D 1.

2 – Protein synthesis
“How does a cell produce a sequence of amino
acids from a sequence of DNA bases?”

“How is the reliability of protein synthesis ensured?”

Learning Objectives
Transcription as the synthesis of RNA using a Students should understand the roles of RNA polymerase in this process.
D1.2.1
DNA template
Role of hydrogen bonding & complementary Include the pairing of adenine (A) on the DNA template strand with uracil
D1.2.2 (U) on the RNA strand.
base pairing in transcription
Single DNA strands are used as a template for transcribing a base sequence,
D1.2.3 Stability of DNA templates without the DNA base sequence changing. In somatic cells that do not
divide, such sequences must be conserved throughout the life of a cell.
Limit to understanding that not all genes in a cell are expressed at any given
Transcription as a process required for the
D1.2.4 time and that transcription, being the first stage of gene expression, is a key
expression of genes stage at which expression of a gene can be switched on and off.
Translation as the synthesis of polypeptides The base sequence of mRNA is translated into the amino acid sequence of a
D1.2.5 polypeptide.
from mRNA
Roles of mRNA, ribosomes and tRNA in Students should know that mRNA binds to the small subunit of the
D1.2.6 ribosome and that two tRNAs can bind simultaneously to the large subunit.
translation
Complementary base pairing between tRNA Include the terms “codon” and “anticodon”.
D1.2.7
and mRNA
Students should understand the reasons for a triplet code. Students should
D1.2.8 Features of the genetic code use and understand the terms “degeneracy” and “universality”.
Using the genetic code expressed as a table of Students should be able to deduce the sequence of amino acids coded by an
D1.2.9 mRNA strand.
mRNA codons
Focus on elongation of the polypeptide, rather than on the special events of
Stepwise movement of the ribosome along initiation and termination.
D1.2.10 mRNA and linkage of amino acids by peptide
bonding to the growing polypeptide chain

D1.2.11 Mutations that change protein structure Include an example of a point mutation affecting protein structure.
Transcription as the synthesis of RNA
Translation is the synthesis of a
polypeptide or protein from the base
sequence of the mRNA. Three
nucleotide bases of the mRNA code for
one amino acid. The sequence of amino
acids determines the shape of the
polypeptide and therefore the protein

http://www.csus.edu/indi v/l/loom/gene%20exp r/ov erview.jpg

Transcription is the synthesis of RNA,
using DNA as a template. It takes
place in the nucleus. The cell`s
machinery copies the gene sequence
into messenger RNA (mRNA) a
molecule that is similar to DNA. The
manufactured RNA is single stranded.
Transcription as the synthesis of RNA
Transcription is the synthesis of mRNA copied from the DNA base sequences.

https://youtu.be/gG7uCskUOrA
Transcription as the synthesis of RNA

The sequence of bases in a

gene does not give any
observable characteristics
in an organism. The
function of most genes is
to specify the sequence of
amino acids in a particular
polypeptide.

It is proteins that often

directly or indirectly
determine the observable
characteristics of an
individual.
Transcription as the synthesis of RNA
The process of transcription relies heavily
on the enzyme RNA polymerase. Watch

https://www.onlinebiologynotes.com/transcription-in-prokaryotes/
the video and note down the all the roles
of RNA polymerase in transcription.
Watch this video to focus
more specifically on the
transcription – the synthesis https://youtu.be/YlOqI3PQwjo
of mRNA from DNA.
Transcription as the synthesis of RNA
Role of RNA polymerase: Watch the video and note down the roles of RNA
polymerase in transcription.

https://www.onlinebiologynotes.com/transcription-in-prokaryotes/
Transcription as the synthesis of RNA
2 3 The strand that is read off
1
The enzyme RNA RNA polymerase moves along
(acts as a template), is called
polymerase binds to a the gene, and by doing so
the antisense strand, while
site on the DNA at the separates the double stranded
the other strand of DNA,
start of a gene. DNA into two single strands.
which is identical (except for
thymine instead of uracil) to
the RNA product is called the
sense strand.

