0% found this document useful (0 votes)
16 views

Chap2 Data

Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
16 views

Chap2 Data

Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd
You are on page 1/ 86

Data

Data and it’s importance

Dr Zakia Jalil

01/27/2021 Introduction to Data Mining, 2nd Edition 1


Tan, Steinbach, Karpatne, Kumar
Outline

 Attributes and Objects

 Types of Data

 Data Quality

 Similarity and Distance

 Data Preprocessing

01/27/2021 Introduction to Data Mining, 2nd Edition 2


Tan, Steinbach, Karpatne, Kumar
What is Data?

 Collection of data objects Attributes


and their attributes
 An attribute is a property or Tid Refund Marital Taxable
Status Income Cheat
characteristic of an object
1 Yes Single 125K No
– Examples: eye color of a
person, temperature, etc. 2 No Married 100K No

– Attribute is also known as 3 No Single 70K No

Objects
variable, field, characteristic, 4 Yes Married 120K No
dimension, or feature 5 No Divorced 95K Yes
 A collection of attributes 6 No Married 60K No
describe an object 7 Yes Divorced 220K No
– Object is also known as 8 No Single 85K Yes
record, point, case, sample, 9 No Married 75K No
entity, or instance
10 No Single 90K Yes
10
Attribute Values

 Attribute values are numbers or symbols


assigned to an attribute for a particular object

 Distinction between attributes and attribute values


– Same attribute can be mapped to different attribute
values
 Example: height can be measured in feet or meters

– Different attributes can be mapped to the same set of


values
 Example: Attribute values for ID and age are integers
– But properties of attribute can be different than the
properties of the values used to represent the
attribute Introduction to Data Mining, 2nd Edition
01/27/2021 4
Tan, Steinbach, Karpatne, Kumar
Measurement of Length
 The way you measure an attribute may not match the
attributes properties.
5 A 1

B
7 2

C
This scale This scale
8 3
preserves preserves
only the the ordering
ordering D and additvity
property of properties of
length. 10 4 length.

15 5
Types of Attributes

 There are different types of attributes


– Nominal
 Examples: ID numbers, eye color, zip codes
– Ordinal
 Examples: rankings (e.g., taste of potato chips on a scale
from 1-10), grades, height {tall, medium, short}
– Interval
 Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
– Ratio
 Examples: temperature in Kelvin, length, counts, elapsed
time (e.g., time to run a race)
01/27/2021 Introduction to Data Mining, 2nd Edition 6
Tan, Steinbach, Karpatne, Kumar
Properties of Attribute Values

 The type of an attribute depends on which of the


following properties/operations it possesses:
– Distinctness: = 
– Order: < >
– Differences are + -
meaningful :
– Ratios are * /
meaningful

– Nominal attribute: distinctness


– Ordinal attribute: distinctness & order
– Interval attribute: distinctness, order & meaningful differences
– Ratio attribute: all 4 properties/operations
01/27/2021 Introduction to Data Mining, 2nd Edition 7
Tan, Steinbach, Karpatne, Kumar
Difference Between Ratio and Interval

 Is it physically meaningful to say that a


temperature of 10 ° is twice that of 5° on
– the Celsius scale?
– the Fahrenheit scale?
– the Kelvin scale?

 Consider measuring the height above average


– If Bill’s height is three inches above average and
Bob’s height is six inches above average, then would
we say that Bob is twice as tall as Bill?
– Is this situation analogous to that of temperature?

01/27/2021 Introduction to Data Mining, 2nd Edition 8


Tan, Steinbach, Karpatne, Kumar
Attribute Description Examples Operations
Type
Nominal Nominal attribute zip codes, employee mode, entropy,
values only ID numbers, eye contingency
distinguish. (=, ) color, sex: {male, correlation, 2
Categorical
Qualitative

female} test

Ordinal Ordinal attribute hardness of minerals, median,


values also order {good, better, best}, percentiles, rank
objects. grades, street correlation, run
(<, >) numbers tests, sign tests
Interval For interval calendar dates, mean, standard
attributes, temperature in deviation,
differences between Celsius or Fahrenheit Pearson's
Quantitative
Numeric

values are correlation, t and


meaningful. (+, - ) F tests
Ratio For ratio variables, temperature in Kelvin, geometric mean,
both differences and monetary quantities, harmonic mean,
ratios are counts, age, mass, percent variation
meaningful. (*, /) length, current

This categorization of attributes is due to S. S. Stevens


Attribute Transformation Comments
Type
Nominal Any permutation of values If all employee ID numbers
were reassigned, would it
make any difference?
Categorical
Qualitative

Ordinal An order preserving change of An attribute encompassing


values, i.e., the notion of good, better best
new_value = f(old_value) can be represented equally
where f is a monotonic function well by the values {1, 2, 3} or
by { 0.5, 1, 10}.

