Principle of Genetics,

Chromosomal Aberrations

AN: 75.1-75.5

Dr. Pretty Rathnakar

1
 Genetics
Genetics is the study of heredity, the process in which a parent passes
certain genes onto their children.

Children inherit their biological parent’s genes that express specific

traits, such as some physical characteristics, natural talents, and
genetic disorders.

2
 Genetic Concepts
• Heredity describes how some traits are passed from parents to their
children.

• The traits are expressed by genes, which are small sections of DNA
that are coded for specific traits.

• Genes are found on chromosomes.

• Humans have two sets of 23 chromosomes— one set from each

parent.

3
• Genetic material is located in the nucleus of Cell
• The genetic information is stored in
Deoxyribonucleic acid (DNA)
• DNA contains all the information needed to build
an individual

4
 Genes

• Genetic information is encoded in the base sequence of the

DNA
• A gene : DNA sequence that encodes amino acid sequence of
a protein
• Beside the coding area, also other elements are needed -
control elements and empty areas

5
 Two important terms...

Phenotype: The outlook of an organism

Genotype: The genetic information written in the DNA

Phenotypes

Genotype
Genotype
GCCAAGAATGGCTCCCACCT ATGTTTCCACCTTCAGGTTCC
GGCTCTCAGACATTCCCCTGG ACTGGGCTGATTCCCCCCTCC
TCCAACCCCCAGGCCATCAA CACTTTCAAGCTCGGCCCCTT
GATGTCTCAGAGAGGCGGCT TCAACTCAGAGAGGCGGCTA
AGACACCCAGAGACCTCAAGT GACACCCAGAGACCTCAAGT
GACCATGTGGGAACGGGATG GACCATGTGGGAACGGGATG
TTTCCAGTGACAGGCA TTTCCAGTGACAGGCAG

7
 Chromosomal Aberration
Normal chromosomal complement in males: 46,XY
Females :46,XX
Any deviation either in number or structure of chromosome :
Chromosomal aberration

• Diploid - normal chromosomal number in human beings : 2n

• Haploid - n=23. Found in gametes
Normal Female Karyotype – 46,XX
Normal Male Karyotype – 46,XY
 Chromosomal Aberrations
• Numerical or Structural.

• They are a very common cause of early spontaneous

miscarriage.

• Usually, but not always, cause multiple congenital

anomalies and learning difficulties.
 Chromosomal abnormalities
Trisomy
Aneuploidy
Tetrasomy
1. Numerical Triploidy
Polyploidy
Tetraploidy
Reciprocal
Translocations
Deletions Robertsonian
2. Structural
Insertions Paracentric
Inversions
Duplication Pericentric

Mosaicism
3. Different cell lines
(mixoploidy) Chimerism
20
 Numerical abnormalities

Numerical abnormalities involve the loss or gain of one or more

chromosomes, referred to as aneuploidy,
or the addition of one or more complete haploid complements, known
as polyploidy.
Loss of a single chromosome results in monosomy. In autosome –
Lethal
Gain of one or two homologous chromosomes is referred to as trisomy
or tetrasomy, respectively
Numerical Chromosomal abnormalities

• Meiotic I Nondisjunction

• Meiotic II Nondisjunction

• Mitotic I Nondisjunction

21
A pair of homologous
MEOSIS
chromosomes in a diploid
parent cell
 Disjunction

• The normal separation of chromosomes in meiosis I or

sister chromatids in meiosis II is termed disjunction.
 Nondisjunction
• Nondisjunction ("not coming apart") is the failure of chromosome pairs to
separate properly during meiosis stage 1 or stage 2.
• An error in meiosis I leads to the gamete containing both homologs of one
chromosome pair.
• Non- disjunction in meiosis II results in the gamete receiving two copies of
one of the homologs of the chromosome pair.

• The result of this error in a cell with an imbalance of chromosomes

(Aneuploid Cell)
• The cause of non-disjunction is uncertain.
• Aging effect on the primary oocyte, which can remain in a state of
suspended inactivity for up to 50 years.
Nondisjunction in Mitosis

16
 Nondisjunction
• Loss of a single chromosome (2n-1), in which the
daughter cell(s) with the defect will have one chromosome
missing from one of its pairs, is referred to as a monosomy.

