TRAINER’S MANUAL

Introduction to Next Generation Sequencing

Hands-on Workshop

Bioplatforms Australia (BPA)

The Commonwealth Scientific and Industrial Research Organisation (CSIRO)

TRAINER’S MANUAL
 Licensing

This work is licensed under a Creative Commons Attribution 3.0 Unported License and
the below text is a summary of the main terms of the full Legal Code (the full licence)
available at http://creativecommons.org/licenses/by/3.0/legalcode.

You are free:

to copy, distribute, display, and perform the work
to make derivative works
to make commercial use of the work

Under the following conditions:

Attribution - You must give the original author credit.

With the understanding that:

Waiver - Any of the above conditions can be waived if you get permission from
the copyright holder.
Public Domain - Where the work or any of its elements is in the public domain
under applicable law, that status is in no way affected by the license.
Other Rights - In no way are any of the following rights affected by the license:

• Your fair dealing or fair use rights, or other applicable copyright exceptions
and limitations;
• The author’s moral rights;
• Rights other persons may have either in the work itself or in how the work
is used, such as publicity or privacy rights.

Notice - For any reuse or distribution, you must make clear to others the licence
terms of this work.
 Contents

Licensing 3

Contents 4

Workshop Information 7
The Trainers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
Providing Feedback . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10
Document Structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10
Resources Used . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11

Data Quality 13
Key Learning Outcomes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
Resources You’ll be Using . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
Useful Links . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
Prepare the Environment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
Quality Visualisation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
Read Trimming . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19

Read Alignment 25
Key Learning Outcomes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
Resources You’ll be Using . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
Useful Links . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28
Prepare the Environment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28
Alignment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28
Manipulate SAM output . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
Visualize alignments in IGV . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
Practice Makes Perfect! . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

ChIP-Seq 33
Key Learning Outcomes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34
Resources You’ll be Using . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36
Prepare the Environment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36
Finding enriched areas using MACS . . . . . . . . . . . . . . . . . . . . . . . . 36
Viewing results with the Ensembl genome browser . . . . . . . . . . . . . . . . 38
Annotation: From peaks to biological interpretation . . . . . . . . . . . . . . . 40
Motif analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
Contents Contents

Reference . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43

RNA-Seq 45
Key Learning Outcomes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46
Resources You’ll be Using . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48
Prepare the Environment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48
Alignment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49
Isoform Expression and Transcriptome Assembly . . . . . . . . . . . . . . . . 52
Differential Expression . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54
Visualising the CuffDiff expression analysis . . . . . . . . . . . . . . . . . . . . 56
Functional Annotation of Differentially Expressed Genes . . . . . . . . . . . . 60
Differential Gene Expression Analysis using edgeR . . . . . . . . . . . . . . . . . 61
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67

de novo Genome Assembly 69

Key Learning Outcomes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70
Resources You’ll be Using . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72
Prepare the Environment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72
Downloading and Compiling Velvet . . . . . . . . . . . . . . . . . . . . . . . . 73
Assembling Single-end Reads . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
Assembling Paired-end Reads . . . . . . . . . . . . . . . . . . . . . . . . . . . 82
Hybrid Assembly . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92

Post-Workshop Information 95
Access to Computational Resources . . . . . . . . . . . . . . . . . . . . . . . . 96
Access to Workshop Documents . . . . . . . . . . . . . . . . . . . . . . . . . . 110
Access to Workshop Data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 110

Space for Personal Notes or Feedback 111

TRAINER’S MANUAL 5
Workshop Information
Workshop Information

8 TRAINER’S MANUAL
The Trainers Workshop Information

The Trainers

Dr. Zhiliang Chen

Postdoctoral Research Associate
The University of New South Wales (UNSW), NSW
[email protected]

Dr. Susan Corley

Postdoctoral Research Associate
The University of New South Wales (UNSW), NSW
[email protected]

Dr. Nandan Deshpande

Postdoctoral Research Associate
The University of New South Wales (UNSW), NSW
[email protected]

Dr. Konsta Duesing

Research Team Leader - Statistics & Bioinformatics
CSIRO Animal, Food and Health Science, NSW
[email protected]
Dr. Matthew Field
Computational Biologist
The John Curtin School of Medical Research ANU College of Medicine, Biology & Environmen
ACT
[email protected]
Dr. Xi (Sean) Li
Bioinformatics Analyst
Bioinformatics Core, CSIRO Mathematics, Informatics and Statistics, ACT
[email protected]
Dr. Annette McGrath
Bioinformatics Core Leader at CSIRO
Bioinformatics Core, CSIRO Mathematics, Informatics and Statistics, ACT
[email protected]
Mr. Sean McWilliam
Bioinformatics Analyst
CSIRO Animal, Food and Health Sciences, QLD
[email protected]

Dr. Paula Moolhuijzen

Senior Bioinformatics Officer
Centre for Comparative Genomics, Murdoch University, WA
[email protected]

Dr. Sonika Tyagi

TRAINER’S
Bioinformatics Supervisor MANUAL 9
Australian Genome Research Facility Ltd, The Walter and Eliza Hall Institute, VIC
Workshop Information Providing Feedback

Providing Feedback
While we endeavour to deliver a workshop with quality content and documentation in a
venue conducive to an exciting, well run hands-on workshop with a bunch of knowledgeable
and likable trainers, we know there are things we could do better.
Whilst we want to know what didn’t quite hit the mark for you, what would be most
helpful and least depressing, would be for you to provide ways to improve the workshop.
i.e. constructive feedback. After all, if we knew something wasn’t going to work, we
wouldn’t have done it or put it into the workshop in the first place! Remember, we’re
experts in the field of bioinformatics not experts in the field of biology!
Clearly, we also want to know what we did well! This gives us that “feel good” factor
which will see us through those long days and nights in the lead up to such hands-on
workshops!
With that in mind, we’ll provide three really high tech mechanism through which you can
provide anonymous feedback during the workshop:

1. A sheet of paper, from a flip-chart, sporting a “happy” face and a “not so happy”
face. Armed with a stack of colourful post-it notes, your mission is to see how many
comments you can stick on the “happy” side!

2. Some empty ruled pages at the back of this handout. Use them for your own personal
notes or for write specific comments/feedback about the workshop as it progresses.

3. An online post-workshop evaluation survey. We’ll ask you to complete this before
you leave. If you’ve used the blank pages at the back of this handout to make
feedback notes, you’ll be able to provide more specific and helpful feedback with the
least amount of brain-drain!

Document Structure
We have provided you with an electronic copy of the workshop’s hands-on tutorial
documents. We have done this for two reasons: 1) you will have something to take away
with you at the end of the workshop, and 2) you can save time (mis)typing commands on
the command line by using copy-and-paste.
We advise you to use Acrobat Reader to view the PDF. This is because it properly supports
some features we have implemented to ensure that copy-and-paste of commands works as
expected. This includes the appropriate copy-and-paste of special characters like tilde and
hyphens as well as skipping line numbers for easy copy-and-past of whole code blocks.

While you could fly through the hands-on sessions doing copy-and-paste you will
learn more if you take the time, saved from not having to type all those commands,
to understand what each command is doing!

10 TRAINER’S MANUAL
Resources Used Workshop Information

The commands to enter at a terminal look something like this:

tophat --solexa-quals -g 2 --library-type fr-unstranded -j \
annotation/Danio_rerio.Zv9.66.spliceSites -o tophat/ZV9_2cells \
genome/ZV9 data/2cells_1.fastq data/2cells_2.fastq

The following styled code is not to be entered at a terminal, it is simply to show you the
syntax of the command. You must use your own judgement to substitute in the correct
arguments, options, filenames etc
tophat [options]* <index_base> <reads_1> <reads_2>

The following is an example how of R commands are styled:

R --no-save
library(plotrix)
data <- read.table("run_25/stats.txt", header=TRUE)
weighted.hist(data$short1_cov+data$short2_cov, data$lgth, breaks=0:70)
q()

The following icons are used in the margin, throughout the documentation to help you
navigate around the document more easily:

Important

For reference

Follow these steps

Questions to answer

Warning - STOP and read

Bonus exercise for fast learners

Advanced exercise for super-fast learners

Resources Used
We have provided you with an environment which contains all the tools and data you
need for the duration of this workshop. However, we also provide details about the tools
and data used by each module at the start of the respective module documentation.

TRAINER’S MANUAL 11
 Module: Data Quality

Primary Author(s):
Sonika Tyagi [email protected]

Contributor(s):
Nathan S. Watson-Haigh [email protected]
Data Quality Key Learning Outcomes

Key Learning Outcomes

After completing this practical the trainee should be able to:

• Assess the overall quality of NGS sequence reads

• Visualise the quality, and other associated matrices, of reads to decide on filters and
cutoffs for cleaning up data ready for downstream analysis

• Clean up and pre-process the sequences data for further analysis

Resources You’ll be Using

Tools Used
FastQC
http://www.bioinformatics.babraham.ac.uk/projects/fastqc/

FASTX-Toolkit
http://hannonlab.cshl.edu/fastx_toolkit/

Picard
http://picard.sourceforge.net/

Useful Links
FASTQ Encoding
http://en.wikipedia.org/wiki/FASTQ_format#Encoding

14 TRAINER’S MANUAL
Introduction Data Quality

Introduction
Going on a blind date with your read set? For a better understanding of the consequences
please check the data quality!

For the purpose of this tutorial we are focusing only on Illumina sequencing which
uses ’sequence by synthesis’ technology in a highly parallel fashion. Although Illumina
high throughput sequencing provides highly accurate sequence data, several sequence
artifacts, including base calling errors and small insertions/deletions, poor quality reads
and primer/adapter contamination are quite common in the high throughput sequencing
data. The primary errors are substitution errors. The error rates can vary from 0.5-2.0%
with errors mainly rising in frequency at the 3’ ends of reads.
One way to investigate sequence data quality is to visualize the quality scores and other
metrics in a compact manner to get an idea about the quality of a read data set. Read
data sets can be improved by post processing in different ways like trimming off low
quality bases, cleaning up any sequencing adapters and removing PCR duplicates. We
can also look at other statistics such as, sequence length distribution, base composition,
sequence complexity, presence of ambiguous bases etc. to assess the overall quality of the
data set.
Highly redundant coverage (>15X) of the genome can be used to correct sequencing errors
in the reads before assembly and errors. Various k-mer based error correction methods
exist but are beyond the scope of this tutorial.

Quality Value Encoding Schema

In order to use a single character to encode Phred qualities, ASCII characters are
used (http://shop.alterlinks.com/ascii-table/ascii-table-us.php). All ASCII
characters have a decimal number associated with them but the first 32 characters are
non-printable (e.g. backspace, shift, return, escape). Therefore, the first printable ASCII
character is number 33, the exclamation mark (!). In Phred+33 encoded quality values
the exclamation mark takes the Phred quality score of zero.
Early Solexa (now Illumina) sequencing needed to encode negative quality values. Because
ASCII characters < 33 are non-printable, using the Phred+33 encoding was not possible.
Therefore, they simply moved the offset from 33 to 64 thus inventing the Phred+64
encoded quality values. In this encoding a Phred quality of zero is denoted by the ASCII
number 64 (the @ character). Since Illumina 1.8, quality values are now encoded using
Phred+33.
FASTQ does not provide a way to describe what quality encoding is used for the quality
values. Therefore, you should find this out from your sequencing provider. Alternatively,
you may be able to figure this out by determining what ASCII characters are present
in the FASTQ file. E.g the presence of numbers in the quality strings, can only mean
the quality values are Phred+33 encoded. However, due to the overlapping nature of
the Phred+33 and Phred+64 encoding schema it is not always possible to identify what

TRAINER’S MANUAL 15
Data Quality Prepare the Environment

encoding is in use. For example, if the only characters seen in the quality string are
(@ABCDEFGHI), then it is impossible to know if you have really good Phred+33 encoded
qualities or really bad Phred+64 encoded qualities.
For a grapical representation of the different ASCII characters used in the two encoding
schema see: http://en.wikipedia.org/wiki/FASTQ_format#Encoding.

Prepare the Environment

To investigate sequence data quality we will demonstrate tools called FastQC and FASTX-
Toolkit. FastQC will process and present the reports in a visual manner. Based on the
results, the sequence data can be processed using the FASTX-Toolkit. We will use one
data set in this practical, which can be found in the QC directory on your desktop.

Open the Terminal and go to the directory where the data are stored:
cd ~/QC/
pwd

At any time, help can be displayed for FastQC using the following command:
fastqc -h

Quality Visualisation
We have a file for a good quality and bad quality statistics. FastQC generates results in
the form of a zipped and unzipped directory for each input file.

Execute the following command on the two files:

fastqc -f fastq bad_example.fastq
fastqc -f fastq good_example.fastq

View the FastQC report file of the bad data using a web browser such as firefox.
firefox bad_example_fastqc.html &

The report file will have a Basic Statistics table and various graphs and tables for different
quality statistics. E.g.:

16 TRAINER’S MANUAL
Quality Visualisation Data Quality

Table 2: FastQC Basic Statistics table

Filename bad example.fastq

File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 40000
Filtered Sequences 0
Sequence length 100
%GC 48

Figure 1: Per base sequence quality plot for bad example.fastq.

A Phred quality score (or Q-score) expresses an error probability. In particular, it serves
as a convenient and compact way to communicate very small error probabilities. The
probability that base A is wrong (P (∼ A)) is expressed by a quality score, Q(A), according
to the relationship:

Q(A) = −10log10(P (∼ A))

The relationship between the quality score and error probability is demonstrated with the
following table:

TRAINER’S MANUAL 17
Data Quality Quality Visualisation

Table 3: Error probabilities associated with various quality (Q) values

Quality score, Q(A) Error probability, P(∼A) Accuracy of the base call
10 0.1 90%
20 0.01 99%
30 0.001 99.9%
40 0.0001 99.99%
50 0.00001 99.999%

How many sequences were there in your file? What is the read length? 40,000. read
length=100bp
Does the quality score values vary throughout the read length? (hint: look at the
’per base sequence quality plot’) Yes. Quality scores are dropping towards the end of
the reads.
What is the quality score range you see? 2-40
At around which position do the scores start falling below Q20? Around 80 bp
position
How can we trim the reads to filter out the low quality data? By trimming off the
bases after a fixed position of the read or by trimming off bases based on the quality
score.

Good Quality Data

View the FastQC report files fastqc report.html to see examples of a good quality
data and compare the quality plot with that of the bad example fastqc.
firefox good_example_fastqc.html &

Sequencing errors can complicate the downstream analysis, which normally requires that
reads be aligned to each other (for genome assembly) or to a reference genome (for
detection of mutations). Sequence reads containing errors may lead to ambiguous paths
in the assembly or improper gaps. In variant analysis projects sequence reads are aligned
against the reference genome. The errors in the reads may lead to more mismatches than
expected from mutations alone. But if these errors can be removed or corrected, the read
alignments and hence the variant detection will improve. The assemblies will also improve
after pre-processing the reads with errors.

18 TRAINER’S MANUAL
Read Trimming Data Quality

Read Trimming
Read trimming can be done in a variety of different ways. Choose a method which best
suits your data. Here we are giving examples of fixed-length trimming and quality-based
trimming.

Fixed Length Trimming

Low quality read ends can be trimmed using a fixed-length trimming. We will use the
fastx trimmer from the FASTX-Toolkit. Usage message to find out various options you
can use with this tool. Type fastx trimmer -h at anytime to display help.
We will now do fixed-length trimming of the bad example.fastq file using the following
command.
cd ~/QC
fastx_trimmer -h
fastx_trimmer -Q 33 -f 1 -l 80 -i bad_example.fastq -o \
bad_example_trimmed01.fastq

We used the following options in the command above:

-Q 33 Indicates the input quality scores are Phred+33

encoded

-f First base to be retained in the output

-l Last base to be retained in the output

-i Input FASTQ file name

-o Output file name

Run FastQC on the trimmed file and visualise the quality scores of the trimmed file.
fastqc -f fastq bad_example_trimmed01.fastq
firefox bad_example_trimmed01_fastqc.html &

The output should look like:

TRAINER’S MANUAL 19
Data Quality Read Trimming

Table 4: FastQC Basic Statistics table

Filename bad example trimmed01.fastq

File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 40000
Filtered Sequences 0
Sequence length 80
%GC 48

Figure 2: Per base sequence quality plot for the fixed-length trimmed bad example.fastq
reads.

What values would you use for -f if you wanted to trim off 10 bases at the 5’ end of
the reads? -f 11

20 TRAINER’S MANUAL
Read Trimming Data Quality

Quality Based Trimming

Base call quality scores can also be used to dynamically determine the trim points for
each read. A quality score threshold and minimum read length following trimming can be
used to remove low quality data.
Run the following command to quality trim your data:
cd ~/QC
fastq_quality_trimmer -h
fastq_quality_trimmer -Q 33 -t 20 -l 50 -i bad_example.fastq -o \
bad_example_quality_trimmed.fastq

-Q 33 Indicates the input quality scores are Phred+33

encoded

-t quality score cut-off

-l minimum length of reads to output

-i Input FASTQ file name

-o Output file name

Run FastQC on the quality trimmed file and visualise the quality scores.
fastqc -f fastq bad_example_quality_trimmed.fastq
firefox bad_example_quality_trimmed_fastqc.html &

The output should look like:

Table 5: FastQC Basic Statistics table

Filename bad example quality trimmed.fastq

File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 38976
Filtered Sequences 0
Sequence length 50-100
%GC 48

TRAINER’S MANUAL 21
Data Quality Read Trimming

Figure 3: Per base sequence quality plot for the quality-trimmed bad example.fastq
reads.

How did the quality score range change with two types of trimming? Some poor
quality bases (Q <20) are still present at the 3’ end of the fixed-length trimmed reads.
It also removes bases that are good quality.
Quality-based trimming retains the 3’ ends of reads which have good quality scores.
Did the number of total reads change after two types of trimming? Quality trimming
discarded >1000 reads. However, We retain a lot of maximal length reads which have
good quality all the way to the ends.
What reads lengths were obtained after quality based trimming? 50-100
Reads <50 bp, following quality trimming, were discarded.
Did you observe adapter sequences in the data? No. (Hint: look at the overrepresented
sequences.
How can you use -a option with fastqc ? (Hint: try fastqc -h). Adaptors can be
supplied in a file for screening.

22 TRAINER’S MANUAL
Read Trimming Data Quality

Adapter Clipping
Sometimes sequence reads may end up getting the leftover of adapters and primers
used in the sequencing process. It’s good practice to screen your data for these
possible contamination for more sensitive alignment and assembly based analysis.
This is particularly important when read lengths can be longer than the molecules
being sequenced. For example when sequencing miRNAs.

Various QC tools are available to screen and/or clip these adapter/primer sequences
from your data. (e.g. FastQC, FASTX-Toolkit, cutadapt).
Here we are demonstrating fastx clipper to trim a given adapter sequence.
cd ~/QC
fastx_clipper -h
fastx_clipper -v -Q 33 -l 20 -M 15 -a \
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG -i bad_example.fastq -o \
bad_example_clipped.fastq

An alternative tool, not installed on this system, for adapter clipping is fastq-mcf.
A list of adapters is provided in a text file. For more information, see FastqMcf at
http://code.google.com/p/ea-utils/wiki/FastqMcf.

Removing Duplicates
Duplicate reads are the ones having the same start and end coordinates. This may be
the result of technical duplication (too many PCR cycles), or over-sequencing (very
high fold coverage). It is very important to put the duplication level in context of
your experiment. For example, duplication level in targeted or re-sequencing projects
may mean something different in RNA-seq experiments. In RNA-seq experiments
oversequencing is usually necessary when detecting low abundance transcripts.
The duplication level computed by FastQC is based on sequence identity at the end
of reads. Another tool, Picard, determines duplicates based on identical start and
end positions in SAM/BAM alignment files.
We will not cover Picard but provide the following for your information.
Picard is a suite of tools for performing many common tasks with SAM/BAM format
files. For more information see the Picard website and information about the various
command-line tools available:
http://picard.sourceforge.net/command-line-overview.shtml

TRAINER’S MANUAL 23
Data Quality Read Trimming

Picard is installed on this system in /tools/Picard/picard-default

One of the Picard tools (MarkDuplicates) can be used to analyse and remove duplicates
from the raw sequence data. The input for Picard is a sorted alignment file in BAM
format. Short read aligners such as, bowtie, BWA and tophat can be used to align
FASTQ files against a reference genome to generate SAM/BAM alignment format.

Interested users can use the following general command to run the MarkDuplicates
tool at their leisure. You only need to provide a BAM file for the INPUT argument
(not provided):
cd ~/QC
java -jar /tools/Picard/picard-default/MarkDuplicates.jar \
INPUT=<alignment_file.bam> VALIDATION_STRINGENCY=LENIENT \
OUTPUT=alignment_file.dup METRICS_FILE=alignment_file.matric \
ASSUME_SORTED=true REMOVE_DUPLICATES=true

24 TRAINER’S MANUAL
Module: Read Alignment

Primary Author(s):
Myrto Kostadima [email protected]

Contributor(s):
Xi Li [email protected]
Read Alignment Key Learning Outcomes

Key Learning Outcomes

After completing this practical the trainee should be able to:

• Perform the simple NGS data alignment task against one interested reference data

• Interpret and manipulate the mapping output using SAMtools

• Visualise the alignment via a standard genome browser, e.g. IGV browser

Resources You’ll be Using

Tools Used
Bowtie
http://bowtie-bio.sourceforge.net/index.shtml

Bowtie 2
http://bowtie-bio.sourceforge.net/bowtie2/index.shtml

Samtools
http://picard.sourceforge.net/

BEDTools
http://code.google.com/p/bedtools/

UCSC tools
http://hgdownload.cse.ucsc.edu/admin/exe/

IGV genome browser

http://www.broadinstitute.org/igv/

Useful Links
SAM Specification
http://samtools.sourceforge.net/SAM1.pdf

Explain SAM Flags

http://picard.sourceforge.net/explain-flags.html

26 TRAINER’S MANUAL
Useful Links Read Alignment

Sources of Data
http://www.ebi.ac.uk/arrayexpress/experiments/E-GEOD-11431

TRAINER’S MANUAL 27
Read Alignment Introduction

Introduction
The goal of this hands-on session is to perform an unspliced alignment for a small subset
of raw reads. We will align raw sequencing data to the mouse genome using Bowtie and
then we will manipulate the SAM output in order to visualize the alignment on the IGV
browser.

Prepare the Environment

We will use one data set in this practical, which can be found in the ChIP-seq directory
on your desktop.
Open the Terminal.
First, go to the right folder, where the data are stored.
cd ~/ChIP-seq

The .fastq file that we will align is called Oct4.fastq. This file is based on Oct4
ChIP-seq data published by Chen et al. (2008). For the sake of time, we will align these
reads to a single mouse chromosome.

Alignment
You already know that there are a number of competing tools for short read alignment,
each with its own set of strengths, weaknesses, and caveats. Here we will try Bowtie, a
widely used ultrafast, memory efficient short read aligner.
Bowtie has a number of parameters in order to perform the alignment. To view them all
type
bowtie --help

Bowtie uses indexed genome for the alignment in order to keep its memory footprint small.
Because of time constraints we will build the index only for one chromosome of the mouse
genome. For this we need the chromosome sequence in FASTA format. This is stored in a
file named mm10, under the subdirectory bowtie index.
The indexed chromosome is generated using the command:
bowtie-build bowtie_index/mm10.fa bowtie_index/mm10

This command will output 6 files that constitute the index. These files that have the
prefix mm10 are stored in the bowtie index subdirectory. To view if they files have been
successfully created type:
ls -l bowtie_index

28 TRAINER’S MANUAL
Alignment Read Alignment

Now that the genome is indexed we can move on to the actual alignment. The first
argument for bowtie is the basename of the index for the genome to be searched; in our
case this is mm10. We also want to make sure that the output is in SAM format using the
-S parameter. The last argument is the name of the FASTQ file.

Align the Oct4 reads using Bowtie:

bowtie bowtie_index/mm10 -S Oct4.fastq > Oct4.sam

The above command outputs the alignment in SAM format and stores them in the file
Oct4.sam.
In general before you run Bowtie, you have to know what quality encoding your FASTQ
files are in. The available FASTQ encodings for bowtie are:

--phred33-quals Input qualities are Phred+33 (default).

--phred64-quals Input qualities are Phred+64 (same as --solexa1.3-quals).

--solexa-quals Input qualities are from GA Pipeline ver. < 1.3.

--solexa1.3-quals Input qualities are from GA Pipeline ver. ≥ 1.3.

--integer-quals Qualities are given as space-separated integers (not

ASCII).

The FASTQ files we are working with are Sanger encoded (Phred+33), which is the
default for Bowtie.
Bowtie will take 2-3 minutes to align the file. This is fast compared to other aligners
which sacrifice some speed to obtain higher sensitivity.

Look at the top 10 lines of the SAM file by typing:

head -n 10 Oct4.sam

TRAINER’S MANUAL 29
Read Alignment Manipulate SAM output

Can you distinguish between the header of the SAM format and the actual alignments?
The header line starts with the letter ‘@’, i.e.:
@HD VN:1.0 SO:unsorted
@SQ SN:chr1 LN:197195432
@PG ID:Bowtie VN:0.12.8 CL:“bowtie bowtie index/mm10 -S Oct4.fastq”
While, the actual alignments start with read id, i.e.:
SRR002012.45 0 chr1 etc
SRR002012.48 16 chr1 etc
What kind of information does the header provide?

• @HD: Header line; VN: Format version; SO: the sort order of alignments.

• @SQ: Reference sequence information; SN: reference sequence name; LN: refer-
ence sequence length.

• @PG: Read group information; ID: Read group identifier; VN: Program version;
CL: the command line that produces the alignment.

To which chromosome are the reads mapped? Chromosome 1.

Manipulate SAM output

SAM files are rather big and when dealing with a high volume of NGS data, storage space
can become an issue. As we have already seen, we can convert SAM to BAM files (their
binary equivalent that are not human readable) that occupy much less space.

