Journal Reading – Imunologi

Edwin Darmawan
Moderator: Dr. dr. Hani Susianti, Sp.PK(K)
Introduction
 Systemic lupus erythematosus
(SLE) is a common autoimmune disease,
which is characterized by the
 abnormal activation of self-reactive T and B cells
 production of self antibodies and immune complex

 Lead to irreversible damage to organ systems.

 Several diagnostic criteria have been made for SLE
diagnosis in clinical and played certain significant roles in
SLE treatment and diagnosis, but the results for SLE
diagnosis still remain unsatisfactory due to the diversity
and hidden characteristics, serology indexes, and
complicate pathogen mechanism.
 Therefore, it will be of great significance to
investigate the mechanism for SLE treatment.
 Previous viewpoint shows that B-cell activation in SLE
patients is mainly assisted by T cells, but recent reports
indicate that B-cell activation in SLE development
depends on the activation of Toll-like receptors (TLRs)
pathway instead of T cell.
TLR9
 Member of the TLR family
 Plays a fundamental role in pathogen recognition and
activation of innate immunity
 Several TLR members play certain roles in SLE
progression and pathogen, including TLR9 and TLR7.
 Ligands for TLR9 are some non methylate or low
methylate DpG DNAs and play certain recognition
roles in endoplasmic reticulum, which is different from
other receptors .
 many TLRs-induced cytokines play crucial toxic actions in
the development of SLE, and the combination of TLR9 and
ligand could activate variety of immune cells to produce
cytokines.
 E.g. when pDC from female B6 129F2 rats was stimulated by
HSV-2 DNA, IFN-𝛼 secreted by TLE9−/− cell was significantly
declined compared with that in wild type rats.
 mRNA expression of TLR9 in active stage
SLE is high, as well as the IL-10 level in SLE
PBMCs, which suggests the correlation
between TLR9 level and IL-10 expression
in SLE.
 Although many studies have been devoted
to the mechanism exploration of TLRs in
SLE development or diagnosis, roles of
TLR9 in clinical SLE diagnosis still remain
controversial.
Study Aim:
 comprehensive experimental methods to
detect the expression of TLR9 and to
analyze the correlation between TLR9
expression and cytokines secretion level
in SLE patients.
↓
 may provide basis for TLR9 application in
the clinical diagnosis and treatment for
SLE.
Materials and Methods
Patients and Samples
 Third Xiangya Hospital Central South University
 39 patients diagnosed as SLE (diagnosed based on the ACR 1997
revised criteria)
 At least 2 years of follow-up
 Healthy persons were included according to the normal physical
examination standard in this hospital.
Ethical Clearance
 All the experimental procedures in this
study were approved by the ethics
committee from the Third Xiangya
Hospital Central SouthUniversity, and
informed consent and approval of
patients were obtained from all the
enrolled patients
 SLE tissue samples were collected at the time of
surgery, snap-frozen in liquid nitrogen, and then stored at
−80∘C.
 For peripheral blood B-cell isolation, 5mL of
peripheral blood was labeled with 50 𝜇L of anti-human
CD20 antibody supplemented with colloidal paramagnetic
microbeads (Miltenyi Bio, Germany).
 Isolated B cells with purity of >95% were assessed by
flow cytometry.
Real-Time- (RT-) PCR Analysis.
 TLR9 mRNA expression in B cells from SLE patients or
healthy persons was detected
 Briefly, B cells isolated from different human skin tissues
were grinded in cell lysis buffer and then washed with PBS
buffer for 3 times.
 Total RNA from B cells was extracted using Trizol
extraction reagent(Invitrogen, USA) according to
manufacturer’s protocol, and then RNase-free Dnase I
(Sangon, Shanghai, China)was added to mixtures to
remove DNA.
 The concentration and purity of isolated RNA were
measured using SMA4000UV-VIS (Merinton, Shanghai,
China) at the wavelength of 260 nm.
 The purified RNA (0.5 𝜇g/𝜇L) was used for
cDNAsynthesis with the Primer Script 1st Strand cDNA
Synthesis Kit (Invitrogen, USA).
 Expressions of mRNAs were detected using SYBR green-
based quantitative RT-PCR (Invitrogen, USA).
 The total reaction system (20 𝜇L volume) containing1 𝜇L
cDNA from the above PCR, 10𝜇L SYBR Premix EX Taq, 1
𝜇L each of the primers (10𝜇M), and 7 𝜇L ddH2O.
 PCR reaction was carried out at 50∘C for 2min and 95∘C
for 10min followed by 40 cycles of 95∘C for 15s and 60∘C
for 1 min.
 Melting curve analysis of amplification products was
performed at the end of each PCR to confirm that only one
product was amplified and detected. In addition, 𝛽-actin was
chosen as the internal control.
Primers used for targets amplification were shown as follows:
 TLR9 sense primer:5‘-ATGGGTTTCTGCCGC-3‘
 antisense primer: 5‘-GGACGCCGTAGAGAAG-3‘
 Foxp3 sense primer: “CTCAAGCACTGCCAGGCGGAC”
 antisense primer: “CAGCGGATGAGCGTGGCGTAGG”
 𝛽-actin sense primer: 5’-GGACTTCGAGCAAGAGATG-3‘
 antisense primer: 5‘- ACATGCGGTTGTGTCACGA-3‘

 In addition, TLR9 antibody(Invitrogen, USA) was labeled with

fluorescein isothiocyanate(FITC), and CD20 antibody labeled
B cells were used to determine the expression of TLR9 in B
cells as previously described.
Enzyme-Linked Immune Sorbent Assay
(ELISA).
 10 mL of peripheral blood isolated from SLE
patients and healthy donors was centrifuged at
12,000 rpm at 4∘C to obtain serum.
 Serum anti-ds-DNA antibody and serum IL-6
were detected using ELISA kit (RD, USA)
 Pretreated microtitre plates were coated with
50 𝜇g/mL of calf thymus dsDNA (Sigma, USA)
for 2 h at 37∘C and then placed overnight at
4∘C.
 After that, plates were washed with PBS buffer
containing 0.05% Tween-20 (PBST) for three
times and then blocked with 5% goat serum in
PBST for 1 h.
 Then serum samples (diluted at 1 : 100 in
PBST containing 10% calf serum and 5%
goat serum) were incubated with
horseradish peroxidase- (HRP-)
conjugated goat anti-mouse IgG (Sigma,
USA) for 2 h at 37∘C.
 Finally, reaction was blocked with 2N
H2SO4 and absorbance was measured
using a microplate reader (BioRad) at 492
nm.
Correlation Analysis between TLR9 Expression and
Cytokines.
 siRNA-TLR9 (Invitrogen, USA) plasma was transfected
into CD20+ labeled B cells for 24 h. B cells transfected
with scrambled siRNA plasma were considered as the
controls. Total RNA was isolated from the B cells in each
group based on the Trizol extraction reagent (Invitrogen,
USA) according to manufacturer’s protocol.
B-Cell Stimulation In Vitro.
 B cells were stimulated in vitro with CpG 2006
oligonucleotide (CpG) (TIB Mol-Biol Synthese Labor
GmbH, Berlin, Germany).
 The cells were resuspended in RPMI 1640 Glutamax
supplemented with 10% FBS, 5% penicillin/streptomycin,
and 0.05mM 2-mercaptoethanol (Gibco Life Technologies
GmbH, Darmstadt, Germany).
 B cells at 1 × 105 were seeded and stimulated with 2.5
𝜇g/mL CpG for 48 h at 37∘C.
 After 2 days of culture, the supernatants were harvested
and frozen at −70∘C prior to analysis.
 Consequently, relative TLR9 mRNA expression in B cells
transfected with siRNA-TLR9 plasma was measured based
on the RT-PCR analysis which was described in the above
method.
 Primers used for silencing TLR:
 sense primer: 5‘-GAAAGCATCAACCACACCAA-3‘,
 antisense primer: 5‘-ACAAGTCCACAAAGCGAAGG-3‘.
 PCR was conducted using the protocol of 30 cycles of 94∘C
for 30 s, 56∘C for 30s, and 72∘C for 30 s. D-Glyceraldehyde-
3- phosphate dehydrogenase (GADPH) was used as internal
control.
 Additionally, expressions of IL-6 and ds-DNA antibody in B
cells transfected with siRNA-tlr9 were detected using ELISA
Statistical Analysis.
 All experiments were conducted three times
independently in this study.
 The total presented data were firstly tested for the
normal distribution using one sample 𝐾-𝑆 test and were
expressed as mean ― standard error of mean (SEM).
 Difference of the data was analyzed using the graph prism
5.0 software (GraphPad Prism, San Diego, CA).
 Independent sample 𝑡-test was used to calculate the
difference between two groups.
 ANOVA (analysis of variance) was used to calculate the
difference for more than 3 groups.
 𝑃 < 0.05 was considered as statistically significant.
Results
Expression of TLR9 in B Cell from SLE Patients.
 RTPCR analysis was used to detect the expression level of
TLR9 in B cells from SLE patients (Figure 1).
 TLR9 mRNA level in SLE patients was significantly increased
compared with that in healthy patients (𝑃 < 0.05, Figures 1(a)
and 1(b)).
 Additionally, flow cytometry analysis indicated that TLR9
level in CD20+ B cells from SLE patients was significantly
higher than that s in control B cells (𝑃 < 0.05, Figures 1(c)
and 1(d)).
IL-6 and ds-DNA Antibody Assay in SLE Patients.
 Th2 cytokines such as IL-6 and IL-10 have been
demonstrated to be involved in SLE development .
 Flow cytometry was used to assess the correlation between
TLR9 expression and cytokines secretion in B cells isolated
from SLE patients (Figure 2).
 Compared with the controls, IL-6 expression and ds-DNA
antibody level in SLE patients were significantly increased (𝑃
< 0.05, Figures 2(a) and 2(b)).
 However, when we analyzed the correlations between TLR9
expression and IL-6 and ds-DNA antibody levels in SLE
patients, the results showed that TLR9 over expression was
positively correlated to IL-6 or ds-DNA antibody level
during SLE development (for IL-6, 𝑅 2 = 0.768, for ds-DNA,
𝑅2 = 0.730, Figures 2(c) and 2(d)).
Correlation between Silencing TLR9 and Cytokine
Expression In Vitro.
 After being transfected with siRNA-TLR9 vector, TLR9
expression in SLE-isolated B cells was significantly declined
compared with that in positive and negative controls (𝑃 <
0.05, Figure 3(a)).
 Expressions of IL-6 and ds-DNA produced by B cells were
also analyzed based on the RT-PCR;
 Results showed that IL-6 and ds-DNA levels in siRNA-TLR9
group were both significantly declined compared with the
controls (𝑃 < 0.05, Figures 3(b) and 3(c)), indicating that
silencing TLR9 may be positively correlated with IL-6 and ds-
DNA levels in B cells.
Secretion of Cytokines Induced by TLR9 in B Cells.
 We further analyzed the cytokines including IL-6, IL-10, and
IL-1r𝛼 levels for the identification of TLR9 expression on
other cytokines secretion in SLE-isolated B cells (Figure 4).
 After being stimulated by CpG, secretion levels of IL-6, IL-10,
and IL-1r𝛼 were all significantly increased compared to the
control (Blank group; 𝑃 < 0.05).

