Scribd
Upload
5 views57 pages

Bioinformatics, Basics To Advance

Bioinformatics is the analysis of biological information using computational and statistical techniques, aimed at enhancing biological research through databases and algorithms. It includes applications such as DNA sequence analysis, genetic variation identification, and protein structure prediction. The field has evolved alongside computer technology and is essential for modern biological studies.

Uploaded by

saleen.salam86
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd
5 views57 pages

Bioinformatics, Basics To Advance

Bioinformatics is the analysis of biological information using computational and statistical techniques, aimed at enhancing biological research through databases and algorithms. It includes applications such as DNA sequence analysis, genetic variation identification, and protein structure prediction. The field has evolved alongside computer technology and is essential for modern biological studies.

Uploaded by

saleen.salam86
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd
You are on page 1/ 57

Bioinformatics

Basics to advance

Lecturer
Dr. Saleen Salam
[email protected]
What is Bioinformatics ?
‫المعلوماتية الحيوية هي تحليل المعلومات‬
‫البيولوجية باستخدام الكمبيوتر و التقنّيات‬
‫االحصائية‬.
‫وهي العلم الذي يسعى الى استخدام وتطوير‬
‫قواعد البيانات و الخوارزمّيات الحاسوبّية‬
‫لتسهيل وتعزيز األبحاث البيولوجّية‬.

• Bioinformatics is the analysis of biological


information using computers and statistical
techniques. It is the science that seeks to use and
develop databases and computer algorithms to
facilitate and enhance biological research
• Bioinformatics encompasses a variety of techniques
and methodologies that leverage computational and
statistical approaches to analyze biological data.
‫‪ ‬أول استخدام لمصطلح المعلوماتية الحيوية كان من قبل مارغريت دايهوف‬
‫والتي تعد رائدة هذا المجال‬
‫نشأ هذا العلم وتطور بالتزامن مع نشأة الحواسب وتطورها حيث يشار اليه‬
‫علم االحياء الحاسوبي ‪computational biology‬‬
• Wet Lab
• The core of wet lab activities involves working with • Dry Lab
tangible samples, such as: focus on data analysis, use of coding and computer systems
• Typical activities in a dry lab include:
• Chemicals and liquids • Modeling and analytical tasks

• Biological samples
.dr
• Pharmaceuticals and various fluids
‫تطبيقات المعلوماتية الحيوية‬
‫في مجاالت الدراسات االكاديمية أصبحت ضرورة‪1-‬‬
‫‪،‬البد منها‬

‫تحليل تركيب الحوامض االمينية‪2‬‬

‫‪،‬تحليل البروتينات‪-3‬‬

‫دراسة التراكيب المختلفة بالمقارنة‪-4‬‬

‫دراسة عمليات االصطفاف لغرض تصنيفها‪-5‬‬

‫التنبؤ بوظائف التراكيب المختلفة للبروتينات ‪-6‬‬


‫وااالحماض النووية باالعتماد على‬
‫‪ profile‬وتحديد ‪ Alignments‬التركيب فًض ل عن تحديد‬
‫التحليل‪expression Gene‬‬
‫الوظيفي مثل تحديد نسق التعبير الجيني‬

‫التنبؤ بتداًخ الت البروتينات مع بعضها ‪-7‬‬


One of the key aspects of bioinformatics
Analysis and comparison of DNA sequences. Every living organism has a
unique DNA sequence that contains the instructions for its development,

01
functioning, and evolution. By studying these sequences, scientists can
gain insights into the genetic makeup of organisms, understand their
evolutionary relationships, and even trace the origins of species.

Identifying genetic variations


Genetic variations refer to differences in DNA sequences among

02 individuals or populations. These variations can have significant


implications for human health, as they can be associated with the
development of diseases or the response to certain medications.
Bioinformatics can identify these variations and gain a better
understanding of how they influence our health and well-being.

Predicting protein structures

03
Understanding protein structures is crucial for deciphering their functions
and developing targeted therapies. Bioinformatics tools enable scientists to
predict the 3D- structures of proteins based on their amino acid sequences,
providing valuable insights into their biological roles.
• What data bases? And Why?
Biological Database

