0% found this document useful (0 votes)
5 views

Lecture 4 (Introduction to Genetics)

The document provides an overview of DNA, genes, and chromosomes, detailing the structure and function of DNA, the process of gene expression, and the genetic code. It explains the types of nucleic acids, the significance of mutations, and hereditary diseases, along with examples of genetic disorders. Additionally, it covers the organization of genetic material within cells and the relationship between genotype and phenotype.

Uploaded by

mkkz27ksvc
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
5 views

Lecture 4 (Introduction to Genetics)

The document provides an overview of DNA, genes, and chromosomes, detailing the structure and function of DNA, the process of gene expression, and the genetic code. It explains the types of nucleic acids, the significance of mutations, and hereditary diseases, along with examples of genetic disorders. Additionally, it covers the organization of genetic material within cells and the relationship between genotype and phenotype.

Uploaded by

mkkz27ksvc
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 30

DNA, Genes & Chromosomes

Introduction to Animal Science


(ANVS2101)
Spring2025
DNA structure was discovered in 1953 by:
James Watson and Francis Crick

✓ Discovered the double-helix and twisted-ladder structure of DNA, the molecule


containing human genes.
✓ Help understanding how genes control the chemical processes inside cells.
✓ The structure that is the basis for heredity.
What is the function of DNA?
DNA stands for...Deoxyribose Nucleic Acid
DNA forms long double strand called chromatin (DNA + proteins) which forms
chromosomes when cells reproduce.

1) Stores the genetic information and master instructions inside each of the
life cells for building proteins.

2) So, DNA makes PROTEINS

3) Responsible for determining all organism’s traits


such as eye color, body structure, and enzyme production.
The Components of DNA
DNA is a polymer made up of repeating individual units of
monomers called nucleotides.

Nucleotides are made up of three parts that are held together by


covalent bonds: Sugar, Nitrogenous Base, Phosphate Group

N.Base
Phosphate
group

Sugar part

Nucleotide = Nucleoside + Phosphate group


Nitrogenous bases...
There are 2 types:
Purine bases Pyrimidine bases
• Adenine (A) and guanine (G) • Thymine (T) and cytosine (C)
• Two carbon rings • A single carbon ring
Types of Nucleic acids
There are 2 types of nucleic acids:
1. Deoxy-ribonucleic acid (DNA)
❖ Pentose Sugar is deoxyribose (no OH at 2’ position)
❖ Bases are Purines (A, G) and Pyrimidine (C, T).

deoxyribose
Ribose
Types of Nucleic acids
There are 2 types of nucleic acids:
2. Ribonucleic acid (RNA)
❖ Pentose Sugar is Ribose.
❖ Bases are Purines (A, G) and Pyrimidines (C, U).

deoxyribose
Ribose
DNA Structures
Nucleic acids have a:
Primary, secondary, tertiary and quaternary structure analogous to the
classification of protein structure.

Nucleotides are joined with


phosphodiester bond
forming polynucleotides.

A linear sequence of
nucleotides that are linked
together by phosphodiester
bond gives the primary
structure .
Base pairing
➢ Adenine (A) always pairs with Thymine (T)
➢ Double H-bond between A and T (DNA), A and U (RNA) (A═T or A═U)
➢ Guanine (G) always pairs with Cytosine (C)
➢ Triple H-bond between G and C in both DNA or RNA (G≡C)

These bases are held


together by hydrogen bonds
Gene Structure and Expression
Gene Structure:
A sequences of DNA with the information to construct a protein
(used as a template for the copying process called transcription).

The gene is the fundamental unit of inherited information in DNA


Gene expression
Is the process by which information/instructions in our DNA are converted
into a functional gene product (These products are often proteins).

A protein
Is an organic molecule that consists of amino acids joined by peptide bonds and perform different
functions in an organism.
What are the main functions of proteins?

➢ Enzymatic proteins: (Almost all known enzymes are protein)


➢ Hormonal proteins: Insulin, growth hormone.
➢ Structural constituents: Collagen, keratin, membrane, etc.
➢ Transport proteins: Hemoglobin, Myoglobin, etc.
➢ Protection or defense proteins: Antibodies.
➢ Motor proteins: Muscle (Myosin, Actin, etc.).
➢ Storage: Casein, Albumin, etc.
RNA structure & Types

• It is formed of linear polynucleotide


• It is generally single stranded deoxyribose
Ribose
• The pentose sugar is Ribose
• Uracil (U) replace Thymine (T) in the pyrimidine bases.

Although RNA is generally single stranded, intra-molecular H-bond


base pairing occur between complementary bases on the same
molecule (secondary structure)

Messenger RNA (mRNA):

Ribosomal RNA (rRNA): Transfer RNA (tRNA):


The Genetic Code
Is the set of rules used by living cells to translate information
encoded within genetic material into proteins.
(Describes how nucleotide sequence is converted to protein sequence)

The genetic code is a set of three-letter


(nucleotides) combinations called
codons, each of which (codon)
corresponds to a specific amino acid
(component of protein) or stop signal
Characteristics of the genetic code

1) Three nucleotides encode an amino acid.


