Scribd
Upload
3 views14 pages

1 Intro Bioinfo

Bioinformatics is an interdisciplinary field that utilizes computational tools to analyze biological macromolecules such as DNA, RNA, and proteins, aiming to enhance understanding of cellular functions and molecular interactions. It encompasses the development of databases and software for sequence analysis, structural analysis, and functional analysis, with applications in drug discovery and biotechnology. However, challenges such as data quality, tool availability, and computational power remain significant limitations in the field.

Uploaded by

somil kumar
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd
3 views14 pages

1 Intro Bioinfo

Bioinformatics is an interdisciplinary field that utilizes computational tools to analyze biological macromolecules such as DNA, RNA, and proteins, aiming to enhance understanding of cellular functions and molecular interactions. It encompasses the development of databases and software for sequence analysis, structural analysis, and functional analysis, with applications in drug discovery and biotechnology. However, challenges such as data quality, tool availability, and computational power remain significant limitations in the field.

Uploaded by

somil kumar
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd
You are on page 1/ 14

Introduction to Bioinformatics

Dr. Atul Kumar Upadhyay


Assistant Professor
Thapar Institute of Engineering & Technology, Patiala, Punjab, India
What is Bioinformatics

Bioinformatics is an interdisciplinary
research area.

Bioinformatics involves the technology


that uses computers for storage, retrieval,
manipulation, and distribution of
information related to biological
macromolecules such as DNA, RNA and
proteins.

Bioinformatics and computational


Biology
Goal of Bioinformatics

• Better understand a living cell

• Understanding of its functions at the molecular level

• Detailed study of biological macromolecules such as


DNA, RNA and Proteins.

• Dissecting flow of information (i.e., Central Dogma) in


biological system.
Scope of Bioinformatics
1. The development of computational tools and
databases

2. The application of these tools and databases in


generating biological knowledge

3. Tool and algorithms development:

 Writing software for sequence, structural, and


functional analysis

 Construction and curating of biological


databases
An open question to students?
-Accession #?
-Annotation?
Is it already in
databases?
Protein Other
characteristics? information?
-Sub-localization -Expression profile?
-Soluble? -Mutants?
You have a gene
-3D fold
sequence

Is there conserved Is there similar Evolutionary


regions? sequences? relationship?
-Alignments? -% identity? -Phylogenetic tree
-Domains? -Family member?
Major areas of Bioinformatics

Molecular Sequence analysis

Molecular Structure analysis

Molecular Function analysis


Molecular Sequence analysis

Sequence Database searches

Motif and pattern discovery

Sequence Alignment

Reconstruction of
evolutionary relationship Gene and promoter finding
Molecular Structure Analysis

Protein, RNA and DNA


structure

Analysis

Comparison

Classification

Prediction
Molecular Function analysis

A. Gene expression

B. Protein-protein
interaction

C. Metabolic pathway
reconstruction

D. Protein subcellular
localization
Applications of Bioinformatics

• Drug discovery

• Agriculture Biotechnology

• Animal Biotechnology Genome Short fragments of DNA

• Microbial Biotechnology
ACGTGGTAA CGTATACAC TAGGCCATA
GTAATGGCG CACCCTTAG
• Forensic analysis TGGCGTATA CATA…
ACGTGGTAATGGCGTATACACCCTTAGGCCATA
Sequence matching problem

• Proteins are longer and DNA strands are even longer

• We match them by breaking them in to shorter subsequences

• Breaking and matching is done by notion of alignment.


Limitations of Bioinformatics

• Availability of quality data

• Availability of quality tools - A critical failure of


current bioinformatics is the lack of a single
software package that can perform all of these
functions.

• Error rates in prediction work

• Computational power and

• Last but not least human expertize of the desired


analysis
Thank You

You might also like