Molecules of Life

Organic Molecules Biological Molecules

Diverse living organisms share common chemical features. Birds, beasts, plants, and soil microorganisms share with humans the same basic structural units (cells) and the same kinds of macromolecules (DNA, RNA, proteins) made up of the same kinds of monomeric subunits (nucleotides, amino acids). They utilize the same pathways for synthesis of cellular components, share the same genetic code.

Ecosystem

Rain forest, desert, fresh water lake, digestive tract of animal for bacteria All species in an ecosystem All individuals of a single species One single individual

Includes all living organisms and non living matter such as air, water and minerals

Community Population Organism

Only includes living things from bacteria, to fungi, to plant to animal Includes only individuals from a specific species such as a plant, an animal, a bacterial colony Serves as a representative of the species and describes overall form and function of an organism

Organ
Tissue Cell

A specialized structural system of an organism

A specialized substructure of an organ A single cell

The brain or the thymus of an animal

The nervous tissue and epithelial tissue are both part of the brain A neuron, a skin cell, a root cell, bacteria, yeast, paramecium

Molecule

A single large or small molecule such as a protein, DNA, sugar or fatty acid

Molecules are the smallest part of biological systems; they can be studied for their chemical, physical properties, but are of particular interest for their usefulness in biological systems.

Organic Molecules
Why is this important? Cells are mostly water and carbon-based molecules Carbon has a valence of 4 so it will form a tremendous variety of large, complex and diverse molecules Large variety of molecules = diversity of life

Unity in Diversity
All life is composed of carbon compounds (Unity) Diversity of life is due to various ways carbon can be assembled Organic chemistry = study of the compounds formed by carbon

Organic Chemistry
The four valence electrons in carbon enable it to be bonded in four different directions Usually forms COVALENT bonds with Hydrogen Often oxygen, nitrogen Four most common elements are: CHON

Hydrocarbons

ISOMER

 Functional groups
groups of atoms that have properties/role on the molecule OH hydroxide (polar) NH2 amino (polar) COOH carboxyl (polar) CH3 methyl (nonpolar)

Ethane

Functional group
Ethanol

Organic Chemistry
Biochemistry - chemistry of living things
Functional groups change the chemical properties/function of a molecule
The great diversity of life is caused by only a few molecules with different arrangements of functional groups

The rearrangement of FUNCTIONAL GROUPS on a molecule causes major changes in the molecules function

Composition of Cells
C, H, N, O, S & P make up >99% of cellular weight
Percent of Total Cell Weight Water Inorganic ions Sugars & precursors Amino acids & precursors Nucleotides & precursors Lipids & precursors Other small molecules Macromolecules (proteins, acids & polysachharides) nucleic 70 1 3 0.4 0.4 2 0.2 22 Number of Types of Each Molecule 1 20 200 100 200 50 ~200 ~5000

Biochemistry
Four basic carbon molecules important to all living things:

Carbohydrates Lipids Proteins Nucleic acids

Biochemistry
The four basic molecules are long chains of smaller molecules linked together A house made up of various parts e.g. Garage, Living room, Bed room, Kitchen, etc.

Biochemistry
Smaller molecules are called MONOMERS Long chains are called

POLYMERS
Polymers are large molecules MACROMOLECULES large polymer

What are the objectives:

For each of the 4 types of molecules:

1. The types and names of the monomers 2. The role of each molecule in life

How Are Organic Compounds Formed?

Monomers = smaller functional molecules
that can be linked together

Macromolecule = large molecule Polymers = macromolecules formed by

linking monomers together

Polymerization
Many monomers are linked together to form macromolecules

Dehydration synthesis

How Are Organic Compounds Formed?

Dehydration synthesis OH- combines with OHfrom adjacent monomer OH + OH = HOH + O HOH = H2O All four compounds important to life are formed by dehydration synthesis

Macromolecules dehydration synthesis

Monomers/Polymers
Hydrolysis - breaking down polymers into monomers

Monomers Monosaccharides Fatty acids Amino acids Nucleotides

Polymer Formed Di & Polysaccharides Triglycerides Proteins Nucleic acids

4 Types of Macromolecules Carbohydrates

Lipids Proteins Nucleic acids

Carbohydrates
Carbon, hydrogen, oxygen C(n)H2O
C6H12O6 glucose C6H12O6 - fructose C5H10O5 - ribose C12H22O11 sucrose

Carbohydrates
Sugars; three types: Monosaccharides one sugar Disaccharides two sugar Oligosaccharides few sugar Polysaccharides many sugar

Carbohydrates Monomers
Simple sugars Monosaccharides one sweet Glucose, fructose, ribose, deoxyribose, galactose

Carbohydrates: Monomers
Glucose; #1 sugar, most used sugar for energy in most organisms Fructose; very sweet (fruits) Most monosaccharides are used as a source of

energy
Ribose and deoxyribose form part of the structure of DNA, RNA

Di-saccharides
Di = two Two monosaccharides joined together by DEHYDRATION SYNTHESIS Energy storage Glucose + glucose = maltose; germinating seeds, malt in beer Glucose + fructose = sucrose; table sugar Galactose + glucose = lactose; milk

Oligosaccharides
few Short chains of monosaccharides on the outside of the cell membrane Cell-to-cell communication, identification

Polysaccharides
Poly = many Long chain of monosaccharides Starch Glycogen Cellulose

Polysaccharides
Examples:
_______ used to make cell walls of plants; indigestible without bacteria in gut; fiber ______ - cell walls of fungi; cells of arthropods ______ stored glucose in plants _______ stored glucose in animals

Types of Macromolecules
Carbohydrates

Lipids
Proteins Nucleic acids

Lipids
Three types of lipids: Triglycerides

Phospholipids Steroids

Fatty Acids
Un-branched carbon chains that make up most lipids Long chains with a carboxyl group attached at one end
--COOH

Two ends of the fatty acid molecule have different properties.