• Gaining a single chromosome(2n+1), in which the

daughter cell(s) with the defect will have one chromosome
in addition to its pairs is referred to as a trisomy.
 Nondisjunction
This is a cause of several medical conditions in humans, including but not
limited to:
• Patau Syndrome - trisomy of chromosome 13
• Edward Syndrome - trisomy of chromosome 18
• Down Syndrome - trisomy of chromosome 21
• Turner Syndrome - lacking of one X chromosome in females - i.e. X0
• Triple X syndrome - an extra X chromosome in females
• Klinefelter Syndrome - extra X chromosomes in males
- i.e. XXY, XXXY, XXXXY, etc.
• XYY Syndrome - an extra Y chromosome in males.
 Polyploidy

Polyploid cells contain multiples of the haploid number of chromosomes

such as 69, triploidy, or 92, tetraploidy.
In humans, triploidy is found relatively often in material grown from
spontaneous miscarriages, but survival beyond mid-pregnancy is rare.
• Failure of a maturation meiotic division in an ovum or sperm,
leading, for example, to retention of a polar body or to the formation
of a diploid sperm.
• Fertilization of an ovum by two sperm: this is known as dispermy.
 Patau’s Syndrome
• Karyotype: 47,XX,+13. Trisomy 13

• Occurrence:
– Only 1 in 15,000 live births. (most aborted
naturally)

• Survival:
– Forty five percent die within the first month
– 90% by six months
– Less than 5% reach 3 years.
Patau’s Syndrome
Small head
Small or missing eyes
Heart defects
Polydactaly (Extra fingers)
Abnormal genitalia
Mentally retarded
Cleft palate
Most die before birth; some survive a few
weeks after birth
 Edward’s Syndrome

• This karyotype demonstrates trisomy 18

• 47,XY,+18

• Incidence is only 1 in 8000 live births

• It is uncommon for fetuses with this

condition to survive
 Edward’s Syndrome
• 30% of these children die within the first
month and only 10% survive one year.

• There is severe mental retardation.

• Other characteristics:
• hypertonia , prominent occiput ,receding jaw,
low set malformed ears
• a very narrow pelvis, rocker bottom feet.
 Edward’s Syndrome

• Internal organ abnormalities:

congenital heart defects : VSD,
diaphragmatic hernia, spina
bifida
 Down syndrome
• Langdon Down
• Incidence:

– 1/750 live births.

– Mothers in their early twenties have a risk of 1/1,500.

– Women over 35 have a risk factor of 1/70, which

jumps to 1/25 for women 45 and over.
• The non-disjunction rate increases with Mother’s age

• Trisomy 21 is one of the most common causes of mental

retardation (IQ between 25-74).
• An average person has an IQ between 90-110.
 Clinical Features
1) Mental retardation
• Moderate - severe range
• Manifested by delayed smiling, laughing &
recognition of mother .

2) Delayed motor development

(Hypotonia)
• Delayed head support, sitting & standing
 Clinical Features
3) Characteristic physical features
Head
• Flat occiput
• Upward slanting of palpebral fissure
• Epicanthal folds
• Flat nasal bridge
• Malformed ears
• Protruded tongue
Limbs
• Simian crease
• Wide gap between First and second toe
 Clinical Features
Associated congenital anomalies
1 - Congenital heart disease: (40% of cases)
Common atrioventricular canal or VSD
2- GIT anomalies: Duodenal atresia
3 - Renal anomalies
Complications
1 - Recurrent chest infections: due to hypotonia and
CHD
2 - Leukemia : 20 times commoner in trisomy 21.
Abnormal Male Karyotype – 47,XY,+21 (Down syndrome)
Abnormal nuchal thickening (NT)
 Nasal bone
Present