7
The RNA separates
from the DNA at the
end of the gene, and
the DNA double helix
reforms. The RNA
4 molecule is released.
The RNA polymerase is also 5
6
Hydrogen bonding RNA Polymerase
responsible for pairing up RNA
between forms covalent
nucleotides with complementary
complementary bonds between the
bases along the DNA. Uracil
base pairs occurs. RNA molecules
replaces thymine in the RNA chain.
Transcription as the synthesis of RNA
Only one of the two DNA strands is transcribed by RNA polymerase. Annotate the
diagram with the following terms: Chromosome, sense strand (non-template strand)
antisense (template) strand, DNA double helix, mRNA, RNA polymerase, gene
Transcription as the synthesis of RNA
Practice Questions:
1. In transcription, which enzyme has a role similar to that of helicase in replication?
A. DNA polymerase III
B. Ligase
C. RNA polymerase
D. DNA polymerase I
2. Which feature is common to both mRNA and DNA?
A. Covalent bonds between adjacent nucleotides

B. Hydrogen bonds between guanine and cytosine

C. Ribose sugar attached to phosphate

D. Antiparallel arrangement of polynucleotide strands

3. The sense strand of the DNA is AGGTTCAGTCCAGT. Write down the base sequence of the mRNA transcript
Sense (non-template) strand: A G G T T C A G T C C A G T

Antisense (template) strand:

mRNA strand:
Role of hydrogen bonding and complementary base
pairing in transcription
Can you explain the role of hydrogen bonding and complemenary base pairing?
Stability of DNA templates
DNA strands can be used as a template
for transcribing a base sequence into a
messenger RNA. The fact that DNA is
stable and doesn’t change its code easily
is important for the conservation of the
original code. The stability is ensured by
the sugar-phosphate backbone and
hydrogen bonds between nucleotides.

For some somatic

(body) cells which
don’t divide to replace
itself – e.g nerve cells
– this means the code
must stay unchanged
throuhout a lifetime.
https://kids.frontiersin.org/articles/10.3389/frym.2016.00022
Stability of DNA templates

https://blog.crownbio.com/dna-damage-response#imgpopup2
The stability of DNA may become compromised by free radicals, chemicals,
cigarette smoke or exposure to UV or nuclear radiation. This damage can
lead to a (harmful or beneficial) mutation. Cells have repair mechanism in
place to help fixing the problem, but they are not always successful.
Transcription is required for the expression of genes
Gene expression is the
process by which information
carried by a gene is turned
into an observable effect on
an organism. This occurs by
transcription and translation.

The DNA sequence itself

does not determine the
observable characteristics,
only the specific sequence
which is transcribed does.
Transcription is required for the expression of genes
….But not all genes in the human genome are expressed (translated and transcribed)
Genes can be ”switched on” and “switched off”. The expression pattern of a
cell depends on the information from both inside and outside the cell.

Needs a protein called Needs neurotransmitters to

alcohol dehydrogenase to deliver messages to other nerve
break down alcohol cells for communication.
The alcohol
dehydrogenase gene In the nerve cell
is transcribed into nucleus the
RNA and the neurotransmitter
corresponding gene is expressed,
protein is translated. while the alcohol
The neurotransmitter dehydrogenase
gene is not gene is “switched
expressed. off.

“Switched off”

“Switched off”
Features of the genetic code
The genetic code carries the message for the sequence of amino acids in a
polypeptide. Three bases on the transcribed strand of the DNA correspond to
one triplet of bases on the mRNA. The triplet of bases is called a codon.

The genetic code is said to

be universal. All organism
use the same 4 letter code
(C, T, A and G).

The genetic code is written in

triplets of bases called codons.
Because there are four bases,
there are 64 different codon
combinations (4 x 4 x 4).

Each codon corresponds to one

specific amino acid out of the
20 different ones that exist.
Different codons can code for
the same amino acid – this is
referred to as degenerate.
Features of the genetic code
The genetic code is the set of rules by which information encoded in mRNA
sequences is converted into proteins (amino acid sequences) by living cells.

Conversion
tables, such as
the ones shown
on the right are
used to
translate the
triplets of bases
(the codons)
into their
respective
amino acid
sequence of the
polypeptide.