Convert SAM to BAM using samtools view and store the output in the file Oct4.bam.
You have to instruct samtools view that the input is in SAM format (-S), the output
should be in BAM format (-b) and that you want the output to be stored in the file
specified by the -o option:
samtools view -bSo Oct4.bam Oct4.sam

Compute summary stats for the Flag values associated with the alignments using:
samtools flagstat Oct4.bam

30 TRAINER’S MANUAL
Visualize alignments in IGV Read Alignment

Visualize alignments in IGV

IGV is a stand-alone genome browser. Please check their website (http://www.broadinstitute.
org/igv/) for all the formats that IGV can display. For our visualization purposes we
will use the BAM and bigWig formats.

When uploading a BAM file into the genome browser, the browser will look for the index
of the BAM file in the same folder where the BAM files is. The index file should have the
same name as the BAM file and the suffix .bai. Finally, to create the index of a BAM
file you need to make sure that the file is sorted according to chromosomal coordinates.

Sort alignments according to chromosomal position and store the result in the file with
the prefix Oct4.sorted:
samtools sort Oct4.bam Oct4.sorted

Index the sorted file.

samtools index Oct4.sorted.bam

The indexing will create a file called Oct4.sorted.bam.bai. Note that you don’t have to
specify the name of the index file when running samtools index, it simply appends a
.bai suffix to the input BAM file.

Another way to visualize the alignments is to convert the BAM file into a bigWig file.
The bigWig format is for display of dense, continuous data and the data will be displayed
as a graph. The resulting bigWig files are in an indexed binary format.

The BAM to bigWig conversion takes place in two steps. Firstly, we convert the BAM
file into a bedgraph, called Oct4.bedgraph, using the tool genomeCoverageBed from
BEDTools. Then we convert the bedgraph into a bigWig binary file called Oct4.bw, using
bedGraphToBigWig from the UCSC tools:
genomeCoverageBed -bg -ibam Oct4.sorted.bam -g \
bowtie_index/mouse.mm10.genome > Oct4.bedgraph
bedGraphToBigWig Oct4.bedgraph bowtie_index/mouse.mm10.genome Oct4.bw

Both of the commands above take as input a file called mouse.mm10.genome that is stored
under the subdirectory bowtie index. These genome files are tab-delimited and describe
the size of the chromosomes for the organism of interest. When using the UCSC Genome
Browser, Ensembl, or Galaxy, you typically indicate which species/genome build you are
working with. The way you do this for BEDTools is to create a “genome” file, which
simply lists the names of the chromosomes (or scaffolds, etc.) and their size (in basepairs).
BEDTools includes pre-defined genome files for human and mouse in the genomes subdi-
rectory included in the BEDTools distribution.

TRAINER’S MANUAL 31
Read Alignment Practice Makes Perfect!

Now we will load the data into the IGV browser for visualization. In order to launch
IGV double click on the IGV 2.3 icon on your Desktop. Ignore any warnings and when it
opens you have to load the genome of interest.
On the top left of your screen choose from the drop down menu Mus musculus (mm10).
Then in order to load the desire files go to:
File > Load from File

On the pop up window navigate to Desktop > ChIP-seq folder and select the file
Oct4.sorted.bam.
Repeat these steps in order to load Oct4.bw as well.
Select chr1 from the drop down menu on the top left. Right click on the name of
Oct4.bw and choose Maximum under the Windowing Function. Right click again and
select Autoscale.
In order to see the aligned reads of the BAM file, you need to zoom in to a specific region.
For example, look for gene Lemd1 in the search box.

What is the main difference between the visualization of BAM and bigWig files? The
actual alignment of reads that stack to a particular region can be displayed using
the information stored in a BAM format. The bigWig format is for display of dense,
continuous data that will be displayed in the Genome Browser as a graph.

Using the + button on the top right, zoom in to see more of the details of the alignments.

What do you think the different colors mean? The different color represents four
nucleotides, e.g. blue is Cytidine (C), red is Thymidine (T).

Practice Makes Perfect!

In the ChIP-seq folder you will find the file gfp.fastq. Follow the above described
analysis, from the bowtie alignment step, for this dataset as well. You will need these
files for the ChIP-Seq module.

32 TRAINER’S MANUAL
 Module: ChIP-Seq

Primary Author(s):
Remco Loos, EMBL-EBI [email protected]
Myrto Kostadima [email protected]

Contributor(s):
Xi Li [email protected]
ChIP-Seq Key Learning Outcomes

Key Learning Outcomes

After completing this practical the trainee should be able to:

• Perform simple ChIP-Seq analysis, e.g. the detection of immuno-enriched areas

using the chosen peak caller program MACS

• Visualize the peak regions through a genome browser, e.g. Ensembl, and identify
the real peak regions

• Perform functional annotation and detect potential binding sites (motif) in the
predicted binding regions using motif discovery tool, e.g. MEME.

Resources You’ll be Using

Tools Used
MACS
http://liulab.dfci.harvard.edu/MACS/index.html

Ensembl
http://www.ensembl.org

PeakAnalyzer
http://www.ebi.ac.uk/bertone/software

MEME
http://meme.ebi.edu.au/meme/tools/meme

TOMTOM
http://meme.ebi.edu.au/meme/tools/tomtom

DAVID
http://david.abcc.ncifcrf.gov

GOstat
http://gostat.wehi.edu.au

34 TRAINER’S MANUAL
Resources You’ll be Using ChIP-Seq

Sources of Data
http://www.ebi.ac.uk/arrayexpress/experiments/E-GEOD-11431

TRAINER’S MANUAL 35
ChIP-Seq Introduction

Introduction
The goal of this hands-on session is to perform some basic tasks in the analysis of ChIP-seq
data. In fact, you already performed the first step, alignment of the reads to the genome,
in the previous session. We start from the aligned reads and we will find immuno-enriched
areas using the peak caller MACS. We will visualize the identified regions in a genome
browser and perform functional annotation and motif analysis on the predicted binding
regions.

Prepare the Environment

The material for this practical can be found in the ChIP-seq directory on your desktop.
This directory also contains an electronic version of this document, which can be useful
to copy and paste commands. Please make sure that this directory also contains the
SAM/BAM files you produced during the alignment practical.

If you didn’t have time to align the control file called gfp.fastq during the alignment
practical, please do it now. Follow the same steps, from the bowtie alignment step, as for
the Oct4.fastq file.

In ChIP-seq analysis (unlike in other applications such as RNA-seq) it can be useful to

exclude all reads that map to more than one location in the genome. When using Bowtie,
this can be done using the -m 1 option, which tells it to report only unique matches (See
bowtie --help for more details).

Open the Terminal and go to the ChIP-seq directory:

cd ~/ChIP-seq

Finding enriched areas using MACS

MACS stands for Model based analysis of ChIP-seq. It was designed for identifying
transcription factor binding sites. MACS captures the influence of genome complexity to
evaluate the significance of enriched ChIP regions, and improves the spatial resolution
of binding sites through combining the information of both sequencing tag position and
orientation. MACS can be easily used for ChIP-Seq data alone, or with a control sample
to increase specificity.

Consult the MACS help file to see the options and parameters:
macs --help

36 TRAINER’S MANUAL
Finding enriched areas using MACS ChIP-Seq

The input for MACS can be in ELAND, BED, SAM, BAM or BOWTIE formats (you
just have to set the --format option).
Options that you will have to use include:

-t To indicate the input ChIP file.

-c To indicate the name of the control file.

--format To change the file format. The default format is

bed.

--name To set the name of the output files.

--gsize This is the mappable genome size. With the read

length we have, 70% of the genome is a fair estima-
tion. Since in this analysis we include only reads
from chromosome 1 (197Mbases), we will use a
--gsize of 138Mbases (70% of 197Mbases).

--tsize To set the read length (look at the FASTQ files to

check the length).

--wig To generate signal wig files for viewing in a genome

browser. Since this process is time consuming,
it is recommended to run MACS first with this
flag off, and once you decide on the values of the
parameters, run MACS again with this flag on.

--diag To generate a saturation table, which gives an indi-

cation whether the sequenced reads give a reliable
representation of the possible peaks.

Now run macs using the following command:

macs -t <Oct4_aligned_bam_file> -c <gfp_aligned_bam_file> --format=BAM \
--name=Oct4 --gsize=138000000 --tsize=26 --diag --wig

Look at the output saturation table (Oct4 diag.xls). To open this file file, right-click on
it and choose “Open with” and select LibreOffice. Do you think that more sequencing is
necessary?
Open the Excel peak file and view the peak details. Note that the number of tags (column
6) refers to the number of reads in the whole peak region and not the peak height.

TRAINER’S MANUAL 37
ChIP-Seq Viewing results with the Ensembl genome browser

Viewing results with the Ensembl genome browser

It is often instructive to look at your data in a genome browser. Before, we used IGV,
a stand-alone browser, which has the advantage of being installed locally and providing
fast access. Web-based genome browsers, like Ensembl or the UCSC browser, are slower,
but provide more functionality. They do not only allow for more polished and flexible
visualisation, but also provide easy access to a wealth of annotations and external data
sources. This makes it straightforward to relate your data with information about repeat
regions, known genes, epigenetic features or areas of cross-species conservation, to name
just a few. As such, they are useful tools for exploratory analysis.
They will allow you to get a ‘feel’ for the data, as well as detecting abnormalities and
problems. Also, exploring the data in such a way may give you ideas for further analyses.

Launch a web browser and go to the Ensembl website at http://www.ensembl.org/

index.html
Choose the genome of interest (in this case, mouse) on the left side of the page, browse to
any location in the genome or click one of the demo links provided on the web page.
Click on the Manage your data link on the left, then choose Add your data in the
Personal Data tab.
Wig files are large so are inconvenient for uploading directly to the Ensemble Genome
browser. Instead, we will convert it to an indexed binary format and put this into a web
accessible place such as on a HTTP, HTTPS, or FTP server. This makes all the browsing
process much faster. Detailed instructions for generating a bigWig from a wig type file
can be found at:
http://genome.ucsc.edu/goldenPath/help/bigWig.html.

We have generated bigWig files in advance for you to upload to the Ensembl browser. They
are at the following URL: http://www.ebi.ac.uk/˜remco/ChIP-Seq_course/Oct4.bw
To visualise the data:

• Paste the location above in the field File URL.

• Choose data format bigWig.

• Choose some informative name and in the next window choose the colour of your
preference.

• Click Save and close the window to return to the genome browser.

Repeat the process for the gfp control sample, located at:
http://www.ebi.ac.uk/˜remco/ChIP-Seq_course/gfp.bw.
After uploading, to make sure your data is visible:

38 TRAINER’S MANUAL
Viewing results with the Ensembl genome browser ChIP-Seq

• Switch to the Configure Region Image tab

• Click Your data in the left panel

• Choose each of the uploaded *.bw files to confirm the Wiggle plot in Change
track style pop up menu has been choosen.

• Closing the window will save these changes.

Go to a region on chromosome 1 (e.g. 1:34823162-35323161), and zoom in and out to

view the signal and peak regions. Be aware that the y-axis of each track is auto-scaled
independently of each other, so bigger-looking peaks may not actually be bigger! Always
look at the values on the left hand side axis.

What can you say about the profile of Oct4 peaks in this region? There are no
significant Oct4 peaks over the selected region.
Compare it with H3K4me3 histone modification wig file we have generated at http:
//www.ebi.ac.uk/˜remco/ChIP-Seq_course/H3K4me3.bw. H3K4me3 has a region
that contains relatively high peaks than Oct4.
Jump to 1:36066594-36079728 for a sample peak. Do you think H3K4me3 peaks
regions contain one or more modification sites? What about Oct4? Yes. There
are roughly three peaks, which indicate the possibility of having more than one
modification sites in this region.
For Oct4, no peak can be observed.

MACS generates its peak files in a file format called bed file. This is a simple text format
containing genomic locations, specified by chromosome, begin and end positions, and
some more optional information.
See http://genome.ucsc.edu/FAQ/FAQformat.html#format1 for details.
Bed files can also be uploaded to the Ensembl browser.

Try uploading the peak file generated by MACS to Ensembl. Find the first peak in
the file (use the head command to view the beginning of the bed file), and see if the
peak looks convincing to you.

TRAINER’S MANUAL 39
ChIP-Seq Annotation: From peaks to biological interpretation

Annotation: From peaks to biological interpretation

In order to biologically interpret the results of ChIP-seq experiments, it is usually recom-
mended to look at the genes and other annotated elements that are located in proximity
to the identified enriched regions. This can be easily done using PeakAnalyzer.

Go to the PeakAnalyzer tool directory:

cd /tools/PeakAnalyzer/peakanalyzer-default

Launch the PeakAnalyzer program by typing:

java -jar PeakAnalyzer.jar &

The first window allows you to choose between the split application (which we will try
next) and peak annotation. Choose the peak annotation option and click Next.
We would like to find the closest downstream genes to each peak, and the genes that
overlap with the peak region. For that purpose you should choose the NDG option and
click Next.
Fill in the location of the peak file Oct4 peaks.bed, and choose the mouse GTF as the
annotation file. You don’t have to define a symbol file since gene symbols are included in
the GTF file.
Choose the output directory and run the program.

