﷽

Sudan University of Science & Technology

Faculty of Medical Laboratory Science
Microbiology Department

Detection of blaNDM-1 and blaKPC Genes among Carbapenem-

Resistant Gram-Negative Rods Isolates from Hospitalized Patients
in Khartoum by using Loop-Mediated Isothermal Amplification
(LAMP) Assay.

A proposal submitted in partial fulfillment for the requirement M.S.C

Degree in microbiology.

Prepared by :

Anfal Ibrahim Bahereldeen

Pho. No: +249 916060120 E-mail: [email protected]

Supervisor name and affiliation :

Prof. Humodi A. Saeed.
Prof. of Medical Microbiology College of Medical Lab Science.
Sudan University of Science and Technology.
E mail address: [email protected]

Co- Supervisor name and affiliation :

2.1 INTRODECTION:
Carbapenem-resistant gram negative rods are worldwide clinical concern and is largely
attributed to the carbapenem hydrolysing enzymes carbapenemases, which hydrolyse most b-
lactams. Carbapenemases are associated with diverse mobile genetic elements, such as plasmids,
transposons and integrons, these enzymes carry multiple resistance genes, conferring resistance
to several antibiotic classes, such as aminoglycosides, fluoroquinolones, tetracyclines,
trimethoprim, sulphonamides and phenicols (Queenan and Bush 2007; Nordmann 2014).

Carbapenemases have been classified molecularly into two groups based on their active sites:
metallo-b-lactamases (MBL or class B) and serine-based (classes A and D) carbapenemases, the
differences in the active sites of carbapenemases affect carbapenem hydrolysis rates and
resistance to other b-lactam antibiotics and b-lactamase inhibitors (Queenan and Bush 2007;
Bush 2013).

Klebsiella pneumoniae carbapenemase (KPC) enzymes, belonging to class A (serine

carbapenemases) and inhibited by boronic acid, are common among the Enterobacteriaceae,
Pseudomonas aeruginosa and Acinetobacter baumannii (Robledo et al., 2011). Some isolates
expressing the KPC enzyme demonstrate low-level carbapenem resistance, but when combined
with other cellular changes, such as porin loss, the MIC for the carbapenems increases. The gene
encoding the KPC enzyme is usually flanked by transposon-related sequences and has been
identified on conjugative plasmids; therefore, the potential for dissemination is significant
(Woodford et al., 2004). New Delhi metallo-beta-lactamase (NDM-1), described in 2009 in K.
pneumoniae, is a newer type of metallo-betalactamase (MBL) of the Ambler class B beta-
lactamases that are inhibited by EDTA (Yong et al., 2009).

A number of phenotypic tests may be used to identify carbapenemase producers including disk
diffusion methods ,broth dilution test and automated antimicrobial susceptibility systems which
show variable sensitivity in the detection of carbapenem resistance, it is recommended that
subsequent phenotypic confirmatory tests are performed, such as the modified Hodge test (MHT)
and the combined disc test (CDT) (Tenover et al., 2006), these phenotypic assays have poor
performance with turnaround times that are not clinically useful.
Currently moleculer method like conventional PCR, real-time PCR (Wang et al. 2012a,b)
,commercial microarrays such as the Check-Direct CPE (Check- points, Wageningen, the
Netherlands) (Nijhuis et al. 2013; Hanemaaijer et al. 2014) and multiplex PCR uses a set of
multiple primers to detect several genes simultaneously (Doyle et al. 2012) are used to detect
blaKPC, blaNDM and others carbapenemases with high sensitivity and specificity but all are
expansive and some are lober intensive, time consuming and need experience.

loop-mediated isothermal amplification (LAMP) assay, which only needs a temperature-

controlled water bath to ensure isothermal conditions, has been developed (Liu et al. 2012;
Nakano et al. 2015). It works by autocycling strand displacement DNA synthesis, using BstDNA
polymerase and a set of four to eight primers that attaches to various portions of the DNA,
thereby increasing its sensitivity and specificity (Liu et al. 2012; Nakano et al. 2015). The
amplification process can be directly observed by measuring the turbidity of the reaction solution
with a spectrophotometer or a fluorescent reagent (Liu et al. 2012; Nakano et al. 2015). The
assay is cheap, fast (works within 1 h) and simple with higher sensitivities for DNA in clinical
samples (Liu et al. 2012; Nakano et al. 2015) compared to PCR. This assay has been used to
detect NDM-1 and all KPC variants from clinical samples at 10 0 CFU ml-1, an LOD 10–100 fold
greater than that of PCR (101 CFU ml-1) (Nakano et al. 2015 and Rachana Solanki et al. 2013).

