff, K.L.; Nataro, J.P.; Blackwelder, W.C.; Nasrin, D.; Farag, T.H.; Panchalingam, S.; Wu, Y.; Sow, S.O.; Sur, D.; Breiman, R.F.; et al. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): A prospective, case-control study. Lancet 2013, 382, 209–222. [Google Scholar] [CrossRef]
  2. Liu, J.; Kabir, F.; Manneh, J.; Lertsethtakarn, P.; Begum, S.; Gratz, J.; Becker, S.M.; Operario, D.J.; Taniuchi, M.; Janaki, L.; et al. Development and assessment of molecular diagnostic tests for 15 enteropathogens causing childhood diarrhoea: A multicentre study. Lancet Infect. Dis. 2014, 14, 716–724. [Google Scholar] [CrossRef]
  3. Platts-Mills, J.A.; Babji, S.; Bodhidatta, L.; Gratz, J.; Haque, R.; Havt, A.; McCormick, B.J.; McGrath, M.; Olortegui, M.P.; Samie, A.; et al. Pathogen-specific burdens of community diarrhoea in developing countries: A multisite birth cohort study (MAL-ED). Lancet Glob. Health 2015, 3, e564–e575. [Google Scholar] [CrossRef] [Green Version]
  4. Ugboko, H.U.; Nwinyi, O.C.; Oranusi, S.U.; Oyewale, J.O. Childhood diarrhoeal diseases in developing countries. Heliyon 2020, 6, e03690. [Google Scholar] [CrossRef]
  5. Humphries, R.M.; Linscott, A.J. Practical guidance for clinical microbiology laboratories: Diagnosis of bacterial gastroenteritis. Clin. Microbiol. Rev. 2015, 28, 3–31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Tarr, G.A.M.; Chui, L.; Lee, B.E.; Pang, X.L.; Ali, S.; Nettel-Aguirre, A.; Vanderkooi, O.G.; Berenger, B.M.; Dickinson, J.; Tarr, P.I.; et al. Performance of stool-testing recommendations for acute gastroenteritis when used to identify children with 9 potential bacterial enteropathogens. Clin. Infect. Dis. 2019, 69, 1173–1182. [Google Scholar] [CrossRef]
  7. Croxen, M.A.; Law, R.J.; Scholz, R.; Keeney, K.M.; Wlodarska, M.; Finlay, B.B. Recent advances in understanding enteric pathogenic Escherichia coli. Clin. Microbiol. Rev. 2013, 26, 822–880. [Google Scholar] [CrossRef] [Green Version]
  8. Hartland, E.L.; Leong, J.M. Enteropathogenic and enterohemorrhagic E. coli: Ecology, pathogenesis, and evolution. Front. Cell Infect. Microbiol. 2013, 3, 15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Nataro, J.P.; Kaper, J.B. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 1998, 11, 142–201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Gaytan, M.O.; Martinez-Santos, V.I.; Soto, E.; Gonzalez-Pedrajo, B. Type three secretion system in attaching and effacing pathogens. Front. Cell Infect. Microbiol. 2016, 6, 129. [Google Scholar] [CrossRef] [Green Version]
  11. Collins, J.W.; Keeney, K.M.; Crepin, V.F.; Rathinam, V.A.; Fitzgerald, K.A.; Finlay, B.B.; Frankel, G. Citrobacter rodentium: Infection, inflammation and the microbiota. Nat. Rev. Microbiol. 2014, 12, 612–623. [Google Scholar] [CrossRef] [PubMed]
  12. Mullineaux-Sanders, C.; Sanchez-Garrido, J.; Hopkins, E.G.D.; Shenoy, A.R.; Barry, R.; Frankel, G. Citrobacter rodentium-host-microbiota interactions: Immunity, bioenergetics and metabolism. Nat. Rev. Microbiol. 2019, 17, 701–715. [Google Scholar] [CrossRef] [PubMed]
  13. Barthold, S.W.; Coleman, G.L.; Jacoby, R.O.; Livestone, E.M.; Jonas, A.M. Transmissible murine colonic hyperplasia. Vet. Pathol. 1978, 15, 223–236. [Google Scholar] [CrossRef] [PubMed]
  14. Mundy, R.; MacDonald, T.T.; Dougan, G.; Frankel, G.; Wiles, S. Citrobacter rodentium of mice and man. Cell Microbiol. 2005, 7, 1697–1706. [Google Scholar] [CrossRef]
  15. Barthold, S.W.; Osbaldiston, G.W.; Jonas, A.M. Dietary, bacterial, and host genetic interactions in the pathogenesis of transmissible murine colonic hyperplasia. Lab. Anim. Sci. 1977, 27, 938–945. [Google Scholar]
  16. Borenshtein, D.; Fry, R.C.; Groff, E.B.; Nambiar, P.R.; Carey, V.J.; Fox, J.G.; Schauer, D.B. Diarrhea as a cause of mortality in a mouse model of infectious colitis. Genome Biol. 2008, 9, R122. [Google Scholar] [CrossRef] [Green Version]
  17. Borenshtein, D.; Nambiar, P.R.; Groff, E.B.; Fox, J.G.; Schauer, D.B. Development of fatal colitis in FVB mice infected with Citrobacter rodentium. Infect. Immun. 2007, 75, 3271–3281. [Google Scholar] [CrossRef] [Green Version]
  18. Brown, K.H. Diarrhea and malnutrition. J. Nutr. 2003, 133, 328S–332S. [Google Scholar] [CrossRef] [Green Version]
  19. Petri, W.A., Jr.; Miller, M.; Binder, H.J.; Levine, M.M.; Dillingham, R.; Guerrant, R.L. Enteric infections, diarrhea, and their impact on function and development. J. Clin. Investig. 2008, 118, 1277–1290. [Google Scholar] [CrossRef]
  20. Bhutta, Z.A.; Hendricks, K.M. Nutritional management of persistent diarrhea in childhood: A perspective from the developing world. J. Pediatr. Gastroenterol. Nutr. 1996, 22, 17–37. [Google Scholar] [CrossRef]
  21. de Mattos, A.P.; Ribeiro, T.C.; Mendes, P.S.; Valois, S.S.; Mendes, C.M.; Ribeiro, H.C., Jr. Comparison of yogurt, soybean, casein, and amino acid-based diets in children with persistent diarrhea. Nutr. Res. 2009, 29, 462–469. [Google Scholar] [CrossRef]
  22. He, F.; Wu, C.; Li, P.; Li, N.; Zhang, D.; Zhu, Q.; Ren, W.; Peng, Y. Functions and signaling pathways of amino acids in intestinal inflammation. BioMed Res. Int. 2018, 2018, 9171905. [Google Scholar] [CrossRef]
  23. Liu, Y.; Wang, X.; Hu, C.A. Therapeutic potential of amino acids in inflammatory bowel disease. Nutrients 2017, 9, 920. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Guan, G.; Wang, H.; Chen, S.; Liu, G.; Xiong, X.; Tan, B.; Duraipandiyan, V.; Al-Dhabi, N.A.; Fang, J. Dietary chitosan supplementation increases microbial diversity and attenuates the severity of citrobacter rodentium infection in mice. Mediat. Inflamm. 2016, 2016, 9236196. [Google Scholar] [CrossRef] [Green Version]
  25. Lin, R.; Piao, M.; Song, Y. Dietary quercetin increases colonic microbial diversity and attenuates colitis severity in citrobacter rodentium-infected mice. Front. Microbiol. 2019, 10, 1092. [Google Scholar] [CrossRef] [PubMed]
  26. Jimenez, A.G.; Ellermann, M.; Abbott, W.; Sperandio, V. Diet-derived galacturonic acid regulates virulence and intestinal colonization in enterohaemorrhagic Escherichia coli and Citrobacter rodentium. Nat. Microbiol. 2020, 5, 368–378. [Google Scholar] [CrossRef] [PubMed]
  27. Ju, T.; Kennelly, J.P.; Jacobs, R.L.; Willing, B.P. Insufficient dietary choline aggravates disease severity in a mouse model of Citrobacter rodentium-induced colitis. Br. J. Nutr. 2021, 125, 50–61. [Google Scholar] [CrossRef]
  28. Maattanen, P.; Lurz, E.; Botts, S.R.; Wu, R.Y.; Yeung, C.W.; Li, B.; Abiff, S.; Johnson-Henry, K.C.; Lepp, D.; Power, K.A.; et al. Ground flaxseed reverses protection of a reduced-fat diet against Citrobacter rodentium-induced colitis. Am. J. Physiol. Gastrointest. Liver Physiol. 2018, 315, G788–G798. [Google Scholar] [CrossRef] [Green Version]
  29. Kim, Y.G.; Sakamoto, K.; Seo, S.U.; Pickard, J.M.; Gillilland, M.G., 3rd; Pudlo, N.A.; Hoostal, M.; Li, X.; Wang, T.D.; Feehley, T.; et al. Neonatal acquisition of clostridia species protects against colonization by bacterial pathogens. Science 2017, 356, 315–319. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  30. Armenta, J.M.; Cortes, D.F.; Pisciotta, J.M.; Shuman, J.L.; Blakeslee, K.; Rasoloson, D.; Ogunbiyi, O.; Sullivan, D.J., Jr.; Shulaev, V. Sensitive and rapid method for amino acid quantitation in malaria biological samples using AccQ.Tag ultra performance liquid chromatography-electrospray ionization-MS/MS with multiple reaction monitoring. Anal. Chem. 2010, 82, 548–558. [Google Scholar] [CrossRef] [Green Version]
  31. Chassaing, B.; Srinivasan, G.; Delgado, M.A.; Young, A.N.; Gewirtz, A.T.; Vijay-Kumar, M. Fecal lipocalin 2, a sensitive and broadly dynamic non-invasive biomarker for intestinal inflammation. PLoS ONE 2012, 7, e44328. [Google Scholar] [CrossRef] [Green Version]
  32. Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
  33. Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Pruesse, E.; Quast, C.; Knittel, K.; Fuchs, B.M.; Ludwig, W.; Peplies, J.; Glockner, F.O. SILVA: A comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res. 2007, 35, 7188–7196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef] [Green Version]
  36. Weiss, S.; Xu, Z.Z.; Peddada, S.; Amir, A.; Bittinger, K.; Gonzalez, A.; Lozupone, C.; Zaneveld, J.R.; Vazquez-Baeza, Y.; Birmingham, A.; et al. Normalization and microbial differential abundance strategies depend upon data characteristics. Microbiome 2017, 5, 27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Papapietro, O.; Teatero, S.; Thanabalasuriar, A.; Yuki, K.E.; Diez, E.; Zhu, L.; Kang, E.; Dhillon, S.; Muise, A.M.; Durocher, Y.; et al. R-spondin 2 signalling mediates susceptibility to fatal infectious diarrhoea. Nat. Commun. 2013, 4, 1898. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Schweinfest, C.W.; Spyropoulos, D.D.; Henderson, K.W.; Kim, J.H.; Chapman, J.M.; Barone, S.; Worrell, R.T.; Wang, Z.; Soleimani, M. Slc26a3 (dra)-deficient mice display chloride-losing diarrhea, enhanced colonic proliferation, and distinct up-regulation of ion transporters in the colon. J. Biol. Chem. 2006, 281, 37962–37971. [Google Scholar] [CrossRef] [Green Version]
  39. Cerutti, A.; Rescigno, M. The biology of intestinal immunoglobulin A responses. Immunity 2008, 28, 740–750. [Google Scholar] [CrossRef] [Green Version]
  40. Wilmore, J.R.; Gaudette, B.T.; Atria, D.G.; Hashemi, T.; Jones, D.D.; Gardner, C.A.; Cole, S.D.; Misic, A.M.; Beiting, D.P.; Allman, D. Commensal microbes induce serum IgA responses that protect against polymicrobial sepsis. Cell Host Microbe 2018, 23, 302–311. [Google Scholar] [CrossRef] [Green Version]
  41. Pitkanen, H.T.; Oja, S.S.; Kemppainen, K.; Seppa, J.M.; Mero, A.A. Serum amino acid concentrations in aging men and women. Amino Acids 2003, 24, 413–421. [Google Scholar] [CrossRef]
  42. Romano, C.; Corsetti, G.; Flati, V.; Pasini, E.; Picca, A.; Calvani, R.; Marzetti, E.; Dioguardi, F.S. Influence of Diets with varying essential/nonessential amino acid ratios on mouse lifespan. Nutrients 2019, 11, 1367. [Google Scholar] [CrossRef] [Green Version]
  43. Neis, E.P.; Dejong, C.H.; Rensen, S.S. The role of microbial amino acid metabolism in host metabolism. Nutrients 2015, 7, 2930–2946. [Google Scholar] [CrossRef] [Green Version]
  44. Zhao, J.; Zhang, X.; Liu, H.; Brown, M.A.; Qiao, S. Dietary protein and gut microbiota composition and function. Curr. Protein Pept. Sci. 2019, 20, 145–154. [Google Scholar] [CrossRef] [PubMed]
  45. Lopez-Miranda, V.; Soto-Montenegro, M.L.; Uranga-Ocio, J.A.; Vera, G.; Herradon, E.; Gonzalez, C.; Blas, C.; Martinez-Villaluenga, M.; Lopez-Perez, A.E.; Desco, M.; et al. Effects of chronic dietary exposure to monosodium glutamate on feeding behavior, adiposity, gastrointestinal motility, and cardiovascular function in healthy adult rats. Neurogastroenterol. Motil. 2015, 27, 1559–1570. [Google Scholar] [CrossRef] [PubMed]
  46. Rhoads, J.M.; Keku, E.O.; Quinn, J.; Woosely, J.; Lecce, J.G. l-glutamine stimulates jejunal sodium and chloride absorption in pig rotavirus enteritis. Gastroenterology 1991, 100, 683–691. [Google Scholar] [CrossRef]
  47. Tordoff, M.G.; Bachmanov, A.A.; Reed, D.R. Forty mouse strain survey of water and sodium intake. Physiol. Behav. 2007, 91, 620–631. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. Eizirik, D.L.; Germano, C.M.; Migliorini, R.H. Dietetic supplementation with branched chain amino acids attenuates the severity of streptozotocin-induced diabetes in rats. Acta Diabetol. Lat. 1988, 25, 117–126. [Google Scholar] [CrossRef] [PubMed]
  49. Tsukano, K.; Inoue, H.; Suzuki, K. Increase in branched-chain amino acids due to acidemia in neonatal calves with diarrhoea. Vet. Rec. Open 2017, 4, e000234. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Kawase, T.; Nagasawa, M.; Ikeda, H.; Yasuo, S.; Koga, Y.; Furuse, M. Gut microbiota of mice putatively modifies amino acid metabolism in the host brain. Br. J. Nutr. 2017, 117, 775–783. [Google Scholar] [CrossRef] [Green Version]
  51. Whitt, D.D.; Demoss, R.D. Effect of microflora on the free amino acid distribution in various regions of the mouse gastrointestinal tract. Appl. Microbiol. 1975, 30, 609–615. [Google Scholar] [CrossRef]
  52. Allison, C.; Macfarlane, G.T. Influence of pH, nutrient availability, and growth rate on amine production by Bacteroides fragilis and Clostridium perfringens. Appl. Environ. Microbiol. 1989, 55, 2894–2898. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Dai, Z.L.; Wu, G.; Zhu, W.Y. Amino acid metabolism in intestinal bacteria: Links between gut ecology and host health. Front. Biosci. 2011, 16, 1768–1786. [Google Scholar] [CrossRef] [Green Version]
  54. Davila, A.M.; Blachier, F.; Gotteland, M.; Andriamihaja, M.; Benetti, P.H.; Sanz, Y.; Tome, D. Re-print of “Intestinal luminal nitrogen metabolism: Role of the gut microbiota and consequences for the host”. Pharmacol. Res. 2013, 69, 114–126. [Google Scholar] [CrossRef]
  55. Hugenholtz, F.; Davids, M.; Schwarz, J.; Muller, M.; Tome, D.; Schaap, P.; Hooiveld, G.; Smidt, H.; Kleerebezem, M. Metatranscriptome analysis of the microbial fermentation of dietary milk proteins in the murine gut. PLoS ONE 2018, 13, e0194066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Nutrients 13 01896 g001 550