When the program has finished running, you will have the option to generate plots, by
pressing the Generate plots button. This is only possible if R is installed on your
computer, as it is on this system. A PDF file with the plots will be generated in the
output folder. You could generate similar plots with Excel using the output files that
were generated by PeakAnalyzer.

This list of closest downstream genes (contained in the file Oct4 peaks.ndg.bed) can
be the basis of further analysis. For instance, you could look at the Gene Ontology
terms associated with these genes to get an idea of the biological processes that may be
affected. Web-based tools like DAVID (http://david.abcc.ncifcrf.gov) or GOstat
(http://gostat.wehi.edu.au) take a list of genes and return the enriched GO categories.

We can pull out Ensemble Transcript IDs from the Oct4 peaks.ndg.bed file and
write them to another file ready for use with DAVID or GOstat:
cut -f 5 Oct4_peaks.ndg.bed | sed '1 d' > Oct4_peaks.ndg.tid

40 TRAINER’S MANUAL
Motif analysis ChIP-Seq

Motif analysis
It is often interesting to find out whether we can associate identified the binding sites
with a sequence pattern or motif. We will use MEME for motif analysis. The input for
MEME should be a file in FASTA format containing the sequences of interest. In our case,
these are the sequences of the identified peaks that probably contain Oct4 binding sites.
Since many peak-finding tools merge overlapping areas of enrichment, the resulting peaks
tend to be much wider than the actual binding sites. Sub-dividing the enriched areas by
accurately partitioning enriched loci into a finer-resolution set of individual binding sites,
and fetching sequences from the summit region where binding motifs are most likely to
appear enhances the quality of the motif analysis. Sub-peak summit sequences can be
retrieved directly from the Ensembl database using PeakAnalyzer.

If you have closed the PeakAnalyzer running window, open it again. If it is still open,
just go back to the first window.
Choose the split peaks utility and click Next. The input consists of files generated by
most peak-finding tools: a file containing the chromosome, start and end locations of the
enriched regions, and a .wig signal file describing the size and shape of each peak. Fill in
the location of both files Oct4 peaks.bed and the wig file generated by MACS, which
is under the Oct4 MACS wiggle/treat/ directory, check the option to Fetch subpeak
sequences and click Next.
In the next window you have to set some parameters for splitting the peaks.

Separation float Keep the default value. This value determines

when a peak will be separated into sub-peaks. This
is the ratio between a valley and its neighbouring
summit (the lower summit of the two). For exam-
ple, if you set this height to be 0.5, two sub-peaks
will be separated only if the height of the lower
summit is twice the height of the valley.

Minimum height Set this to be 5. Only sub-peaks with at least

this number of tags in their summit region will be
separated. Change the organism name from the
default human to mouse and run the program.

Since the program has to read large wig files, it will take a few minutes to run. Once the
run is finished, two output files will be produced. The first describes the location of the
sub-peaks, and the second is a FASTA file containing 300 sequences of length 61 bases,
taken from the summit regions of the highest sub-peaks.

Open a web bowser and go to the MEME website at http://meme.ebi.edu.au/meme/

tools/meme, and fill in the necessary details, such as:

• Your e-mail address

TRAINER’S MANUAL 41
ChIP-Seq Motif analysis

• The sub-peaks FASTA file Oct4 peaks.bestSubPeaks.fa (will need uploading), or

just paste in the sequences.

• The number of motifs we expect to find (1 per sequence)

• The width of the desired motif (between 6 to 20)

• The maximum number of motifs to find (3 by default). For Oct4 one classical motif
is known.
You will receive the results by e-mail. This usually doesn’t take more than a few minutes.

Open the e-mail and click on the link that leads to the HTML results page.
Scroll down until you see the first motif logo. We would like to know if this motif is similar
to any other known motif. We will use TOMTOM for this. Scroll down until you see the
option Submit this motif to. Click the TOMTOM button to compare to known motifs
in motif databases, and on the new page choose to compare your motif to those in the
JASPAR and UniPROBE database.

Which motif was found to be the most similar to your motif? Sox2

42 TRAINER’S MANUAL
Reference ChIP-Seq

Reference
Chen, X et al.: Integration of external signaling pathways with the core transcriptional
network in embryonic stem cells. Cell 133:6, 1106-17 (2008).

TRAINER’S MANUAL 43
 Module: RNA-Seq

Primary Author(s):
Myrto Kostadima, EMBL-EBI [email protected]
Remco Loos, EMBL-EBI [email protected]
Sonika Tyagi, AGRF [email protected]

Contributor(s):
Nathan S. Watson-Haigh [email protected]
Susan M Corley [email protected]
RNA-Seq Key Learning Outcomes

Key Learning Outcomes

After completing this practical the trainee should be able to:

• Understand and perform a simple RNA-Seq analysis workflow.

• Perform gapped alignments to an indexed reference genome using TopHat.

• Perform transcript assembly using Cufflinks.

• Visualize transcript alignments and annotation in a genome browser such as IGV.

• Be able to identify differential gene expression between two experimental conditions.

• Be familiar with R environment and be able to run R based RNA-seq packages.

Resources You’ll be Using

Tools Used
Tophat
http://tophat.cbcb.umd.edu/

Cufflinks
http://cufflinks.cbcb.umd.edu/

Samtools
http://samtools.sourceforge.net/

BEDTools
http://code.google.com/p/bedtools/

UCSC tools
http://hgdownload.cse.ucsc.edu/admin/exe/

IGV
http://www.broadinstitute.org/igv/

DAVID Functional Analysis

http://david.abcc.ncifcrf.gov/

edgeR pakcage
http://http://www.bioconductor.org/packages/release/bioc/html/edgeR.html/

CummeRbund manual
http://www.bioconductor.org/packages/release/bioc/vignettes/cummeRbund/
inst/doc/cummeRbund-manual.pdf

46 TRAINER’S MANUAL
Resources You’ll be Using RNA-Seq

Sources of Data
http://www.ebi.ac.uk/ena/data/view/ERR022484
http://www.ebi.ac.uk/ena/data/view/ERR022485
http://www.pnas.org/content/suppl/2008/12/16/0807121105.DCSupplemental

TRAINER’S MANUAL 47
RNA-Seq Introduction

Introduction
The goal of this hands-on session is to perform some basic tasks in the downstream analysis
of RNA-seq data. We will start from RNA-seq data aligned to the zebrafish genome using
Tophat.
We will perform transcriptome reconstruction using Cufflinks and we will compare the gene
expression between two different conditions in order to identify differentially expressed
genes.
In the second part of the tutorial we will also be demonstrating usage of R-based packages
to perform differential expression analysis. We will be using edgeR for the demonstration.
The gene/tag counts generated from the alignment are used as input for edgeR.

Prepare the Environment

We will use a dataset derived from sequencing of mRNA from Danio rerio embryos in
two different developmental stages. Sequencing was performed on the Illumina platform
and generated 76bp paired-end sequence data using polyA selected RNA. Due to the time
constraints of the practical we will only use a subset of the reads.
The data files are contained in the subdirectory called data and are the following:

2cells 1.fastq and 2cells 2.fastq

These files are based on RNA-seq data of a 2-cell zebrafish embryo

6h 1.fastq and 6h 2.fastq

These files are based on RNA-seq data of zebrafish embryos 6h post fertil-
ization
Open the Terminal and go to the RNA-seq working directory:
cd ~/RNA-seq/

All commands entered into the terminal for this tutorial should be from within the
∼/RNA-seq directory.

Check that the data directory contains the above-mentioned files by typing:
ls data

48 TRAINER’S MANUAL
Alignment RNA-Seq

Alignment
There are numerous tools for performing short read alignment and the choice of aligner
should be carefully made according to the analysis goals/requirements. Here we will use
Tophat, a widely used ultrafast aligner that performs spliced alignments.
Tophat is based on the Bowtie aligner and uses an indexed genome for the alignment to
speed up the alignment and keep its memory footprint small. The the index for the Danio
rerio genome has been created for you.

The command to create an index is as follows. You DO NOT need to run this
command yourself - we have done this for you.
bowtie-build genome/Danio_rerio.Zv9.66.dna.fa genome/ZV9

Tophat has a number of parameters in order to perform the alignment. To view them all
type:
tophat --help

The general format of the tophat command is:

tophat [options]* <index_base> <reads_1> <reads_2>

Where the last two arguments are the .fastq files of the paired end reads, and the
argument before is the basename of the indexed genome.
The quality values in the FASTQ files used in this hands-on session are Phred+33 encoded.
We explicitly tell tophat of this fact by using the command line argument --solexa-quals.

You can look at the first few reads in the file data/2cells 1.fastq with:
head -n 20 data/2cells_1.fastq

Some other parameters that we are going to use to run Tophat are listed below:

-g Maximum number of multihits allowed. Short

reads are likely to map to more than one location
in the genome even though these reads can have
originated from only one of these regions. In RNA-
seq we allow for a limited number of multihits, and
in this case we ask Tophat to report only reads
that map at most onto 2 different loci.

--library-type Before performing any type of RNA-seq analysis

you need to know a few things about the library
preparation. Was it done using a strand-specific

TRAINER’S MANUAL 49
RNA-Seq Alignment

protocol or not? If yes, which strand? In our data

the protocol was NOT strand specific.

-j Improve spliced alignment by providing Tophat

with annotated splice junctions. Pre-existing genome
annotation is an advantage when analysing RNA-
seq data. This file contains the coordinates of
annotated splice junctions from Ensembl. These
are stored under the sub-directory annotation in
a file called ZV9.spliceSites.

-o This specifies in which subdirectory Tophat should

save the output files. Given that for every run the
name of the output files is the same, we specify
different directories for each run.

It takes some time (approx. 20 min) to perform tophat spliced alignments, even for
this subset of reads. Therefore, we have pre-aligned the 2cells data for you using the
following command:

You DO NOT need to run this command yourself - we have done this for you.
tophat --solexa-quals -g 2 --library-type fr-unstranded -j \
annotation/Danio_rerio.Zv9.66.spliceSites -o tophat/ZV9_2cells \
genome/ZV9 data/2cells_1.fastq data/2cells_2.fastq

Align the 6h data yourself using the following command:

# Takes approx. 20mins
tophat --solexa-quals -g 2 --library-type fr-unstranded -j \
annotation/Danio_rerio.Zv9.66.spliceSites -o tophat/ZV9_6h \
genome/ZV9 data/6h_1.fastq data/6h_2.fastq

The 6h read alignment will take approx. 20 min to complete. Therefore, we’ll take a look
at some of the files, generated by tophat, for the pre-computed 2cells data.

Alignment Visualisation in IGV

The Integrative Genomics Viewer (IGV) is able to provide a visualisation of read alignments
given a reference sequence and a BAM file. We’ll visualise the information contained
in the accepted hits.bam and junctions.bed files for the pre-computed 2cells data.
The former, contains the tophat sliced alignments of the reads to the reference while the
latter stores the coordinates of the splice junctions present in the data set.
Open the RNA-seq directory on your Desktop and double-click the tophat subdirectory
and then the ZV9 2cells directory.

50 TRAINER’S MANUAL
Alignment RNA-Seq

1. Launch IGV by double-clicking the “IGV 2.3.*” icon on the Desktop (ignore any
warnings that you may get as it opens). NOTE: IGV may take several minutes to
load for the first time, please be patient.

2. Choose “Zebrafish (Zv9)” from the drop-down box in the top left of the IGV window.
Else you can also load the genome fasta file.

3. Load the accepted hits.sorted.bam file by clicking the “File” menu, selecting
“Load from File” and navigating to the Desktop/RNA-seq/tophat/ZV9 2cells di-
rectory.

4. Rename the track by right-clicking on its name and choosing “Rename Track”. Give
it a meaningful name like “2cells BAM”.

5. Load the junctions.bed from the same directory and rename the track “2cells
Junctions BED”.

6. Load the Ensembl annotations file Danio rerio.Zv9.66.gtf stored in the RNA-seq/annotation
directory.

7. Navigate to a region on chromosome 12 by typing chr12:20,270,921-20,300,943

into the search box at the top of the IGV window.

Keep zooming to view the bam file alignments

Some useful IGV manuals can be found below
http://www.broadinstitute.org/software/igv/interpreting_insert_size
http://www.broadinstitute.org/software/igv/alignmentdata

Can you identify the splice junctions from the BAM file? Slice junctions can be
identified in the alignment BAM files. These are the aligned RNA-Seq reads that
have skipped-bases from the reference genome (most likely introns).
Are the junctions annotated for CBY1 consistent with the annotation? Read alignment
supports an extended length in exon 5 to the gene model (cby1-001)
Are all annotated genes, from both RefSeq and Ensembl, expressed? No BX000473.1-
201 is not expressed

Once tophat finishes aligning the 6h data you will need to sort the alignments found in
the BAM file and then index the sorted BAM file.
samtools sort tophat/ZV9_6h/accepted_hits.bam \
tophat/ZV9_6h/accepted_hits.sorted
samtools index tophat/ZV9_6h/accepted_hits.sorted.bam

Load the sorted BAM file into IGV, as described previously, and rename the track
appropriately.