 Since TLR9 is the specific recognized receptor for DNA

CpG in SLE cells, the results further showed that levels of
the three factors were significantly decreased by the silenced
TLR9 (𝑃 < 0.05), which suggests that silencing TLR9 was
negatively correlated with the three-factor secretion in CpG
stimulated B cells.
TLR9 Downstream Proteins Expression.
 TheTLR9 downstream signal-related proteins expression
including Foxp3 and ICOS was measured to further analyze
the mechanism (Figure 5).
 Compared to the controls, relative mRNA levels of Foxp3
and ICOS (inducible co stimulator) were both significantly
decreased by the silenced TLR9 in vitro B cells, suggesting
that silenced TLR9 may lead to the down regulation of
pathway signals of Foxp3 and ICOS.
Discussion
 Previous articles have reported the
potential roles of TLR9 in SLE of animal
body’s development and progression;
however, the results remain controversial.
 In this study, we used siRNA mediated
gene method to investigate the
correlation of TLR9 expression cytokines
secretion in SLE isolated in B cells.
 In agreement with former study, our data showed that
TLR9 mRNA expression was higher in SLE patients than
that in healthy persons (𝑃 < 0.05).
 Moreover, we firstly discovered that there was significant
correlation between TLR9 expression and cytokines level
including IL-6 and ds- DNA (𝑃 < 0.01).
 Furthermore, silencing TLR9 significantly decreased the
secretion of IL-6, IL-10, and IL-1r𝛼 in SLE isolated B cells,
as well as the pathway-associated protein expression,
including Foxp3 and ICOS.
 Foregoing evidences have shown that TLR9 was involved
in SLE through several manners such as mediating Bcell
activation, mediating DC cells activation, and inducing
cytokines secretion.