Figure 1. An amino acid-based diet protects mice from lethal infection with Citrobacter rodentium. Mice fed each diet (RD: regular natural diet (n = 10), PD: regular purified diet (n = 10), AD: amino acid-based purified diet (n = 10), FD: purified high-fat diet (n = 10)) were orally administered C. rodentium. (A) Mouse survival and (B) body weight change 3, 6, 9, and 10 days post-infection compared to that on day 0. Data are expressed as mean ± SEM. (C) Gene expression of Ctnnb1 and Mmp7 in the colon 9 days post-infection by real-time RT-PCR. mRNA expression of each gene was normalized to that of Rpl19. Each dot represents an individual mouse, and horizontal bars indicate mean values. Statistical significance was assessed by the (A) log-rank test, compared to RD group, (B) two-way ANOVA with Šídák’s multiple comparisons test, or (C) unpaired Student’s t-test. * p < 0.05; ** p < 0.01; *** p < 0.001; N.S., not significant.
Figure 1. An amino acid-based diet protects mice from lethal infection with Citrobacter rodentium. Mice fed each diet (RD: regular natural diet (n = 10), PD: regular purified diet (n = 10), AD: amino acid-based purified diet (n = 10), FD: purified high-fat diet (n = 10)) were orally administered C. rodentium. (A) Mouse survival and (B) body weight change 3, 6, 9, and 10 days post-infection compared to that on day 0. Data are expressed as mean ± SEM. (C) Gene expression of Ctnnb1 and Mmp7 in the colon 9 days post-infection by real-time RT-PCR. mRNA expression of each gene was normalized to that of Rpl19. Each dot represents an individual mouse, and horizontal bars indicate mean values. Statistical significance was assessed by the (A) log-rank test, compared to RD group, (B) two-way ANOVA with Šídák’s multiple comparisons test, or (C) unpaired Student’s t-test. * p < 0.05; ** p < 0.01; *** p < 0.001; N.S., not significant.
Nutrients 13 01896 g001
Nutrients 13 01896 g002 550
Figure 2. An amino acid-based diet neither promotes pathogen clearance nor suppresses intestinal damage. (A–F) Mice fed each diet (PD; regular purified diet, AD; amino acid-based purified diet) were orally infected with C. rodentium (n = 9–10 in each group). (A,B) Fecal pathogen load on 1, 3, 5, and 9 days post-infection (A) and in the tissues 10 days post-infection (B). (C) H&E staining of colon slides from representative infected mice fed PD or AD 10 days post-infection. scale bar, 200 μm (D) Fecal lipocalin-2 concentration 9 days post-infection. (E) Plasma concentration of fluorescein isothiocyanate (FITC)-dextran 7 days post-infection. (F) Gene expression of Il1b, Il6, Il17a, Il22, and Slc26a3 in the colon 9 days post-infection by real-time RT-PCR. mRNA expression of each gene was normalized to that of Rpl19 (G–H) Mice fed PD or AD for 2 weeks (n = 10 in each group). IgA levels in (G) feces or (H) plasma. Each dot represents an individual mouse, and the horizontal bars indicate mean values. Statistical significance was assessed by two-way ANOVA with (A,B) Šídák’s multiple comparisons test, (D,F (Il1b, Il6, Il17a, Slc26a3), H) Mann–Whitney test, (E,F (Il22)) unpaired Welch’s t-test, or (G) unpaired Student’s t-test. N.S., not significant.
