0% found this document useful (0 votes)
6 views68 pages

Chap2 Data

This document provides an overview of data mining, focusing on the definition of data, types of attributes, and the characteristics of structured data. It discusses various types of data sets, including record, graph, and ordered data, as well as data quality issues such as noise, outliers, and missing values. Additionally, it covers data preprocessing techniques like aggregation and sampling to enhance data quality for analysis.

Uploaded by

Effat
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPT, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
6 views68 pages

Chap2 Data

This document provides an overview of data mining, focusing on the definition of data, types of attributes, and the characteristics of structured data. It discusses various types of data sets, including record, graph, and ordered data, as well as data quality issues such as noise, outliers, and missing values. Additionally, it covers data preprocessing techniques like aggregation and sampling to enhance data quality for analysis.

Uploaded by

Effat
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPT, PDF, TXT or read online on Scribd
You are on page 1/ 68

Data Mining: Data

Lecture Notes for Chapter 2

Introduction to Data Mining


by
Tan, Steinbach, Kumar

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 1


What is Data?

 Collection of data objects and Attributes


their attributes

 An attribute is a property or Tid Refund Marital Taxable


Status Income Cheat
characteristic of an object
1 Yes Single 125K No
– Examples: eye color of a
2 No Married 100K No
person, temperature, etc.
3 No Single 70K No
– Attribute is also known as
4 Yes Married 120K No
variable, field, characteristic,
5 No Divorced 95K Yes
or feature Objects
6 No Married 60K No
 A collection of attributes
7 Yes Divorced 220K No
describe an object
8 No Single 85K Yes
– Object is also known as
9 No Married 75K No
record, point, case, sample,
10 No Single 90K Yes
entity, or instance 10

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 2


Attribute Values

 Attribute values are numbers or symbols assigned


to an attribute

 Distinction between attributes and attribute values


– Same attribute can be mapped to different attribute
values
 Example: height can be measured in feet or meters

– Different attributes can be mapped to the same set of


values
 Example: Attribute values for ID and age are integers
 But properties of attribute values can be different

– ID has no limit but age has a maximum and minimum value

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 3


Measurement of Length
 The way you measure an attribute is somewhat may not match
the attributes properties.
5 A 1

B
7 2

8 3

10 4

15 5

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 4


Types of Attributes

 There are different types of attributes


– Nominal
 Examples: ID numbers, eye color, zip codes
– Ordinal
 Examples: rankings (e.g., taste of potato chips on a scale
from 1-10), grades, height in {tall, medium, short}
– Interval
 Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
– Ratio
 Examples: temperature in Kelvin, length, time, counts

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 5


Properties of Attribute Values

 The type of an attribute depends on which of the


following properties it possesses:
– Distinctness: = 
– Order: < >
– Addition: + -
– Multiplication: */

– Nominal attribute: distinctness


– Ordinal attribute: distinctness & order
– Interval attribute: distinctness, order & addition
– Ratio attribute: all 4 properties

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 6


Attribute Description Examples Operations
Type

Nominal The values of a nominal attribute zip codes, employee mode, entropy,
are just different names, i.e., ID numbers, eye color, contingency
nominal attributes provide only sex: {male, female} correlation, 2 test
enough information to distinguish
one object from another. (=, )

Ordinal The values of an ordinal attribute hardness of minerals, median, percentiles,


provide enough information to order {good, better, best}, rank correlation,
objects. (<, >) grades, street numbers run tests, sign tests

Interval For interval attributes, the calendar dates, mean, standard


differences between values are temperature in Celsius deviation, Pearson's
meaningful, i.e., a unit of or Fahrenheit correlation, t and F
measurement exists. tests
(+, - )

Ratio For ratio variables, both differences temperature in Kelvin, geometric mean,
and ratios are meaningful. (*, /) monetary quantities, harmonic mean,
counts, age, mass, percent variation
length, electrical
current
Attribute Transformation Comments
Level

Nominal Any permutation of values If all employee ID numbers


were reassigned, would it
make any difference?

