Data Mining: Data

What is Data?
• Collection of data objects and Attributes
their attributes

• An attribute is a property or Tid Refund Marital Taxable

Status Income Cheat
characteristic of an object
1 Yes Single 125K No
– Examples: eye color of a person,
temperature, etc. 2 No Married 100K No
3 No Single 70K No
– Attribute is also known as
variable, field, characteristic, or 4 Yes Married 120K No
feature 5 No Divorced 95K Yes
Objects
• A collection of attributes describe 6 No Married 60K No

an object 7 Yes Divorced 220K No

– Object is also known as record, 8 No Single 85K Yes

point, case, sample, entity, or 9 No Married 75K No

instance 10 No Single 90K Yes
10
 Attribute Values
• Attribute values are numbers or symbols assigned to an attribute

• Distinction between attributes and attribute values

– Same attribute can be mapped to different attribute values
• Example: height can be measured in feet or meters

– Different attributes can be mapped to the same set of values

• Example: Attribute values for ID and age are integers
• But properties of attribute values can be different
– ID has no limit but age has a maximum and minimum value
 Measurement of Length
• The way you measure an attribute is somewhat may not match the
attributes properties.
5 A 1

B
7 2

8 3

10 4

15 5
 Types of Attributes
• There are different types of attributes
– Nominal:Examples: ID numbers, eye color, zip
codes
– Ordinal: Examples: rankings (e.g., taste of potato
chips on a scale from 1 10), grades, height in {tall,
medium, short}
– Interval: Examples: calendar dates, temperatures
in Celsius or Fahrenheit.
– Ratio: Examples: temperature in Kelvin, length,
time, counts
 Properties of Attribute Values
• The type of an attribute depends on which of the following properties it
possesses:
– Distinctness: =
– Order: < >
– Addition: +
– Multiplication: */

– Nominal attribute: distinctness

– Ordinal attribute: distinctness & order
– Interval attribute: distinctness, order & addition
– Ratio attribute: all 4 properties
Attribute Description Examples Operations
Type

Nominal The values of a nominal attribute are zip codes, employee mode, entropy,
just different names, i.e., nominal ID numbers, eye color,
attributes provide only enough sex: {male, female}
contingency
information to distinguish one object correlation, 2
from another. (=, ) test

Ordinal The values of an ordinal hardness of minerals, median, percentiles,

{good, better, best}, rank correlation,
attribute provide enough grades, street numbers run tests, sign tests
information to order objects.
(<, >)
Interval For interval attributes, the calendar dates, mean, standard
differences between values are deviation, Pearson's
meaningful, i.e., a unit of
temperature in correlation, t and F
measurement exists. Celsius or tests
(+, - ) Fahrenheit
Ratio For ratio variables, both temperature in geometric
differences and ratios are Kelvin, monetary mean,
meaningful. (*, /) quantities, counts, harmonic
age, mass, length, mean, percent
electrical current variation
Attribute Transformation Comments
Level

Nominal Any permutation of values If all employee ID numbers

were reassigned, would it
make any difference?

Ordinal An order preserving change of An attribute encompassing

values, i.e., the notion of good, better
new_value = f(old_value) best can be represented
where f is a monotonic function. equally well by the values
{1, 2, 3} or by { 0.5, 1,
10}.
Interval new_value =a * old_value + b Thus, the Fahrenheit and
where a and b are constants Celsius temperature scales
differ in terms of where
their zero value is and the
size of a unit (degree).

Ratio new_value = a * old_value Length can be measured in

meters or feet.
Discrete and Continuous Attributes
• Discrete Attribute
– Has only a finite or countably infinite set of values
– Examples: zip codes, counts, or the set of words in a collection of
documents
– Often represented as integer variables.
– Note: binary attributes are a special case of discrete attributes

• Continuous Attribute
– Has real numbers as attribute values
– Examples: temperature, height, or weight.
– Practically, real values can only be measured and represented using a
finite number of digits.
– Continuous attributes are typically represented as floating point
variables.
 Types of data sets
• Record
– Data Matrix
– Document Data
– Transaction Data

• Graph
– World Wide Web
– Molecular Structures

• Ordered
– Spatial Data
– Temporal Data
– Sequential Data
– Genetic Sequence Data
 Important Characteristics of Structured Data

– Dimensionality
• Curse of Dimensionality

– Sparsity
• Only presence counts

– Resolution
• Patterns depend on the scale
 Record Data
• Data that consists of a collection of records, each of which consists of a
fixed set of attributes
Tid Refund Marital Taxable
Status Income Cheat

1 Yes Single 125K No

2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10
 Data Matrix
• If data objects have the same fixed set of numeric attributes,
then the data objects can be thought of as points in a multi
dimensional space, where each dimension represents a
distinct attribute

• Such data set can be represented by an m by n matrix, where

there are m rows, one for each object, and n columns, one for
each attribute

Projection Projection Distance Load Thickness

of x Load of y load

10.23 5.27 15.22 2.7 1.2

12.65 6.25 16.22 2.2 1.1
 Document Data
• Each document becomes a `term' vector,
– each term is a component (attribute) of the vector,
– the value of each component is the number of times the
corresponding term occurs in the document.