TRAINER’S MANUAL 51
RNA-Seq Isoform Expression and Transcriptome Assembly

Isoform Expression and Transcriptome Assembly

There are a number of tools that perform reconstruction of the transcriptome and for
this workshop we are going to use Cufflinks. Cufflinks can do transcriptome assembly
either ab initio or using a reference annotation. It also quantifies the isoform expression
in Fragments Per Kilobase of exon per Million fragments mapped (FPKM).
Cufflinks has a number of parameters in order to perform transcriptome assembly and
quantification. To view them all type:
cufflinks --help

We aim to reconstruct the transcriptome for both samples by using the Ensembl annotation
both strictly and as a guide. In the first case Cufflinks will only report isoforms that are
included in the annotation, while in the latter case it will report novel isoforms as well.
The Ensembl annotation for Danio rerio is available in annotation/Danio rerio.Zv9.66.gtf.
The general format of the cufflinks command is:
cufflinks [options]* <aligned_reads.(sam|bam)>

Where the input is the aligned reads (either in SAM or BAM format).

Some of the available parameters for Cufflinks that we are going to use to run Cufflinks
are listed below:

-o Output directory.

-G Tells Cufflinks to use the supplied GTF annota-

tions strictly in order to estimate isoform annota-
tion.

-b Instructs Cufflinks to run a bias detection and cor-

rection algorithm which can significantly improve
accuracy of transcript abundance estimates. To do
this Cufflinks requires a multi-fasta file with the
genomic sequences against which we have aligned
the reads.

-u Tells Cufflinks to do an initial estimation proce-

dure to more accurately weight reads mapping to
multiple locations in the genome (multi-hits).

--library-type Before performing any type of RNA-seq analysis

you need to know a few things about the library
preparation. Was it done using a strand-specific
protocol or not? If yes, which strand? In our data
the protocol was NOT strand specific.

52 TRAINER’S MANUAL
Isoform Expression and Transcriptome Assembly RNA-Seq

Perform transcriptome assembly, strictly using the supplied GTF annotations, for the
2cells and 6h data using cufflinks:
# 2cells data (takes approx. 5mins):
cufflinks -o cufflinks/ZV9_2cells_gtf -G \
annotation/Danio_rerio.Zv9.66.gtf -b \
genome/Danio_rerio.Zv9.66.dna.fa -u --library-type fr-unstranded \
tophat/ZV9_2cells/accepted_hits.bam
# 6h data (takes approx. 5mins):
cufflinks -o cufflinks/ZV9_6h_gtf -G annotation/Danio_rerio.Zv9.66.gtf \
-b genome/Danio_rerio.Zv9.66.dna.fa -u --library-type fr-unstranded \
tophat/ZV9_6h/accepted_hits.bam

Cufflinks generates several files in the specified output directory. Here’s a short description
of these files:

genes.fpkm tracking Contains the estimated gene-level expression val-

ues.

isoforms.fpkm tracking Contains the estimated isoform-level expression

values.

skipped.gtf Contains loci skipped as a result of exceeding the

maximum number of fragments.

transcripts.gtf This GTF file contains Cufflinks’ assembled iso-

forms.

The complete documentation can be found at: http://cufflinks.cbcb.umd.edu/manual.

html#cufflinks_output

So far we have forced cufflinks, by using the -G option, to strictly use the GTF annotations
provided and thus novel transcripts will not be reported. We can get cufflinks to perform
a GTF-guided transcriptome assembly by using the -g option instead. Thus, novel
transcripts will be reported.

TRAINER’S MANUAL 53
RNA-Seq Differential Expression

GTF-guided transcriptome assembly is more computationally intensive than strictly

using the GTF annotations. Therefore, we have pre-computed these GTF-guided
assemblies for you and have placed the results under subdirectories:
cufflinks/ZV9 2cells gtf guided and cufflinks/ZV9 6h gft guided.
You DO NOT need to run these commands. We provide them so you know how we
generated the the GTF-guided transcriptome assemblies:
# 2cells guided transcriptome assembly (takes approx. 30mins):
cufflinks -o cufflinks/ZV9_2cells_gtf_guided -g \
annotation/Danio_rerio.Zv9.66.gtf -b \
genome/Danio_rerio.Zv9.66.dna.fa -u --library-type fr-unstranded \
tophat/ZV9_2cells/accepted_hits.bam
# 6h guided transcriptome assembly (takes approx. 30mins):
cufflinks -o cufflinks/ZV9_6h_gtf_guided -g \
annotation/Danio_rerio.Zv9.66.gtf -b \
genome/Danio_rerio.Zv9.66.dna.fa -u --library-type fr-unstranded \
tophat/ZV9_6h/accepted_hits.bam

1. Go back to IGV and load the pre-computed, GTF-guided transcriptome assembly

for the 2cells data (cufflinks/ZV9 2cells gtf guided/transcripts.gtf).

2. Rename the track as “2cells GTF-Guided Transcripts”.

3. In the search box type ENSDART00000082297 in order for the browser to zoom in to
the gene of interest.

Do you observe any difference between the Ensembl GTF annotations and the GTF-
guided transcripts assembled by cufflinks (the “2cells GTF-Guided Transcripts” track)?
Yes. It appears that the Ensembl annotations may have truncated the last exon.
However, our data also doesn’t contain reads that span between the last two exons.

Differential Expression
One of the stand-alone tools that perform differential expression analysis is Cuffdiff. We
use this tool to compare between two conditions; for example different conditions could
be control and disease, or wild-type and mutant, or various developmental stages.
In our case we want to identify genes that are differentially expressed between two
developmental stages; a 2cells embryo and 6h post fertilization.
The general format of the cuffdiff command is:

54 TRAINER’S MANUAL
Differential Expression RNA-Seq

cuffdiff [options]* <transcripts.gtf> \

<sample1_replicate1.sam[,...,sample1_replicateM]> \
<sample2_replicate1.sam[,...,sample2_replicateM.sam]>

Where the input includes a transcripts.gtf file, which is an annotation file of the
genome of interest or the cufflinks assembled transcripts, and the aligned reads (either in
SAM or BAM format) for the conditions. Some of the Cufflinks options that we will use
to run the program are:

-o Output directory.

-L Labels for the different conditions

-T Tells Cuffdiff that the reads are from a time series

experiment.

-b Instructs Cufflinks to run a bias detection and cor-

rection algorithm which can significantly improve
accuracy of transcript abundance estimates. To do
this Cufflinks requires a multi-fasta file with the
genomic sequences against which we have aligned
the reads.

-u Tells Cufflinks to do an initial estimation proce-

dure to more accurately weight reads mapping to
multiple locations in the genome (multi-hits).

--library-type Before performing any type of RNA-seq analysis

you need to know a few things about the library
preparation. Was it done using a strand-specific
protocol or not? If yes, which strand? In our data
the protocol was NOT strand specific.

-C Biological replicates and multiple group contrast

can be defined here
Run cuffdiff on the tophat generated BAM files for the 2cells vs. 6h data sets:
cuffdiff -o cuffdiff/ -L ZV9_2cells,ZV9_6h -T -b \
genome/Danio_rerio.Zv9.66.dna.fa -u --library-type fr-unstranded \
annotation/Danio_rerio.Zv9.66.gtf \
tophat/ZV9_2cells/accepted_hits.bam tophat/ZV9_6h/accepted_hits.bam

We are interested in the differential expression at the gene level. The results are reported
by Cuffdiff in the file cuffdiff/gene exp.diff. Look at the first few lines of the file
using the following command:
head -n 20 cuffdiff/gene_exp.diff

TRAINER’S MANUAL 55
RNA-Seq Differential Expression

We would like to see which are the most significantly differentially expressed genes.
Therefore we will sort the above file according to the q value (corrected p value for multiple
testing). The result will be stored in a different file called gene exp qval.sorted.diff.
sort -t$'\t' -g -k 13 cuffdiff/gene_exp.diff > \
cuffdiff/gene_exp_qval.sorted.diff

Look again at the first few lines of the sorted file by typing:
head -n 20 cuffdiff/gene_exp_qval.sorted.diff

Copy an Ensembl transcript identifier from the first two columns for one of these genes
(e.g. ENSDARG00000077178). Now go back to the IGV browser and paste it in the search
box.

What are the various outputs generated by cuffdiff? Hint: Please refer to the Cuffdiff
output section of the cufflinks manual online.
Do you see any difference in the read coverage between the 2cells and 6h con-
ditions that might have given rise to this transcript being called as differentially
expressed?

The coverage on the Ensembl browser is based on raw reads and no normalisation
has taken place contrary to the FPKM values.

The read coverage of this transcript (ENSDARG00000077178) in the 2cells data set is
much higher than in the 6h data set.

Cuffquant utility from the cufflinks suite can be used to generate the count files to be
used with count based differential analysis methods such as, edgeR and Deseq.

Visualising the CuffDiff expression analysis

We will use an R-Bioconductor package called cummeRbund to visualise, manipulate
and explore Cufflinks RNA-seq output. We will load an R environment and look at
few quick tips to generate simple graphical output of the cufflinks analysis we have
just run.

56 TRAINER’S MANUAL
Differential Expression RNA-Seq

CummeRbund takes the cuffdiff output and populates a SQLite database with various
type of output generated by cuffdiff e.g, genes, transcripts, transcription start site,
isoforms and CDS regions. The data from this database can be accessed and processed
easily. This package comes with a number of in-built plotting functions that are
commonly used for visualising the expression data. We strongly recommend reading
through the bioconductor manual and user guide of CummeRbund to learn about
functionality of the tool. The reference is provided in the resource section.

TRAINER’S MANUAL 57
RNA-Seq Differential Expression

Prepare the environment. Go to the cuffdiff output folder and copy the transcripts
file there.
cd ~/RNA-seq/cuffdiff
cp ~/RNA-seq/annotation/Danio_rerio.Zv9.66.gtf ~/RNA-seq/cuffdiff
ls -l

Load the R environment

R (press enter)

Load the require R package.

library(cummeRbund)

Read in the cuffdiff output

cuff<-readCufflinks(dir="/home/trainee/Desktop/RNA-seq/cuffdiff", \
gtfFile='Danio_rerio.Zv9.66.gtf',genome="Zv9", rebuild=T)

Assess the distribution of FPKM scores across samples

pdf(file = "SCV.pdf", height = 6, width = 6)
dens<-csDensity(genes(cuff))
dens
dev.off()

Box plots of the FPKM values for each samples

pdf(file = "BoxP.pdf", height = 6, width = 6)
b<-csBoxplot(genes(cuff))
b
dev.off()

Accessing the data

sigGeneIds<-getSig(cuff,alpha=0.05,level="genes")
head(sigGeneIds)
sigGenes<-getGenes(cuff,sigGeneIds)
sigGenes
head(fpkm(sigGenes))
head(fpkm(isoforms(sigGenes)))

Plotting a heatmap of the differentially expressed genes

pdf(file = "heatmap.pdf", height = 6, width = 6)
h<-csHeatmap(sigGenes,cluster="both")
h
dev.off()

58 TRAINER’S MANUAL
Differential Expression RNA-Seq

What options would you use to draw a density or boxplot for different replicates
if available ? (Hint: look at the manual at Bioconductor website)
densRep<-csDensity(genes(cuff),replicates=T)
brep<-csBoxplot(genes(cuff),replicates=T)

How many differentially expressed genes did you observe? type ’summary(sigGenes)’
on the R prompt to see.

TRAINER’S MANUAL 59
RNA-Seq Differential Expression

Functional Annotation of Differentially Expressed

Genes
After you have performed the differential expression analysis you are interested in
identifying if there is any functionality enrichment for your differentially expressed
genes. On your Desktop click:
Applications >> Internet >> Firefox Web Browser

And go to the following URL: http://david.abcc.ncifcrf.gov/ On the left side

click on Functional Annotation. Then click on the Upload tab. Under the section
Choose from File, click Choose File and navigate to the cuffdiff directory. Select
the file called globalDiffExprs Genes qval.01 top100.tab. Under Step 2 select
ENSEMBL GENE ID from the drop-down menu. Finally select Gene list and then
press Submit List. Click on Gene Ontology and then click on the CHART button of
the GOTERM BP ALL item.