Ordinal An order preserving change of An attribute encompassing


values, i.e., the notion of good, better
new_value = f(old_value) best can be represented
where f is a monotonic function. equally well by the values
{1, 2, 3} or by { 0.5, 1,
10}.
Interval new_value =a * old_value + b Thus, the Fahrenheit and
where a and b are constants Celsius temperature scales
differ in terms of where
their zero value is and the
size of a unit (degree).

Ratio new_value = a * old_value Length can be measured in


meters or feet.
Discrete and Continuous
Attributes

 Discrete Attribute
– Has only a finite or countably infinite set of values
– Examples: zip codes, counts, or the set of words in a collection
of documents
– Often represented as integer variables.
– Note: binary attributes are a special case of discrete attributes

 Continuous Attribute
– Has real numbers as attribute values
– Examples: temperature, height, or weight.
– Practically, real values can only be measured and represented
using a finite number of digits.
– Continuous attributes are typically represented as floating-point
variables.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 9


Types of data sets
 Record
– Data Matrix
– Document Data
– Transaction Data

 Graph
– World Wide Web
– Molecular Structures

 Ordered
– Spatial Data
– Temporal Data
– Sequential Data
– Genetic Sequence Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 10


Important Characteristics of Structured
Data

– Dimensionality
 Curse of Dimensionality

– Sparsity
 Only presence counts

– Resolution
 Patterns depend on the scale

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 11


Record Data

 Data that consists of a collection of records, each


of which consists of a fixed set of attributes
Tid Refund Marital Taxable
Status Income Cheat

1 Yes Single 125K No


2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 12


Data Matrix

 If data objects have the same fixed set of numeric


attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute

 Such data set can be represented by an m by n matrix,


where there are m rows, one for each object, and n
columns, one for each attribute

Projection Projection Distance Load Thickness


of x Load of y load

10.23 5.27 15.22 2.7 1.2


12.65 6.25 16.22 2.2 1.1

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 13


Document Data

 Each document becomes a `term' vector,


– each term is a component (attribute) of the vector,
– the value of each component is the number of times
the corresponding term occurs in the document.

timeout

season
coach

game
score
team

ball

lost
pla

wi
n
y

Document 1 3 0 5 0 2 6 0 2 0 2

Document 2 0 7 0 2 1 0 0 3 0 0

Document 3 0 1 0 0 1 2 2 0 3 0

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 14


Transaction Data

 A special type of record data, where


– each record (transaction) involves a set of items.
– For example, consider a grocery store. The set of
products purchased by a customer during one
shopping trip constitute a transaction, while the
individual products that were purchased are the items.

TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 15


Graph Data

 Examples: Generic graph and HTML Links

<a href="papers/papers.html#bbbb">
Data Mining </a>
<li>
2 <a href="papers/papers.html#aaaa">
Graph Partitioning </a>
<li>
5 1 <a href="papers/papers.html#aaaa">
Parallel Solution of Sparse Linear System of Equations </a>
<li>
2 <a href="papers/papers.html#ffff">
N-Body Computation and Dense Linear System Solvers
5

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 16


Chemical Data

 Benzene Molecule: C6H6

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 17


Ordered Data

 Sequences of transactions
Items/Events

An element of
the sequence

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 18


Ordered Data

 Genomic sequence data

GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 19


Ordered Data

 Spatio-Temporal Data

Average Monthly
Temperature of
land and ocean

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 20


Data Quality

 What kinds of data quality problems?


 How can we detect problems with the data?
 What can we do about these problems?