Degeneracy of the genetic code refers to the fact that different combinations of
codons can result the expressing the same amino acid. Give one specific example.
Features of the genetic code
How is the genetic code like a scrambled sentence?
Use the genetic code expressed as a table of codons
1. Using the genetic code table on the right, deduce the codons for
a. methionine (met)
b. tyrosine (tyr)
c. arginine (arg)

2. Deduce the amino acid sequences that correspond to these mRNA sequences:
a. ACG
b. CACGGG
c. CGCGCGAGG

3. If mRNA contains the base sequence CUCAUCGAAUAACCC

a. Deduce the amino acid sequence of the polypeptide translated from the mRNA

b. Deduce the base sequence of the template (antisense) strand transcribed to produce the mRNA
Use the genetic code expressed as a table of codons
Can you “transcribe” the genetic code below?
Use the genetic code expressed as a table of codons
1. Deduce the codon(s) that translate for Aspartate

2. If mRNA contains the base sequence

AUGCUGACUAGGUCCGGAUGA
Deduce the amino acid sequence of
the polypeptide translated

3. Deduce the base sequence of the DNA antisense strand from which the
mRNA was transcribed.

4. If mRNA contains the base sequence ACUAAC deduce the base sequence of
the DNA sense strand.
 Roles of mRNA, ribosomes and tRNA in translation
Transfer RNA (tRNA) molecules translate the base sequence of mRNA
to an amino acid sequence. They have an anticodon of three bases that
bind to a codon on mRNA via complementary base pairing. tRNA
molecules carry amino acids corresponding to their codon
http://classes.midlandstech.edu/carterp/Courses/bio225/chap08/08-10_Translation-6_1.jpg

The ribosomes act

as the binding site
for mRNA and tRNA.
They catalyse the
peptide bonds
between amino
acids of the
polypeptide.

mRNA has a site to which a ribosome can bind and a sequence of codons
that specifies the amino acid sequence of the polypeptide (including start
and stop codon). One mRNA molecule can be translated many times.
Roles of mRNA, ribosomes and tRNA in translation
Translation takes place in free,
and membrane bound ribosomes
using the mRNA strand produced
during transcription.

Ribosomes are composed of two

subunits: a large and a small
subunit. Both subunits are
composed of long strands of rRNA.

When synthesizing a new The ribosome

then walks down
protein, the two subunits lock
the messenger
together with a messenger RNA RNA three
trapped in the space between. nucleotides at a
time, building a
new protein
piece-by-piece.
http://rna.ucsc.edu/rnacenter/images/70s_atrna.jpg
Translation
Stepwise movement of the ribosome
along mRNA and linkage of amino
acids by peptide bonding to the
growing polypeptide chain. Translation
of an mRNA molecule is done by
repeating cycle steps.
https://1drv.ms/v/s!Au8ZKE_EDcrQgp4qJUlVfrVCo59wqw?e=17rUi7

Each cycle results in the

addition of one amino
acid to the growing
polypeptide chain.
During each cycle the
ribosome moves three
bases (one codon) along.
Translation
Carefully watch the video and try to get a grasp of the process of
translation. Pay attention to the different sites (EPA) on the ribosome,
peptide bond formation and the movement of the ribosome.

https://1drv.ms/v/s!Au8ZKE_EDcrQhLQ85ryy8v3-CF8DEA?e=iMsfUu
Translation
With the help of the previous two videos, try to annotate the diagram to describe the stepwise
movement of the ribosome along the mRNA during elongation.

1 2 3

The small ribosomal Now the first tRNA loaded The large subunit can now
subunit attaches to the with an amino acid specific bind to close the complex.
mRNA and slides along the to the corresponding
molecule in a 5 prime to 3 anticodon (here methionine)
prime direction until it attaches to a site on the
recognizes the start codon ribosome called the P-site
with the bases AUG.
Translation The ribosome has three
binding sites (E, P and A).
The second tRNA carrying
an amino acid binds with
4 its anticodon to the
Elongation is repeated complementary codon at
multiple times until the the A (amino acetyl) site
stop codon is reached. of the ribosome.
5

The empty The ribosome moves

6
tRNA in the along the mRNA by
Peptide bond
E-site 7 one codon in 5’ -> 3’
formation between the
separates direction, causing the
second tRNA to move amino acid on the
from codon tRNA and the amino
from the A to the P
on the acid in the P site. The
site, and the first from
ribosome. the P to the E site. polypeptide formed by
this is transferred to
the tRNA in the A-site.
Comparing Transcription and Translation

Transcription Translation
Required molecules
Coding sequence
Product
Location
Direction of synthesis
Source of energy
Practice questions:
1. The sequence of nucleotides in a section of RNA is GCCAUACGAUCG
What is the base sequence of the DNA sense strand?

A. CGGUAUGCUAGC
B. GCCATACGATCG
C. CGGTATGCTAGC
D. GCCAUACGAUCG (Total 1 mark)

2. What sequence of processes is carried out by the structure labelled X during translation?

A. Combining with an amino acid and then binding to an anticodon

B. Binding to an anticodon and then combining with an amino acid
C. Binding to a codon and then combining with an amino acid
D. Combining with an amino acid and then binding to a codon (Total 1 mark)
Mutations that change protein structure
A gene mutation is a change to the base sequence of a gene. Even a mutation
as small as a single base substitution changes a codon to a different one. Look
at the image below – can you tell what the consequences of this might be?
Mutations that change protein structure
Part 1: Make a protein
Launch the ConnectedBio Protein Synthesis simulation.
1. Enter this DNA nucleotide sequence (avoid extra spaces!):
ATGCTCTGTTTTATCTACGTCTCACCAACAGC
2. Click Transcribe and watch the simulation.
3. Click Translate and watch the simulation.
4. Examine the resulting protein.
a. Click the amino acids to learn their names and about
their characteristics.
b. What do you notice about the amino acids?
c. Take a screenshot of the polypeptide you have obtained.

Part 2: Make Guided Changes

1.Click on Edit the DNA nucleotide sequence. Count to the ninth (9th) DNA nucleotide and substitute the
Thymine (T) for an Adenine (A). Click Rerun the simulation and examine the resulting protein.
a. Take a screenshot and put it next to the one from Part 1.
b. Compare the new protein to the one from before. What do you notice?

2.Now, click again on Edit the DNA nucleotide sequence. Substitute a C for the ninth nucleotide.
e. Rerun the simulation and examine the resulting protein
a. Compare the new protein to your screenshot from Part 1 and 2.
b. What do you notice?
Part 3: Discuss
With a partner discuss: Does a DNA mutation always change the protein? Why or why not? How does a
mutation change a protein?
Mutations that change protein structure
Sickle cell anemia is a disease which is caused by a mutation in the DNA
which changes the oxygen transporting polypeptide structure of the
protein hemoglobin which is contained in red blood cells.
In the sickle cell
(antisense) disease, the human
chromosome number
11 is the one which
experiences a base
(antisense) substitution mutation
of a gene (Hb) resulting
in the polypeptide
beta-globin to change
shape and structure.

The ability to transport oxygen (the

normal function of red blood cells) is
greatly impaired, and the sickled shape of
the blood cells leads to a number
ofdiffernet symptoms in affected people.
Mutations that change protein structure
Mutations that change protein structure
Consequences of sickle cell anemia

The polypeptide chain of the mutated beta-globin changes its structure due to the
altered interactions between amino acids. The hydrophobic interactions between
amino acids in the protein transform the hemoglobin into rigid fibers, resulting in a
change in shape. This new structure is referred to as a sickle shape.
Mutations that change protein structure

http://sgugenetics.pbworks.com/f/1353358655/01_12-sickle_cell_mutation.jpg
Sickle cell anaemia is caused by the substitution of
A………………………… by T……………………… in the sense
strand of the gene for β-haemoglobin so that the
sequence G……… on the sense strand of the normal
gene becomes G…………… in the mutated gene. During
transcription, the mRNA codon is changed from G………
to G…………… which means that during translation the
amino acid in the β-haemoglobin polypeptide
g……………………..……… is replaced by the amino acid
v…………………………. Since these two amino acids have
different properties from each other, the structure of
the resulting protein is changed, and the red blood cell
becomes s………………………… - shaped. This can cause
blockages in blood vessels called a …………………………,
pain in bones and joints, organ damage, and
shortened life of red blood cells which leads to a
condition called a…………………………
Mutations that change protein structure

The normal biconcave

disc shape of the red
blood cell is changed
to a 'sickle' shape.