Figure 2. An amino acid-based diet neither promotes pathogen clearance nor suppresses intestinal damage. (A–F) Mice fed each diet (PD; regular purified diet, AD; amino acid-based purified diet) were orally infected with C. rodentium (n = 9–10 in each group). (A,B) Fecal pathogen load on 1, 3, 5, and 9 days post-infection (A) and in the tissues 10 days post-infection (B). (C) H&E staining of colon slides from representative infected mice fed PD or AD 10 days post-infection. scale bar, 200 μm (D) Fecal lipocalin-2 concentration 9 days post-infection. (E) Plasma concentration of fluorescein isothiocyanate (FITC)-dextran 7 days post-infection. (F) Gene expression of Il1b, Il6, Il17a, Il22, and Slc26a3 in the colon 9 days post-infection by real-time RT-PCR. mRNA expression of each gene was normalized to that of Rpl19 (G–H) Mice fed PD or AD for 2 weeks (n = 10 in each group). IgA levels in (G) feces or (H) plasma. Each dot represents an individual mouse, and the horizontal bars indicate mean values. Statistical significance was assessed by two-way ANOVA with (A,B) Šídák’s multiple comparisons test, (D,F (Il1b, Il6, Il17a, Slc26a3), H) Mann–Whitney test, (E,F (Il22)) unpaired Welch’s t-test, or (G) unpaired Student’s t-test. N.S., not significant.
Nutrients 13 01896 g002
Nutrients 13 01896 g003 550
Figure 3. An amino acid-based diet promotes water intake and protects from lethal infectious diarrhea. (A,B) Mice fed each diet (PD; regular purified diet, AD; amino acid-based purified diet) were infected orally with Citrobacter rodentium (n = 9–10 in each group). (A) Blood urea nitrogen (BUN) level. Each dot represents an individual mouse and the horizontal bars indicate mean values. (B) Mouse survival after peritoneal saline treatment once a day after 6 days. (C,D) Mice fed PD or AD for 2 weeks (n = 9–10 in each group). (C) Water and (D) food intake. Data are expressed as mean ± SD. Statistical significance was assessed by two-way ANOVA with (A) Šídák’s multiple comparisons test, (B) log-rank test, (C) unpaired Student’s t-test, or (D) Mann–Whitney test. ** p < 0.01; *** p < 0.001; N.S., not significant.
Figure 3. An amino acid-based diet promotes water intake and protects from lethal infectious diarrhea. (A,B) Mice fed each diet (PD; regular purified diet, AD; amino acid-based purified diet) were infected orally with Citrobacter rodentium (n = 9–10 in each group). (A) Blood urea nitrogen (BUN) level. Each dot represents an individual mouse and the horizontal bars indicate mean values. (B) Mouse survival after peritoneal saline treatment once a day after 6 days. (C,D) Mice fed PD or AD for 2 weeks (n = 9–10 in each group). (C) Water and (D) food intake. Data are expressed as mean ± SD. Statistical significance was assessed by two-way ANOVA with (A) Šídák’s multiple comparisons test, (B) log-rank test, (C) unpaired Student’s t-test, or (D) Mann–Whitney test. ** p < 0.01; *** p < 0.001; N.S., not significant.
Nutrients 13 01896 g003
Nutrients 13 01896 g004 550
Figure 4. An amino acid-based diet alters plasma amino acid levels. Plasma levels of each amino acid in the mice fed each diet (PD: regular purified diet, AD: amino acid-based purified diet) for 2 weeks (n = 6 in each group). Each dot represents an individual mouse, and horizontal bars indicate mean values. Statistical significance was assessed using the unpaired Welch’s t-test. * p < 0.05; N.S., not significant.
Figure 4. An amino acid-based diet alters plasma amino acid levels. Plasma levels of each amino acid in the mice fed each diet (PD: regular purified diet, AD: amino acid-based purified diet) for 2 weeks (n = 6 in each group). Each dot represents an individual mouse, and horizontal bars indicate mean values. Statistical significance was assessed using the unpaired Welch’s t-test. * p < 0.05; N.S., not significant.
