Molecular Basis of Inheritance – Extra questions

1. What are 5’ end and 3’ end of a polynucleotide chain?

A- The polynucleotide chain has a free phosphate moiety at the 5th position of the pentose sugar, is
known as 5’ end
The 3rd position of the position of the pentose sugar has free OH group, this end is called 3’ end.
2. Draw Schematic Diagram of a part of double stranded polynucleotide DNA chain, having all 4
nitrogenous bases and showing the polarity.
A refer Fig 5.2
3. How do histones acquire positive charge?
A- Histones are rich in basic amino acids such as LYSINES AND ARGININES, which carry positive
charges in their side chains, hence histones are positively charged.
4. Describe the structure of nucleosome.
Or Explain the role of histones in forming a nucleosome.
A- A nucleosome consists of histones which are positively charged proteins and negatively charged
DNA
Eight molecules of histones are organized to form a unit, called histone octamer.
The negatively charged DNA of about 200 bp bound around the histone octamer to form a
nucleosome. Each nucleosome is a bead like structure, The whole DNA appear as beads on a string.
5. Explain the two factors responsible for conferring stability to the double helix structure of DNA.
An- DNA is structurally more stable because it is double stranded and the two strands are
complimentary to each other, there is base airing between complimentary strands, and stacking
between adjacent baes. Even if they are separated by heat or chemicals), can come together when
suitable conditions are provided.
6. Draw a poly nucleotide chain with 4 different types of nucleotides and locate the following bonds,
(or Name the different types pf bonds)
a. N-Glycosidic linkage b. Phospho di ester bond
c. Name the components of a nucleotide (Ans. Nitrogenous base, pentose sugar, Phosphate group)
ii. How are base pairs held together in a DNA molecule? Explain the base complimentarity rule.
Name the scientist who framed this rule.
An:. In the basepairs of DNA Adinine and Thymine are held by two weak H -bonds and guanine and
cytosine are hele together by three H- bonds.
In a DNA double helix, a purine always pairs with a pyramidine. Adinine always pairs with Thymine
and Guanine always pairs with Cytosine. Erwin Chargaff observed that ratios between A-T, and C- G
are constant and equal to 1.
7. What is meant by antiparallel polarity of DNA?
The Two chains of a DNA are anti parallel means that each strand has opposite polarity, ie, one strand
shows 3’->5’ polarity and the other strand has 5’ ->3’ polarity.
8. Explain how a very long DNA molecule (2.2m in mammals) packed with in a tiny nucleus (10-6m)
in the cell.
An:- In the mammalian cells (or eukaryotes ) there is a set of positively charged basic proteins, called
histones. Histones are organised to form a unit of eight molecules, called histone octamer.
- The negatively charged DNA is wrapped around the positively charged histone octamer to
form a structure called nucleosome.
- A typical nucleosome contains 200bpof DNA helix.
- The nucleosome constitute the repeating units of chromatin, which appear as beads on string
structure under electron microscope.
- These are further packaged by coiling to form the chromatin fibres, which condense to form
chromosomes.
- The packaging of DNA at higher levels requires additional set of proteins called non histone
chromosomal (NHC) proteins
9. Draw a neat labelled diagram of a nucleosome. Name the two basic aminoacids present mainly
in the nucleosome. (Ans: Refer Text book diagram)
10. Differentiate between Euchromatin and Hetero chromatin.
An:. -The regions of a chromatin, which are light, are the regions where chromatin is loosely
packed , they are called euchromatin.
-The regions of a chromatin which are stained dark, are the regions where chromatin is tightly
packed, they are called hetero chromatin.
- Euchromatin is transcriptionally more active, while hetero chromatin is inactive.
10. write the salient features of DNAdouble helix. (refer text book)
11. what is meant by central dogma in molecular biology and who proposed it?
An:-Francis Crick proposed central dogma of molecular biology.
It states that the genetic information flows from DNA->RNA ->Protein. DNAs by the process of
replication produces new DNAs, and RNA is produced from the DNA by the process of Transcription,
RNA is used to produce by the process of translation.
Reverse Transcription- In some viruses the genetic information passes from RNA to DNA, this
process is known as reverse Transcription, in which a DNA strand is produced corresponding to RNA
strand.
11. State the dual role of deoxyribonucleoside triphosphates during DNA replication.
An: i. The deoxyribonucleoside triphosphates are the building blocks for the DNA strand or
polynucleotide chain.
ii. they also serve as energy source in the form of ATP and GTP
12. Draw a neat labelled diagram showing replication fork of DNA.
Ans- fig 5.8
13. Discuss the enzyme DNA ligase plays during DNA replication.
An- DNA ligase joins the short fragments of DNA that are produced by discontinuous synthesis, into a
lagging strand. It also joins the two strands of DNA by forming H bonds between the complimentary
strands.
14. Why both the strands of DNA are not copied during transcription?
An- Both the strands of DNA are not copied during transcription for the following reasons-
i. If both strands are copied, two different RNAs and hence two different polypeptide chains are
produced. If a single segment of DNA produces two polypeptide chains, genetic information become
complicated.
ii. The two complimentary strands of RNA molecules produced simultaneously would form a double