 Examples of data quality problems:


– Noise and outliers
– missing values
– duplicate data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 21


Noise

 Noise refers to modification of original values


– Examples: distortion of a person’s voice when talking
on a poor phone and “snow” on television screen

Two Sine Waves Two Sine Waves + Noise

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 22


Outliers

 Outliers are data objects with characteristics that


are considerably different than most of the other
data objects in the data set

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 23


Missing Values

 Reasons for missing values


– Information is not collected
(e.g., people decline to give their age and weight)
– Attributes may not be applicable to all cases
(e.g., annual income is not applicable to children)

 Handling missing values


– Eliminate Data Objects
– Estimate Missing Values
– Ignore the Missing Value During Analysis
– Replace with all possible values (weighted by their
probabilities)

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 24


Duplicate Data

 Data set may include data objects that are


duplicates, or almost duplicates of one another
– Major issue when merging data from heterogeous
sources

 Examples:
– Same person with multiple email addresses

 Data cleaning
– Process of dealing with duplicate data issues

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 25


Data Preprocessing

 Aggregation
 Sampling
 Dimensionality Reduction
 Feature subset selection
 Feature creation
 Discretization and Binarization
 Attribute Transformation

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 26


Aggregation

 Combining two or more attributes (or objects) into


a single attribute (or object)

 Purpose
– Data reduction
 Reduce the number of attributes or objects
– Change of scale
 Cities aggregated into regions, states, countries, etc
– More “stable” data
 Aggregated data tends to have less variability

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 27


Aggregation

Variation of Precipitation in Australia

Standard Deviation of Average Standard Deviation of Average


Monthly Precipitation Yearly Precipitation

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 28


Sampling
 Sampling is the main technique employed for data selection.
– It is often used for both the preliminary investigation of the data
and the final data analysis.

 Statisticians sample because obtaining the entire set of data


of interest is too expensive or time consuming.

 Sampling is used in data mining because processing the


entire set of data of interest is too expensive or time
consuming.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 29


Sampling …

 The key principle for effective sampling is the


following:
– using a sample will work almost as well as using the
entire data sets, if the sample is representative

– A sample is representative if it has approximately the


same property (of interest) as the original set of data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 30


Types of Sampling

 Simple Random Sampling


– There is an equal probability of selecting any particular item

 Sampling without replacement


– As each item is selected, it is removed from the population

 Sampling with replacement


– Objects are not removed from the population as they are
selected for the sample.
 In sampling with replacement, the same object can be picked up
more than once

 Stratified sampling
– Split the data into several partitions; then draw random samples
from each partition
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 31
Sample Size

8000 points 2000 Points 500 Points

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 32


Sample Size
 What sample size is necessary to get at least one
object from each of 10 groups.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 33


Curse of Dimensionality

 When dimensionality
increases, data becomes
increasingly sparse in the
space that it occupies

 Definitions of density and


distance between points,
which is critical for
clustering and outlier
detection, become less
meaningful • Randomly generate 500 points
• Compute difference between max and min
distance between any pair of points

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 34


Dimensionality Reduction

 Purpose:
– Avoid curse of dimensionality
– Reduce amount of time and memory required by data
mining algorithms
– Allow data to be more easily visualized
– May help to eliminate irrelevant features or reduce
noise

 Techniques
– Principle Component Analysis
– Singular Value Decomposition
– Others: supervised and non-linear techniques

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 35


Dimensionality Reduction: PCA

 Goal is to find a projection that captures the


largest amount of variation in data

x2

x1

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 36


Dimensionality Reduction: PCA

 Find the eigenvectors of the covariance matrix


 The eigenvectors define the new space

x2

x1
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 37
Dimensionality Reduction: ISOMAP

By: Tenenbaum, de Silva,


Langford (2000)

 Construct a neighbourhood graph


 For each pair of points in the graph, compute the shortest
path distances – geodesic distances

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 38


Dimensionality Reduction: PCA

Dimensions
Dimensions==206
120
160
10
40
80

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 39


Feature Subset Selection

 Another way to reduce dimensionality of data

 Redundant features
– duplicate much or all of the information contained in
one or more other attributes
– Example: purchase price of a product and the amount
of sales tax paid

 Irrelevant features
– contain no information that is useful for the data
mining task at hand
– Example: students' ID is often irrelevant to the task of
predicting students' GPA
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 40
Feature Subset Selection