In study preformed in different hospitals located in Khartoum State during the period from
August to October 2016, higher percentages of multi-durg resistant isolates were reported
74(41%) and higher carbapenem-resistance was reported 31(17.2%), mostly by Carbapenemase
production 20 (64.5%) (Elsadig .A. Haj. 2016)

In view of need to cheap and easy methods for the diagnosis of MDR-GNRs in basic
microbiological laboratories we planned a cross-sectional analytical study to detection of
blaNDM-1 and blaKPC genes in Gram-negative clinical isolates by using LAMP assay

2.2 RATIONAL:
The epidemiological profile of Sudan, as in other low- and middle-income countries, where
malnutrition and infectious diseases are the main causes of morbidity and mortality, Infections
due to Gram-negative bacilli are on rise world over, the wide use of broad-spectrum antibiotics
can lead to colonization with resistant strains which can transmit among people and animals, and
can be transmitted from one country to another without notice, carbapenems are commonly used
to treat infections caused by multidrug resistant-gram negative rods(MDR-GNRs). These MDR-
GNRs are most frequently documented in acute care facilities, many clinical laboratories have
problems in detecting carbapenemases (Rodrigues C et al. 2004), the problem was clearly severe
in developing countries where drug availability was limited and resistance was high. traditional
and automated antimicrobial susceptibility systems show variable sensitivity in the detection of
carbapenem resistance, and need phenotypic confirmatory tests like modified Hodge test (MHT)
and the combined disc test (CDT) (Tenover et al., 2006), these phenotypic assays have poor
performance, now molecular diagnostic techniques, such as real-time PCR, are sensitive and
accurate methods for identifying the presence of blaNDM-1 and blaKPC genes (Cole et al.,
2009; Manchanda et al., 2011) but it very expensive time consuming and need experience, loop-
mediated isothermal amplification (LAMP) assay has emerged as a powerful, rapid, simple,
inexpensive gene amplification tool for identifying blaNDM-1 and blaKPC genes. We need to
look for effective, low cost methods to solve our problems and improve our life, this study aimed
to provide some helps in this problem and open the way for other researchers to perform more
studies by like this simple techniques’ and work around this issue and other issues.

2.3.OBJECTIVE:
2.3.1. General objective:

To detection of blaNDM-1 and blaKPC genes among Carbapenem-resistant gram-negative

rods isolates from hospitalized patients in Khartoum by using loop-mediated isothermal
amplification (LAMP) assay.

2.3.3.Specific objective:

1. To identification the clinical isolate of gram negative rods that collected from different
hospitalized patients in Khartoum by using convential biochemical tests.
2. To screening for Carbapenem-resistant gram-negative rods that collected from different
hospitalized patients in Khartoum by using Kirby-Bauer disk diffusion method.
3. To confirme the carbapenemase production by using Modified Hodge Test (MHT)
4. To test the MBL production by using Imipenem-EDTA Combined Disc Test (CDT)
 5. To detection of blaNDM-1 and blaKPC genes among Carbapenem-resistant gram-
negative rods isolates from different hospitalized patients in Khartoum by using loop-
mediated isothermal amplification (LAMP) assay

3.Material and Methods

3.1.Study design
Descriptive Cross sectional study.

3.2. Study duration

From March 2019 to February 2020.

3.3.Study population

In wards hospitalized patients in Khartoum whose suffering from bacterial infection .

3.4. Inclusion and exclusion criteria:

 Inclusion all in ward hospitlized patients surfing from bacterial infection in targeting
hospitals.

3.5. Study area:

Omdurman Teaching hospital, Bahri Teaching hospital, Bashaier hospital and Khartoum
Teaching hospital, that located in Capital of Sudan .

3.6. Sampling size

100 Gram negative rods isolate.

3.7. Method of sampling

n0 = z2 pq
d2
n= sample size.
z= the normal standard deviate (z=1.96).
p= the frequency of occurrence of an event
q= 1-p (the frequency of non occurrence of an event)
d= degree of precision (0.04%)
3.8. Data collection

Data collection tools: check list of questionnaire..

3.9. Sample pressing:

1) Re-identification of clinical isolates:

All Gram-negative rods were re-identified by using standard microbiological techniques

according to (Cheesbrough. 2000).

2) Antimicrobial susceptibility testing of GNB isolates :

Will be tested by the Clinical and Laboratory Standards (CLSI) Kirby-Bauer disk diffusion
method on Muller-Hinton Agar (MHA) plate using different antimicrobial disks including:
Imepenem, Ceftriaxone, ceftazidime , Amoxicillin/Clavulinic acid, Ciprofloxacin, Gentamicin &
Co-trimoxazole .

E. coli ATCC 25922 will be used as control strains and tested each time when susceptibility
testing will be performed, zone diameters of each of the antibiotics will be interpreted as per
CLSI recommendations (CLSI, 2011).

3) All phenotypic imepenem-resistant strains were confirmed by:

Modified Hodge test (MHT) that based on the inactivation of a carbapenem by carbapenemases
producing strains that enables a carbapenem-susceptible indicator strain to extend growth
towards a carbapenem-containing disc, along the streak of inoculum of the tested strain (Girlich
et al. 2012). The MHT has been fraught with false positive detections (especially among AmpC
and CTX-M hyperproducers) in several studies (Wang et al. 2011; Clinical and Laboratory
Standards Institute (CLSI). 2015) and poor detection of NDM producers (Girlich et al. 2012). as
described in(Anderson et al., 2007).

So the imipenem, meropenem or third generation cephalosporins (ceftazidime) resistant isolate in

Kirby Bauer disk diffusion method also will confirmed by Disc-inhibitors synergy test to detect
and differentiate between Class A and B carbapenemases and test the MBL production (Yong et
al., 2002).

4) blaNDM-1 and blaKPC genes detection by using loop-mediated isothermal

amplification (LAMP) assay:
 DNA extraction will be carried out according to the Centers for Disease Control and
Prevention (CDC) protocol by the boiling method .
 LAMP assay: blaNDM-1 and blaKPC specific forward outer primer (F3), backward outer
primer (B3), forward inner primer (FIP) and backward inner primer (BIP) will be designed
with the help of the Primer Explorer V4 software (http://primerexplorer.jp:81/lamp/) and two
additional loop primers [forward loop primer (FLP) and backward loop primer (BLP)] will
be designed to accelerate the amplification reaction (Notomi et al., 2000). All LAMP primers
were synthesized commercially (Active Oligos) .
 LAMP reaction: LAMP reactions will be carried out in 25 ml reaction mixture (DNA
Amplification kit; Eiken Chemical Co.) depending on (Rachana Solanki. 2013) protcal.
 Detection of LAMP products will be done usng: visual fluorescence by adding 0.2 ml of
1/10000 DMSO SYBR1 Green I (Invitrogen) to 25 ml of LAMP product as in(Rachana
Solanki. 2013)
 Primers:

blaKPC gene primers:

KPC F3: TCGAACAGGACTTTGGCG

KPC B3 GGAACCAGCGCATTTTTGC

KPC FIP CACAGTGGGAAGCGCTCCTCTTTTGTGTACGCGATGGATACCG

KPC BIP TCAAGGGCTTTCTTGCTGCCGTTTTCGTAACGGATGGGTGTGTC

KPC BLP AGCAGCAGGCCGGCTTGCTG

KPC FLP TAACTACAGTTGCGCCTGAGC

blaNDM-1 gene primers:

NDM-1F3 GCATAAGTCGCAATCCCCG

NDM-1B3 CTTCCTATCTCGACATGCCG

NDM-1 FIP GAGATCAACCTGCCGGTCGCTTTTTCCATACCGCCCATCTTGT

NDM-1 BIP TCTGGGCGGTCTGGTCATCGTTTTTTCCAACGGTTTGATCGTCA

NDM-1 FLP GGTGACTCACGCGCATCAGG

NDM-1 BLP ACCACCAGCACGCGGCCGCCATC

3.8. Ethical consideration:

 Ethical approval will be taken from research ethics committee of Sudan University of
Science & Technology.
 Ethical approval will be taken from research ethics committee at Federal Ministry of
Health-Sudan.
 Research purpose and objectives will be explained to participant in clear simple words.
 Participant has right to no harm (privacy and confidently by using code questionare)
 Participant has right to benfit from the research results.
 Informed consent will be taken from each participant in the study.
 The laboratory result will be sended to participant immediately.
 In case of researches in medical staff questioners should be filled in their rest time only.

Timetable(2018-2019)
Months
Tasks 2019 2020

3-4 5 6,7,8,9 10-11 12 1

Writing a proposal *
Supervisor review and approval *
Submit the project for ethical approval *
Mentor to order supplies and equipments *
Chick all research material *
Data and sample collation *
Data and sample testing *
Final result anlysis and review *
Prepare a research thesis * * *
Draft paper for submation to journal *
Review the paper and submitted *
Data sheet :
Hospital name: ……………………………………………………………………
Sample NO: …………………Type of specimen ………………………………………
Specimen data: …………………………………
Patient code: …………gender: …………………….age: ..…………resident:……………………
Complain:
1. ………………………………………………………………………………………………
2. ………………………………………………………………………………………………
3. ………………………………………………………………………………………………
4. ………………………………………………………………………………………………
Duration of infection………………………Duration of treatment………………………………...

Lablotery result:

1. Isolated microorganisms:
………………………………………………………………………………………………
………………………………………………………………………………………………

2. Sensitivity results:
sensitive to:
………………………………………………………………………………………………………
………………………………………………………………………………………………………
resist to:
………………………………………………………………………………………………………
…………………………………………………………………………………................................

3. Modified Hodge test (MHT) results:

……………………………………………………………………………….....

4. Disc-inhibitors synergy test result:

………………………………………………………………………………………………
………………………………………………………………………………………………

5. LAMP result:
………………………………………………………………………………………………
………………………………………………………………………………………………
………………………………………………………………………………………………
………………………………………………………………………………………………
………………………………………………………………………………………………