0% found this document useful (0 votes)
25 views90 pages

Lecture 08 - Dynamic Programming

A very good lecture on dynamic programming
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
25 views90 pages

Lecture 08 - Dynamic Programming

A very good lecture on dynamic programming
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd
You are on page 1/ 90

Dynamic Programming

Dynamic Programming
• Dynamic programming, like the divide-and-conquer method, solves
problems by combining the solutions to sub-problems.
• “Programming” in this context refers to a tabular method, not to
writing computer code.
• We typically apply dynamic programming to optimization problems
• Many possible solutions. Each solution has a value, and we wish to
find a solution with the optimal (minimum or maximum) value.
Dynamic Programming
• When developing a dynamic-programming algorithm, we follow a
sequence of four steps:
1. Characterize the structure of an optimal solution.
2. Recursively define the value of an optimal solution.
3. Compute the value of an optimal solution, typically in a bottom-up fashion.
4. Construct an optimal solution from computed information.
• If we need only the value of an optimal solution, and not the solution
itself, then we can omit step 4.
Knapsack problem
Given some items, pack the knapsack to get
the maximum total value. Each item has some
weight and some value. Total weight that we can
carry is no more than some fixed number W.
So we must consider weights of items as well as
their values.

Item # Weight Value


1 1 8
2 3 6
3 5 5
Knapsack problem
There are two versions of the problem:
1. “0-1 knapsack problem”
• Items are indivisible; you either take an item or not. Some
special instances can be solved with dynamic programming

2. “Fractional knapsack problem”


• Items are divisible: you can take any fraction of an item
0-1 Knapsack problem
• Given a knapsack with maximum capacity W, and a set S consisting of
n items
• Each item i has some weight wi and benefit value bi (all wi and W are
integer values)
• Problem: How to pack the knapsack to achieve maximum total value
of packed items?
0-1 Knapsack problem
• Problem, in other words, is to find
max  bi subject to w i W
iT iT

 The problem is called a “0-1” problem,


because each item must be entirely
accepted or rejected.
0-1 Knapsack problem: brute-force approach
Let’s first solve this problem with a
straightforward algorithm
• Since there are n items, there are 2n possible
combinations of items.
• We go through all combinations and find the one
with maximum value and with total weight less or
equal to W
• Running time will be O(2n)
0-1 Knapsack problem:
dynamic programming approach
• We can do better with an algorithm based on
dynamic programming

• We need to carefully identify the subproblems


Defining a Subproblem

• Given a knapsack with maximum capacity W, and a set S consisting of


n items
• Each item i has some weight wi and benefit value bi (all wi and W are
integer values)
• Problem: How to pack the knapsack to achieve maximum total value
of packed items?
Defining a Subproblem
• We can do better with an algorithm based on
dynamic programming

• We need to carefully identify the subproblems

Let’s try this:


If items are labeled 1..n, then a subproblem
would be to find an optimal solution for
Sk = {items labeled 1, 2, .. k}
Defining a Subproblem
If items are labeled 1..n, then a subproblem would
be to find an optimal solution for Sk = {items
labeled 1, 2, .. k}

• This is a reasonable subproblem definition.


• The question is: can we describe the final solution
(Sn ) in terms of subproblems (Sk)?
• Unfortunately, we can’t do that.
Defining a Subproblem
w1 =2 w2 =4 w3 =5 w4 =3 Weight Benefit
b1 =3 b2 =5 b3 =8 b4 =4
Item wi bi
? #
1 2 3
Max weight: W = 20 S4
For S4: 2 4 5
S5
Total weight: 14 3 5 8
Maximum benefit: 20 4 3 4
5 9 10
w1 =2 w2 =4 w3 =5 w5 =9
b1 =3 b2 =5 b3 =8 b5 =10

For S5:
Solution for S4 is
Total weight: 20 not part of the
Maximum benefit: 26 solution for S !!!
Defining a Subproblem
• As we have seen, the solution for S4 is not part of the
solution for S5

• So our definition of a subproblem is flawed and we


need another one!
Defining a Subproblem
• Given a knapsack with maximum capacity W, and a set S consisting of
n items
• Each item i has some weight wi and benefit value bi (all wi and W are
integer values)
• Problem: How to pack the knapsack to achieve maximum total value
of packed items?
Defining a Subproblem
• Let’s add another parameter: w, which will represent
the maximum weight for each subset of items