 For example, with the addition of IL-2 and IL-10 in CD27

labeled B cells, TLR9 expression in initial B cells was
declined compared with that in memory B cells, which
indicated the immune role of TLR9 in B-cell response .
 Paper showed that that the structure change of
dendritic cells (DC) may result in self-reactive B cells
in SLE, and Means et al. described that TLR9 mRNA
level was significantly increased when DC cells were
stimulated by autoantibody-DNA complexes isolated
from human SLE serum.
 Also, TLR9 was correlated to induce cytokines
production including TNF-𝛼 and IL-10 involved in SLE
through activating pDC. All of these evidences
showed that TLR9was involved inmaintaining the
tolerance of B cell to SLE antibody and played a
protective role for SLE patients.
 In this study, secretions of IL-6 and ds-DNA antibody
levels were declined by silencing TLR9, indicating that
TLR9 expression was positively correlated to IL-6 and ds-
DNA antibody secretion in B cells from SLE patients.
 IL-6 plays pivotal roles in inflammation and the maturation
of B cells and has been proved to be closely related to
SLE development and progression, while ds-DNA
antibody is a specific index for SLE diagnosis.
 Influences of TLR9 expression on IL-6 and
ds-DNA antibody levels in SLE have not
been fully described.
 However, anti-ds-DNA antibody level was
positively correlated with SLE disease
activity, and radioimmunoassay had shown
that anti-ds-DNA antibody in SLE
patients at active stage was significantly
high compared with that in SLE at resting
stage.
 On the other side, IL-6 mRNA level was high in
SLE patients serum and can act as a biomarker in
SLE development .
 Based on our data, we speculated that TLR9 expression
was positively correlated to SLE pathogen, and TLR9
expression could induce the B-cell secreted IL-6 and ds-
DNA antibody to SLE serum.
 Therefore,TLR9 smay be a biomarker in SLE
diagnosis.
 Subsequently, our study showed that ICOS and Foxp3
expressions were decreased by silencing TLR9 in B cells,
suggesting that silencing TLR9 was negatively correlated ICOS
and Foxp3 expressions in B cells.
 ICOS is a CD28 and CTLA-4 cell-surface receptor family
protein, which functions in immunodeficiency biological
processes.
 ICOS was overexpressed in peripheral blood from SLE
patients and performed certain significant influence on Th2
type cytokine secretion, such as IL-10 and IL-4 [33].
 It has been said that Foxp3 plays significant roles in SLE
pathogen through being involved in the Treg cells at the
transcriptional level.
 Based on our data, we speculated that silencing TLR9 may be
involved in SLE via down regulating the ICOS and Foxp3 signal
pathway.
 Meanwhile, Capolunghi and his colleagues have
successfully blocked the self-antibodies produced in B
cells fromSLE patients using TLR9 inhibitor.
 Contrary to Capolunghi’s study, we used gene
silenced method to investigate the associations
between TLR9 expression and SLE development in
human patients.
 Besides, Chen had demonstrated the understanding
of TLR9 immune recognition in SLE development
through gene knockdown method in SLE mice model.
 However, our study has successfully illustrated the
immune role of TLR9 in human SLE B cells using gene
silenced method.
Conclusion
 The data presented in this study suggests that TLR9 may
play pivotal roles in SLE diagnosis through positively
correlating with IL-6 and ds-DNA antibody secretion via
being involved in the ICOS and Foxp3 signal pathway.
 The successful application of silencing TLR9 in human SLE
B cells may loan theatrical basis for the possibility of TLR9
genetic therapy in SLE diagnosis and treatment.
 However, further studies are still needed to explore the
deep mechanism.
 CRITICAL
APPRAISAL
CRITICAL APPRAISAL
VALIDITY - Methods
1. Was a defined representative sample of patients
assembled at a common point in the course of their disease?
YES

2. Was follow up of study patients sufficiently long and

complete? YES

3. Were objective outcome criteria applied in a ‘blind’

fashion? YES
 CRITICAL APPRAISAL
IMPORTANCY – Results
Expression of TLR9 in B Cell from SLE Patients. (𝑃 < 0.05)
IL-6 and ds-DNA Antibody Assay in SLE Patients. (𝑃 < 0.05)
TLR9 over expression was positively correlated to IL-6 or ds-DNA
antibody level during SLE development (for IL-6, 𝑅 2 = 0.768, for ds-DNA, 𝑅2
= 0.730
TLR9 expression in SLE-isolated B cells was significantly declined
compared with that in positive and negative controls (𝑃 < 0.05)
Silencing TLR9 may be positively correlated with IL-6 and ds-DNA
levels in B cells. Significantly declined compared with the controls (𝑃 <
0.05)
After being stimulated by CpG, secretion levels of IL-6, IL-10, and IL-1r𝛼 were
all significantly increased compared to the control (Blank group; 𝑃 <
0.05)
Compared to the controls, relative mRNA levels of Foxp3 and ICOS
CRITICAL APPRAISAL

APPLICABILITY – Discussion
 1. Is our patient so different from those in the study
that its results cannot apply? No

 2. Will this evidence make a clinically important impact

on our conclusions about what to offer or tell our
patient?
THANK
YOU