 Techniques:
– Brute-force approch:
Try all possible feature subsets as input to data mining algorithm
– Embedded approaches:
 Feature selection occurs naturally as part of the data mining
algorithm
– Filter approaches:
 Features are selected before data mining algorithm is run
– Wrapper approaches:
 Use the data mining algorithm as a black box to find best subset
of attributes

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 41


Feature Creation

 Create new attributes that can capture the


important information in a data set much more
efficiently than the original attributes

 Three general methodologies:


– Feature Extraction
 domain-specific
– Mapping Data to New Space
– Feature Construction
 combining features

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 42


Mapping Data to a New Space

 Fourier transform
 Wavelet transform

Two Sine Waves Two Sine Waves + Noise Frequency

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 43


Discretization Using Class Labels
 Entropy based approach

3 categories for both x and y 5 categories for both x and y

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 44


Discretization Without Using Class
Labels

Data Equal interval width

Equal frequency K-means

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 45


Attribute Transformation

 A function that maps the entire set of values of a


given attribute to a new set of replacement values
such that each old value can be identified with
one of the new values
– Simple functions: xk, log(x), ex, |x|
– Standardization and Normalization

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 46


Similarity and Dissimilarity

 Similarity
– Numerical measure of how alike two data objects are.
– Is higher when objects are more alike.
– Often falls in the range [0,1]
 Dissimilarity
– Numerical measure of how different are two data
objects
– Lower when objects are more alike
– Minimum dissimilarity is often 0
– Upper limit varies
 Proximity refers to a similarity or dissimilarity
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 47
Similarity/Dissimilarity for Simple
Attributes

p and q are the attribute values for two data objects.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 48


Euclidean Distance
 Euclidean Distance

Where n is the number of dimensions (attributes) and pk and qk are, respectively, the kth attributes (components) or data objects p and q.

 Standardization is necessary, if scales differ.

n 2
dist   ( pk  qk )
k 1

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 49


Euclidean Distance

3
point x y
2 p1
p1 0 2
p3 p4
1
p2 2 0
p2 p3 3 1
0 p4 5 1
0 1 2 3 4 5 6

p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0

Distance Matrix

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 50


Minkowski Distance
 Minkowski Distance is a generalization of Euclidean Distance

Where r is a parameter, n is the number of dimensions (attributes) and pk and qk are, respectively, the kth attributes (components) or data objects p and q.

1
n r r
dist (  | pk  qk |)
k 1

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 51


Minkowski Distance: Examples

 r = 1. City block (Manhattan, taxicab, L1 norm) distance.


– A common example of this is the Hamming distance, which is just the
number of bits that are different between two binary vectors

 r = 2. Euclidean distance

 r  . “supremum” (Lmax norm, L norm) distance.


– This is the maximum difference between any component of the vectors

 Do not confuse r with n, i.e., all these distances are


defined for all numbers of dimensions.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 52


Minkowski Distance

L1 p1 p2 p3 p4
p1 0 4 4 6
p2 4 0 2 4
p3 4 2 0 2
p4 6 4 2 0
point x y
p1 0 2 L2 p1 p2 p3 p4
p2 2 0 p1 0 2.828 3.162 5.099
p3 3 1 p2 2.828 0 1.414 3.162
p4 5 1 p3 3.162 1.414 0 2
p4 5.099 3.162 2 0

L p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0

Distance Matrix
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 53
Mahalanobis Distance

1 T
mahalanobis( p, q) ( p  q)  ( p  q)

 is the covariance matrix of


the input data X

1 n
 j ,k   ( X ij  X j )( X ik  X k )
n  1 i 1

For red points, the Euclidean distance is 14.7, Mahalanobis distance is 6.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 54


Mahalanobis Distance

Covariance Matrix:

 0.3 0.2
  
 0.2 0.3
C

B A: (0.5, 0.5)
B: (0, 1)
A C: (1.5, 1.5)

Mahal(A,B) = 5
Mahal(A,C) = 4

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 55


Common Properties of a Distance

 Distances, such as the Euclidean distance,


have some well known properties.
1. d(p, q)  0 for all p and q and d(p, q) = 0 only if
p = q. (Positive definiteness)
2. d(p, q) = d(q, p) for all p and q. (Symmetry)
3. d(p, r)  d(p, q) + d(q, r) for all points p, q, and r.
(Triangle Inequality)
where d(p, q) is the distance (dissimilarity) between
points (data objects), p and q.