stranded RNA, which don’t allow translation.
15. Why is transcription is coupled with translation prokaryotes but not in eukaryotes?
An- In prokaryotes the mRNA does not require processing to become active.
ii. Transcription and translation occur in the same place called cytosol of the cell, as there is no well
defined nucleus. So coupling is possible in prokaryotes.
iii. In eukaryotes the mRNA has to be processed (Splicing) before becoming active
iv.In eukaryotes the RNAs produced (Transcription) inside nucleus, then to be transported to the
cytoplasm for translation. So coupling not possible.
16. What is splicing of RNA? Where does it occur?
An- Since hnRNA contains both introns and exons it has under go splicing, to remove the introns
which are the non coding sequences. After splicing all exons are joined together to form the functional
mRNA. Splicing occurs in the nucleus.
17. Name the scientist who suggested that the genetic code should be made of a combination of three
nucleotides. Explain the basis on which he arrived at this conclusion.
An- George Gamov suggested the triplet code for the first time.
There are only four bases and they have to cod for 20 amino acids. If the code will have a
combination of three nucleotides, a permutation combination of 43(4 x4 x4), would generate 64
codons, ie, many more codons than required number for the 20 amino acids.
18. Following are the features of genetic code. What does each one indicate?
Stop codon- is a codon that does not for any amino acid and terminates the process of translation;
there is no tRNA for a stop codon.
Unambiguous - A codon is unambiugous as it code for one specific amino acid only.
Degenerate- a codon is said to be degenerate, as certain amino acids are coded by more than one
codon.
Universal- A particular codon , codes for a same amino acids in all organisms, be it a bacterium or
humans .
19. Mention the exceptions of universal rules of codons.
The exceptions of universal rule for codons are-
i. The mitochondrial codons
ii. some codons of protozoans.
19. Explain the discovery made by Hershey and Chase, using radio active sulphur and radio active P
in their experiment.
An- They used radioactive S and radioactive P to distinguish between proteins and DNA, to prove
which of these is the genetic material.
-The viruses /bacterio phages grown on radioactive sulphur (S35) contained radioactive protein, but
not radioactive DNA, because DNA does not contain sulphur.
-When these viruses were allowed to infect bacteria, the bacteria did not contain radioactivity, because
proteins did not enter the bacteria; hence protein is not the genetic material.
- the viruses grown on radioactive phosphorus P-32 Contained radioactive DNA because DNA
contains phosphorus and not proteins.
-When These viruses were allowed to infect the bacteria, the bacteria were radioactive, indicating that
DNA has passed from the virus into the bacteria.
- they concluded that DNA is the genetic material that has passed from the virus into the bacteria.
20. Why is DNA molecule considered as a better hereditary material than RNA molecule?
AN – DNA is a better genetic material for the following reasons;
1. The genetic material should be stable and should not change with age or change in physiology, this
stability is given to DNA by its double stranded nature, presence of thymine and the plane of base
pairs stacking over the other.
2. because 2’-OH Group of RNA nucleotide is a reactive group, it makes RNA labile and easily
degradable; it is absent in DNA.
3. RNA (23s RNA) He is also catalytic, that is it is reactive, but DNA is less reactive and more stable.
21. It is established that RNA is the first genetic material. Explain giving reasons.
AN – RNA is the first genetic material because -
1. RNA can directly code for the synthesis of proteins and hence can easily express the character; it is
the genetic material in many viruses.
2. RNA can also act as a catalyst, there are some important biochemical reactions in living systems
that are catalyzed by RNAs and not proteins.
3. Many essential life processes like splicing, translation etc have evolved around RNA.
22. Answer the following questions based on Meselson and Stahl experiment on E .coli
a. write the name of the chemical substance used as the only source of nitrogen in the experiment.
B. Why did they allow the synthesis of the light and heavy DNA molecules in the experiment?
C. How did they distinguish the heavy DNA molecules from the light DNA molecules? Explain.
d. Write the conclusion, the scientist arrived at, at the end of the experiment.
Ans- a. NH4Cl ( ammonium chloride)
b- It was done to show that after one generation of E. coli with N15-DNA, in a medium of N14
the DNA was of intermediate density between the light and heavy DNAs, it shows that of the two
strands, only one strand is synthesised newly, using the N14 as the nitrogen sourcein the medium.
c. The heavy and light DNA molecules can be distinguished by centrifugationin a cesium chloride
(CsCl) density gradient, the N15 -DNA was heavier than N14 -DNA and the hybrid
N15- N14 DNAwas intermediate between the two.
d- They concluded that DNA replication is semi- conservative, ie, of the two strands of DNA, one is
the parental strand while the other is synthesised new.
23. Why does DNA replication occurs within a replication fork and not in its and their length
simultaneously?
- DNA replication is continuous and discontinuous on the two strands within the replication fork. Give
reasons.
An- Replication of DNA occurs in small replication forks, Because dna is such a long molecule that
the separation of the two strands along its entire length requires a very high amount of energy.