• ‫قاعدة البيانات البيولوجية هي مجموعة من البيانات التي يتم تنظيمها‬


‫ تلعب‬.‫بحيث يمكن الوصول إلى محتوياتها وإدارتها وتحديثها بسهولة‬
‫قواعد البيانات البيولوجية دوًر ا أساسًيا في العلوم الحيوية وخاصة في‬
‫ إنها توفر للعلماء الفرصة للوصول إلى بيانات‬.‫المعلوماتية الحيوية‬
‫التسلسل والبنية لعشرات اآلالف من التسلسالت من مجموعة واسعة‬
‫ تمثل قواعد البيانات البيولوجية موردا ال يقدر بثمن‬.‫من الكائنات الحية‬
‫لدعم البحوث البيولوجية‬.
• A biological database is a collection of data that is organized so that it contents
can easily be accessed, managed and updated. Biological databases play a
fundamental role in bioscience particularly in bioinformatics. They offer
scientists the opportunity to access sequence and structure data for tens of
thousands of sequences from a broad range of organisms. Biological databases
represent an invaluable resource in support of biological research.
Bioinformatics
Approaches
Next-Generation Sequencing
(NGS) Data Analysis
Purpose To process and analyze
large-scale DNA or RNA
sequencing data

Read mapping (e.g., Bowtie,


BWA), variant calling (e.g.,
Methods GATK, SAMtools), and de
novo assembly (e.g., SPAdes,
Trinity) for genome and
transcriptome analysis.
Proteomics and Mass
Spectrometry
To study the
structure, function,
and interactions of
proteins
Mass spectrometry-
based proteomics for
protein identification,
quantification, and
post-translational
modification analysis.
Epigenomics
To study
modifications to
the genome that do
not involve
changes to the
underlying DNA
Analyzing
sequence
data from
techniques like ChIP-seq
(Chromatin
Immunoprecipitation
Sequencing) and bisulfite
sequencing to study DNA
methylation.
Sequencing Methods
• Over many generations, an organism may acquire point mutations but
most of these will not result in any change in the protein sequence.
Homology Similarity attributed to descent from
a common ancestor

• Definition: homology Two types of homology


• Orthologs Homologous sequences in different
species that arose from a common ancestral gene
during speciation; may or may not be responsible for a
similar function.
• Paralogs Homologous sequences within a single
species that arose by gene duplication.
Sequence output
Raw data

Computer calls
GNNTNNTGTGNCGGATACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGCACCACCAC
CACCACCACCCCATGGGTATGAATAAGCAAAAGGTTTGTCCTGCTTGTGAATCTGCGGAACTTATTTATGATCCAGAAAG
GGGGGAAATAGTCTGTGCCAAGTGCGGTTATGTAATAGAAGAGAACATAATTGATATGGGTCCTAAGTGGCGTGCTTTTG
ATGCTTCTCAAAGGGAACGCAGGTCTAGAACTGGTGCACCAGAAAGTATTCTTCTTCATGACAAGGGGCTTTCAACTGCA
ATTGGAATTGACAGATCGCTTTCCGGATTAATGAGAGAGAAGATGTACCGTTTGAGGAAGTGGCANTCCANATTANGAGT
TAGTGATGCAGCANANAGGAACCTAGCTTTTGCCCTAAGTGAGTTGGATAGAATTNCTGCTCAGTTAAAACTTCCNNGAC
ATGTAGAGGAAGAAGCTGCAANGCTGNACANAGANGCAGNGNGANAGGGACTTATTNGANGCAGATCTATTGAGAGCGTT
ATGGCGGCANGTGTTTACCCTGCTTGTAGGTTATTAAAAGNTCCCGGGACTCTGGATGAGATTGCTGATATTGCTAGAGC
How clear are the nucleotide peaks?
Here, you are out at the very limit of resolution, around 900-
1000 nt. You get only a general sense of the sequence here.
There are only a few basecalls that can be considered reliable.
The G at 981 may in fact be two G's, the N could be a G or an A,
and who knows how many A's there are afterwards.
• A phylogenetic tree, also known as a cladogram, tree of life, or
evolutionary tree, is a graphical representation resembling a tree that
illustrates the evolutionary and phylogenetic relationships between
biological taxa based on their physical or genetic characteristics.
Comprising nodes and branches, a phylogenetic tree uses nodes to
stand for taxonomic units and branches to depict estimated time
relationships between these units
Parts of a Phylogenetic Tree
• Topology: The topology of a tree is the overall branching
pattern of a tree.
• Branch: A branch represents a lineage - a group that
originates from a common ancestor.
• Tip: The tip at the end of a branch represents a species,
gene, taxon, etc.
• Node: The node represents the common ancestor of the
lineages that branch from it.
• Clade: The clade includes a common ancestor and all of its
descendants.
• Root: The root is the common ancestor to all species within
the tree.
• Outgroup: The outgroup represents a taxon that diverges
from all other taxa represented in the tree.
• Thank you for listening

You might also like