• The subproblem then will be to compute V[k,w], i.e.,


to find an optimal solution for Sk = {items labeled 1,
2, .. k} in a knapsack of size w
Recursive Formula for subproblems
• The subproblem will then be to compute V[k,w], i.e.,
to find an optimal solution for Sk = {items labeled 1,
2, .. k} in a knapsack of size w

• Assuming knowing V[i, j], where i=0,1, 2, … k-1,


j=0,1,2, …w, how to derive V[k,w]?
Recursive Formula for subproblems
(continued)
Recursive formula for subproblems:
 V [k  1, w] if wk  w
V [ k , w]  
max{V [k  1, w],V [k  1, w  wk ]  bk } else

It means, that the best subset of Sk that has total


weight w is:
1) the best subset of Sk-1 that has total weight  w, or
2) the best subset of Sk-1 that has total weight  w-wk plus
the item k
Recursive Formula
 V [k  1, w] if wk  w
V [ k , w]  
max{V [k  1, w],V [k  1, w  wk ]  bk } else

• The best subset of Sk that has the total weight  w,


either contains item k or not.
• First case: wk>w. Item k can’t be part of the solution,
since if it was, the total weight would be > w, which is
unacceptable.
• Second case: wk  w. Then the item k can be in the
solution, and we choose the case with greater value.
0-1 Knapsack Algorithm
for w = 0 to W
V[0,w] = 0
for i = 1 to n
V[i,0] = 0
for i = 1 to n
for w = 0 to W
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
Running time
for w = 0 to W
O(W)
V[0,w] = 0
for i = 1 to n
V[i,0] = 0
for i = 1 to n Repeat n times
for w = 0 to W O(W)
< the rest of the code >
What is the running time of this
algorithm?
O(n*W)
Remember that the brute-force algorithm
takes O(2n)
Example

Let’s run our algorithm on the


following data:

n = 4 (# of elements)
W = 5 (max weight)
Elements (weight, benefit):
(2,3), (3,4), (4,5), (5,6)
Example (2)
i\W 0 1 2 3 4 5
0 0 0 0 0 0 0
1
2
3
4

for w = 0 to W
V[0,w] = 0
Example (3)
i\W 0 1 2 3 4 5
0 0 0 0 0 0 0
1 0
2 0
3 0
4 0