Nutrients 13 01896 g004
Nutrients 13 01896 g005 550
Figure 5. An amino acid-based diet changes gut microbiota composition and fecal amino acid levels. Mice fed each diet (PD, regular purified diet; AD, amino acid-based purified diet) for 2 weeks (n = 6 in each group). (A) Total bacterial number in the feces. (B) Relative abundance of operational taxonomic units (OTUs) in fecal samples from each group. The various colors correspond to each bacterial order. (C) Relative abundance of OTUs assigned to Erysipelotrichaceae and Streptococcaceae families. (D) Fecal levels of each amino acid. Each dot represents an individual mouse, and horizontal bars indicate mean values. Statistical significance was assessed by (A) unpaired Student’s t-test, (C) Mann–Whitney test, or (D) unpaired Welch’s t-test. * p < 0.05; ** p < 0.01; *** p < 0.001; N.S., not significant.
Figure 5. An amino acid-based diet changes gut microbiota composition and fecal amino acid levels. Mice fed each diet (PD, regular purified diet; AD, amino acid-based purified diet) for 2 weeks (n = 6 in each group). (A) Total bacterial number in the feces. (B) Relative abundance of operational taxonomic units (OTUs) in fecal samples from each group. The various colors correspond to each bacterial order. (C) Relative abundance of OTUs assigned to Erysipelotrichaceae and Streptococcaceae families. (D) Fecal levels of each amino acid. Each dot represents an individual mouse, and horizontal bars indicate mean values. Statistical significance was assessed by (A) unpaired Student’s t-test, (C) Mann–Whitney test, or (D) unpaired Welch’s t-test. * p < 0.05; ** p < 0.01; *** p < 0.001; N.S., not significant.
Nutrients 13 01896 g005
Nutrients 13 01896 g006 550
Figure 6. Oral glutamate treatment protects mice from lethal diarrheal Citrobacter rodentium infection. (A) Mice were treated with or without 1% glutamate for 10 days. Water intake of each group. Data are expressed as mean ± SD. (B–D) Mice treated with or without 1% glutamate were infected orally with C. rodentium (n = 8 in each group). (B) Fecal pathogen load 6 days post-infection. (C) Blood urea nitrogen (BUN) level 0 and 6 days post-infection. (D) Mouse survival. Each dot represents an individual mouse and the horizontal bars indicate mean values. Statistical significance was assessed by (A,B) unpaired Student’s t-test or (C) two-way ANOVA with Šídák’s multiple comparisons test. ** p < 0.01; *** p < 0.001; N.S., not significant.
Figure 6. Oral glutamate treatment protects mice from lethal diarrheal Citrobacter rodentium infection. (A) Mice were treated with or without 1% glutamate for 10 days. Water intake of each group. Data are expressed as mean ± SD. (B–D) Mice treated with or without 1% glutamate were infected orally with C. rodentium (n = 8 in each group). (B) Fecal pathogen load 6 days post-infection. (C) Blood urea nitrogen (BUN) level 0 and 6 days post-infection. (D) Mouse survival. Each dot represents an individual mouse and the horizontal bars indicate mean values. Statistical significance was assessed by (A,B) unpaired Student’s t-test or (C) two-way ANOVA with Šídák’s multiple comparisons test. ** p < 0.01; *** p < 0.001; N.S., not significant.
Nutrients 13 01896 g006
Table
Table 1. Nutrient composition of experimental diets.
Table 1. Nutrient composition of experimental diets.