2) The code is degenerate.
3) The code is nonoverlapping.
4) The code has directionality.
5) The code has universality.
The alphabet of the genetic code contains only four letters (A, T, G, C).

Stop
codons
start
codon

➢ There are three triplets not translated into amino acid, indicating chain termination called
stop codon (UAA, UAG, UGA).
➢ In addition, the codon AUG has a special role, serving as the start codon where
translation begins.
The code is non-overlapping
The triplets are read end-to-end in sequence (e.g. UUU = phenylalanine, UUA = leucine)

The same letter is not used for two


different codons.
In other words, no single base can
take part in the formation of more
than one codon.
The code has directionality and is degenerate

✓ The code is degenerate which means that the same amino acid is
coded by more than one base triplet.

✓ For example, the three amino acids arginine, alanine and leucine each have more
than one synonymous codons.
The genetic code is (nearly) universal

✓ The code is universal and applies to all species with some


exceptions.

✓ With some minor exceptions, all living organisms on Earth use the
same genetic code.

✓ This means that the codons specifying the 20 amino acids in


your cells are the same as those used by the bacteria inhabiting
hydrothermal vents at the bottom of the Pacific Ocean.
Chromosomes
• Human body cells contain 46 chromosomes in 23 pairs one of each pair inherited
from each parent.
• Humans have 22 pairs of autosomes and one pair of sex chromosomes (X and Y)
• Chromosome pairs 1–22 are called autosomes.
• The 23rd pair are called sex chromosomes:
• XX is female, XY is male.
Frequent genetic disorders in
humans
Autosomes
✓ Down syndrome (trisomy 21: 47, XX,+21)
✓ Edwards syndrome (trisomy 18: 47, XX,+18)
✓ Patau syndrome (trisomy 13: 47, XX+13)

Sex chromosomes
✓ Turner syndrome 45,
✓ X- (results in a female with the syndrome)
✓ Klinefelter syndrome 47,XXY

Extra copy of all chromosomes


✓ Triploidy (23+23+23=69 chromosomes)
-Results in early death in early pregnancy
Hereditary Diseases
These diseases are caused by mutations passed from a parent to a
offspring.

1) Multifactiorial diseases:
The diseases is caused by interaction of different mutations or many
genes and environmental factors. Such as diabetes, and obesity.

1) Mendelian inheritance:
Presence or absence of the phenotype depends only on the
genotype of a small set of genes with a known mode of inheritance
What is a mutation?
Mutation:
An alteration or change in the genetic material.
Which could be spontaneous or inherited.

• Spontaneous: from exposure to mutagenic/carcinogenic factors


but more arise through errors in DNA replication/repair.

• Usually, spontaneous mutations are recognised and fixed by


DNA repair machinery if effects are detrimental.
A Point mutations:
Is a genetic mutation where a single nucleotide base is:
Added, Deleted, Changed.
Types of point mutations:
1) Silent mutation: does not change the amino acid.
2) Nonsense mutation: causes premature stop-codon.
3) Missense mutation: leads to change an amino acid.
A single-base mutation causing a missense mutation of amino acid
In Ovine chromosome 6

Spider Lamb Syndrome


Is a disorder resulting in abnormal
transformation of cartilage to bone.

The name derives from the limbs of


animals as being thin, elongated,
"spider-like".

Causing:
1. Abnormally long and curved limbs
2. Twisted spine
3. Abnormal bone and cartilage growth
4. Long necks
Double Muscling in Belgian Blue cattle

Resulting from a 11-nucleotide deletion in the third exon of Myostatin gene.


Myostatin gene is a regulator of skeletal muscle growth.
Important Terms
Phenotype: The outlook of an organism
Genotype: The genetic information contained in DNA

Phenotypes

Genotype Genotype
ATGTTTCCACCTTCAGGTTCCACT
GCCAAGAATGGCTCCCACCTGCTCT
GGGCTGATTCCCCCCTCCCACTTT
CAGACATTCCCCTGGTCCAACCCCC
CAAGCTCGGCCCCTTTCAACTCAG
AGGCCATCAAGATGTCTCAGAGAG
AGAGGCGGCTAGACACCCAGAGA
GCGGCTAGACACCCAGAGACCTCA
CCTCAAGTGACCATGTGGGAACG
AGTGACCATGTGGGAACGGGATGT
GGATGTTTCCAGTGACAGGCAG
TTCCAGTGACAGGCA
✓ A locus (plural loci):
Is the actual location of the gene on a region of a chromosome.

✓ An allele (alternative forms of a given gene) A or a?


Most genes have two alleles,
A is dominant allele and a is recessive allele.

❖ Dominant (powerful) allele:


only one allele needed to cause the phenotype (heterozygous)
❖ Recessive allele:
both allels needed to cause the phenotype (homozygous)
Put these in order of size from the
Largest to Smallest?

➢ Chromosome
➢ DNA
➢ Nucleus
➢ Gene
➢ Nitrogen base
➢ Cell

You might also like