- DNA polymerase can catalyse the polymerization of nucleotide only in 5’ -3’ direction.
- So on the template strand with 3’- 5’ Polarity DNA replication is continuous.
- On the template strange with5’-3’ polarity, DNA synthesis occurs in short stretches as the
opening of replication for continuous, later these short stretches are joined by the action of
DNA ligases.
24. Explain The events occurring in a replicating fork during replication of DNA.
An- Both the strands of parent DNA function as a template strands.
- On the template strand with 3’- 5’polarity the new strand is synthesized as a continuous
stretch as the DNA polymerase can carry out polymerization of the nucleotides only in 5’- 3’
direction, this is called continuous synthesis and the strand is called leading strand.
- On the other templates strand with 5’ -3’ polarity the new strand is synthesized from the point
of replication fork, also in 5’-3’ direction. But in short stretches, they are later joined by DNA
legases to form a strand called lagging strand. (draw diagram)
25. With the help of a Diagram describe the important parts of a transcription unit in bacteria.
AN – (fig 6.8) A transcription unit has the following parts
a. Promoter- the promoter is located towards the 5’end of the coding strand or structural gene, this
sequence of DNA provides place for the RNA polymerase to bind to it an and initiate
transcription. Its presence also defines the coding and templates plans of the unit.
b. structural genes- They are located in between the promoter and Terminator sequences. They
have the information to transcribe onto the RNA.
C Terminator- the Terminator is located towards the 3’ end of the structural gene it defines the end
of the process of transcription, when the rna polymerase falls on this sequence of D N A.
26. What are the differences between the structural genes of eukaryotes and prokaryotes.?
An. In eukaryotes, the RNA produced after transcription is known as heterogeneous nuclear RNA
(hnR N A) the primary transcript of hnRNA has coding sequences called exons as well as non
coding sequences called introns, ie, they are split genes. It undergoes a process called splicing in
which the introns are removed and the exons are joined together in a particular manner to form
the functional mRNA.
In prokaryotes, The mRNA is polystyronic that is codes for more than one polypeptide. the
information is continuous and no splicing is required.
27. Explain the role of RNA polymerase in transcription in bacteria.
An- *A single DNA-dependent RNA Polymerase catalyses the formation of mRNA, tRNA, rRNA
in bacteria.
*The enzyme is capable of catalyzing only the elongation step of transcription.
*It helps to bind the initiation factor or sigma factor with the promoter and initiate transcription.
*It’s somehow facilitates the opening of the DNA helix and catalyses the polymerization of
ribonucleoside triphosphates in a template dependent fashion, that is elongation.
When it reaches the Terminator sequence, the enzyme associates transiently with the termination
or rho- factor that terminates transcription, the RNA and the enzyme fall off the template.
28. How are the following formed and involved in DNA packaging in a nuclear of a cell?
i. Histone octamer ii. Nucleosome c. Chromatin
Ans- i. Eight molecules of the positively charged protein histones are organized to form a unit
called histone octamer
ii. A nucleosome is formed When the negatively charged DNA of about 200 BP is wrapped around
the positively charged histone octamer.
iii. Chromatin is a threatless colored structure formed by the repeating units of nucleosomes.
The chromatin fibers are further coiled and condensed at metaphase stage of cell division to form
chromosomes.
The packaging of chromatin at higher level requires another set of proteins called non histone
chromosomal (NHC) proteins
29. Describe the experiment conducted by F Griffith in 1928 with the Streptococcus pneumoniae
and write the conclusion he arrived at.
B. State the contribution ofAvery, Mac Leod and Mc Carty In providing the biochemical nature to
the results as obtained by Griffith.
Ans- Frederic Griffith in 1928 performed the experiments on bacterial transformation with
Streptococcus pneumoniae, The bacterium that causes pneumonia.
He observed two strains of the bacteria one forming smooth shiny colonies S type and the other
forming rough colonies are type. The S -type are where provided with a mucous coat made up of
polysaccharide which gave the smooth appearance, the mucous coat was absent in the R type.
In the S- type the cells are virulent while the R type cells are non-virulent.
- When live s type cells were injected into the mice they suffered from pneumonia and died.
- S strain----→injected into mice ---→Mice died
- When live R type cells were injected into the mice the disease did not appear and the mice
survived.
- R-strain --→ injected in to mice ---→Mice Alive
- When heat killed S-type cells were injected the disease did not appear.
- S-strain (heat killed) --→ injected in to mice ---→Mice Alive
 - When he’d killed S type Cells were mixed with live R type cells and injected into the mice
,the mice died of pneumonia and live s-type cells were isolated from the body of the mice.
- S-strain (heat killed+ R-strain --→ injected in to mice---→Mice died
- The concluded that the R strain had somehow been transformed by the heat killed S strain
bacteria into virulent R- strain which must be due to the transfer of genetic material, the
transforming principle.
b. Avery, Mac Leod and Mc Carty Beauty fired biochemicals like proteins, DNA, and RNA from
the Heat killed S- cells.
When these fractions were added individually to the culture of life R-cells, DNA was able to
cause transformation of R- cells into S cells.
They also found that protein digesting enzymes and RNA digesting enzymes did not affect
transformation, indicating that transforming substance is not a protein or RNA.
Digestion with DNase Inhibited the transformation, this suggests that the DNA caused the
transformation.
Q. Why does hnRNA undergo splicing? Where does splicing occur in the cell?
Answer:
hnRNA undergoes splicing to remove non-coding sequences, i.e. introns and joins exons. Splicing
occurs in the nucleus of the cell.

Q. What will happen if DNA replication is not followed by cell division in a eukaryotic cell?
Answer:
If cell division is not followed after DNA replication then replicated chromosomes (DNA) would not
be distributed to daughter nuclei. A repeated replication of DNA without any cell division results in
the accumulation of DNA inside the cell.
This would increase the volume of the cell nucleus, thereby causing cell expansion. Further, it will
lead to polyploidy.

Name the enzyme and state its property that is responsible for continuous and discontinuous
replication of the two strands of a DNA molecule.
Answer:
DNA-dependent DNA polymerase This enzyme can polymerise deoxynucleotides in 5′ → 3′ direction
only.
Due to this, replication of DNA is continuous in one strand with polarity 3′ → 5’while discontinuous
in another polarity 5′ → 3′.

Q. Name the specific components and the linkage between them that forms deoxyadenosine.
Answer:
The specific components of deoxyadenosine are adenine and deoxyribose. These are linked by N-
glycosidic linkage.

Q. A template strand is given below. Write down the corresponding coding strand and the mRNA
strand that can be formed, along with their polarity.
3′- ATGCATGCATGCATGCA TGCATGC-5′
Answer:
For the given template strand 3- ATGCATGCAT GCATGCATGCATGC- 5′
Coding strand is 5′- TACGTACGTACGTACGTACG TACG – 3′
and mRNA strand is 5′- UACGUACGUACGUACGU ACGUACG – 3′
Answer the questions based on the dinucleotide shown below.

(i) Name the type of sugar guanine base is attached to.

(ii) Name the linkage connecting the two nucleotides.
(iii) Identify the 3′ end of the dinucleotide. Give a reason for your answer. (All India 2010C)
Answer:
(i) Pentose sugar or deoxyribose sugar.
(ii) Two nucleotides are linked through 3′-5′ phosphodiester linkage to form a dinucleotide.
(iii) The ribose sugar has a free 3′ – OH group which is referred to as 3’end of the polynucleotide
chain.

Q. Explain the mechanism of DNA replication with the help of a replication fork. What role does the
enzyme DNA-ligase play in a replication fork?
Answer:
Replication in DNA strand occurs within a small opening of the DNA helix, known as replication
fork.( figure- 6.8),
DNA polymerases catalyse polymerisation only in one direction, i.e. 5′ → 3′. It creates additional
complications at the replicating fork. Consequently, on one strand (template 3′ → 5′), the replication
is continuous. This is known as leading strand, while on the other strand (template 5′ → 3′), it is
discontinuous. This is known as lagging strand.
The discontinuously synthesised fragments called Okazaki fragments are later joined by DNA ligase.

Name the three polymerases found in eukaryotic’cells and mention their functions. (2018C)
Answer:
Three types of RNA polymerases are found in eukaryotic cells and their functions are as follows

• RNA polymerase-I transcribes rRNAs.

• RNA polymerase-II transcribes the precursor of mRNA called hnRNA.
• RNA polymerase-III transcribes tRNA, 5 SrRNA and swRNAs.

Study the diagram given below:

Name the linkage X, Y, Z and the respective molecules formed by them.

Answer:
X : N-glycosidic linkage. It forms nucleoside.
Y : Phosphoester linkage. It forms nucleotide.
Z : 3′-5’phosphodiester linkage. It forms polynucleotide.
Q. Describe the experiment that helped demonstrate the semi-conservative mode of DNA replication.
Or
How was a heavy isotope of nitrogen used to provide experimental evidence to semi-conservative
mode of DNA replication?
Answer:
Matthew Meselson and Franklin Stahl conducted an experiment with Escherichia coli (1958) as
follows

• They grew many generations of E. coli in a medium that contained 15NH4Cl (15N is the
heavy isotope of nitrogen) as the only source of nitrogen. The result was that 15N was
incorporated into the newly synthesised DNA. Upon centrifugation in a cesium
chloride (CsCl) density gradient, this heavy DNA molecule could be distinguished
from the normal DNA.
• The cells were then transferred into a medium containing normal 14NH4Cl.
• At definite time intervals, as the cells multiplied, samples were taken and the DNA
which remained as double-stranded helices were extracted.
• The samples were separated independently on CsCl gradient to measure the densities
of DNA.
• The DNA obtained from the culture, one generation after the transfer from 15N to 14N
medium had a hybrid or intermediate density.
• The DNA obtained from the culture after another generation (generation II), was
composed of equal amounts of hybrid DNA and Tight’ DNA.
Fig-6.7

Thus, Meselson and Stahl concluded that the DNA replication is semi-conservative, i.e. out of the two
strands of DNA one is the parental
strand, while another is newly synthesised.

Q. (i) Differentiate between a template strand and coding strand of DNA.

(ii) Name the source of energy for the replication of DNA.
Answer:
(i) Differences between template strand and coding strand are as follows

Template strand Coding strand

It has 3′- 5’polarity. It has 5′- 3’polarity.

It gets transcribed. It does not get transcribed.

Its sequence is complementary to mRNA Its sequence is same as mRNA except it

formed. contains ‘T’ instead of ‘U’.

(ii) The source of energy for the replication of DNA are the deoxyribonucleoside triphosphates that
have two terminal high energy phosphates.
 A DNA segment has a total of 2000 nucleotides, out of which 520 are adenine containing nucleotides.
How many purine bases this DNA segment possesses?
(ii) Draw a diagrammatic sketch of a portion of DNA segment to support your answer.

Fig 6.3

i) Given, A = 520
therefore, T = 520
A + T = 520 + 520 = 1040
Total number of nucleotides = 2000
G + C = 2000 – 1040 = 960
G = 960/2 = 450
Hence, total number of purine bases are
⇒ A + G = 520 + 480 = 1000

Q. With the help of a schematic diagram, explain the location and role of the following in a
transcription unit. Promoter, structural gene, terminator.
Answer:
Structure of a transcription unit fig 6.9

The promoter and terminator flank the structural gene in a transcription unit. The promoter is located
towards 5’end (upstream) of the structural gene and it helps to initiate transcription by binding with
RNA polymerase. The terminator is located toward 3’end (downstream) of the coding strand and it
usually defines the end of the process of transcription. The structural gene is present in between
promoter and terminator. It codes for enzyme or protein for structural functions.
(i) What are the transcriptional products of RNA polymerase-III?
(ii) Differentiate between capping and tailing.
(iii) Expand ArcRNA.
Answer:
(i) RNA polymerase-III is responsible for the transcription of tRNA, SrRNA and snRNAs (small
nuclear RNAs).
(ii) In capping process, an unusual nucleotide (methyl guanosine triphosphate) is added to ‘5’ end of
hnRNA.
In tailing process, 200-300 adenylate residues are added at 3′ end of hnRNA.
(iii) hnRNA is heterogeneous nuclear RNA.
It is established that RNA is the first genetic material. Explain giving three reasons.
Answer:
RNA is the first genetic material in cells because

• RNA is capable of both storing genetic information and catalysing chemical reactions.
• Essential life processes (such as metabolism, translation, splicing, etc.) were evolved
around RNA.
• It shows the power of self-replication.

(i) Construct a complete transcription unit with promoter and terminator on the basis of hypothetical
template strand given below.

(ii) Write the RNA strand transcribed from the above transcription unit along with its polarity.
Answer:
(i) Transcription unit

(ii) RNA strand transcribed from the above transcriptional unit

Q. How is hnRNA processed to form mRNA?

Answer:
The precursor of mRNA transcribed by RNA polymerase-II is called heterogeneous nuclear RNA
(hnRNA). It undergoes following processing to form nascent wRNA.

• Splicing In this process, the non-coding introns are removed and coding sequences
called exons are joined in a definite order. This is required because primary transcript
contains both introns and exons.
• Capping an unusual nucleotide (methyl guanosine triphosphate) is added to ‘5’ end of
hnRNA.
In tailing process, 200-300 adenylate residues are added at 3′ end of hnRNA.
• The fully processed mRNA is released from the nucleus into cytoplasm for translation.

Monocistronic structural genes in eukaryotes have interrupted coding sequences. Explain. How are
they different in prokaryotes?
Answer:
Monocistronic structural genes in eukaryotes have interrupted coding sequences due to the presence
of introns, i.e. non-coding sequences.

• Differences between monocistronic structural gene in prokaryotes and in eukaryotes are as

follows
Structural gene in eukaryotes
Structural gene in prokaryotes

Consists of both coding and non-coding

Consists of only coding sequences. sequences.

Information is split due to the presence of

Information is continuous as only exons are present. introns in between exons.

Splicing is required to make functional

There is no need of splicing. mRNA.

Q. Explain the role of 35S and 32P in the experiments conducted by Hershey and Chase.
Answer:
Hershey and Chase used 35S and 32P in their culture medium. These are radioactive sulphur and
phosphorus, respectively. These two components were used to detect whether the genetic material is
DNA or protein.

• Role of 32P and 35S Viruses grown on medium with 32S. had non-radioactive genetic material
and radioactive protein as sulphur is not present in DNA but found in protein.
While those grown on 32P had radioactive genetic material because DNA contains phosphorus
but proteins does not contain it. Thus, it was established that DNA is the genetic material.

Q. Describe the initiation process of transcription in bacteria.

Answer:
Initiation process of transcription in bacteria RNA polymerase becomes associated transiently to an
initiation factor sigma (cr) and binds to specific sequence on DNA called promoter to initiate
transcription.
A single DNA-dependent RNA polymerase catalyses the transcription of all the three types of RNA.

Q. Describe the termination process of transcription in bacteria. (Delhi 2010)

Answer:
Termination occurs when RNA polymerase reaches the terminator region and the nascent RNA falls
off. The RNA polymerase being transiently associated with termination factor rho (p) also falls off the
transcription unit.

Q. Explain the processing the /mRNA needs to undergo before becoming functional mRNA in
eukaryotes.

In eukaryotes, the primary transcript is often larger than the functional RNA, called heterogeneous
nuclear RNA or hnRNA.
Post-transcription processing is necessary to convert primary transcript of different types of RNAs
into functional RNAs.

The processing includes

• Cleavage Larger RNA precursors are cleaved to form smaller RNAs.

• Splicing Eukaryotic transcripts possess extra segments called introns which are non-
functional. They do not appear in mature or processed RNA. The functional coding
sequences are called exons. Splicing is the removal of introns and fusion of exons in a
definite order to form functional RNAs.
• Terminal additions (capping and tailing) Capping includes addition of an unusual
nucleotide to 5’ end of hrRNA. These unusual segments are CCA segment in tRNA
and cap nucleotides at 5’end of mRNA. In tailing, poly-A segment (200-300 residues)
are added at 3’end of mRNA. Cap is formed by the modification of GTP into 7-methyl
guanosine or 7 mG.
• Nucleotide modifications They are most common in tRNA-methylation (i.e. methyl
cytosine, methyl guanosine), deamination (e.g. inosine form adenine), dihydrouracil,
pseudouracil, etc.

Q. Give an example of a codon having dual function.

Answer:
AUG is a codon with dual functions. It codes for the amino acid methionine (met) and also acts as an
initiator codon of polypeptide synthesis during protein synthesis.
Q.Write the two specific codons that a translational unit of mRNA is flanked by one on either sides.
Answer:
Two specific-codons that are flanked on either sides of mRNA in a translation unit are

• Start codon (AUG)

• Stop codon (UAG or UAA or UAA).

Q. How is repetitive/satellite DNA separated from bulk genomic DNA for various genetic
experiments?
Answer:
Satellite DNA is separated from bulk genomic DNA by density-gradient centrifugation technique.

Q. State which human chromosome has

(i) the maximum number of genes and
(ii) the one which has the least number of genes.
Answer:
(i) Chromosome 1 (2968 genes).
(ii) Chromosome Y (231 genes).

Q. Which one of the two subunits of ribosome encounters an mRNA?

Answer:
Smaller subunit.

Q. Differentiate between the following: Inducer and repressor in lac operon.

Answer:
Inducer It is a chemical which after coming in contact with repressor, changes it into non-DNA
binding state, so as to free the operator gene.
Repressor It is a regulator protein meant for blocking the operator gene.

Q. Mention the contribution of genetic maps in human genome project.

Answer:
Genetic maps are used as a starting point in the sequencing of whole genome.

Q. Mention any two ways in which Single Nucleotide Polymorphisms (SNPs) identified in human
genome, can bring out revolutionary changes in biological and medical sciences.
Answer:

• By tracing human history.

• By finding chromosomal locations for disease associated sequences.

Q. Differentiate between the genetic codes given below

(i) Unambiguous and universal
(ii) Degenerate and initiator
Answer:
(i) The difference between unambiguous and universal genetic codes is as follows
Unambiguous:
In genetic code, one codon codes for only one amino acid, hence it is unambiguous.
Universal:
The genetic code is universal, i.e. each codon codes for same amino acid in all organisms.

(ii) The difference between degenerate and initiator codes is as follows

Degenerate Initiator

Some amino acids are coded by more than one

These codons act as start signal for translation,
codon, hence the code is degenerate.

e.g serine, leucine, arginine are encoded by 6 e.g. AUG acts as initiator codon and it codes for
codons. methionine.

Q. Following are the features of genetic codes. What does each one indicate?
Stop codon, Unambiguous codon, Degenerate codon, Universal codon.
Answer:

• Stop codon does not code for any amino acids, e.g. UGA.
• Unambiguous codon codes for only one . amino acid, e.g. CCG codes for proline.
• Degenerate codon Genetic code is described as degenerate when a single amino acid is
coded by more than one codon, e.g. serine is coded by 6 codons.
• Universal codons codes for the same amino acid in all organisms (except in
mitochondria and few protozoan).

Q. What is aminoacylation? State its significance.

Or
Explain aminoacylation of tRNA.
Answer:
Aminoacylation or charging of tRNA is a process in which amino acids get activated in the presence
of ATP and get linked to their cognate tRNA.
Significance of aminoacylation The charged tRNA carries amino acids to the site of protein synthesis.
If two charged tRNAs are brought close to each other, the formation of peptide bond is favoured
energetically.

Q. State the functions of ribozyme and release factor in protein synthesis, respectively.
Answer:
Ribozyme in bacteria is 23S rRNA, that acts as an enzyme for the formation of a peptide bond
between two amino acids.
Release factor binds to the stop condon (UAA) to terminate translation and release the complete
polypeptide.

Q. How would lac operon operate in E. coli growing in a culture medium, where lactose is present as
source of sugar?
Answer:
When lactose is present in a medium having E. coli, it will act as a substrate for enzyme 3-
galactosidase and switches on the operon.
Hence, it is also termed as an inducer. It inactivates repressor by binding to it and allows RNA
polymerase access to the promoter.
Q. Where does peptide bond formation occur in a bacterial ribosome and how?
Answer:
A peptide bond is formed between carboxyl group (-COOH) of amino acid at P-site and amino group
(-NH) of amino acid at A-site. It is formed by the enzyme peptidyl transferase in a bacterial ribosome.

Q. (i) Name the scientist who suggested that the genetic code should he made of a combination of
three nucleotides.
(ii) Explain the basis on which he arrived at this conclusion.
Answer:
(i) George Gamow suggested that the genetic code should be made of a combination of three
nucleotides.
(ii) George stated that a codon must be of three bases in order to code for 20 amino acids, since there
are only four bases (i.e. 43 or 4 × 4 × 4 = 64) which code for 20 amino acids.

Draw a schematic diagram of lac operon in its switched off position. Label the following
(i) Structural genes
(ii) Repressor bound to its correct positions
(iii) Promoter gene
(iv) Regulatory gene

ANS- FIG 6.14,In the absence of inducer

Q. Write the full form of VNTR. How is VNTR different from Probe?
Answer:
VNTR-Variable Number Tandem Repeat.
Difference between VNTR and Probe is as follows
VNTR:
It is a class of satellite DNA, where a small sequence is arranged tandemly in many copy numbers.
Probe:
It is a radiolabelled VNTR, used for hybridisation with DNA segments in question.

A very small sample of tissue or even a drop of blood can help determine paternity’. Provide a
scientific explanation to substantiate how it is possible. (All India 2019)
Answer:
DNA fingerprinting is the basis of paternity testing in case of disputes. This technique is used to
distinguish between individual of same species by using their DNA sample. The DNA is isolated from
the cells and further amplified to produce many copies by using polymerase chain reaction. This
amplified DNA is further processed to detect the presence of similarities between the parent and child.

Because, the DNA from sample can be amplified to produce many copies in DNA fingerprinting, only
a very small sample of tissue or even a drop of blood can help determine paternity.

Q. Expand ‘BAC’ and ‘YAC’ what are they and what is the purpose for which they are used?
Answer:
BAC — Bacterial Artificial Chromosome
YAC — Yeast Artificial Chromosome.
‘BAC’ and ‘YAC’ are used as vectors in cloning of DNA.

Q. (i) Expand VNTR and describe its role in DNA fingerprinting.

(ii) List any two applications of DNA fingerprinting technique.
Answer:
(i) VNTR The expanded form of VNTR is Variable Number of Tandem Repeats. These are short
nucleotide repeats in the DNA. These are highly specific for individuals. No two individuals have the
same VNTR.

Role of VNTR in Fingerprinting VNTRs are used as probe markers in the identification of DNA of
different individuals because no two individuals can have the same VNTRs (except in case of
monozygotic twins).

(ii) Applications of DNA Fingerprinting:

• DNA fingerprinting can identify the real genetic mother, father and offspring.
• DNA fingerprinting is very useful in the detection of crime and legal pursuits.

Q. (i) List the two methodologies which were involved in human genome project. Mention how they
were used.
(ii) Expand YAG and mention what was it used for.
Answer:
(i) Two major methodologies involved in HGP are as follows

• Expressed Sequence Tags (ESTs) This method focuses on identifying all the genes that
are expressed as RNA.
• Sequence annotation This method involves the sequencing of whole set of genome
(that contained all coding and non-coding sequence) and then assigning functions to
the different regions in the sequence.

(ii) YAC stands for yeast artificial chromosome. These were used as vectors in which fragments of
whole DNA of human were inserted and cloned.

Q. A number of passengers were severely burnt beyond recognition during a train accident. Name and
describe a modern technique that can help handover the dead to their relatives.
Or
Following the collision of two trains a large number of passengers are killed. A majority of them are
beyond recognition. Authorities want to handover the dead to their relatives. Name a modern
scientific method and write the procedure that would help in the identification of kinship.
Or
Following a severe accident, many charred-disfigured bodies are recovered from the site making the
identification of the dead very difficult. Name and explain the technique that would help the
authorities to establish the identity of the dead to be able to handover the dead to their respective
relatives.
Or
In a maternity clinic, for some reasons the authorities are not able to handover the two newborns to
their respective real parents. Name and describe the technique that you would suggest to sort out the
matter.
Answer:
The technique that can help in the identification of victims is DNA fingerprinting which is used to
distinguish between individuals of same species by using their DNA sample. The chemical structure
of DNA is same in everyone (99.9%) except the order of base pairs, i.e. only 0.1% of DNA makes
every individual unique.
DNA fingerprinting exploits the highly variable tandem repeating sequences, i.e. VNTRs for
profiling. These VNTRs are highly conserved among members of the same species.
Technique:
This technique is carried out in following steps:

• DNA Isolation DNA is extracted from the cells in a high speed centrifuge.
• Amplification Many copies of the extracted DNA can be made by the use of
polymerase chain reaction.
• Digestion of DNA by restriction endonucleases.
• Separation of DNA fragments by electrophoresis.
• Blotting Transfer of separated DNA fragments to synthetic membranes (like nylon or
nitrocellulose).
• Hybridisation, with the help of a radio-labelled VNTR probe (small segments of DNA
which help to detect the presence of a gene in a long DNA sequence). These probes
target a specific nucleotide sequence that is complementary to them.
• Autoradiography Detection of hybridised DNA fragments by autoradiography.

The presence of similarities between the victims and their relatives determines their association on the
basis of which dead bodies or newborns can be identified and handed over to their families.

Q. (i) What do ‘Y’ and ‘B’ stand for in ‘YAC’ and ‘BAG used in Human Genome . Project (HGP)?
Mention their role in the project.
(ii) Write the percentage of the total human genome that codes for proteins and the percentage of
discovered genes whose functions are known as observed during HGP.
(iii) Expand SNPs identified by scientists in HGP.
Answer:
(i) Y stands for yeast in the word YAC (Yeast Artificial Chromosome) and B stands for bacteria in the
word BAC (Bacterial Artificial Chromosome). These are used as vectors in cloning of DNA.
(ii) Less than 2% of the total human genome codes for protein, functions of 50 % of discovered genes
are not known.
(iii) SNPs stands for single nucleotide polymorphisms.

Q. Write any three goals of human genome project. (Outside Delhi 2016C)
Answer:
The following are the goals of the human genome project:

• Identify all the (approximately) 20000-25000 genes in human DNA.

