Bio PPT
Bio PPT
Hard Answer-
Computational techniques for
management and analysis of
biological data and knowledge.
Why Learn Bioinformatics?
Bioinformatics provides a set of tools that is essential
in modern biomedical research (or other research
using biological molecules).
And also ….
Basic Science Motivation
-Sequence alignment.
-Protien structure alignment.
-Protien structure prediction.
-Prediction of gene expression.
-Protein-protein interactions.
-Finding evolutionary relationship.
Primary sequence databases :
EMBL (European Molecular Biology Laboratory nucleotide
sequence database at EBI, Hinxton, UK)
GenBank (at National Center for Biotechnology information,
NCBI, Bethesda, MD, USA)
DDBJ (DNA Data Bank Japan at CIB , Mishima, Japan).
3D structure databases :
PDB (Protein Data Bank cured by RCSB, USA)
EBI-MSD (Macromolecular Structure Database at EBI, UK )
NDB (Nucleic Acid structure Datatabase at Rutgers State
University of New Jersey , USA)
Protein sequence databases :
>U54469
CGGGGGCGGGTCGGGGGGGGAAAAATCCCCCTCT
GGCCCCCCCCCCCCTTCTGGGTGGTCAACGT
-Flatfiles can be seperated into three major parts: