0% found this document useful (0 votes)
73 views44 pages

Genetics 1

The document provides an introduction to genetics including: 1. Genetic material is located in the nucleus and stored as DNA, which contains all the information needed to build an individual. 2. A gene is a sequence of DNA nucleotides that contains the information to specify an amino acid sequence of a polypeptide chain. A single DNA molecule contains many genes. 3. Mutations can alter DNA sequences and be passed down, sometimes causing inherited genetic diseases.

Uploaded by

Sam Mumo
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
73 views44 pages

Genetics 1

The document provides an introduction to genetics including: 1. Genetic material is located in the nucleus and stored as DNA, which contains all the information needed to build an individual. 2. A gene is a sequence of DNA nucleotides that contains the information to specify an amino acid sequence of a polypeptide chain. A single DNA molecule contains many genes. 3. Mutations can alter DNA sequences and be passed down, sometimes causing inherited genetic diseases.

Uploaded by

Sam Mumo
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd
You are on page 1/ 44

Introduction to

genetics
MWANGI KJ
Genetic material is located to the nucleus

The genetic information is


stored in Deoxyribonucleic
acid (DNA)
DNA contains all the
information needed to build
an individual
Chromosome

Condenced scaffold

fibers connected to
chromosome scaffold

chromatin fibers

chromatin

DNA
Nucleosome
Gene

oA sequence of DNA nucleotides containing the information that


specifies the amino acid sequence of a single polypeptide chain.
oA gene is thus a unit of hereditary information.
oA single molecule of DNA contains many genes.
Genome
oThe total genetic information coded in the DNA of a typical cell in
an organism
oThe human genome contains between 50,000 -100,000 genes
oThis information required for producing 50,000 - 100,000 different
proteins.
.
What is DNA needed for?

• Genetic information
is used for gene expression
• Information of a gene is
transferred from DNA and
converted to protein
• RNA molecules work as
messangers
• Proteins are the biological workers
Information of the DNA is copied
by directing the synthesis of a
RNA molecule
in a process called transcription

• RNA directs the protein


synthesis in a translation

• Protein’s 3D structure
determines it’s function

• Information can transfer only in


one direction
Protein synthesis
The genetic language
oIt is similar in principle to a written language
oIts consists of a set of symbols, such as A, B, C, D, that form an alphabet.
oThe letters are arranged in specific sequences to form words
oThe words are arranged in linear sequences to form sentences.
oThe genetic language contains only 4 letters, corresponding to the bases A, G, C, and T.
oThe genetic words are 3-base sequences that specify particular a.a that is, each word in the genetic language is
only 3 letters long.
o This is termed a triplet code.
oThe sequence of 3-letter code words (triplets) along a gene in a single strand of DNA specifies the sequence of
a.a in a polypeptide chain.
oThus, a gene is equivalent to a sentence, the genetic information in the human genome is equivalent to a book
containing 50,000 to 100,000 sentences.
DNA (Deoxyribo Nucleic Acid)
• DNA is a polymer of nucleotide monomers
• 2’-deoxyribose sugar Base part
• Four bases:
• Adenine, A
• Guanine, G
• Thymine, T
• Cytosine, C
• Together a sugar and
a base are called
a nucleoside
Sugar part
Four bases...
Purine bases Pyrimidine bases
Adenine and guanine Thymine and cytosine
Two carbon rings A single carbon ring
DNA chains
Nucleosides are joiden together
with phospsodiesteri bond

Sequence of bases vary 


genetic information

Chains are extremely long!


DNA Molecules
DNA molecules are
composed of two
polynucleotide chains

Double helix, twisted


in right handed way

Twists a full circle in


every 10 bases
• ”ladder-structure”
– Bases = steps
– Sugars and phosphates =
suporting pilars

• Two nucleotide chains


run in opposite
directions  chemical
direction
Complementary Pairing

Bases interact with other bases


◦ Purines with two carbon rings interact only with single ring
pyrimidines  Space between the chains is limited.
◦ AT
◦ GC
◦ Complementary pairing  Vital for retainins of the genetic
information!

• Interaction is stabilized by hydrogen


bonds
• A-T bond  two hydrogen bonds
• G-C bond  three hydrogen bonds
The Genetic Code
Describes how base sequences are converted to protein
sequence
DNA sequence is divided into series of units of three bases
 a codon
One codon is spesific to one amino acid ( structural
component of protein)
The four bases can form 64
codons

20 amino acids are found


from the nature

Codons hava also


alternative functions needed
to regulate protein synthesis
• Right reading frame is
obligatory!!!
• Sequence of human HCR gene, which assosiates with psoriasis

atgtttccac cttcaggttc cactgggctg attcccccct cccactttca agctcggccc


ctttcaactc tgccaagaat ggctcccacc tggctctcag acattcccct ggtccaaccc

• Many different reading frames can be used, but only one is the right one
• Transleate tools can found form the internet The right one
Frame 1
Met F P P S G S T G L I P P S H F Q A R P L S T L P R Met A P T W L S D I
PLVQ
 
Frame 2
C F H L Q V P L G Stop F P P P T F K L G P F Q L C Q E W L P P G S Q T F
PWSN
 
Frame 1
G L D Q G N V Stop E P G G S H S W Q S Stop K G P S L K V G G G N Q
P S G T Stop R W K H
Mutations
• Mutations are alterations in DNA sequence

• Many chemical and physiological agents


and errors in DNA replication

• Cells can repaire some mistakes

• Once introduced and not repaired,


changes in DNA sequence are
made permanent by DNA replication
Sequence variations:
Single nucleotide polymorphims:

Alteration of a single base 

1. Causes an alteration in the amino acid


that the codon codes

2. Does not cause alteration on the amino


acid that the codon codes

3. Alters codon in the way that it becomes


stop-codon for protein synthesis
• Frameshift mutation: insertion/deletion
of bases  reading frame is alterered
The Human genome...

• 3 billion base pairs

• about 30000 genes

• 23 chromosome pares  46 chromosomes

• 25 % of the DNA is gene related

• Only 5 % encodes proteins

• Genes include exons and introns

• Beside coding areas also additional secuences are found


Two important terms...

Phenotype: The outlook of an organism

Genotype: The genetic information written in the DNA

Phenotypes

Genotype Genotype

GCCAAGAATGGCTCCCACCT
ATGTTTCCACCTTCAGGTTCC
GGCTCTCAGACATTCCCCTG
ACTGGGCTGATTCCCCCCTCC
GTCCAACCCCCAGGCCATCA
CACTTTCAAGCTCGGCCCCTT
AGATGTCTCAGAGAGGCGGC
TCAACTCAGAGAGGCGGCTA
TAGACACCCAGAGACCTCAA
GACACCCAGAGACCTCAAGT
GTGACCATGTGGGAACGGGA
GACCATGTGGGAACGGGATG
TGTTTCCAGTGACAGGCA
TTTCCAGTGACAGGCAG
Passing on the genetic information:

• Information passed on in the sexual reproduction


• Needed for new characteristics to develope
Humans

• 46 chromosomes ( 44 autosomes, 2 sex chromosomes)

• X and Y –chromosomes

• XX  female

• XY  Male
The chromosome pare:

• A locus
• An allele
• Heterozygous (Aa)
• Homozygous (AA or aa)
• We have two copies of each gene, one from the mother
and one from the father  Genotype

• Dominant character: only one allele needed to cause the


phenotype (heterozygous)

• Recessive character: both allels needed to cause the


phenotype (homozygous)
Inherited diseases
• DNA mutations are significant in development of diseases

• Inherited diseases are caused by mutations passed from


a parent to a offspring

• Monogenic diseases: disease is caused by mutation in


one gene

• Multifactioria diseases: disease is caused by co-operative


action of different mutations in different genes and
environmental factors
• Mendelian inheritance: Presence or absence depends
of the genotype at the single locus
Genotypes Phenotypes
At each locus (except for sex chromosomes)
there are 2 genes. These constitute the
individual’s genotype at the locus.

The expression of a genotype is termed a


phenotype. For example, hair color, weight, or
the presence or absence of a disease.

33
Genotypes Phenotypes (example)

genotypes

phenotypes

Eb- dominant allele.


Ew- recessive allele.

34
Dominant vs. Recessive
• A dominant allele is
expressed even if it is
paired with a
recessive allele.

• A recessive allele is
only visible when
paired with another
recessive allele.

35
Medical Genetics
When studying rare disorders, 6 general patterns
of inheritance are observed:

Autosomal recessive
Autosomal dominant
X-linked recessive
X-linked dominant
Codominant
Mitochondrial

36
Medical Genetics (cont.)
Autosomal recessive
The disease appears
in male and female
children of
unaffected parents.
e.g., cystic fibrosis

37
Medical Genetics (cont.)
Autosomal dominant
Affected males and females
appear in each generation of
the pedigree.
Affected mothers and
fathers transmit the
phenotype to both sons and
daughters.
e.g., Huntington disease.

38
Medical Genetics (cont.)
X-linked recessive
Many more males than females
show the disorder.
All the daughters of an
affected male are “carriers”.
None of the sons of an
affected male show the
disorder or are carriers.
e.g., hemophilia

39
Medical Genetics (cont.)
X-linked dominant
Affected males pass the
disorder to all daughters but
to none of their sons.
Affected heterozygous
females married to unaffected
males pass the condition to
half their sons and daughters
e.g. fragile X syndrome

40
Medical Genetics (cont.)
Codominant inheritance

Two different versions


(alleles) of a gene can be
expressed, and each version
makes a slightly different
protein
Both alleles influence the
genetic trait or determine the
characteristics of the genetic
condition.
E.g. ABO locus

41
Medical Genetics (cont.)
Mitochondrial inheritance
This type of inheritance
applies to genes in
mitochondrial DNA
Mitochondrial disorders can
appear in every generation of a
family and can affect both
males and females, but fathers
do not pass mitochondrial
traits to their children.
E.g. Leber's hereditary optic
neuropathy (LHON)

42
Notes
Cystic fibrosis – disease affecting the mucus lining of the
lungs, leading to breathing problems and other difficulties
Huntington disease - or Huntington's chorea is an inherited
disorder characterized by abnormal body movements called
chorea, and loss of memory. There also is evidence that doctors as
far back as the Middle Ages knew of this devastating disease. The
incidence is 5 to 8 per 100,000. It takes its name from the New
York physician George Huntington who first described it precisely in
1872.

43
Notes
Hemophilia-illness that impair the body's ability to
control bleeding.
Fragile X syndrome - is a genetic condition that
causes a range of developmental problems including
learning disabilities and mental retardation. Usually males
are more severely affected by this disorder than females.
In addition to learning difficulties, affected males tend to
be restless, fidgety, and inattentive. Affected males also
have characteristic physical features that become more
apparent with age.

44

You might also like