for i = 1 to n
V[i,0] = 0
Items:
1: (2,3)
Example (4) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=1 4: (5,6)
0 0 0 0 0 0 0
bi=3
1 0 0
wi=2
2 0
3 0 w=1
4 0 w-wi =-1
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
Items:
1: (2,3)
Example (5) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=1 4: (5,6)
0 0 0 0 0 0 0
bi=3
1 0 0 3
wi=2
2 0
3 0 w=2
4 0 w-wi =0
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
Items:
1: (2,3)
Example (6) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=1 4: (5,6)
0 0 0 0 0 0 0
bi=3
1 0 0 3 3
wi=2
2 0
3 0 w=3
4 0 w-wi =1
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
Items:
1: (2,3)
Example (7) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=1 4: (5,6)
0 0 0 0 0 0 0
bi=3
1 0 0 3 3 3
wi=2
2 0
3 0 w=4
4 0 w-wi =2
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
Items:
1: (2,3)
Example (8) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=1 4: (5,6)
0 0 0 0 0 0 0
bi=3
1 0 0 3 3 3 3
wi=2
2 0
3 0 w=5
4 0 w-wi =3
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
Items:
1: (2,3)
Example (9) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=2 4: (5,6)
0 0 0 0 0 0 0
bi=4
1 0 0 3 3 3 3
wi=3
2 0 0
3 0 w=1
4 0 w-wi =-2
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
Items:
1: (2,3)
Example (10) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=2 4: (5,6)
0 0 0 0 0 0 0
bi=4
1 0 0 3 3 3 3
wi=3
2 0 0 3
3 0 w=2
4 0 w-wi =-1
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
Items:
1: (2,3)
Example (11) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=2 4: (5,6)
0 0 0 0 0 0 0
bi=4
1 0 0 3 3 3 3
wi=3
2 0 0 3 4
3 0 w=3
4 0 w-wi =0
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
Items:
1: (2,3)
Example (12) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=2 4: (5,6)
0 0 0 0 0 0 0
bi=4
1 0 0 3 3 3 3
wi=3
2 0 0 3 4 4
3 0 w=4
4 0 w-wi =1
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
Items:
1: (2,3)
Example (13) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=2 4: (5,6)
0 0 0 0 0 0 0
bi=4
1 0 0 3 3 3 3
wi=3
2 0 0 3 4 4 7
3 0 w=5
4 0 w-wi =2
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
Items:
1: (2,3)
Example (14) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=3 4: (5,6)
0 0 0 0 0 0 0
bi=5
1 0 0 3 3 3 3
wi=4
2 0 0 3 4 4 7
3 0 0 3 4 w= 1..3
4 0
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
Items:
1: (2,3)
Example (15) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=3 4: (5,6)
0 0 0 0 0 0 0
bi=5
1 0 0 3 3 3 3
wi=4
2 0 0 3 4 4 7
3 0 0 3 4 5 w= 4
4 0 w- wi=0
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
Items:
1: (2,3)
Example (16) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=3 4: (5,6)
0 0 0 0 0 0 0
bi=5
1 0 0 3 3 3 3
wi=4
2 0 0 3 4 4 7
3 0 0 3 4 5 7 w= 5
4 0 w- wi=1
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
Items:
1: (2,3)
Example (17) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=4 4: (5,6)
0 0 0 0 0 0 0
bi=6
1 0 0 3 3 3 3
wi=5
2 0 0 3 4 4 7
3 0 0 3 4 5 7 w= 1..4
4 0 0 3 4 5
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
Items:
1: (2,3)
Example (18) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=4 4: (5,6)
0 0 0 0 0 0 0
bi=6
1 0 0 3 3 3 3
wi=5
2 0 0 3 4 4 7
3 0 0 3 4 5 7 w= 5
4 0 0 3 4 5 7 w- wi=0
if wi <= w // item i can be part of the solution
if bi + V[i-1,w-wi] > V[i-1,w]
V[i,w] = bi + V[i-1,w- wi]
else
V[i,w] = V[i-1,w]
else V[i,w] = V[i-1,w] // wi > w
How to find actual Knapsack Items
• All of the information we need is in the table.
• V[n,W] is the maximal value of items that can be
placed in the Knapsack.
• Let i=n and k=W
if V[i,k]  V[i1,k] then
mark the ith item as in the knapsack
i = i1, k = k-wi
else
i = i1 // Assume the ith item is not in the knapsack
// Could it be in the optimally packed
knapsack?
Items:
1: (2,3)
Finding the Items 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=4 4: (5,6)
0 0 0 0 0 0 0 k= 5
1 0 0 3 3 3 3 bi=6
2 0 0 3 4 4 7 wi=5
3 0 0 3 4 5 7 V[i,k] = 7
4 0 0 3 4 5 7 V[i1,k] =7
i=n, k=W
while i,k > 0
if V[i,k]  V[i1,k] then
mark the ith item as in the knapsack
i = i1, k = k-wi
else
i = i1
Items:
1: (2,3)
Finding the Items (2) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=4 4: (5,6)
0 0 0 0 0 0 0 k= 5
1 0 0 3 3 3 3 bi=6
2 0 0 3 4 4 7 wi=5
3 0 0 3 4 5 7 V[i,k] = 7
4 0 0 3 4 5 7 V[i1,k] =7
i=n, k=W
while i,k > 0
if V[i,k]  V[i1,k] then
mark the ith item as in the knapsack
i = i1, k = k-wi
else
i = i1
Items:
1: (2,3)
Finding the Items (3) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=3 4: (5,6)
0 0 0 0 0 0 0 k= 5
1 0 0 3 3 3 3 bi=5
2 0 0 3 4 4 7 wi=4
3 0 0 3 4 5 7 V[i,k] = 7
4 0 0 3 4 5 7 V[i1,k] =7
i=n, k=W
while i,k > 0
if V[i,k]  V[i1,k] then
mark the ith item as in the knapsack
i = i1, k = k-wi
else
i = i1
Items:
1: (2,3)
Finding the Items (4) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=2 4: (5,6)
0 0 0 0 0 0 0 k= 5
1 0 0 3 3 3 3 bi=4
2 0 0 3 4 4 7 wi=3
3 0 0 3 4 5 7 V[i,k] = 7
4 0 0 3 4 5 7 V[i1,k] =3
i=n, k=W
k  wi=2
while i,k > 0
if V[i,k]  V[i1,k] then
mark the ith item as in the knapsack
i = i1, k = k-wi
else
i = i1
Items:
1: (2,3)
Finding the Items (5) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=1 4: (5,6)
0 0 0 0 0 0 0 k= 2
1 0 0 3 3 3 3 bi=3
2 0 0 3 4 4 7 wi=2
3 0 0 3 4 5 7 V[i,k] = 3
4 0 0 3 4 5 7 V[i1,k] =0
i=n, k=W
k  wi=0
while i,k > 0
if V[i,k]  V[i1,k] then
mark the ith item as in the knapsack
i = i1, k = k-wi
else
i = i1
Items:
1: (2,3)
Finding the Items (6) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 i=0 4: (5,6)
0 0 0 0 0 0 0 k= 0
1 0 0 3 3 3 3
2 0 0 3 4 4 7
3 0 0 3 4 5 7 The optimal
knapsack
4 0 0 3 4 5 7
should contain
i=n, k=W {1, 2}
while i,k > 0
if V[i,k]  V[i1,k] then
mark the nth item as in the knapsack
i = i1, k = k-wi
else
i = i1
Items:
1: (2,3)
Finding the Items (7) 2: (3,4)
3: (4,5)
i\W 0 1 2 3 4 5 4: (5,6)
0 0 0 0 0 0 0
1 0 0 3 3 3 3
2 0 0 3 4 4 7
3 0 0 3 4 5 7 The optimal
knapsack
4 0 0 3 4 5 7
should contain
i=n, k=W {1, 2}
while i,k > 0
if V[i,k]  V[i1,k] then
mark the nth item as in the knapsack
i = i1, k = k-wi
else
i = i1
Memorization (Memory Function Method)