Do these categories make sense given the samples we’re studying? Developmental
Biology
Browse around DAVID website and check what other information are available.
Cellular component, Molecular function, Biological Processes, Tissue expression,
Pathways, Literature, Protein domains

60 TRAINER’S MANUAL
Differential Gene Expression Analysis using edgeR RNA-Seq

Differential Gene Expression Analysis using edgeR

The example we are working through today follows a case Study set out in the edgeR
Users Guide (4.3 Androgen-treated prostate cancer cells (RNA-Seq, two groups) which
is based on an experiment conducted by Li et al. (2008, Proc Natl Acad Sci USA, 105,
20179-84).
The researches used a prostate cancer cell line (LNCaP cells). These cells are sensitive to
stimulation by male hormones (androgens). Three replicate RNA samples were collected
from LNCaP cells treated with an androgen hormone (DHT). Four replicates were collected
from cells treated with an inactive compound. Each of the seven samples was run on a
lane (7 lanes) of an Illumina flow cell to produce 35 bp reads. The experimental design
was therefore:
Table 6: Experimental design

Lane Treatment Label

1 Control Con1
2 Control Con2
3 Control Con3
4 Control Con4
5 DHT DHT1
6 DHT DHT2
7 DHT DHT3

Prepare the environment and load R:

cd ~/RNA-seq/edgeR
R (press enter)

Once on the R prompt. Load libraries:

library(edgeR)
library(biomaRt)
library(gplots)

Read in count table and experimental design:

data <- read.delim("pnas_expression.txt", row.names=1, header=T)
targets <- read.delim("Targets.txt", header=T)

Create DGEList object:

y <- DGEList(counts=data[,1:7], group=targets$Treatment)

Change the column names of the object to align with treatment:

colnames(y) <- targets$Label

TRAINER’S MANUAL 61
RNA-Seq Differential Gene Expression Analysis using edgeR

Check the dimensions of the object:

dim(y)

We see we have 37435 rows (i.e. genes) and 7 columns (samples).

Now we will filter out genes with low counts by only keeping those rows where the count
per million (cpm) is at least 1 in at least three samples:
keep <-rowSums( cpm(y)>1) >=3
y <- y[keep, ]

How many rows (genes) are retained now dim(y) would give you 16494
How many genes were filtered out? do 37435-16494.

We will now perform normalization to take account of different library size:

y<-calcNormFactors(y)

We will check the calculated normalization factors:

y$samples

Lets have a look at whether the samples cluster by condition. (You should produce a plot
as shown in Figure 4):
plotMDS(y)

62 TRAINER’S MANUAL
Differential Gene Expression Analysis using edgeR RNA-Seq

Figure 4: Visualization of sample clustering

We now estimate common and gene-specific dispersion:

y <- estimateCommonDisp(y)
y <- estimateTagwiseDisp(y)

We will plot the tagwise dispersion and the common dispersion (You should obtain a plot
as shown in the Figure 5):
plotBCV(y)

TRAINER’S MANUAL 63
RNA-Seq Differential Gene Expression Analysis using edgeR

Figure 5: Visualization of sample clustering

We see here that the common dispersion estimates the overall Biological Coefficient of
Variation (BCV) of the dataset averaged over all genes. The common dispersion is 0.02
and the BCV is the square root of the common dispersion (sqrt[0.02] = 0.14). A BCV of
14% is typical for cell line experiment.
We now test for differentially expressed BCV genes:
et <- exactTest(y)

Now we will use the topTags function to adjust for multiple testing. We will use the
Benjimini Hochberg (”BH”) method and we will produce a table of results:
res <- topTags(et, n=nrow(y$counts), adjust.method="BH")$table

Let’s have a look at the first rows of the table:

head(res)

You can see we have the ensemble gene identifier in the first column, the log fold change in
the second column, the the logCPM, the P-Value and the adjusted P-Value. The ensemble
gene identifier is not as helpful as the gene symbol so let’s add in a column with the gene

64 TRAINER’S MANUAL
Differential Gene Expression Analysis using edgeR RNA-Seq

symbol. We will use the BiomaRt package to do this.

item We start by using the useMart function of BiomaRt to access the human data base
of ensemble gene ids. Then we create a vector of our ensemble gene ids:
ensembl_names<-rownames(res)
ensembl<-useMart("ensembl", dataset="hsapiens_gene_ensembl")

We then use the function getBM to get the gene symbol data we want
Tthis can take about a minute or so to complete.

genemap <-getBM( attributes= c("ensembl_gene_id", "entrezgene", \

"hgnc_symbol"), filters="ensembl_gene_id", values=ensembl_names, \
mart=ensembl)

Have a look at the start of the genemap dataframe:

head(genemap)

We see that we have 3 columns, the ensemble id, the entrez gene id and the hgnc symbol
We use the match function to match up our data with the data we have just retrieved
from the database.
idx <- match(ensembl_names, genemap$ensembl_gene_id )
res$entrez <-genemap$entrezgene [ idx ]
res$hgnc_symbol <- genemap$hgnc_symbol [ idx ]

Next we have a look at the head of our res dataframe:

head(res)

As you see we have now added the hgnc symbol and the entrez id to our results.
Let’s now make a subset of the most significant upregulated and downregulated genes:
de<-res[res$FDR<0.05, ]
de_upreg <-res[res$FDR<0.05 & res$logFC >0,]
de_downreg <-res[res$FDR<0.05 & res$logFC <0,]

How many differentially expressed genes are there? (Hint: Try str(de) 4429
How many upregulated genes and downregulated genes do we have? str(de upreg) =
2345 str(de downreg) = 2084

Lets write out these results:

write.csv( as.data.frame(de), file="DEGs.csv")

You can try running the list through DAVID for functional annotation. We will select top

TRAINER’S MANUAL 65
RNA-Seq Differential Gene Expression Analysis using edgeR

100 genes from the differential expressed list and write those to a separate list.
de_top_3000 <-de[1:3000,]
de_top_gene_symbols <-de_top_3000$hgnc_symbol
write(de_top_gene_symbols, "DE_gene_symbols.txt", sep="\t")

You can now quit the R prompt

q()

Please note that the output files you are creating are saved in your present working
directory. If you are not sure where you are in the file system try typing pwd on your
command prompt to find out.

66 TRAINER’S MANUAL
References RNA-Seq

References
1. Trapnell, C., Pachter, L. & Salzberg, S. L. TopHat: discovering splice junctions with
RNA-Seq. Bioinformatics 25, 1105-1111 (2009).

2. Trapnell, C. et al. Transcript assembly and quantification by RNA-Seq reveals

unannotated transcripts and isoform switching during cell differentiation. Nat.
Biotechnol. 28, 511-515 (2010).

3. Langmead, B., Trapnell, C., Pop, M. & Salzberg, S. L. Ultrafast and memory-efficient
alignment of short DNA sequences to the human genome. Genome Biol. 10, R25
(2009).

4. Roberts, A., Pimentel, H., Trapnell, C. & Pachter, L. Identification of novel tran-
scripts in annotated genomes using RNA-Seq. Bioinformatics 27, 2325-2329 (2011).

5. Roberts, A., Trapnell, C., Donaghey, J., Rinn, J. L. & Pachter, L. Improving RNA-
Seq expression estimates by correcting for fragment bias. Genome Biol. 12, R22
(2011).

6. Robinson MD, McCarthy DJ and Smyth GK. edgeR: a Bioconductor package for
differential expression analysis of digital gene expression data. Bioinformatics, 26
(2010).

7. Robinson MD and Smyth GK Moderated statistical tests for assessing differences in

tag abundance. Bioinformatics, 23, pp. -6.

8. Robinson MD and Smyth GK (2008). Small-sample estimation of negative binomial

dispersion, with applications to SAGE data.âĂİ Biostatistics, 9.

9. McCarthy, J. D, Chen, Yunshun, Smyth and K. G (2012). Differential expression

analysis of multifactor RNA-Seq experiments with respect to biological variation.
Nucleic Acids Research, 40(10), pp. -9.

TRAINER’S MANUAL 67
Module: de novo Genome Assembly

Primary Author(s):
Matthias Haimel [email protected]
Nathan S. Watson-Haigh [email protected]

Contributor(s):
de novo Genome Assembly Key Learning Outcomes

Key Learning Outcomes

After completing this practical the trainee should be able to:

• Compile velvet with appropriate compile-time parameters set for a specific analysis

• Be able to choose appropriate assembly parameters

• Assemble a set of single-ended reads

• Assemble a set of paired-end reads from a single insert-size library

• Be able to visualise an assembly in AMOS Hawkeye

• Understand the importance of using paired-end libraries in de novo genome assembly

Resources You’ll be Using

Although we have provided you with an environment which contains all the tools and
data you will be using in this module, you may like to know where we have sourced those
tools and data from.

Tools Used
Velvet
http://www.ebi.ac.uk/˜zerbino/velvet/

AMOS Hawkeye
http://apps.sourceforge.net/mediawiki/amos/index.php?title=Hawkeye

gnx-tools
https://github.com/mh11/gnx-tools

FastQC
http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/

R
http://www.r-project.org/

70 TRAINER’S MANUAL
Resources You’ll be Using de novo Genome Assembly

Sources of Data
• ftp://ftp.ensemblgenomes.org/pub/release-8/bacteria/fasta/Staphylococcus/
s_aureus_mrsa252/dna/s_aureus_mrsa252.EB1_s_aureus_mrsa252.dna.chromosome.
Chromosome.fa.gz

• http://www.ebi.ac.uk/ena/data/view/SRS004748

• ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR022/SRR022825/SRR022825.fastq.gz

• ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR022/SRR022823/SRR022823.fastq.gz

• http://www.ebi.ac.uk/ena/data/view/SRX008042

• ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR022/SRR022852/SRR022852_1.fastq.
gz

• ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR022/SRR022852/SRR022852_2.fastq.
gz

• ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR023/SRR023408/SRR023408_1.fastq.
gz

• ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR023/SRR023408/SRR023408_2.fastq.
gz

• http://www.ebi.ac.uk/ena/data/view/SRX000181

• ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR000/SRR000892/SRR000892.fastq.gz

• ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR000/SRR000893/SRR000893.fastq.gz

• http://www.ebi.ac.uk/ena/data/view/SRX007709

• ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR022/SRR022863/SRR022863_1.fastq.
gz

• ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR022/SRR022863/SRR022863_2.fastq.
gz

TRAINER’S MANUAL 71
de novo Genome Assembly Introduction

Introduction
The aim of this module is to become familiar with performing de novo genome assembly
using Velvet, a de Bruijn graph based assembler, on a variety of sequence data.

Prepare the Environment

The first exercise should get you a little more comfortable with the computer environment
and the command line.
First make sure that you are in your home directory by typing:
cd

and making absolutely sure you’re there by typing:

pwd

Now create sub-directories for this and the two other velvet practicals. All these directories
will be made as sub-directories of a directory for the whole course called NGS. For this
you can use the following commands:
mkdir -p NGS/velvet/{part1,part2,part3}

The -p tells mkdir (make directory) to make any parent directories if they don’t already
exist. You could have created the above directories one-at-a-time by doing this instead:
mkdir NGS
mkdir NGS/velvet
mkdir NGS/velvet/part1
mkdir NGS/velvet/part2
mkdir NGS/velvet/part3

After creating the directories, examine the structure and move into the directory ready
for the first velvet exercise by typing:
ls -R NGS
cd NGS/velvet/part1
pwd

72 TRAINER’S MANUAL
Downloading and Compiling Velvet de novo Genome Assembly

Downloading and Compiling Velvet

For the duration of this workshop, all the software you require has been set up for you
already. This might not be the case when you return to “real life”. Many of the programs
you will need, including velvet, are quite easy to set up, it might be instructive to try a
couple.

Although you will be using the preinstalled version of velvet, it is useful to know how to
compile velvet as some of the parameters you might like to control can only be set at
compile time. You can find the latest version of velvet at:
http://www.ebi.ac.uk/˜zerbino/velvet/
You could go to this URL and download the latest velvet version, or equivalently, you
could type the following, which will download, unpack, inspect, compile and execute your
locally compiled version of velvet:
cd ~/NGS/velvet/part1
pwd
tar xzf ~/NGS/Data/velvet_1.2.10.tgz
ls -R
cd velvet_1.2.10
make
./velveth

The standout displayed to screen when ’make’ runs may contain an error message but it
is ignored

Take a look at the executables you have created. They will be displayed as green by the
command:
ls --color=always

The switch --color, instructs that files be coloured according to their type. This is often
the default but we are just being explicit. By specifying the value always, we ensure that
colouring is always applied, even from a script.