Triglycerides
Fats, Oils, Waxes Insoluble in water nonpolar Glycerol + three fatty acids Dehydration synthesis Lots of C-H bonds (energy)

Triglycerides
2 types of triglycerides: Saturated Unsaturated Saturated fats have no double bonds; are full (saturated) with hydrogen
Arteriosclerosis

Saturated fatty acid Saturated fatty

acids

Unsaturated fatty acid

Unsaturated fatty acid

Types of Fats
Saturated No double bonds Saturated w/ H Solids @ (200) Animal fats Bacon grease, lard, butter Unsaturated Double bond(s) Unsaturated Liquids @ (200) Plant fats (oil) Corn, peanut, olive oils

Waxes
Structural lipid consisting of a long fattyacid chain joined to a long alcohol chain Waterproof
In plants, they form a protective coating on the outer surfaces In animals, form protective layers
Whats the purpose of?

Fats: Functions
Store energy More energy in fats than in carbs; birds eat sunflower seeds first Padding (eye, other organs) Insulation (keep you warmer; seals, whales) Waterproofing - oils

Lipids - Phospholipids
Triglyceride - One of the fatty acid tails is replaced with a phosphate group Phospho lipid Major component of cell membrane

Fatty acids

Cell Membrane
Protects cellular components from diffusing into external environment

Membrane components may: be protective regulate transport in and out of cell or subcellular domain allow selective receptivity and signal transduction by providing transmembrane receptors that bind signaling molecules allow cell recognition provide anchoring sites for cytoskeletal filaments or components of the extracellular matrix. This allows the cell to maintain its shape and perhaps move to distant sites. help compartmentalize subcellular domains or microdomains provide a stable site for the binding and catalysis of enzymes. regulate the fusion of the membrane with other membranes in the cell via specialized junctions ) provide a passageway across the membrane for certain molecules, such as in gap junctions. allow directed cell or organelle motility

Steroids

General structure

Steroids
Cholesterol basic molecule used in cell membrane; also used to make other steroids (estrogen and testosterone)

Lipids: Steroids
Sex hormones:
Testosterone; male Estrogen; female

Lipids: Steroids
Anabolic steroids = artificially created testosterone Mimics male hormone Increased muscle mass Decreased sex drive, infertility Heart, liver problems

Lipids - Steroids
Anabolic steroids synthetic variations of testosterone Builds muscle and bone mass during puberty; maintains male characteristics Used in 1950s to treat anemia and muscle diseases Abused by athletes; linked to liver damage, cardiovascular, mood swings

Steroids
Insoluble in water (nonpolar) Very different from other lipids in structure 4 fused carbon rings with various FUNCTIONAL GROUPS

Proteins
Composed of AMINO ACIDS (monomers) 20 different amino acids Differences between the 20 amino acids are caused by different R (side) groups

Different amino acids caused by different side groups

Amino Acids
Amino acids are linked together by dehydration synthesis Bonds formed between amino acids are BONDS Long chain of peptides = polypeptide

PEPTIDE

 Amino acids are linked together in a specific sequence Conformational shape specific 3d shape of a protein If the sequence gets messed up, the protein may not function. May be fatal or only cause health problems Denaturation change in the conformational shape keeping the protein from functioning

Conformational Shape
H bonding helps determine shape Breaking the H bond changes the shape of the protein (denaturation) Heat - cooking changes the shape of proteins; turn brown; eggs turn white Poisons chemicals change shape by interrupting bonds (acids, bases, acetone)

Proteins - Functions
1. Structure feathers, hair, muscle, nail, horn

2. Enzymes speed up reactions 3. Hormones chemical messengers 4. Carriers hemoglobin carries oxygen to
cells

Enzymes
Speed up chemical reactions without being changed Reduce activation energy

Nucleic Acids
Monomers NUCLEOTIDES Nucleotides: A simple sugar A phosphate group A NITROGENOUS BASE

Nucleic Acids
Large and complex organic molecules Store and transfer important info in the cell
Info is important for the manufacturing of proteins

Two major types:

DNA (deoxyribonucleic acid) RNA (ribonucleic acid)
Can also act as enzymes

Adenine always bonds with Thymine

H bonding

Cytosine always bonds with guanine A-T C-G

ATTC C G CATG G GTCTTTT

TAA G G C G TA C C CA G AAAA

DNA sequence = genetic code

TACCATACTTTCGGCTACTTTTGGG ATGGTATGATATCCGATGATAACCC

TACCATACTATAGGCTACTATTGGG
If A-T and C-G, what is the complimentary strand?