• Determine the sequence of the 8 billion chemical base pairs that make up human DNA.
• Improve tools for data analysis.

Q. What is mutation? Explain with the help of an example how does a point mutation affect the
genetic code. Name another type of mutation.
Answer:
A mutation is a sudden, stable, inheritable change in genetic material. A classical example of point
mutation is a change of single base pair in the gene for p-globin chain that results in the change of
amino acid residue glutamate to valine in a cell of a person suffering from sickle-cell anaemia. It is a
genetic disease.

The other type of mutation includes frameshift insertion or deletion mutation. The insertion or
deletion of one or more bases may change the reading frame from the point of insertion or deletion.
Insertion or deletion of three or its multiple bases insert or delete one or multiple codon, hence one or
multiple amino acid may be formed in polypeptide.
Q. Explain the significance of satellite DNA in DNA fingerprinting technique.
Answer:
Significance of satellite DNA in DNA fingerprinting A DNA satellite is a region that consists of short
DNA sequences repeated many times. The variation between individuals in the lengths of their DNA
satellites forms the basis of DNA fingerprinting.

DNA satellites are of two types, i.e. microsatellites and minisatellites. Their characteristic that makes
them useful for identification is that they are highly polymorphic. The length of each satellite in DNA
is inherited.

The length of satellite regions is highly variable between people. These form small peaks during
density gradient centrifugation and thus, are invaluable for identification purposes.

Q. Describe how the lac operon operates, both in the presence and the absence of an inducer in E. coli.
Answer:
Lac operon is made up of one regulatory gene i and three structural genes (z, y, a).
Its function in the presence and the absence of inducer is as follows
(i) When inducer (lactose) is absent, i gene regulates and produces repressor mRNA. The repressor
protein binds to the operator region of operon and as a result prevents RNA polymerase to bind to the
operon. The operon is switched off in this situation.

(ii) When inducer (lactose) is present, lactose acts as an inducer and binds to the repressor. Thus,
forming an inactive repressor. The repressor fails to bind the operator region. The RNA polymerase
binds to the operator and transcripts lac mRNA.

Lac mRNA is known to be polycistronic which produces all three enzymes, i.e. P-galactosidase,
permease and transacetylase required for the hydrolysis of lact >se. Operon is switched on in this
situation.

Q. Explain the process of translation.

Answer:
Translation is the process of polymerisation of amino acids to form a polypeptide with the help of
mRNA, tRNA and ribosomes and many enzymes involved in the process.
The different phases of translation are:

• Activation of amino acids

• Initiation of polypeptide synthesis
• Elongation of polypeptide chain .
• Termi’nation of polypeptide synthesis

Q. (i) Name the scientist who postulated the presence of an adapter molecule that can assist in protein
synthesis, (ii) . Mention its role in protein synthesis.
Answer:
(i) Francis Crick proposed the presence of an adapter molecule, i.e. tRNA which could read the code
and bind to the specific amino acids, thus assisting in protein synthesis. A tRNA- functions as carrier
of amino acids and participates in protein synthesis.

Q. (i) Why is tRNA called an adapter?

(ii) Draw and label a secondary structure of tRNA. How does the actual structure of tRNA look like?
Answer:
(i) tRNA binds to a specific amino acid and it also reads the codon of the amino acid bound to it
through its anticodon. So, it is called an adapter molecule.

In actual structure, the /RNA is a compact molecule, that looks like an inverted L.

Question 117.
The following is the flow chart higlighting the steps in DNA fingerprinting technique. Identify a, b, c,
d, e and f.

Answer:
a – Restriction endonuclease
b – Polyacrylamide gel
c – Nitrocellulose or Nylon
d – VNTR e – Hybridisation
e- Autoradiography

(i) Write the contributions of the following scientists in deciphering the genetic code.
George Gamow, Har Gobind Khorana, Marshall Nirenberg, Severo Ochoa.
(ii) State the importance of genetic code in protein biosynthesis.
Answer:
(i) George Gamow coined the term genetic code and argued that since there are only four bases and if
they have to code for 20 amino acids, the code should constitute a contribution of bases.
He suggested that in order to code for all* the amino acids the genetic code should be made up of 3
nucleotides.
Har Gobind Khorana developed a chemical 52 method for the synthesis of RNA molecule with
defined base combinations (homopolymers and copolymers). Marshall Nirenberg Put forward a cell-
free system for protein synthesis that helps in deciphering the code.
Severo Ochoa Showed that the polynucleotide phosphorylase also helped in polymerising RNA with
defined sequences in a template independent manner (enzymatic RNA synthesis).

(ii) The genetic code is the set of rules by which information encoded in genetic material is translated
into proteins by living cells. The genetic code is nearly universal language that encodes directions for
cells. Their arrangement as codons, stores the blueprint for amino acid chain. This chain in turn forms
proteins which regulate the biological process in every living beings

Q. (i) Write any two different levels at which regulation of gene expression could be exerted in
eukaryotes.
(ii) Give a labelled schematic representation of ‘lac operon’ in its switched off position.
Answer:
(i) The different levels at which regulation of gene expression can be exerted in eukaryotes are
following

• Transcriptional level (formation of primary transcript).

• Processing level (regulation of splicing)