Have a look of the output the command produces and you will see that MAXKMERLENGTH=31
and CATEGORIES=2 parameters were passed into the compiler.
This indicates that the default compilation was set for de Bruijn graph k-mers of maximum
size 31 and to allow a maximum of just 2 read categories. You can override these, and
other, default configuration choices using command line parameters. Assume, you want
to run velvet with a k-mer length of 41 using 3 categories, velvet needs to be recompiled
to enable this functionality by typing:
make clean
make MAXKMERLENGTH=41 CATEGORIES=3
./velveth

TRAINER’S MANUAL 73
de novo Genome Assembly Downloading and Compiling Velvet

Discuss with the persons next to you the following questions:

What are the consequences of the parameters you have given make for velvet?
MAXKMERLENGTH: increase the max k-mer length from 31 to 41
CATEGORIES: paired-end data require to be put into separate categories. By
increasing this parameter from 2 to 3 allows you to process 3 paired / mate-pair
libraries and unpaired data.
Why does Velvet use k-mer 31 and 2 categories as default? Possibly a number of
reason:
- odd number to avoid palindromes
- The first reads were very short (20-40 bp) and there were hardly any paired-end
data
around so there was no need to allow for longer k-mer lengths / more categories.
- For programmers: 31 bp get stored in 64 bits (using 2bit encoding)
Should you get better results by using a longer k-mer length? If you can achieve a
good k-mer coverage - yes.

velvet can also be used to process SOLID colour space data. To do this you need
a further make parameter. With the following command clean away your last
compilation and try the following parameters:
make clean
make MAXKMERLENGTH=41 CATEGORIES=3 color
./velveth_de

What effect would the following compile-time parameters have on velvet:

OPENMP=Y Turn on multithreading
LONGSEQUENCES=Y Assembling reads / contigs longer than 32kb long
BIGASSEMBLY=Y Using more than 2.2 billion reads
VBIGASSEMBLY=Y Not documented yet
SINGLE COV CAT=Y Merge all coverage statistics into a single variable - save memory

For a further description of velvet compile and runtime parameters please see the velvet
Manual: https://github.com/dzerbino/velvet/wiki/Manual

74 TRAINER’S MANUAL
Assembling Single-end Reads de novo Genome Assembly

Assembling Single-end Reads

The following exercise focuses on velvet using single-end reads, how the available parameters
effect an assembly and how to measure and compare the changes.
Even though you have carefully compiled velvet in your own workspace, we will be use the
pre-installed version.
The data you will use is from Staphylococcus aureus USA300 which has a genome of
around 3MBases. The reads are unpaired Illumina, also known as single-end library.
The data for this section was obtained from the Sequence Read Archive (SRA), using
SRR022825 and SRR022823 run data from SRA Sample SRS004748. The SRA experiment
can be viewed at:

http://www.ebi.ac.uk/ena/data/view/SRS004748

To begin with, first move back to the directory you prepared for this exercise, create a new
folder with a suitable name for this part and move into it. There is no need to download
the read files, as they are already stored locally. Instead we will create symlinks to the
files. Continue by copying (or typing):
cd ~/NGS/velvet/part1
mkdir SRS004748
cd SRS004748
pwd
ln -s ~/NGS/Data/SRR022825.fastq.gz ./
ln -s ~/NGS/Data/SRR022823.fastq.gz ./
ls -l

You are ready to process your data with Velvet. There are two main components to
Velvet:

velveth Used to construct, from raw read data, a dataset

organised in the fashion expected by the second
component, velvetg.

velvetg The core of velvet where the de Bruijn graph as-

sembly is built and manipulated.

You can always get further information about the usage of both velvet programs by typing
velvetg or velveth in your terminal.

Now run velveth for the reads in SRR022825.fastq.gz and SRR022823.fastq.gz using
the following options:

• A de Bruijn graph k-mer of 25

TRAINER’S MANUAL 75
de novo Genome Assembly Assembling Single-end Reads

• An output directory called run 25

velveth run_25 25 -fastq.gz -short SRR022825.fastq.gz SRR022823.fastq.gz

velveth Once velveth finishes, move into the output directory run 25 and have a look
at what velveth has generated so far. The command less allows you to look at output
files (press q to quit and return to the command prompt). Here are some other options
for looking at file contents:
cd run_25
ls -l
head Sequences
cat Log

What did you find in the folder run 25? Sequences, Roadmaps, Log
Describe the content of the two velveth output files? Sequences: FASTA file version
of provided reads
Roadmaps: Internal file of velvet - basic information about number of reads, k-mer
size
What does the Log file store for you? Time stamp, Executed commands; velvet
version + compiler parameters, results

Now move one directory level up and run velvetg on your output directory, with the
commands:
cd ../
time velvetg run_25

Move back into your results directory to examine the effects of velvetg:
cd run_25
ls -l

What extra files do you see in the folder run 25? PreGraph, Graph, stats.txt,
contigs.fa, LastGraph
What do you suppose they might represent? PreGraph, Graph, LastGraph: Velvet
internal graph representation at different stages (see manual for more details about
the file format)
stats.txt: tab-delimited description of the nodes of the graph incl. coverage information
contigs.fa: assembly output file
In the Log file in run 25, what is the N50? 4409 bp

76 TRAINER’S MANUAL
Assembling Single-end Reads de novo Genome Assembly

Hopefully, we will have discussed what the N50 statistic is by this point. Broadly, it is the
median (not average) of a sorted data set using the length of a set of sequences. Usually
it is the length of the contig whose length, when added to the length of all longer contigs,
makes a total greater that half the sum of the lengths of all contigs. Easy, but messy - a
more formal definition can be found here:

http://www.broadinstitute.org/crd/wiki/index.php/N50

Backup the contigs.fa file and calculate the N50 (and the N25,N75) value with the
command:
cp contigs.fa contigs.fa.0
gnx -min 100 -nx 25,50,75 contigs.fa

Does the value of N50 agree with the value stored in the Log file? No
If not, why do you think this might be? K-mer N50 vs bp N50; contig length cut-off
value, estimated genome length

In order to improve our results, take a closer look at the standard options of velvetg
by typing velvetg without parameters. For the moment focus on the two options
-cov cutoff and -exp cov. Clearly -cov cutoff will allow you to exclude contigs for
which the k-mer coverage is low, implying unacceptably poor quality. The -exp cov
switch is used to give velvetg an idea of the coverage to expect.
If the expected coverage of any contig is substantially in excess of the suggested expected
value, maybe this would indicate a repeat. For further details of how to choose the
parameters, go to “Choice of a coverage cutoff”:

http://wiki.github.com/dzerbino/velvet/

Briefly, the k-mer coverage (and much more information) for each contig is stored in the
file stats.txt and can be used with R to visualize the k-mer coverage distribution. Take
a look at the stats.txt file, start R, load and visualize the data using the following
commands:
R --no-save --no-restore
install.packages('plotrix')
library(plotrix)
data <- read.table("stats.txt", header=TRUE)
weighted.hist(data$short1_cov, data$lgth, breaks=0:50)

A weighted histogram is a better way of visualizing the coverage information, because of

noise (lots of very short contigs). You can see an example output below:

TRAINER’S MANUAL 77
de novo Genome Assembly Assembling Single-end Reads

Figure 6: A weighted k-mer coverage histogram of the single-end reads.

After choosing the expected coverage and the coverage cut-off, you can exit R by typing:
q()

The weighted histogram suggests to me that the expected coverage is around 14 and that
everything below 6 is likely to be noise. Some coverage is also represented at around 20,
30 and greater 50, which might be contamination or repeats (depending on the dataset),
but at the moment this should not worry you. To see the improvements, rerun velvetg
first with -cov cutoff 6 and after checking the N50 use only / add -exp cov 14 to the
command line option. Also keep a copy of the contigs file for comparison:
cd ~/NGS/velvet/part1/SRS004748
time velvetg run_25 -cov_cutoff 6

# Make a copy of the run

cp run_25/contigs.fa run_25/contigs.fa.1

time velvetg run_25 -exp_cov 14

cp run_25/contigs.fa run_25/contigs.fa.2

time velvetg run_25 -cov_cutoff 6 -exp_cov 14

cp run_25/contigs.fa run_25/contigs.fa.3

78 TRAINER’S MANUAL
Assembling Single-end Reads de novo Genome Assembly

What is the N50 with no parameter: 4,447 bp

What is the N50 with -cov cutoff 6: 5,168 bp
What is the N50 with -exp cov 14: 4,903 bp
What is the N50 with -cov cutoff 6 -exp cov 14: 5,417 bp
Did you notice a variation in the time velvetg took to run? If so, can you explain
why that might be? Velvet reuses already calculated results (from PreGraph,Graph)

You were running velvetg with the -exp cov and -cov cutoff parameters. Now try to
experiment using different cut-offs, expected parameters and also explore other settings
(e.g. -max coverage, -max branch length, -unused reads, -amos file, -read trkg or
see velvetg help menu).

Make some notes about the parameters you’ve played with and the results you ob-
tained. -max coverage: cut-off value for the upper range (like cov cutoff for the lower
range)
-max branch length: length of branch to look for bubble
-unused reads: write unused reads into file
-amos file: write AMOS message file
-read trkg: tracking read (more memory usage) - automatically on for certain opera-
tions

AMOS Hawkeye
The -amos file argument tells velvetg to output the assembly as an AMOS message
file (*.afg) which can then be used by tools like Hawkeye from the AMOS suite of tools.
Lets create the AMOS message file by running velvetg with some appropriate parameters:
velvetg run_25 -cov_cutoff 6 -exp_cov 14 -amos_file yes

The -exp cov argument to enable read-tracking -read trkg yes in Velvet. Without read
tracking enabled, very little read-level information can be output to the AMOS message
file. This results in a pretty useless visualisation in Hawkeye! However, since reads are
being tracked, the analysis takes longer and uses more memory.

Now convert the AMOS message file velvet asm.afg into an AMOS bank using bank-transact
and view the assembly with AMOS Hawkeye.

TRAINER’S MANUAL 79
de novo Genome Assembly Assembling Single-end Reads

bank-transact -c -b run_25/velvet_asm.bnk -m run_25/velvet_asm.afg

hawkeye run_25/velvet_asm.bnk

Have a look around the interface, in particular try to look at the “Scaffold View” and
“Contig View” of the larges scaffold. You should see something like this:

Figure 7:

If you have time, try running the velvetg command without the -exp cov argument,
create the AMOS bank and see how the assemblies look different in Hawkeye. Here’s
a hint:
velvetg run_25 -cov_cutoff 6 -amos_file yes
bank-transact -c -b run_25/velvet_asm.bnk -m run_25/velvet_asm.afg
hawkeye run_25/velvet_asm.bnk

80 TRAINER’S MANUAL
Assembling Single-end Reads de novo Genome Assembly

Simple Assembly Simulation

The data for this section is from Staphylococcus aureus MRSA252, a genome closely
related to the genome that provided the short read data in the earlier sections of this
exercise. The sequence data this time is the fully assembled genome. The genome
size is therefore known exactly and is 2,902,619 bp.

In this exercise you will process the single whole genome sequence with velveth and
velvetg, look at the output only and go no further. The main intent of processing
this whole genome is to compute its N50 value. This must clearly be very close to the
ideal N50 value for the short reads assembly and so aid evaluation of that assembly.

To begin, move back to the main directory for this exercise, make a sub-directory for
the processing of this data and move into it. All in one go, this would be:
cd ~/NGS/velvet/part1/
mkdir MRSA252
cd MRSA252

Next, you need to download the genome sequence from http://www.ensemblgenomes.

org/ which holds five new sites, for bacteria, protists, fungi, plants and invertebrate
metazoa. You could browse for the data you require or use the file which we have
downloaded for you. For the easier of these options, make and check a symlink to the
local file and with the commands:
ln -s ~\
/NGS/Data/s_aureus_mrsa252.EB1_s_aureus_mrsa252.dna.chromosome.Chromosome.fa.gz \
./
ls -l

Usually Velvet expects relatively short sequence entries and for this reason has a read
limit of 32,767 bp per sequence entry. As the genome size is 2,902,619 bp - longer
as the allowed limit and does not fit with the standard settings into velvet. But
like the maximum k-mer size option, you can tell Velvet during compile time, using
LONGSEQUENCES=Y, to expect longer input sequences than usual. I already prepared
the executable which you can use by typing velveth long and velvetg long.

TRAINER’S MANUAL 81
de novo Genome Assembly Assembling Paired-end Reads

Now, run velveth long, using the file you either just downloaded or created a symlink
to as the input:
velveth_long run_25 25 -fasta.gz -long \
s_aureus_mrsa252.EB1_s_aureus_mrsa252.dna.chromosome.Chromosome.fa.gz
velvetg_long run_25

What is the N50? 24,142 bp

How does the N50 compare to the previous single end run (SRS004748)? Big
difference
Does the total length differ from the input sequence length? 2,817,181 (stats) vs
2,902,619 (input)
What happens when you rerun velvet with a different k-mer length? K-mer 31:
N50: 30,669 bp, total 2,822,878

Assembling Paired-end Reads

The use of paired-end data in de novo genome assembly results in better quality assemblies,
particularly for larger, more complex genomes. In addition, paired-end constraint violation
(expected distance and orientation of paired reads) can be used to identify misassemblies.

If you are doing de novo assembly, pay the extra and get paired-ends: they’re worth
it!

The data you will examine in this exercise is again from Staphylococcus aureus which has
a genome of around 3MBases. The reads are Illumina paired end with an insert size of
350 bp.
The required data can be downloaded from the SRA. Specifically, the run data (SRR022852)
from the SRA Sample SRS004748.

http://www.ebi.ac.uk/ena/data/view/SRS004748

The following exercise focuses on preparing the paired-end FASTQ files ready for Velvet,
using Velvet in paired-end mode and comparing results with Velvet’s ’auto’ option.

First move to the directory you made for this exercise and make a suitable named directory
for the exercise:
cd ~/NGS/velvet/part2
mkdir SRS004748

82 TRAINER’S MANUAL
Assembling Paired-end Reads de novo Genome Assembly

cd SRS004748

There is no need to download the read files, as they are already stored locally. You will
simply create a symlink to this pre-downloaded data using the following commands:
ln -s ~/NGS/Data/SRR022852_?.fastq.gz ./

It is interesting to monitor the computer’s resource utilisation, particularly memory. A

simple way to do this is to open a second terminal and in it type:
top

top is a program that continually monitors all the processes running on your computer,
showing the resources used by each. Leave this running and refer to it periodically
throughout your Velvet analyses. Particularly if they are taking a long time or whenever
your curiosity gets the better of you. You should find that as this practical progresses,
memory usage will increase significantly.
Now, back to the first terminal, you are ready to run velveth and velvetg. The reads
are -shortPaired and for the first run you should not use any parameters for velvetg.