y
n
wi

pla
ball
lost

team
score
game

coach
season

timeout
 Transaction Data
• A special type of record data, where
– each record (transaction) involves a set of items.
– For example, consider a grocery store. The set of products purchased
by a customer during one shopping trip constitute a transaction, while
the individual products that were purchased are the items.
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
 Graph Data
• Examples: Generic graph and HTML Links
<a href="papers/papers.html#bbbb">
Data Mining </a>
<li>
<a href="papers/papers.html#aaaa">
2 Graph Partitioning </a>
<li>
1 <a href="papers/papers.html#aaaa">
5 Parallel Solution of Sparse Linear System of Equations </a>
<li>
2 <a href="papers/papers.html#ffff">
N-Body Computation and Dense Linear System Solvers
5
 Chemical Data
• Benzene Molecule: C6H6
 Ordered Data
• Sequences of transactions
Items/Events

An element of
the sequence
 Ordered Data
• Genomic sequence data
GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG
 Ordered Data

• Spatio Temporal Data

Average Monthly
Temperature of
land and ocean
 Data Quality
• What kinds of data quality problems?
• How can we detect problems with the data?
• What can we do about these problems?

• Examples of data quality problems:

– Noise and outliers
– missing values
– duplicate data
 Noise
• Noise refers to modification of original values
– Examples: distortion of a person’s voice when talking on a poor
phone and “snow” on television screen

Two Sine Waves Two Sine Waves +

Noise
 Outliers
• Outliers are data objects with characteristics that are considerably
different than most of the other data objects in the data set
 Missing Values
• Reasons for missing values
– Information is not collected
(e.g., people decline to give their age and weight)
– Attributes may not be applicable to all cases
(e.g., annual income is not applicable to children)

• Handling missing values

– Eliminate Data Objects
– Estimate Missing Values
– Ignore the Missing Value During Analysis
– Replace with all possible values (weighted by their probabilities)
 Duplicate Data
• Data set may include data objects that are duplicates, or
almost duplicates of one another
– Major issue when merging data from heterogeous sources

• Examples:
– Same person with multiple email addresses

• Data cleaning
– Process of dealing with duplicate data issues
 Data Preprocessing
• Aggregation
• Sampling
• Dimensionality Reduction
• Feature subset selection
• Feature creation
• Discretization and Binarization
• Attribute Transformation
 Aggregation
• Combining two or more attributes (or objects) into a single
attribute (or object)
• Purpose
– Data reduction
• Reduce the number of attributes or objects
– Change of scale
• Cities aggregated into regions, states, countries, etc
– More “stable” data
• Aggregated data tends to have less variability
 Aggregation
Variation of Precipitation

Standard Deviation of Standard Deviation of

Average Monthly Average Yearly
Precipitation Precipitation
 Sampling
• Sampling is the main technique employed for data selection.
– It is often used for both the preliminary investigation of the data and
the final data analysis.

• Statisticians sample because obtaining the entire set of data

of interest is too expensive or time consuming.

• Sampling is used in data mining because processing the

entire set of data of interest is too expensive or time
consuming.
 Sampling
• The key principle for effective sampling is the
following:
– using a sample will work almost as well as using
the entire data sets, if the sample is
representative

– A sample is representative if it has approximately

the same property (of interest) as the original set
of data
 Types of Sampling
• Simple Random Sampling
– There is an equal probability of selecting any particular item

• Sampling without replacement

– As each item is selected, it is removed from the population

• Sampling with replacement

– Objects are not removed from the population as they are selected for
the sample.
• In sampling with replacement, the same object can be picked up more
than once

• Stratified sampling
– Split the data into several partitions; then draw random samples from
each partition
 Sample Size

8000 points 2000 Points 500 Points

 Sample Size
• What sample size is necessary to get at least
one object from each of 10 groups.
 Curse of Dimensionality
• When dimensionality
increases, data becomes
increasingly sparse in the
space that it occupies

• Definitions of density and

distance between points,
which is critical for
clustering and outlier
detection, become less
meaningful
• Randomly generate 500 points
• Compute difference between max
and min distance between any pair
of points
 Dimensionality Reduction
• Purpose:
– Avoid curse of dimensionality
– Reduce amount of time and memory required by data
mining algorithms
– Allow data to be more easily visualized
– May help to eliminate irrelevant features or reduce noise

• Techniques
– Principal Component Analysis
– Singular Value Decomposition
– Others: supervised and non linear techniques
 Dimensionality Reduction: PCA
• Goal is to find a projection that captures the
largest amount of variation in data
x2

x1
 Dimensionality Reduction: PCA
• Find the eigenvectors of the covariance matrix
• The eigenvectors define the new space
x2

x1
 Feature Subset Selection
• Another way to reduce dimensionality of data

• Redundant features
– duplicate much or all of the information contained
in one or more other attributes
– Example: purchase price of a product and the
amount of sales tax paid

• Irrelevant features
– contain no information that is useful for the data
mining task at hand
– Example: students' ID is often irrelevant to the
 Feature Subset Selection
• Techniques:
– Brute force approch:
• Try all possible feature subsets as input to data mining
algorithm
– Embedded approaches:
• Feature selection occurs naturally as part of the data
mining algorithm
– Filter approaches:
• Features are selected before data mining algorithm is run
– Wrapper approaches:
• Use the data mining algorithm as a black box to find best
subset of attributes
 Feature Creation
• Create new attributes that can capture the
important information in a data set much
more efficiently than the original attributes

• Three general methodologies:

– Feature Extraction
• domain specific
– Mapping Data to New Space
– Feature Construction
• combining features