DietPDADFDRD *
g%g%g%g%
Protein201826.224.8 **
Carbohydrate646626.354.55 ***
Fat7734.94.6 ****
(kcal/gm)445.23.4
Ingredientgggg
Casein2000258.4-
L-Cystine34.33.9-
L-Arginine-6.1--
L-Histidine-HCl-H2O-4.7--
L-Isoleucine-7.7--
L-Leucine-16.0--
L-Lysine-HCl-13.4--
L-Methionine-5.2--
L-Phenylalanine-8.5--
L-Threonine-7.3--
L-Tryptophan-2.1--
L-Valine-9.4--
L-Alanine-5.2--
L-Asparagine-H2O-6.8--
L-Aspartate-5.5--
L-Glutamic Acid-22.0--
L-Glutamine-16.7--
Glycine-3--
L-Proline-18.1--
L-Serine-10.1--
L-Tyrosine-9.3--
Corn Starch397.5403.40-
Maltodextrin132134162-
Sucrose100108.788.9-
Cellulose, BW200505165-
Corn Oil000-
Soybean Oil707132-
Lard00317-
t-butylhydroquinone000-
Vitaminsmgmgmgmg
Vitamin A6.66.78.58.1
Vitamin B15.35.46.818
Vitamin B266.17.814
Vitamin B65.85.97.513
Vitamin B122.52.51.30
Vitamin D31010.112.90.1
Vitamin E131.7133.7113.571
Pantothenic acid13.513.717.430
Biotin2022.60.5
Folic Acid26.78.58.1
Total (g)1000100010001000
* RD; regular natural diet, PD; regular purified diet, AD; amino acid-based purified diet, FD; purified high-fat diet. Average of periodic analysis in 2020. ** Protein source: soybean waste, whitefish meal, yeast. *** Carbohydrate source: wheat flour, corn, Milo (fiber source: wheat bran, defatted rice bran, alfalfa meal). **** Fat source: cereal germ, soybean oil. All diets contain appropriate minerals.
Table
Table 2. Primer sequences.
Table 2. Primer sequences.
Genes Primer Sequence
Ctnnb1ForwardATG GAG CCG GAC AGA AAA GC
ReverseTGG GAG GTG TCA ACA TCT TCT T
Mmp7ForwardGCA TTT CCT TGA GGT TGT CC
ReverseCAC ATC AGT GGG AAC AGG C
Il1bForwardGAA ATG CCA CCT TTT GAC AGT G
ReverseTGG ATG CTC TCA TCA GGA CAG
Il6ForwardTGA TGC ACT TGC AGA AAA CA
ReverseACC AGA GGA AAT TTT CAA TAG GC
Il17aForwardTCAGCGTGTCCAAACACTGAG
ReverseCGCCAAGGGAGTTAAAGACTT
Il22ForwardGTG CTC AAC TTC ACC CTG GA
ReverseTGG ATG TTC TGG TCG TCA CC
Slc26a3ForwardAACATCCCTCCAGCCTACG
ReverseTGGACCCACAGATATGTGTCT
Rpl19ForwardTAC CGG GAA TCC AAG AAG ATT GA
ReverseAGG ATG CGC TTG TTT TTG AAC
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kimizuka, T.; Seki, N.; Yamaguchi, G.; Akiyama, M.; Higashi, S.; Hase, K.; Kim, Y.-G. Amino Acid-Based Diet Prevents Lethal Infectious Diarrhea by Maintaining Body Water Balance in a Murine Citrobacter rodentium Infection Model. Nutrients 2021, 13, 1896. https://doi.org/10.3390/nu13061896

AMA Style

Kimizuka T, Seki N, Yamaguchi G, Akiyama M, Higashi S, Hase K, Kim Y-G. Amino Acid-Based Diet Prevents Lethal Infectious Diarrhea by Maintaining Body Water Balance in a Murine Citrobacter rodentium Infection Model. Nutrients. 2021; 13(6):1896. https://doi.org/10.3390/nu13061896

Chicago/Turabian Style

Kimizuka, Tatsuki, Natsumi Seki, Genki Yamaguchi, Masahiro Akiyama, Seiichiro Higashi, Koji Hase, and Yun-Gi Kim. 2021. "Amino Acid-Based Diet Prevents Lethal Infectious Diarrhea by Maintaining Body Water Balance in a Murine Citrobacter rodentium Infection Model" Nutrients 13, no. 6: 1896. https://doi.org/10.3390/nu13061896

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop