Scribd
Upload
193 views23 pages

Multiple Sequence Alignment: Sumbitted To: DR - Navneet Choudhary

Uploaded by

Ankita Sharma

Multiple sequence alignment is used to compare three or more biological sequences like DNA, RNA or proteins. It identifies regions of similarity and divergence between sequences that may have a common evolutionary origin. Most programs use heuristic methods to find suboptimal but computationally efficient alignments rather than optimal alignments. Well-known tools for multiple sequence alignment include ClustalW, T-Coffee, MSA and programs that search conserved blocks databases like BLOCKS.

Copyright:

Attribution Non-Commercial (BY-NC)
Download as PPT, PDF, TXT or read online from Scribd
Download as ppt, pdf, or txt

Multiple Sequence Alignment: Sumbitted To: DR - Navneet Choudhary

Uploaded by

Ankita Sharma
193 views23 pages
Multiple sequence alignment is used to compare three or more biological sequences like DNA, RNA or proteins. It identifies regions of similarity and divergence between sequences that may have a common evolutionary origin. Most programs use heuristic methods to find suboptimal but computationally efficient alignments rather than optimal alignments. Well-known tools for multiple sequence alignment include ClustalW, T-Coffee, MSA and programs that search conserved blocks databases like BLOCKS.

Original Title

bioinformatics

Copyright

© Attribution Non-Commercial (BY-NC)

Available Formats

PPT, PDF, TXT or read online from Scribd

Did you find this document useful?

Is this content inappropriate?

Multiple sequence alignment is used to compare three or more biological sequences like DNA, RNA or proteins. It identifies regions of similarity and divergence between sequences that may have a common evolutionary origin. Most programs use heuristic methods to find suboptimal but computationally efficient alignments rather than optimal alignments. Well-known tools for multiple sequence alignment include ClustalW, T-Coffee, MSA and programs that search conserved blocks databases like BLOCKS.

Copyright:

Attribution Non-Commercial (BY-NC)
Download as PPT, PDF, TXT or read online from Scribd
Download as ppt, pdf, or txt
193 views23 pages

Multiple Sequence Alignment: Sumbitted To: DR - Navneet Choudhary

Uploaded by

Ankita Sharma
Multiple sequence alignment is used to compare three or more biological sequences like DNA, RNA or proteins. It identifies regions of similarity and divergence between sequences that may have a common evolutionary origin. Most programs use heuristic methods to find suboptimal but computationally efficient alignments rather than optimal alignments. Well-known tools for multiple sequence alignment include ClustalW, T-Coffee, MSA and programs that search conserved blocks databases like BLOCKS.

Copyright:

Attribution Non-Commercial (BY-NC)
Download as PPT, PDF, TXT or read online from Scribd
Download as ppt, pdf, or txt
You are on page 1/ 23

Multiple sequence alignment

Sumbitted to: Submitted by:


Ramesh Bishnoi
Dr.Navneet Choudhary
Nikita jain
What is Multiple Sequence
Alignment
• A sequence alignment of three or more biological sequences, generally
protein, DNA, or RNA.
• The input set of query sequences are assumed to have an evolutionary
relationship by which they share a lineage and are descended from a
common ancestor.
• Used to assess sequence conservation of protein domains, tertiary and
secondary structures, and even individual amino acids or nucleotides.
• Most multiple sequence alignment programs use heuristic methods rather
than global optimization because identifying the optimal alignment
between more than a few sequences of moderate length is prohibitively
computationally expensive.
An example of Multiple Alignment

VTISCTGSSSNIGAG-NHVKWYQQLPG
VTISCTGTSSNIGS--ITVNWYQQLPG
LRLSCSSSGFIFSS--YAMYWVRQAPG
LSLTCTVSGTSFDD--YYSTWVRQPPG
PEVTCVVVDVSHEDPQVKFNWYVDG--
ATLVCLISDFYPGA--VTVAWKADS--
AALGCLVKDYFPEP--VTVSWNSG---
VSLTCLVKGFYPSD--IAVEWWSNG--
Goals of Multiple Sequence
Alignment-
1. To generate a concise, information rich summary of sequence data.

2. Used to illustrate the dissimilarity between a group of sequences.

3. Alignments can be treated as models that can be used to treat hypothesis.

4. Use in phylogenetics -Multiple sequence alignments can be used to


create a phylogenetic tree.

5. Used to identify functionally important sites, such as binding sites, active


sites, or sites corresponding to other key functions, by locating conserved
domains.

 
Why we do multiple alignments?
1. Simple sequence comparison
2. Conserved vs. non-conserved regions

1. proteins - motifs/profiles

2. whole genome - genes, control regions

3. Homology (as opposed to similarity)

1. Evolution - phylogeny

2. Structural homology
4. Sequence differences
1. Single Nucleotide Polymorphisms (SNPs)

5. Help prediction of the secondary and tertiary structures of new sequences;


6. Preliminary step in molecular evolution analysis using Phylogenetic methods
for constructing phylogenetic trees.
Multiple Alignment Method
• The most practical and widely used method in multiple
sequence alignment is the hierarchical extensions of pairwise
alignment methods.

• The principal is that multiple alignments is achieved by


successive application of pairwise methods.
Multiple Alignment Method
• The steps are summarized as follows:

• Compare all sequences pairwise.

• Perform cluster analysis on the pairwise data to generate a hierarchy for


alignment. This may be in the form of a binary tree or a simple ordering

• Build the multiple alignment by first aligning the most similar pair of
sequences, then the next most similar pair and so on. Once an alignment of
two sequences has been made, then this is fixed. Thus for a set of sequences
A, B, C, D having aligned A with C and B with D the alignment of A, B, C, D
is obtained by comparing the alignments of A and C with that of B and D
using averaged scores at each aligned position.
Steps in Multiple Alignment
 
Multiple Sequence Alignment
Tools
• BLOCKS : HMM profile library
• CDD: Conserved domain database
• Interpro: A unified resource combining PROSITE, PRINTS, ProDom
And Pfam
• iProClass database :From the Protein Information Resource
• Pfam: Profile HMM library
• ClustalW: general purpose multiple sequence alignment program
• DIALIGN: local MSA
• MultAlin :Multiple sequence alignment with hierarchical clustering
• MSA: Multiple Sequence Alignment
• PileUp: general multiple sequence alignment program
• SAGA and COFFEE: Cedric Notredame's work .
ClustalW- for multiple alignment
• ClustaW is a general purpose multiple alignment program for DNA or
proteins.
• ClustalW is produced by Julie D. Thompson, Toby Gibson of European
Molecular Biology Laboratory, Germany and Desmond Higgins of European
Bioinformatics Institute, Cambridge, UK. Algorithmic

• ClustalW is cited: improving the sensitivity of progressive multiple sequence


alignment through sequence weighting, positions-specific gap penalties and
weight matrix choice.
• ClustalW can create multiple alignments, manipulate existing alignments, do
profile analysis and create phylogentic trees.

• Alignment can be done by 2 methods:


– - slow/accurate
– - fast/approximate
•
Running ClustalW
[~]% clustalw

**************************************************************
******** CLUSTAL W (1.7) Multiple Sequence Alignments ********
**************************************************************

1. Sequence Input From Disc


2. Multiple Alignments
3. Profile / Structure Alignments
4. Phylogenetic trees

S. Execute a system command


H. HELP
X. EXIT (leave program)

Your choice:
Running ClustalW

The input file for clustalW is a file containing all


sequences in one of the following formats:

•NBRF/PIR,
EMBL/SwissProt,
• Pearson (Fasta),
•GDE,
•Clustal,
•GCG/MSF,
• RSF.
Output of ClustalW
CLUSTAL W (1.7) multiple sequence alignment

HSTNFR GGGAAGAG---TTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAG------GCAG
SYNTNFTRP GGGAAGAG---TTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAG------GCAG
CFTNFA -------------------------------------------TGTCCAG------ACAG
CATTNFAA GGGAAGAG---CTCCCACATGGCCTGCAACTAATCAACCCTCTGCCCCAG------ACAC
RABTNFM AGGAGGAAGAGTCCCCAAACAACCTCCATCTAGTCAACCCTGTGGCCCAGATGGTCACCC
RNTNFAA AGGAGGAGAAGTTCCCAAATGGGCTCCCTCTCATCAGTTCCATGGCCCAGACCCTCACAC
OATNFA1 GGGAAGAGCAGTCCCCAGCTGGCCCCTCCTTCAACAGGCCTCTGGTTCAG------ACAC
OATNFAR GGGAAGAGCAGTCCCCAGCTGGCCCCTCCTTCAACAGGCCTCTGGTTCAG------ACAC
BSPTNFA GGGAAGAGCAGTCCCCAGGTGGCCCCTCCATCAACAGCCCTCTGGTTCAA------ACAC
CEU14683 GGGAAGAGCAATCCCCAACTGGCCTCTCCATCAACAGCCCTCTGGTTCAG------ACCC
** *
Blocks database and tools
• Blocks are multiply aligned ungapped segments corresponding
to the most highly conserved regions of proteins.

• The Blocks web server tools are : Block Searcher, Get Blocks
and Block Maker. These are aids to detection and verification
of protein sequence homology.

• They compare a protein or DNA sequence to a database of


protein blocks, retrieve blocks, and create new
blocks,respectively.
The BLOCKS web server
At URL: http://blocks.fhcrc.org/

The BLOCKS WWW server can be used to create blocks of a group


of sequences, or to compare a protein sequence to a database of
blocks.

The Blocks Searcher tool should be used for multiple alignment of


distantly related protein sequences.
The Blocks Searcher tool
• For searching a database of blocks, the first position of the
sequence is aligned with the first position of the first block, and
a score for that amino acid is obtained from the profile column
corresponding to that position. Scores are summed over the
width of the alignment, and then the block is aligned with the
next position.
• This procedure is carried out exhaustively for all positions of
the sequence for all blocks in the database, and the best
alignments between a sequence and entries in the BLOCKS
database are noted. If a particular block scores highly, it is
possible that the sequence is related to the group of sequences
the block represents.
The Blocks Searcher tool
• Typically, a group of proteins has more than one region in
common and their relationship is represented as a series
of blocks separated by unaligned regions. If a second
block for a group also scores highly in the search, the
evidence that the sequence is related to the group is
strengthened, and is further strengthened if a third block
also scores it highly, and so on.
The BLOCKS Database
The blocks for the BLOCKS database are made
automatically by looking for the most highly
conserved regions in groups of proteins represented
in the PROSITE database. These blocks are then
calibrated against the SWISS-PROT database to
obtain a measure of the chance distribution of
matches. It is these calibrated blocks that make up
the BLOCKS database.
The Block Maker Tool
• Block Maker finds conserved blocks in a group of
two or more unaligned protein sequences, which are
assumed to be related, using two different algorithms.
• Input file must contain at least 2 sequences.
• Input sequences must be in FastA format.
• Results are returned by e-mail.
T-Coffee-

• It allows the combination of a collection of


multiple/pairwise, global or local alignments into a
single model
• Pairwise global alignment
• Pairwise local alignment
• Combined above two into a library
• Builds MSA with highest consistency with the library of
alignments (progressive assembly)
T-Coffee
DiAlign-
• It constructs pairwise and multiple alignments by
comparing whole segments of the sequences.
• Alignment of whole segments and not individual amino
acids (bases)
• Pair wise comparison > segment pairs (diagonals),
represent local alignments
• Diagonals weighted for likelihood
• Alignment built from consistent diagonals
• No gap penalties
• Independent of sequence order
Fig: DiAlign

You might also like