Courtesy: http://en.wikipedia.org/wiki/File
 Cytogenetics

95% - Trisomy 21
4% - Translocation t(14q 21q)
1%- 46/47 chromosomes – one cell line with 46 chromosome and
one with 47 – mosaisism
Chorionic villous sampling
Amniocentesis
 Turner syndrome
Cytogenetics: 45, XO, FEMALE
Incidence: 1/5000
Features
• Lymphedema of hands and feet in newborn
• Short stature
• Webbing of neck
• Wide carrying angle
• Gonadal dysgenesis (1ry amenorrhea)
• Renal anomalies and cardiac anomalies
 Turner syndrome
(Gonadal Dysgenesis)
At Birth .. Edema of dorsum of hand & feet
.. Webbing of neck.
Childhood period
- Short stature
- Head .. Low posterior hairline
- Neck .. Webbing of the neck
- Chest .. Broad chest & wide spaced
nipples
- Limbs .. Cubitus valgus
 Turner syndrome
Adolescence
- Failure of development of secondary sexual characters
- 1ry amenorrhea (streaked ovary)
- Normal mentality, Some learning disability
Associated anomalies & complications:
1 Cardiac anomalies: Bicuspid aortic valve – AS -
coarctation of aorta
2 Renal anomalies: Horseshoe kidney
Turner Syndrome, webbed neck
Turner Syndrome, webbed neck
Turner Syndrome, Lymphedema
45,X – Turner Syndrome
 Klinefelter syndrome
Cytogenetics : 47,XXY, MALE
Incidence: 1/1000
Features
• Hypogonadism with small testes
• Gynecomastia
• Tall stature (tall legs)
• Infertility (most common presentation)
• A common but not a serious disease, which may
benefit from testosterone therapy
Klinefelter syndrome
Abnormal Male Karyotype – 47,XXY (Klinefelter syndrome)
mos 48,XXXY[16]/49,XXXXY[4]
TETRAPLOIDY
 Chromosomal abnormalities
Trisomy
Aneuploidy
Tetrasomy
1. Numerical Triploidy
Polyploidy
Tetraploidy
Reciprocal
Translocations
Deletions Robertsonian
2. Structural
Insertions Paracentric
Inversions
Duplication Pericentric

Mosaicism
3. Different cell lines
(mixoploidy) Chimerism
20
 Structural aberrations

Structural rearrangements in chromosomes – breaks followed by

reconstitution
• Chemical agents or viruses
• Classification :

1. Stable : Deletions , inversions , translocations ,isochromosomes

2. Unstable : Dicentric , ring chromosomes

They can occur during the formation of an egg or sperm cells, in early
foetal development or in any cell after birth.
Structural Chromosomal abnormalities

Translocation Deletion Inversion

Isochromosome

Insertion Ring
chromosome
69
• Balanced rearrangements have an increased risk of history of infertility ,
multiple miscarriages or children affected with unbalanced structural or
numerical chromosomal abnormalities and with presentation of clinical
features due to formation of unbalanced gametes.

• Unbalanced structural abnormalities cause both physical and

mental problems
 Translocations
• A portion of one chromosome is transferred to another.

• RECIPROCAL
TRANSLOCATION:
• segments of
different
chromosome have
been exchanged.
 Reciprocal
Translocations
Involves breakage of at least two chromosomes with exchange of the
fragments.
Usually the chromosome number remains at 46 and, if the exchanged
fragments are of roughly equal size, a reciprocal translocation can be
identified only by detailed chromosomal banding studies or FISH

In general, reciprocal translocations are unique to a particular family.

A particular balanced reciprocal translocation involving the long arms of

chromosomes 11 and 22 is relatively common.
 Segregation
at Meiosis.
They can segregate to generate significant
chromosome imbalance.

This can lead to early pregnancy loss or to

the birth of an infant with multiple
abnormalities.

Problems arise at meiosis because the

chromosomes involved in the translocation
cannot pair normally to form bivalents.

Instead they form a cluster known as a

pachytene quadrivalent .
• ROBERTSONIAN TRANSLOCATION:
• an entire chromosome has attached to another at the centromere.
In humans this only occurs in chromosome 13,14,15,21 and 22.
 Robertsonian translocation
A results from the breakage of two acrocentric chromosomes (13, 14,
15, 21, and 22) at or close to their centromeres, with subsequent fusion
of their long arms (centric fusion).
The short arms of each chromosome are lost.
No clinical importance as they contain genes only for ribosomal RNA,
for which there are multiple copies on the various other acrocentric
chromosomes.
The total chromosome number is reduced to 45. No loss or gain of
important genetic material- functionally balanced rearrangement.
Incidence of Robertsonian translocations 1 in 1000,
Most common being fusion of the long arms of chromosomes 13 and 14
 Deletions
• Occurs when a chromosome breaks and some genetic material is lost .
Deletions can be large or small and can occur anywhere along a chromosome
• Terminal
• Interstitial
 Deletions

A ‘large’ chromosomal deletion can be visualized under the light

microscope.
E.g: Wolf Hirschhorn and cri du chat, which involve loss of material from
the short arms of chromosomes 4 and 5, respectively .

Submicroscopic microdeletions are identified with the help of high-

resolution prometaphase cytogenetics augmented by FISH studies
E.g. Prader-Willi and Angelman syndromes (Ch 15 from father and
mother resp)
CRI DU CHAT SYNDROME :5p Di George syndrome : Deletion of a small piece of long
Deletion of short arm of chromosome 5 arm of chromosome 22
46,XX,del 5p
46,X,del(X)(q22)
 Duplication
• Occurs when part of a chromosome is copied
(duplicated ) and present in two copies .

• This type of chromosomal change results in extra copies of

genetic material from the duplicated segment.

• These extra genes present on the duplicated segment do not

function properly
Duplication of short arm of chromosome 12
PALLISTER KILLIAN SYNDROME
 Inversion
• Involves the breakage of a chromosome in two places, the
resulting piece of DNA is reversed and re-inserted into the
chromosome.

• Inversions can be balanced or unbalanced and can predispose an

individual to having a child with a duplication or deletion of the involved
region.
 Iso-chromosomes

• Is a chromosome with two identical arms.

• Instead of one long arm (q) and one short arm (p), an
isochromosome has two long or two short arms thereby having
extra copy and missing copy of other genes

E.g. Isochromosome X – Turners Syndrome .

46,X,i(X)(q10)
Ring chromosome

• The chromosome breaks in two places and the ends join to

form a ring structure. In many cases , the genetic material near
the ends of the chromosome is lost.
• Turners Syndrome
• If the involved chromosome is an autosome, the effects are
usually serious.
• Ring chromosomes are often unstable in mitosis so that it is
common to find a ring chromosome in only a proportion of cells.
The other cells in the individual are usually monosomic because
of the absence of the ring chromosome.
46,X,?r(X)
Mosaics and Chimeras
 Mosaicism

The presence in an individual, or in a tissue, of two or more cell lines

that differ in their genetic constitution but are derived from a single
zygote, that is, they have the same genetic origin.
Chromosome mosaicism usually results from non-disjunction in an early
embryonic mitotic division with the persistence of more than one cell
line. Mosaicism
Mosaicism

The ensuing cell line with 45 chromosomes

would probably not survive, so that the
resulting embryo would be expected to show
approximately 33% mosaicism for trisomy 21.
 Chimerism

The presence in an individual of two or more genetically distinct cell

lines derived from more than one zygote i.e they have a different
genetic origin.
The word chimera is derived from the mythological Greek monster that
had the head of a lion, the body of a goat and the tail of a dragon.
Human chimeras are of two kinds: dispermic chimeras and blood
chimeras

• According to Homer, the Chimera was " lion- fronted and

snake behind, a goat in the
middle…”
 Dispermic Chimeras

These are the result of double fertilization whereby two genetically

different sperm fertilize two ova and the resulting two zygotes fuse to
form one embryo.

If the two zygotes are of different sex, the chimeric embryo can develop
into an individual with true hermaphroditism and an XX/XY karyotype.
 Blood chimeras

Blood chimeras result from an exchange of cells, via the placenta,

between non-identical twins in utero.
For E.g. 90% of one twin’s cells can have an XY karyotype with red
blood cells showing predominantly blood group B, whereas 90% of the
cells of the other twin can have an XX karyotype with red blood cells
showing predominantly blood group A.
 Prader-Willi Syndrome

• An uncommon, non-inherited, life-threatening birth defect.

• Affects all races and both sexes

• One in every 15,000 babies are infected

The cause is unclear
 Characteristics
• Obesity
• Poor muscle tone
• Unsatisfiable appetite
• Incomplete sexual development
• Retardation
• Short Stature
• Long and narrow head at birth
• Narrow face
• Small hands and feet
• Behaviour problems
Prader-Willi Syndrome
 Genetics
• Chromosome 15 (15q11.2-13)
• Loss of genes normally contributed by the father
• Error
• Non –inherited deletion of paternal chromosome
• Two maternal chromosome 15’s
• Error in imprinting- paternal chromosome in non-
functional
Mutation

• Is a permanent and transmissible change in DNA sequence

• It can be an insertion or deletion of genetic information, or

an alteration in the original genetic information.
 Classification of Mutation

Somatic mutations (Somatic cells)

Based on Where they occur

Germ line mutations (Gametes)

Gene level mutations

The length of the nucleotide
sequences they affect
Chromosomal mutations
Genetic counseling
 What is Genetic Counseling?
• Medical education of affected individuals and the general public
concerning inherited disorder.

• Genetics counselors are health care professionals with specialized

graduate degrees and experience in medical genetics and
counseling.

• Genetic counseling involves a process of communication and

education that addresses:
 Diagnosis, management and prognosis
 Estimation and communication of risks
 Explaining reproductive options
What do Genetics Counselors Do?
• Work as members of a healthcare team
• Assess the risk of a genetic disorder by researching a persons family
history and evaluating medical records
• Provide support and information to help a person to make a
decision about testing
• Interpret results of medical tests and data
• Explain possible treatments or preventative measures
• Discuss reproductive options
 Steps in genetic counseling
• Diagnosis - based on accurate family history, medical history, examination
and investigations
• Mode of inheritance and risk of developing/ transmitting the disease
• Communicating the information to the families so that they make their
own decisions in view of their risk and family goals and their ethical and
religious standards
• Management and prognosis
• Options available for dealing with the risks
• Maintaining contact with families and follow up
 Genetic Counseling should be

• non-directive

• non-judgemental

• Should provide accurate scientific and comprehensible information

• so that families take their own decisions (Autonomy)

 Scope of genetic counseling
1.Counseling to affected individuals and families having affected children
with a congenital disorder

2. Premarital counseling

3. Prescreening counseling

4. Preconception counseling

5. Counseling regarding consanguinity

Number 1 is usually offered by a genetics specialist

Numbers 2-5 can be offered by trained primary health care providers
• The consultant should be provided with information that enables him
or her to understand:

1.The medical diagnosis and its implications in terms of prognosis and

possible treatment.

2.The mode of inheritance of the disorder and the risk of developing and/or
transmitting it.

3. The choices or options available for dealing with the risks.

 Genetic Counselor
• Genetic counselors work as members of a health care team, providing
information and support to families with congenital disorders.

• Role of genetic counselor:

• Diagnose
• Explain risks of recurrence, prognosis and management
• Explain possible methods for prevention, including prenatal screening
and diagnosis, and preimplantation diagnosis
• NOT DIRECTIVE
Techniques

• Karyotype • Aminocentesis

Tests for abnormalities of chromosomes

Techniques

Pedigree Analysis • This is a common test used to

determine the risk of a child
having a genetics disorder that
his ancestors were carriers for
particular disorder
 What is a pedigree chart?
A record of the family of an individual

Used to study the transmission of a hereditary condition

Useful when there are large families and there is a good family record over
several generations.

Pedigree charts offer an ethical way of studying human genetics

A genetic counselor will still use pedigree charts to help determine the
distribution of a disease in an affected family.
Symbols used in pedigree charts
A married couple with five children. Two
daughters and three sons. The middle son is
• Normal male affected by the condition

• Affected male
• Normal female
• Affected female
• Marriage. Eldest child  Youngest child
 Communication
• The ability to communicate is essential in genetic counseling.

• Communication is a two-way process. The counselor should

provide information, and has to listen to the fears and worries of the
family.

• A readiness to listen is a key attribute for anyone involved in genetic

counseling, as is an ability to present information in a clear, sympathetic
and appropriate manner
Ethical issues in genetic counseling
• Autonomy: the couple should take their own decision

• Informed choice: the decision is based on the information given by the

counselor

• Informed consent: The individual or couple should give their

informed consent for any investigation

• Confidentiality
Main Services Offered by a Medical Genetics Centre

• Genetic counseling to families reporting to the centre

• Laboratory services for the diagnosis of genetic disorders (cytogenetics,
molecular genetics, biochemical tests)
• Training of health professionals on the principles and practice of
medical genetics
• Research
• Development of community genetics services for the control of genetic
disorders in the community
 Conclusions:

Genetic counseling involves:

• Medical diagnosis, prognosis and treatment

• Mode of inheritance and risk of recurrence, options available for

dealing with the risk

• Communicating the information to the couple so that they make their

own decisions and reproductive options in view of their risk and family
goals and their ethical and religious standards

• Should be non-directive, non-judgemental

 Books
• Emery’s ELEMENTS OF MEDICAL GENETICS
• Peter Turnpenny, Sian Ellard

• MEDICAL GENETICS
• Jorde Carey, Bamshad White

• Thompson & Thompson GENETICS in MEDICINE

• Nussbaum, McINNES, WILLARD

• Principles and Practice of Assisted Reproductive Technology – Dr.

Kamini A Rao
Questions?
Question 1. Give example for numerical
autosomal abnormality?
Question 2. Flexed big toe and prominent heel
is a phenotypic feature of ?

• a) Down syndrome
• b) Patau’s syndrome
• c) Edward’s syndrome
• d) Turner syndrome
Question 3.Give an example of structural
chromosomal abnormality of deletion?
Question 4. What type of mutation would cause
a person to have an extra X chromosome? And
what is the name of the syndrome?
Question 5. What is the mode of inheritance
in the following pedigrees?
Answers:
1. Patau’s syndrome, Edward’s syndrome, Down syndrome
2. Edward’s syndrome
3. Cri du chat syndrome/ Di-George syndrome/Praderwilli Syndrome
4. Non-disjunction, Klinefelter syndrome
5. Autosomal Dominant