• Goal:
• Solve only subproblems that are necessary and solve it only once
• Memorization is another way to deal with overlapping subproblems
in dynamic programming
• With memorization, we implement the algorithm recursively:
• If we encounter a new subproblem, we compute and store the solution.
• If we encounter a subproblem we have seen, we look up the answer
• Most useful when the algorithm is easiest to implement recursively
• Especially if we do not need solutions to all subproblems.
0-1 Knapsack Memory Function Algorithm

for i = 1 to n MFKnapsack(i, w)
for w = 1 to W if V[i,w] < 0
V[i,w] = -1 if w < wi
value = MFKnapsack(i-1, w)
for w = 0 to W else
V[0,w] = 0 value = max(MFKnapsack(i-1, w),
for i = 1 to n bi + MFKnapsack(i-1, w-wi))
V[i,0] = 0 V[i,w] = value
return V[i,w]
Matrix-chain multiplication
• We are given a sequence (chain) (A1,A2,…,An) of n matrices to be
multiplied, and we wish to compute the product

A1*A2*….*An
• We can solve this by using the standard algorithm for multiplying pairs
of matrices as a subroutine once we have parenthesized it to resolve
all ambiguities in how the matrices are multiplied together.
• A product of matrices is fully parenthesized if it is either a single
matrix or the product of two fully parenthesized matrix products,
surrounded by parentheses.
Matrix-chain multiplication
• If we have four matrices A1, A2, A3, A4 , then:
Standard Algorithm for Multiplication
Order of Multiplication
• Suppose we have 3 Matrices A1, A2, A3 of sizes 10 x 100, 100 x 5, and 5
x 50 respectively
• We have two options ((A1, A2), A3) and (A1, (A2, A3))
• For option 1 we will do 10*100*5 = 5000 + 10*5*50 = 2500 => 7,500
operations
• For option 2 we will do 100*5*50 = 25,000 + 10*100*50 = 50,000 =>
75,000 operations
• Option 1 is 10 times faster than option 2
matrix-chain multiplication problem
• Given a chain (A1,A2,…,An) of n matrices, where for i = 1,2,…,n, matrix
Ai has dimension pi-1 x pi , fully parenthesize the product A1A2 … An in
a way that minimizes the number of scalar multiplications.

Counting the number of parenthesizations


Applying dynamic programming
• Recall
1. Characterize the structure of an optimal solution.
2. Recursively define the value of an optimal solution.
3. Compute the value of an optimal solution, typically in a bottom-up fashion.
4. Construct an optimal solution from computed information.
Step 1: The structure of an optimal parenthesization

• Let us use the notation Ai..j for the matrix that results from the
product Ai Ai+1 … Aj
• An optimal parenthesization of the product A1A2…An splits the
product between Ak and Ak+1 for some integer k where1 ≤ k < n
• First compute matrices A1..k and Ak+1..n ; then multiply them to get
the final matrix A1..n
• Example, k = 4 (A1A2A3A4)(A5A6)
Total cost of A1..6 = cost of A1..4 plus total
cost of multiplying these two matrices
together.
Step 1: The structure of an optimal parenthesization

• Key observation: parenthesizations of the subchains A1A2…Ak and


Ak+1Ak+2…An must also be optimal if the parenthesization of the chain
A1A2…An is optimal (why?)

• That is, the optimal solution to the problem contains within it the
optimal solution to subproblems
• We must ensure that when we search for the correct place to split the
product, we have considered all possible places, so that we are sure
of having examined the optimal one.
Step 1: The structure of an optimal parenthesization
Step 2: A recursive solution
• we define the cost of an optimal solution recursively in terms of the
optimal solutions to subproblems.
• We have to find the minimum cost for finding Ai Ai+1 … Aj for 1 <= i <= j <= n.
• Let m[i, j] be the minimum number of scalar multiplications necessary
to compute Ai..j
• Minimum cost to compute A1..n is m[1, n]
• Suppose the optimal parenthesization of Ai..j splits the product
between Ak and Ak+1 for some integer k where i ≤ k < j
Step 2: A recursive solution
• We can define m[i, j] recursively as follows. If i = j , the problem is
trivial;
• To compute m[i, j] for i < j, we observe
• Ai..j = (Ai Ai+1…Ak)·(Ak+1Ak+2…Aj)= Ai..k · Ak+1..j
• Cost of computing Ai..j = cost of computing Ai..k + cost of computing Ak+1..j + cost
of multiplying Ai..k and Ak+1..j
• Cost of multiplying Ai..k and Ak+1..j is pi-1pk pj
m[i, j ] = m[i, k] + m[k+1, j ] + pi-1pk pj for i ≤ k < j
• m[i, i ] = 0 for i=1,2,…,n
Step 2: A recursive solution
• But… optimal parenthesization occurs at one value of k among all
possible i ≤ k < j
• Check all these and select the best one

0 if i=j
m[i, j ] =
min {m[i, k] + m[k+1, j ] + pi-1pk pj } if i<j
i ≤ k< j
• To keep track of how to construct an optimal solution, we use a
table s
• s[i, j ] = value of k at which Ai Ai+1 … Aj is split for optimal
parenthesization
Step 3: Computing the optimal costs
Input: Array p[0…n] containing matrix dimensions and n
Result: Minimum-cost table m and split table s

MATRIX-CHAIN-ORDER(p[ ], n)
for i ← 1 to n Takes O(n3) time
m[i, i] ← 0
for l ← 2 to n Requires O(n2) space
for i ← 1 to n-l+1
j ← i+l-1
m[i, j] ← 
for k ← i to j-1
q ← m[i, k] + m[k+1, j] + p[i-1] p[k] p[j]
if q < m[i, j]
m[i, j] ← q
s[i, j] ← k
Step 3: Computing the optimal costs
•Computing the optimal costs
• How much subproblems in total?
• One for each choice of i and j satisfying 1 ≤ i ≤ j ≤ n

• Θ(n2)

• MATRIX-CHAIN-ORDER(p)
• Input: a sequence p = < p0, p1, p2,…, pn> (length[p] = n+1)
• Try to fill in the table m in a manner that corresponds to solving the parenthesization
problem on matrix chains of increasing length
• Lines 4-12: compute m[i, i+1], m[i, i+2], … each time
Step 3: Computing the optimal costs
Step 3: Computing the optimal costs
Step 3: Computing the optimal costs
Step 4: Constructing an optimal solution

• Constructing an optimal solution


• Each entry s[i, j] records the value of k such that the optimal
parenthesization of AiAi+1…Aj splits the product between Ak and
Ak+1

• A1..n →A1..s[1..n] As[1..n]+1..n


• A1..s[1..n] →A1..s[1, s[1..n]] As[1, s[1..n]]+1..s[1..n]
• Recursive…
Step 4: Constructing an optimal solution

• Constructing an optimal
solution

• A1 A2 A3 A4 A5
A6
Matrix Chain Multiply

Algorithm Matrix-Chain-Multiply(A, s, i, j)

if j > i then
x = Matrix-Chain-Multiply(A, s, i, s[i, j)
y = Matrix-Chain-Multiply(A, s, s[i, j]+1, j)
return (x, y)
else
return Ai
Optimal binary search trees
• Given sequence K = k1, k2, . . . , kn of n distinct keys, sorted (k1 < k2 < · ·
· < kn).
• Want to build a binary search tree from the keys.
• For ki , have probability pi that a search is for ki .
• Want BST with minimum expected search cost.
Optimal binary search trees: Example
Example
Optimal substructure
Optimal substructure (1)
Recursive solution
Recursive solution (1)
Computing an optimal solution
Computing an optimal solution(1)
Computing an optimal solution(2)
Computing an optimal solution(3)
Construct an optimal solution
Longest common subsequence
• Biological applications often need to compare the DNA of two (or more)
different organisms.
• A strand of DNA consists of a string of molecules called bases, where the
possible bases are adenine, guanine, cytosine, and thymine. Representing
each of these bases by its initial letter, we can express a strand of DNA as
a string over the finite set {A; C; G; T}.
• For example, the DNA of one organism may be
S1 = ACCGGTCGAGTGCGCGGAAGCCGGCCGAA,
and the DNA of another organism may be
S2 = GTCGTTCGGAATGCCGTTGCTCTGTAAA.
GTCGTCGGAAGCCGGCCGAA.
Longest common subsequence
• Formally, given a sequence X = {x1; x2; : : : ;xm}, another sequence Z =
{z1, z2, …. , zk} is a subsequence of X if there exists a strictly increasing
sequence {i1, i2, … ,ik} of indices of X such that for all j = 1,2,…,k, we
have xij = zj .
• For example, Z = {B; C; D; B} is a subsequence of X = {A; B;C; B;D;A;B}
with corresponding index sequence {2; 3; 5; 7}.
• Given two sequences X and Y , we say that a sequence Z is a common
subsequence of X and Y if Z is a subsequence of both X and Y .
Longest common subsequence (LCS) is {B, C, B, A}
longest-common-subsequence problem
• we are given two sequences X = {x1; x2; : : : ; xm} and Y = {y1; y2; : : : ; yn}
and wish to find a maximum length common subsequence of X and Y .
Step 1: Characterizing a longest common subsequence

To be precise, given a sequence X = {x1; x2; : : : ;xm}, we define the ith prefix of X, for i = { 0;
1; : : : ;m} as Xi = {x1; x2; : : : ; xi }.
For example, if X = {A; B; C; B; D; A; B}, then X4 = {A;B;C;B} and X0 is the empty
sequence.
Step 2: A recursive solution
• We can readily see the overlapping-subproblems property in the LCS
problem.
• To find an LCS of X and Y , we may need to find the LCSs of X and Yn-1
and of Xm-1 and Y . But each of these subproblems has the
subsubproblem of finding an LCS of Xm-1 and Yn-1. Many other
subproblems share subsubproblems.
Step 3: Computing the length of an LCS
• Procedure LCS-LENGTH takes two sequences X = {x1; x2; : : : ; xm} and Y
= {y1;y2; : : : ;yn} as inputs. It stores the c[I, j] values in a table c[0..m 0.. n],
• It computes the entries in row-major order.
• The procedure also maintains the table b[1 .. m 1 … n] to help us
construct an optimal solution.
Step 3: Computing the length of an LCS
Step 3: Computing the length of an LCS
Step 4: Constructing an LCS

You might also like