Interval new_value = a * old_value + b Thus, the Fahrenheit and


where a and b are constants Celsius temperature scales
Quantitative
Numeric

differ in terms of where their


zero value is and the size of a
unit (degree).
Ratio new_value = a * old_value Length can be measured in
meters or feet.

This categorization of attributes is due to S. S. Stevens


Discrete and Continuous Attributes

 Discrete Attribute
– Has only a finite or countably infinite set of values
– Examples: zip codes, counts, or the set of words in a
collection of documents
– Often represented as integer variables.
– Note: binary attributes are a special case of discrete
attributes
 Continuous Attribute
– Has real numbers as attribute values
– Examples: temperature, height, or weight.
– Practically, real values can only be measured and
represented using a finite number of digits.
– Continuous attributes are typically represented as floating-
point variables.
01/27/2021 Introduction to Data Mining, 2nd Edition 11
Tan, Steinbach, Karpatne, Kumar
Asymmetric Attributes
 Only presence (a non-zero attribute value) is regarded as
important
 Words present in documents
 Items present in customer transactions

 If we met a friend in the grocery store would we ever say


the following?
“I see our purchases are very similar since we didn’t buy most of
the same things.”

01/27/2021 Introduction to Data Mining, 2nd Edition 12


Tan, Steinbach, Karpatne, Kumar
Critiques of the attribute categorization

 Incomplete
– Asymmetric binary
– Cyclical
– Multivariate
– Partially ordered
– Partial membership
– Relationships between the data

 Real data is approximate and noisy


– This can complicate recognition of the proper attribute type
– Treating one attribute type as another may be approximately
correct

01/27/2021 Introduction to Data Mining, 2nd Edition 13


Tan, Steinbach, Karpatne, Kumar
Key Messages for Attribute Types

 The types of operations you choose should be


“meaningful” for the type of data you have
– Distinctness, order, meaningful intervals, and meaningful ratios
are only four (among many possible) properties of data

– The data type you see – often numbers or strings – may not
capture all the properties or may suggest properties that are not
present

– Analysis may depend on these other properties of the data


Many statistical analyses depend only on the distribution

– In the end, what is meaningful can be specific to domain


01/27/2021 Introduction to Data Mining, 2nd Edition 14
Tan, Steinbach, Karpatne, Kumar
Important Characteristics of Data

– Dimensionality (number of attributes)


 High dimensional data brings a number of challenges

– Sparsity
 Only presence counts

– Resolution
 Patterns depend on the scale

– Size
 Type of analysis may depend on size of data

01/27/2021 Introduction to Data Mining, 2nd Edition 15


Tan, Steinbach, Karpatne, Kumar
Types of data sets
 Record
– Data Matrix
– Document Data
– Transaction Data
 Graph
– World Wide Web
– Molecular Structures
 Ordered
– Spatial Data
– Temporal Data
– Sequential Data
– Genetic Sequence Data

01/27/2021 Introduction to Data Mining, 2nd Edition 16


Tan, Steinbach, Karpatne, Kumar
Record Data

 Data that consists of a collection of records, each


of which consists of a fixed set of attributes
Tid Refund Marital Taxable
Status Income Cheat

1 Yes Single 125K No


2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10

01/27/2021 Introduction to Data Mining, 2nd Edition 17


Tan, Steinbach, Karpatne, Kumar
Data Matrix

 If data objects have the same fixed set of numeric


attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute

 Such a data set can be represented by an m by n matrix,


where there are m rows, one for each object, and n
columns, one for each attribute
Projection Projection Distance Load Thickness
of x Load of y load

10.23 5.27 15.22 2.7 1.2


12.65 6.25 16.22 2.2 1.1

01/27/2021 Introduction to Data Mining, 2nd Edition 18


Tan, Steinbach, Karpatne, Kumar
Document Data

 Each document becomes a ‘term’ vector


– Each term is a component (attribute) of the vector
– The value of each component is the number of times
the corresponding term occurs in the document.

timeout

season
coach

game
score
play
team

win
ball

lost
Document 1 3 0 5 0 2 6 0 2 0 2

Document 2 0 7 0 2 1 0 0 3 0 0

Document 3 0 1 0 0 1 2 2 0 3 0

01/27/2021 Introduction to Data Mining, 2nd Edition 19


Tan, Steinbach, Karpatne, Kumar
Transaction Data

 A special type of data, where


– Each transaction involves a set of items.
– For example, consider a grocery store. The set of products
purchased by a customer during one shopping trip constitute a
transaction, while the individual products that were purchased are
the items.
– Can represent transaction data as record data
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
01/27/2021 Introduction to Data Mining, 2nd Edition 20
Tan, Steinbach, Karpatne, Kumar
Graph Data
 Examples: Generic graph, a molecule, and webpages

2
5 1
2
5

Benzene Molecule: C6H6


01/27/2021 Introduction to Data Mining, 2nd Edition 21
Tan, Steinbach, Karpatne, Kumar
Ordered Data

 Sequences of transactions
Items/Events

An element of
the sequence
01/27/2021 Introduction to Data Mining, 2nd Edition 22
Tan, Steinbach, Karpatne, Kumar
Ordered Data

 Genomic sequence data

GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG

01/27/2021 Introduction to Data Mining, 2nd Edition 23


Tan, Steinbach, Karpatne, Kumar
Ordered Data

 Spatio-Temporal Data

Average Monthly
Temperature of
land and ocean

01/27/2021 Introduction to Data Mining, 2nd Edition 24


Tan, Steinbach, Karpatne, Kumar
Data Quality

 Poor data quality negatively affects many data processing


efforts

 Example: a classification model for detecting people who


are loan risks is built using poor data
– Some credit-worthy candidates are denied loans
– More loans are given to individuals that default

01/27/2021 Introduction to Data Mining, 2nd Edition 25


Tan, Steinbach, Karpatne, Kumar
Data Quality …

 What kinds of data quality problems?


 How can we detect problems with the data?
 What can we do about these problems?

 Examples of data quality problems:


– Noise and outliers
– Wrong data
– Fake data
– Missing values
– Duplicate data
01/27/2021 Introduction to Data Mining, 2nd Edition 26
Tan, Steinbach, Karpatne, Kumar
Noise

 For objects, noise is an extraneous/ irrelevant object


 For attributes, noise refers to modification of original values
– Examples: distortion of a person’s voice when talking on a poor phone and
“snow” on television screen
– The figures below show two sine waves of the same magnitude and different
frequencies, the waves combined, and the two sine waves with random noise
 The magnitude and shape of the original signal is distorted

Two sine waves Observed signal (sum of the two sine waves) Observed signal with noise
1 3 3

0.8
2 2
0.6

0.4
1 1
0.2
magnitude

magnitude

magnitude
0 0 0

-0.2
-1 -1
-0.4

-0.6
-2 -2
-0.8

-1 -3 -3
0 0.1 0.2 0.3 0.4 0.5 0 0.1 0.2 0.3 0.4 0.5 0 0.1 0.2 0.3 0.4 0.5
time (seconds) time (seconds) time (seconds)

01/27/2021 Introduction to Data Mining, 2nd Edition 27


Tan, Steinbach, Karpatne, Kumar
Outliers

 Outliers are data objects with characteristics that


are considerably different than most of the other
data objects in the data set
– Case 1: Outliers are
noise that interferes
with data analysis

– Case 2: Outliers are


the goal of our analysis
 Credit card fraud
 Intrusion detection

 Causes?
01/27/2021 Introduction to Data Mining, 2nd Edition 28
Tan, Steinbach, Karpatne, Kumar
Missing Values

 Reasons for missing values


– Information is not collected
(e.g., people decline to give their age and weight)
– Attributes may not be applicable to all cases
(e.g., annual income is not applicable to children)

 Handling missing values


– Eliminate data objects or variables
– Estimate missing values
 Example: time series of temperature
 Example: census results

– Ignore the missing value during analysis

01/27/2021 Introduction to Data Mining, 2nd Edition 29


Tan, Steinbach, Karpatne, Kumar
Duplicate Data

 Data set may include data objects that are


duplicates, or almost duplicates of one another
– Major issue when merging data from heterogeneous
sources

 Examples:
– Same person with multiple email addresses

 Data cleaning
– Process of dealing with duplicate data issues

 When should duplicate data not be removed?


01/27/2021 Introduction to Data Mining, 2nd Edition 30
Tan, Steinbach, Karpatne, Kumar
Similarity and Dissimilarity Measures

 Similarity measure
– Numerical measure of how alike two data objects are.
– Is higher when objects are more alike.
– Often falls in the range [0,1]
 Dissimilarity measure
– Numerical measure of how different two data objects
are
– Lower when objects are more alike
– Minimum dissimilarity is often 0
– Upper limit varies
 Proximity refers to a similarity or dissimilarity
01/27/2021 Introduction to Data Mining, 2nd Edition 31
Tan, Steinbach, Karpatne, Kumar
Similarity/Dissimilarity for Simple Attributes

The following table shows the similarity and dissimilarity


between two objects, x and y, with respect to a single, simple
attribute.
Ordinal-Examples: rankings (e.g., taste of potato chips on a scale from 1-10),
grades, height {tall, medium, short}
Interval-Examples: calendar dates, temperatures in Celsius or Fahrenheit.
Ratio-Examples: temperature in Kelvin, length, counts, elapsed time (e.g., time to
run a race)

01/27/2021 Introduction to Data Mining, 2nd Edition 32


Tan, Steinbach, Karpatne, Kumar
Euclidean Distance

 Euclidean Distance

where n is the number of dimensions (attributes) and xk


and yk are, respectively, the kth attributes (components)
or data objects x and y.

 Standardization is necessary, if scales differ.

01/27/2021 Introduction to Data Mining, 2nd Edition 33


Tan, Steinbach, Karpatne, Kumar
Euclidean Distance

3
point x y
2 p1
p1 0 2
p3 p4
1
p2 2 0
p2 p3 3 1
0 p4 5 1
0 1 2 3 4 5 6

p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
Distance Matrix
01/27/2021 Introduction to Data Mining, 2nd Edition 34
Tan, Steinbach, Karpatne, Kumar
Minkowski Distance

 Minkowski Distance is a generalization of Euclidean


Distance

Where r is a parameter, n is the number of dimensions


(attributes) and xk and yk are, respectively, the kth
attributes (components) or data objects x and y.

01/27/2021 Introduction to Data Mining, 2nd Edition 35


Tan, Steinbach, Karpatne, Kumar
Minkowski Distance: Examples

 r = 1. City block (Manhattan, taxicab, L1 norm) distance.


– A common example of this for binary vectors is the Hamming
distance, which is just the number of bits that are different
between two binary vectors

 r = 2. Euclidean distance

 r  . “supremum” (Lmax norm, L norm) distance.


– This is the maximum difference between any component of
the vectors

 Do not confuse r with n, i.e., all these distances are


defined for all numbers of dimensions.

01/27/2021 Introduction to Data Mining, 2nd Edition 36


Tan, Steinbach, Karpatne, Kumar
Minkowski Distance

L1 p1 p2 p3 p4
p1 0 4 4 6
p2 4 0 2 4
p3 4 2 0 2
p4 6 4 2 0
point x y
p1 0 2 L2 p1 p2 p3 p4
p2 2 0 p1 0 2.828 3.162 5.099
p3 3 1 p2 2.828 0 1.414 3.162
p4 5 1 p3 3.162 1.414 0 2
p4 5.099 3.162 2 0

L p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0

Distance Matrix
01/27/2021 Introduction to Data Mining, 2nd Edition 37
Tan, Steinbach, Karpatne, Kumar
Mahalanobis Distance

-0.5

 is the covariance matrix

For red points, the Euclidean distance is 14.7, Mahalanobis distance is 6.


01/27/2021 Introduction to Data Mining, 2nd Edition 38
Tan, Steinbach, Karpatne, Kumar
Mahalanobis Distance

Covariance
Matrix:
 0.3 0.2
 
C
 0 . 2 0 . 3
B A: (0.5, 0.5)
B: (0, 1)
A
C: (1.5, 1.5)

Mahal(A,B) = 5
Mahal(A,C) = 4

01/27/2021 Introduction to Data Mining, 2nd Edition 39


Tan, Steinbach, Karpatne, Kumar
Common Properties of a Distance
 Distances, such as the Euclidean distance,
have some well known properties.
1. d(x, y)  0 for all x and y and d(x, y) = 0 if and only
if x = y.
2. d(x, y) = d(y, x) for all x and y. (Symmetry)
3. d(x, z)  d(x, y) + d(y, z) for all points x, y, and z.
(Triangle Inequality)

where d(x, y) is the distance (dissimilarity) between


points (data objects), x and y.

 A distance that satisfies these properties is a


metric

01/27/2021 Introduction to Data Mining, 2nd Edition 40


Tan, Steinbach, Karpatne, Kumar
Common Properties of a Similarity

 Similarities, also have some well known


properties.

1. s(x, y) = 1 (or maximum similarity) only if x = y.


(does not always hold, e.g., cosine)
2. s(x, y) = s(y, x) for all x and y. (Symmetry)

where s(x, y) is the similarity between points (data


objects), x and y.

01/27/2021 Introduction to Data Mining, 2nd Edition 41


Tan, Steinbach, Karpatne, Kumar
Similarity Between Binary Vectors
 Common situation is that objects, x and y, have only
binary attributes
 Compute similarities using the following quantities
f01 = the number of attributes where x was 0 and y was 1
f10 = the number of attributes where x was 1 and y was 0
f00 = the number of attributes where x was 0 and y was 0
f11 = the number of attributes where x was 1 and y was 1

 Simple Matching and Jaccard Coefficients


SMC = number of matches / number of attributes
= (f11 + f00) / (f01 + f10 + f11 + f00)

J = number of 11 matches / number of non-zero attributes


= (f11) / (f01 + f10 + f11)
01/27/2021 Introduction to Data Mining, 2nd Edition 42
Tan, Steinbach, Karpatne, Kumar
SMC versus Jaccard: Example

x= 1000000000
y= 0000001001

f01 = 2 (the number of attributes where x was 0 and y was 1)


f10 = 1 (the number of attributes where x was 1 and y was 0)
f00 = 7 (the number of attributes where x was 0 and y was 0)
f11 = 0 (the number of attributes where x was 1 and y was 1)

SMC = (f11 + f00) / (f01 + f10 + f11 + f00)


= (0+7) / (2+1+0+7) = 0.7

J = (f11) / (f01 + f10 + f11) = 0 / (2 + 1 + 0) = 0


01/27/2021 Introduction to Data Mining, 2nd Edition 43
Tan, Steinbach, Karpatne, Kumar
Cosine Similarity

 If d1 and d2 are two document vectors, then


cos( d1, d2 ) = <d1,d2> / ||d1|| ||d2|| ,
where <d1,d2> indicates inner product or vector dot
product of vectors, d1 and d2, and || d || is the length of
vector d.
 Example:
d1 = 3 2 0 5 0 0 0 2 0 0
d2 = 1 0 0 0 0 0 0 1 0 2
<d1, d2> = 3*1 + 2*0 + 0*0 + 5*0 + 0*0 + 0*0 + 0*0 + 2*1 + 0*0 + 0*2 = 5
| d1 || = (3*3+2*2+0*0+5*5+0*0+0*0+0*0+2*2+0*0+0*0)0.5 = (42) 0.5 = 6.481
|| d2 || = (1*1+0*0+0*0+0*0+0*0+0*0+0*0+1*1+0*0+2*2) 0.5 = (6) 0.5 = 2.449
cos(d1, d2
01/27/2021 ) = 0.3150Introduction to Data Mining, 2nd Edition 44
Tan, Steinbach, Karpatne, Kumar
Correlation measures the linear relationship between objects

01/27/2021 Introduction to Data Mining, 2nd Edition 45


Tan, Steinbach, Karpatne, Kumar
Visually Evaluating Correlation

Scatter plots
showing the
similarity from
–1 to 1.

01/27/2021 Introduction to Data Mining, 2nd Edition 46


Tan, Steinbach, Karpatne, Kumar
Drawback of Correlation
9
 x = (-3, -2, -1, 0, 1, 2, 3) 8
7
 y = (9, 4, 1, 0, 1, 4, 9) 6
5

Y
4
3

yi = xi2 2
1
0
-4 -2 0 2 4
X

 mean(x) = 0, mean(y) = 4
 std(x) = 2.16, std(y) = 3.74

 corr = (-3)(5)+(-2)(0)+(-1)(-3)+(0)(-4)+(1)(-3)+(2)(0)+3(5) / ( 6 * 2.16 * 3.74 )


=0

01/27/2021 Introduction to Data Mining, 2nd Edition 47


Tan, Steinbach, Karpatne, Kumar
Correlation vs Cosine vs Euclidean Distance
 Compare the three proximity measures according to their behavior under
variable transformation
– scaling: multiplication by a value
– translation: adding a constant
Property Cosine Correlation Euclidean Distance
Invariant to scaling Yes Yes No
(multiplication)
Invariant to translation No Yes No
(addition)

 Consider the example


– x = (1, 2, 4, 3, 0, 0, 0), y = (1, 2, 3, 4, 0, 0, 0)
– ys = y * 2 (scaled version of y), yt = y + 5 (translated version)

Measure (x , y) (x , ys) (x , yt)


Cosine 0.9667 0.9667 0.7940

Correlation 0.9429 0.9429 0.9429

Euclidean Distance 1.4142 5.8310 14.2127

01/27/2021 Introduction to Data Mining, 2nd Edition 48


Tan, Steinbach, Karpatne, Kumar
Correlation vs cosine vs Euclidean distance

 Choice of the right proximity measure depends on the domain


 What is the correct choice of proximity measure for the
following situations?
– Comparing documents using the frequencies of words
 Documents are considered similar if the word frequencies are similar

– Comparing the temperature in Celsius of two locations


 Two locations are considered similar if the temperatures are similar in
magnitude

– Comparing two time series of temperature measured in Celsius


 Two time series are considered similar if their “shape” is similar, i.e., they vary
in the same way over time, achieving minimums and maximums at similar
times, etc.

01/27/2021 Introduction to Data Mining, 2nd Edition 49


Tan, Steinbach, Karpatne, Kumar
Comparison of Proximity Measures

 Domain of application
– Similarity measures tend to be specific to the type of
attribute and data
– Record data, images, graphs, sequences, 3D-protein
structure, etc. tend to have different measures
 However, one can talk about various properties that
you would like a proximity measure to have
– Symmetry is a common one
– Tolerance to noise and outliers is another
– Ability to find more types of patterns?
– Many others possible
 The measure must be applicable to the data and
produce results that agree with domain knowledge
01/27/2021 Introduction to Data Mining, 2nd Edition 50
Tan, Steinbach, Karpatne, Kumar
Information Based Measures

 Information theory is a well-developed and


fundamental disciple with broad applications

 Some similarity measures are based on


information theory
– Mutual information in various versions
– Maximal Information Coefficient (MIC) and related
measures
– General and can handle non-linear relationships
– Can be complicated and time intensive to compute

01/27/2021 Introduction to Data Mining, 2nd Edition 51


Tan, Steinbach, Karpatne, Kumar
Information and Probability

 Information relates to possible outcomes of an event


– transmission of a message, flip of a coin, or
measurement of a piece of data

 The more certain an outcome, the less information


that it contains and vice-versa
– For example, if a coin has two heads, then an outcome
of heads provides no information
– More quantitatively, the information is related the
probability of an outcome
 The smaller the probability of an outcome, the more information
it provides and vice-versa
– Entropy is the commonly used measure
01/27/2021 Introduction to Data Mining, 2nd Edition 52
Tan, Steinbach, Karpatne, Kumar
Entropy

 For
– a variable (event), X,
– with n possible values (outcomes), x1, x2 …, xn
– each outcome having probability, p1, p2 …, pn
– the entropy of X , H(X), is given by

 Entropy is between 0 and log2n and is measured


in bits
– Thus, entropy is a measure of how many bits it takes
to represent an observation of X on average
01/27/2021 Introduction to Data Mining, 2nd Edition 53
Tan, Steinbach, Karpatne, Kumar
Entropy Examples

 For a coin with probability p of heads and


probability q = 1 – p of tails

– For p= 0.5, q = 0.5 (fair coin) H = 1


– For p = 1 or q = 1, H = 0

 What is the entropy of a fair four-sided die?

01/27/2021 Introduction to Data Mining, 2nd Edition 54


Tan, Steinbach, Karpatne, Kumar
Entropy for Sample Data: Example

Hair Color Count p -plog2p


Black 75 0.75 0.3113
Brown 15 0.15 0.4105
Blond 5 0.05 0.2161
Red 0 0.00 0
Other 5 0.05 0.2161
Total 100 1.0 1.1540

Maximum entropy is log25 = 2.3219

01/27/2021 Introduction to Data Mining, 2nd Edition 55


Tan, Steinbach, Karpatne, Kumar
Entropy for Sample Data

 Suppose we have
– a number of observations (m) of some attribute, X,
e.g., the hair color of students in the class,
– where there are n different possible values
– And the number of observation in the ith category is mi
– Then, for this sample

 For continuous data, the calculation is harder

01/27/2021 Introduction to Data Mining, 2nd Edition 56


Tan, Steinbach, Karpatne, Kumar
Mutual Information

 Information one variable provides about another

Formally, , where

H(X,Y) is the joint entropy of X and Y,

Where pij is the probability that the ith value of X and the jth value of Y
occur together

 For discrete variables, this is easy to compute

 Maximum mutual information for discrete variables is


log2(min( nX, nY ), where nX (nY) is the number of values of X (Y)
01/27/2021 Introduction to Data Mining, 2nd Edition 57
Tan, Steinbach, Karpatne, Kumar
Mutual Information Example

Student Count p -plog2p Student Grade Count p -plog2p


Status Status
Undergrad 45 0.45 0.5184
Undergrad A 5 0.05 0.2161
Grad 55 0.55 0.4744
Undergrad B 30 0.30 0.5211
Total 100 1.00 0.9928
Undergrad C 10 0.10 0.3322

Grade Count p -plog2p Grad A 30 0.30 0.5211

A 35 0.35 0.5301 Grad B 20 0.20 0.4644


B 50 0.50 0.5000 Grad C 5 0.05 0.2161
C 15 0.15 0.4105 Total 100 1.00 2.2710
Total 100 1.00 1.4406

Mutual information of Student Status and Grade = 0.9928 + 1.4406 - 2.2710 = 0.1624

01/27/2021 Introduction to Data Mining, 2nd Edition 58


Tan, Steinbach, Karpatne, Kumar
Maximal Information Coefficient
 Reshef, David N., Yakir A. Reshef, Hilary K. Finucane, Sharon R. Grossman, Gilean McVean, Peter J.
Turnbaugh, Eric S. Lander, Michael Mitzenmacher, and Pardis C. Sabeti. "Detecting novel
associations in large data sets." science 334, no. 6062 (2011): 1518-1524.

 Applies mutual information to two continuous variables


 Consider the possible binnings of the variables into
discrete categories
– nX × nY ≤ N0.6 where
nX is the number of values of X
nY is the number of values of Y
N is the number of samples (observations, data objects)
 Compute the mutual information
– Normalized by log2(min( nX, nY )
 Take the highest value
01/27/2021 Introduction to Data Mining, 2nd Edition 59
Tan, Steinbach, Karpatne, Kumar
General Approach for Combining Similarities

 Sometimes attributes are of many different types, but an


overall similarity is needed.
1: For the kth attribute, compute a similarity, sk(x, y), in the
range [0, 1].
2: Define an indicator variable, k, for the kth attribute as
follows:
k = 0 if the kth attribute is an asymmetric attribute and
both objects have a value of 0, or if one of the objects
has a missing value for the kth attribute
k = 1 otherwise
3. Compute

01/27/2021 Introduction to Data Mining, 2nd Edition 60


Tan, Steinbach, Karpatne, Kumar
Using Weights to Combine Similarities

 May not want to treat all attributes the same.


– Use non-negative weights 

 Can also define a weighted form of distance

01/27/2021 Introduction to Data Mining, 2nd Edition 61


Tan, Steinbach, Karpatne, Kumar
Data Preprocessing

 Aggregation
 Sampling
 Discretization and Binarization
 Attribute Transformation
 Dimensionality Reduction
 Feature subset selection
 Feature creation

01/27/2021 Introduction to Data Mining, 2nd Edition 62


Tan, Steinbach, Karpatne, Kumar
Aggregation

 Combining two or more attributes (or objects) into a single


attribute (or object)
 Purpose
– Data reduction - reduce the number of attributes or objects
– Change of scale
 Cities aggregated into regions, states, countries, etc.
 Days aggregated into weeks, months, or years
– More “stable” data - aggregated data tends to have less variability

01/27/2021 Introduction to Data Mining, 2nd Edition 63


Tan, Steinbach, Karpatne, Kumar
Example: Precipitation in Australia

 This example is based on precipitation in


Australia from the period 1982 to 1993.
The next slide shows
– A histogram for the standard deviation of average
monthly precipitation for 3,030 0.5◦ by 0.5◦ grid cells in
Australia, and
– A histogram for the standard deviation of the average
yearly precipitation for the same locations.
 The average yearly precipitation has less
variability than the average monthly precipitation.
 All precipitation measurements (and their
standard deviations) are in centimeters.
01/27/2021 Introduction to Data Mining, 2nd Edition 64
Tan, Steinbach, Karpatne, Kumar
Example: Precipitation in Australia …

Variation of Precipitation in Australia

Standard Deviation of Average Standard Deviation of


Monthly Precipitation Average Yearly Precipitation
01/27/2021 Introduction to Data Mining, 2nd Edition 65
Tan, Steinbach, Karpatne, Kumar
Sampling
 Sampling is the main technique employed for data
reduction.
– It is often used for both the preliminary investigation of
the data and the final data analysis.

 Statisticians often sample because obtaining the


entire set of data of interest is too expensive or
time consuming.

 Sampling is typically used in data science


because processing the entire dataset of interest
is too expensive or time consuming.
01/27/2021 Introduction to Data Mining, 2nd Edition 66
Tan, Steinbach, Karpatne, Kumar
Sampling …

 The key principle for effective sampling is the


following:

– Using a sample will work almost as well as using the


entire data set, if the sample is representative

– A sample is representative if it has approximately the


same properties (of interest) as the original set of data

01/27/2021 Introduction to Data Mining, 2nd Edition 67


Tan, Steinbach, Karpatne, Kumar
Sample Size

8000 points 2000 Points 500 Points

01/27/2021 Introduction to Data Mining, 2nd Edition 68


Tan, Steinbach, Karpatne, Kumar
Types of Sampling
 Simple Random Sampling
– There is an equal probability of selecting any particular
item
– Sampling without replacement
 As each item is selected, it is removed from the
population
– Sampling with replacement
 Objects are not removed from the population as they
are selected for the sample.
 In sampling with replacement, the same object can be
picked up more than once
 Stratified sampling
– Split the data into several partitions; then draw random
samples from each partition
01/27/2021 Introduction to Data Mining, 2nd Edition 69
Tan, Steinbach, Karpatne, Kumar
Sample Size
 What sample size is necessary to get at least one
object from each of 10 equal-sized groups.

01/27/2021 Introduction to Data Mining, 2nd Edition 70


Tan, Steinbach, Karpatne, Kumar
Discretization

 Discretization is the process of converting a


continuous attribute into an ordinal attribute
– A potentially infinite number of values are mapped into
a small number of categories
– Discretization is used in both unsupervised and
supervised settings

01/27/2021 Introduction to Data Mining, 2nd Edition 71


Tan, Steinbach, Karpatne, Kumar
Unsupervised Discretization

Data consists of four groups of points and two outliers. Data is one-
dimensional, but a random y component is added to reduce overlap.

01/27/2021 Introduction to Data Mining, 2nd Edition 72


Tan, Steinbach, Karpatne, Kumar
Unsupervised Discretization

Equal interval width approach used to obtain 4 values.

01/27/2021 Introduction to Data Mining, 2nd Edition 73


Tan, Steinbach, Karpatne, Kumar
Unsupervised Discretization

Equal frequency approach used to obtain 4 values.

01/27/2021 Introduction to Data Mining, 2nd Edition 74


Tan, Steinbach, Karpatne, Kumar
Unsupervised Discretization

K-means approach to obtain 4 values.

01/27/2021 Introduction to Data Mining, 2nd Edition 75


Tan, Steinbach, Karpatne, Kumar
Discretization in Supervised Settings

– Many classification algorithms work best if both the independent


and dependent variables have only a few values
– We give an illustration of the usefulness of discretization using
the following example.

01/27/2021 Introduction to Data Mining, 2nd Edition 76


Tan, Steinbach, Karpatne, Kumar
Binarization

 Binarization maps a continuous or categorical


attribute into one or more binary variables

01/27/2021 Introduction to Data Mining, 2nd Edition 77


Tan, Steinbach, Karpatne, Kumar
Attribute Transformation

 An attribute transform is a function that maps the


entire set of values of a given attribute to a new set
of replacement values such that each old value can
be identified with one of the new values
– Simple functions: xk, log(x), ex, |x|
– Normalization
 Refers to various techniques to adjust to differences
among attributes in terms of frequency of
occurrence, mean, variance, range
 Take out unwanted, common signal, e.g., seasonality

– In statistics, standardization refers to subtracting off the


means and dividing by the standard deviation
01/27/2021 Introduction to Data Mining, 2nd Edition 78
Tan, Steinbach, Karpatne, Kumar
Example: Sample Time Series of Plant Growth
Minneapolis

Net Primary
Production (NPP)
is a measure of
plant growth used
by ecosystem
scientists.

Correlations between time series


Correlations between time series
Minneapolis Atlanta Sao Paolo
Minneapolis 1.0000 0.7591 -0.7581
Atlanta 0.7591 1.0000 -0.5739
Sao Paolo -0.7581 -0.5739 1.0000
01/27/2021 Introduction to Data Mining, 2nd Edition 79
Tan, Steinbach, Karpatne, Kumar
Seasonality Accounts for Much Correlation
Minneapolis
Normalized using
monthly Z Score:
Subtract off monthly
mean and divide by
monthly standard
deviation

Correlations between time series


Correlations between time series
Minneapolis Atlanta Sao Paolo
Minneapolis 1.0000 0.0492 0.0906
Atlanta 0.0492 1.0000 -0.0154
Sao Paolo 0.0906 -0.0154 1.0000
01/27/2021 Introduction to Data Mining, 2nd Edition 80
Tan, Steinbach, Karpatne, Kumar
Curse of Dimensionality

 When dimensionality
increases, data becomes
increasingly sparse in the
space that it occupies

 Definitions of density and


distance between points,
which are critical for
clustering and outlier
detection, become less
meaningful • Randomly generate 500 points
• Compute difference between max and
min distance between any pair of points
01/27/2021 Introduction to Data Mining, 2nd Edition 81
Tan, Steinbach, Karpatne, Kumar
Dimensionality Reduction

 Purpose:
– Avoid curse of dimensionality
– Reduce amount of time and memory required by data
mining algorithms
– Allow data to be more easily visualized
– May help to eliminate irrelevant features or reduce
noise

 Techniques
– Principal Components Analysis (PCA)
– Singular Value Decomposition
– Others: supervised and non-linear techniques

01/27/2021 Introduction to Data Mining, 2nd Edition 82


Tan, Steinbach, Karpatne, Kumar
Dimensionality Reduction: PCA

 Goal is to find a projection that captures the


largest amount of variation in data
x2

x1
01/27/2021 Introduction to Data Mining, 2nd Edition 83
Tan, Steinbach, Karpatne, Kumar
Feature Subset Selection

 Another way to reduce dimensionality of data


 Redundant features
– Duplicate much or all of the information contained in
one or more other attributes
– Example: purchase price of a product and the amount
of sales tax paid
 Irrelevant features
– Contain no information that is useful for the data
mining task at hand
– Example: students' ID is often irrelevant to the task of
predicting students' GPA
 Many techniques developed, especially for
classification
01/27/2021 Introduction to Data Mining, 2nd Edition 84
Tan, Steinbach, Karpatne, Kumar
Feature Creation

 Create new attributes that can capture the


important information in a data set much more
efficiently than the original attributes

 Three general methodologies:


– Feature extraction
 Example: extracting edges from images
– Feature construction
 Example: dividing mass by volume to get density
– Mapping data to new space
 Example: Fourier and wavelet analysis

01/27/2021 Introduction to Data Mining, 2nd Edition 85


Tan, Steinbach, Karpatne, Kumar
Mapping Data to a New Space

 Fourier and wavelet transform

Frequency

Two Sine Waves + Noise Frequency

01/27/2021 Introduction to Data Mining, 2nd Edition 86


Tan, Steinbach, Karpatne, Kumar

You might also like