 A distance that satisfies these properties is a


metric

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 56


Common Properties of a Similarity

 Similarities, also have some well known


properties.
1. s(p, q) = 1 (or maximum similarity) only if p = q.

2. s(p, q) = s(q, p) for all p and q. (Symmetry)

where s(p, q) is the similarity between points (data


objects), p and q.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 57


Similarity Between Binary Vectors
 Common situation is that objects, p and q, have only
binary attributes
 Compute similarities using the following quantities
M01 = the number of attributes where p was 0 and q was 1
M10 = the number of attributes where p was 1 and q was 0
M00 = the number of attributes where p was 0 and q was 0
M11 = the number of attributes where p was 1 and q was 1

 Simple Matching and Jaccard Coefficients


SMC = number of matches / number of attributes
= (M11 + M00) / (M01 + M10 + M11 + M00)

J = number of 11 matches / number of not-both-zero attributes values


= (M11) / (M01 + M10 + M11)

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 58


SMC versus Jaccard: Example

p= 1000000000
q= 0000001001

M01 = 2 (the number of attributes where p was 0 and q was 1)


M10 = 1 (the number of attributes where p was 1 and q was 0)
M00 = 7 (the number of attributes where p was 0 and q was 0)
M11 = 0 (the number of attributes where p was 1 and q was 1)

SMC = (M11 + M00)/(M01 + M10 + M11 + M00) = (0+7) / (2+1+0+7) = 0.7

J = (M11) / (M01 + M10 + M11) = 0 / (2 + 1 + 0) = 0

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 59


Cosine Similarity
 If d1 and d2 are two document vectors, then
cos( d1, d2 ) = (d1  d2) / ||d1|| ||d2|| ,
where  indicates vector dot product and || d || is the length of vector d.

 Example:

d1 = 3 2 0 5 0 0 0 2 0 0
d2 = 1 0 0 0 0 0 0 1 0 2

d1  d2= 3*1 + 2*0 + 0*0 + 5*0 + 0*0 + 0*0 + 0*0 + 2*1 + 0*0 + 0*2 = 5
||d1|| = (3*3+2*2+0*0+5*5+0*0+0*0+0*0+2*2+0*0+0*0)0.5 = (42) 0.5 = 6.481
||d2|| = (1*1+0*0+0*0+0*0+0*0+0*0+0*0+1*1+0*0+2*2) 0.5 = (6) 0.5 = 2.245

cos( d1, d2 ) = .3150


© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 60
Extended Jaccard Coefficient
(Tanimoto)

 Variation of Jaccard for continuous or count


attributes
– Reduces to Jaccard for binary attributes

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 61


Correlation

 Correlation measures the linear relationship


between objects
 To compute correlation, we standardize data
objects, p and q, and then take their dot product

pk ( pk  mean( p)) / std ( p)

qk ( qk  mean( q)) / std ( q)

correlatio n( p, q)  p q
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 62
Visually Evaluating Correlation

Scatter plots
showing the
similarity from
–1 to 1.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 63


General Approach for Combining
Similarities

 Sometimes attributes are of many different


types, but an overall similarity is needed.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 64


Using Weights to Combine
Similarities

 May not want to treat all attributes the same.


– Use weights wk which are between 0 and 1 and sum
to 1.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 65


Density

 Density-based clustering require a notion of


density

 Examples:
– Euclidean density
 Euclidean density = number of points per unit volume

– Probability density

– Graph-based density

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 66


Euclidean Density – Cell-based

 Simplest approach is to divide region into a


number of rectangular cells of equal volume and
define density as # of points the cell contains

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 67


Euclidean Density – Center-based

 Euclidean density is the number of points within a


specified radius of the point

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 68

You might also like