From this point on, where it will be informative to time your runs. This is very easy to
do, just prefix the command to run the program with the command time. This will cause
UNIX to report how long the program took to complete its task.

Set the two stages of velvet running, whilst you watch the memory usage as reported by
top. Time the velvetg stage:
velveth run_25 25 -fmtAuto -create_binary -shortPaired -separate \
SRR022852_1.fastq.gz SRR022852_2.fastq.gz
time velvetg run_25

What does -fmtAuto and -create binary do? (see help menu) -fmtAuto tries to
detect the correct format of the input files e.g. FASTA, FASTQ and whether they
are compressed or not.
-create binary outputs sequences as a binary file. That means that velvetg can
read the sequences from the binary file more quickly that from the original sequence
files.
Comment on the use of memory and CPU for velveth and velvetg? velveth uses
only one CPU while velvetg uses all possible CPUs for some parts of the calculation.

How long did velvetg take? My own measurements are:

real 1m8.877s; user 4m15.324s; sys 0m4.716s

TRAINER’S MANUAL 83
de novo Genome Assembly Assembling Paired-end Reads

Next, after saving your contigs.fa file from being overwritten, set the cut-off parameters
that you investigated in the previous exercise and rerun velvetg. time and monitor the
use of resources as previously. Start with -cov cutoff 16 thus:
mv run_25/contigs.fa run_25/contigs.fa.0
time velvetg run_25 -cov_cutoff 16

Up until now, velvetg has ignored the paired-end information. Now try running velvetg
with both -cov cutoff 16 and -exp cov 26, but first save your contigs.fa file. By
using -cov cutoff and -exp cov, velvetg tries to estimate the insert length, which you
will see in the velvetg output. The command is, of course:
mv run_25/contigs.fa run_25/contigs.fa.1
time velvetg run_25 -cov_cutoff 16 -exp_cov 26

Comment on the time required, use of memory and CPU for velvetg? Runtime
is lower when velvet can reuse previously calculated data. By using -exp cov, the
memory usage increases.
Which insert length does Velvet estimate? Paired-end library 1 has length: 228,
sample standard deviation: 26

Next try running velvetg in ‘paired-end mode‘. This entails running velvetg specifying
the insert length with the parameter -ins length set to 350. Even though velvet estimates
the insert length it is always advisable to check / provide the insert length manually as
velvet can get the statistics wrong due to noise. Just in case, save your last version of
contigs.fa. The commands are:
mv run_25/contigs.fa run_25/contigs.fa.2
time velvetg run_25 -cov_cutoff 16 -exp_cov 26 -ins_length 350
mv run_25/contigs.fa run_25/contigs.fa.3

How fast was this run? My own measurements are:

real 0m29.792s; user 1m4.372s; sys 0m3.880s

Take a look into the Log file.

What is the N50 value for the velvetg runs using the switches:
Base run: 19,510 bp -cov cutoff 16 24,739 bp
-cov cutoff 16 -exp cov 26 61,793 bp
-cov cutoff 16 -exp cov 26 -ins length 350 n50 of 62,740 bp; max 194,649 bp;
total 2,871,093 bp

84 TRAINER’S MANUAL
Assembling Paired-end Reads de novo Genome Assembly

Try giving the -cov cutoff and/or -exp cov parameters the value auto. See the velvetg
help to show you how. The information Velvet prints during running includes information
about the values used (coverage cut-off or insert length) when using the auto option.

What coverage values does Velvet choose (hint: look at the output that Velvet
produces while running)? Median coverage depth = 26.021837
Removing contigs with coverage < 13.010918 . . .
How does the N50 value change? n50 of 68,843 bp; max 194,645 bp; total 2,872,678
bp

Run gnx on all the contig.fa files you have generated in the course of this exercise. The
command will be:
gnx -min 100 -nx 25,50,75 run_25/contigs.fa*

For which runs are there Ns in the contigs.fa file and why? contigs.fa.2, contigs.fa.3,
contigs.fa
Velvet tries to use the provided (or infers) the insert length and fills ambiguous regions
with Ns.
Comment on the number of contigs and total length generated for each run.

Filename No. contigs Total length No. Ns

Contigs.fa.0 631 2,830,659 0
Contigs.fa.1 580 2,832,670 0
Contigs.fa.2 166 2,849,919 4,847
Contigs.fa.3 166 2,856,795 11,713
Contigs.fa 163 2,857,439 11,526
Table 7:

AMOS Hawkeye
We will now output the assembly in the AMOS massage format and visualise the assembly
using AMOS Hawkeye.
Run velvetg with appropriate arguments and output the AMOS message file, then
convert it to an AMOS bank and open it in Hawkeye:
time velvetg run_25 -cov_cutoff 16 -exp_cov 26 -ins_length 350 \
-amos_file yes -read_trkg yes
time bank-transact -c -b run_25/velvet_asm.bnk -m run_25/velvet_asm.afg

TRAINER’S MANUAL 85
de novo Genome Assembly Assembling Paired-end Reads

hawkeye run_25/velvet_asm.bnk

Looking at the scaffold view of a contig, comment on the proportion of “happy mates”
to “compressed mates” and “stretched mates”. Nearly all mates are compressed with
no stretched mates and very few happy mates.
What is the mean and standard deviation of the insert size reported under the
Libraries tab? Mean: 350 bp SD: 35 bp
Look at the actual distribution of insert sizes for this library. Can you explain where
there is a difference between the mean and SD reported in those two places? We
specified -ins length 350 to the velvetg command. Velvet uses this value, in the
AMOS message file that it outputs, rather than its own estimate.

You can get AMOS to re-estimate the mean and SD of insert sizes using intra-contig pairs.
First, close Hawkeye and then run the following commands before reopening the AMOS
bank to see what has changed.
asmQC -b run_25/velvet_asm.bnk -scaff -recompute -update -numsd 2
hawkeye run_25/velvet_asm.bnk

Looking at the scaffold view of a contig, comment on the proportion of “happy mates”
to “compressed mates” and “stretched mates”. There are only a few compressed and
stretched mates compared to happy mates. There are similar numbers of stretched
and compressed mates.
What is the mean and standard deviation of the insert size reported under the
Libraries tab? TODO Mean: 226 bp SD: 25 bp
Look at the actual distribution of insert sizes for this library. Does the mean and SD
reported in both places now match? Yes
Can you find a region with an unusually high proportion of stretched, compressed,
incorrectly orientated or linking mates? What might this situation indicate? This
would indicate a possible misassembly and worthy of further investigation.
Look at the largest scaffold, there are stacks of stretched pairs which span contig
boundaries. This indicates that the gap size has been underestimated during the
scaffolding phase.

86 TRAINER’S MANUAL
Assembling Paired-end Reads de novo Genome Assembly

Velvet and Data Quality

So far we have used the raw read data without performing any quality control or read
trimming prior to doing our velvet assemblies.

Velvet does not use quality information present in FASTQ files.

For this reason, it is vitally important to perform read QC and quality trimming. In
doing so, we remove errors/noise from the dataset which in turn means velvet will run
faster, will use less memory and will produce a better assembly. Assuming we haven’t
compromised too much on coverage.
To investigate the effect of data quality, we will use the run data (SRR023408) from the
SRA experiment SRX008042. The reads are Illumina paired end with an insert size of 92
bp.
Go back to the main directory for this exercise and create and enter a new directory
dedicated to this phase of the exercise. The commands are:
cd ~/NGS/velvet/part2
mkdir SRX008042
cd SRX008042

Create symlinks to the read data files that we downloaded for you from the SRA:
ln -s ~/NGS/Data/SRR023408_?.fastq.gz ./

We will use FastQC, a tool you should be familiar with, to visualise the quality of our
data. We will use FastQC in the Graphical User Interface (GUI) mode.
Start FastQC and set the process running in the background, by using a trailing &, so we
get control of our terminal back for entering more commands:
fastqc &

Open the two compressed FASTQ files (File − > Open) by selecting them both and
clicking OK). Look at tabs for both files:

Figure 8:

TRAINER’S MANUAL 87
de novo Genome Assembly Assembling Paired-end Reads

Are the quality scores the same for both files? Overall yes
Which value varies? Per sequence quality scores
Take a look at the Per base sequence quality for both files. Did you note that it is
not good for either file? The quality score of both files drop very fast. Qualities of
the REV strand drop faster than the FWD strand. This is because the template has
been sat around while the FWD strand was sequenced.
At which positions would you cut the reads if we did “fixed length trimming”? Looking
at the “Per base quality” and “Per base sequence content”, I would choose around 27
Why does the quality deteriorate towards the end of the read? Errors more likely for
later cycles
Does it make sense to trim the 5’ start of reads? Looking at the “Per base sequence
content”, yes - there is a clear signal at the beginning.

Have a look at the other options that FastQC offers.

Which other statistics could you use to support your trimming strategy? “Per base
sequence content”, “Per base GC content”, “Kmer content”, “Per base sequence
quality”

Figure 9:

Once you have decided what your trim points will be, close FastQC. We will use
fastx trimmer from the FASTX-Toolkit to perform fixed-length trimming. For usage
information see the help:
fastx_trimmer -h

fastx trimmer is not able to read compressed FASTQ files, so we first need to decompress
the files ready for input.

The suggestion (hopefully not far from your own thoughts?) is that you trim your reads

88 TRAINER’S MANUAL
Assembling Paired-end Reads de novo Genome Assembly

as follows:
gunzip < SRR023408_1.fastq.gz > SRR023408_1.fastq
gunzip < SRR023408_2.fastq.gz > SRR023408_2.fastq
fastx_trimmer -Q 33 -f 1 -l 32 -i SRR023408_1.fastq -o \
SRR023408_trim1.fastq
fastx_trimmer -Q 33 -f 1 -l 27 -i SRR023408_2.fastq -o \
SRR023408_trim2.fastq

Many NGS read files are large. This means that simply reading and writing files can
become the bottleneck, also known as I/O bound. Therefore, it is often good practice
to avoid unnecessary disk read/write.
We could do what is called pipelining to send a stream of data from one command to
another, using the pipe (|) character, without the need for intermediary files. The
following command would achieve this:
gunzip --to-stdout < SRR023408_1.fastq.gz | fastx_trimmer -Q 33 -f 4 \
-l 32 -o SRR023408_trim1.fastq
gunzip --to-stdout < SRR023408_2.fastq.gz | fastx_trimmer -Q 33 -f 3 \
-l 29 -o SRR023408_trim2.fastq

Now run velveth with a k-mer value of 21 for both the untrimmed and trimmed read
files in -shortPaired mode. Separate the output of the two executions of velveth into
suitably named directories, followed by velvetg:
# untrimmed reads
velveth run_21 21 -fmtAuto -create_binary -shortPaired -separate \
SRR023408_1.fastq SRR023408_2.fastq
time velvetg run_21

# trimmed reads
velveth run_21trim 21 -fmtAuto -create_binary -shortPaired -separate \
SRR023408_trim1.fastq SRR023408_trim2.fastq
time velvetg run_21trim

How long did the two velvetg runs take? run 25: real 3m16.132s; user 8m18.261s;
sys 0m7.317s
run 25trim: real 1m18.611s; user 3m53.140s; sys 0m4.962s
What N50 scores did you achieve? Untrimmed: 11
Trimmed: 15
What were the overall effects of trimming? Time saving, increased N50, reduced
coverage

TRAINER’S MANUAL 89
de novo Genome Assembly Assembling Paired-end Reads

The evidence is that trimming improved the assembly. The thing to do surely, is to
run velvetg with the -cov cutoff and -exp cov. In order to use -cov cutoff and
-exp cov sensibly, you need to investigate with R, as you did in the previous exercise,
what parameter values to use. Start up R and produce the weighted histograms:
R --no-save
library(plotrix)
data <- read.table("run_21/stats.txt", header=TRUE)
data2 <- read.table("run_21trim/stats.txt", header=TRUE)
par(mfrow=c(1,2))
weighted.hist(data$short1_cov, data$lgth, breaks=0:50)
weighted.hist(data2$short1_cov, data2$lgth, breaks=0:50)

Figure 10: Weighted k-mer coverage histograms of the paired-end reads pre-trimmed
(left) and post-trimmed (right).

For the untrimmed read histogram (left) there is an expected coverage of around 13 with a
coverage cut-off of around 7. For the trimmed read histogram (right) there is an expected
coverage of around 9 with a coverage cut-off of around 5.
If you disagree, feel free to try different settings, but first quit R before running velvetg:
q()

time velvetg run_21 -cov_cutoff 7 -exp_cov 13 -ins_length 92

time velvetg run_21trim -cov_cutoff 5 -exp_cov 9 -ins_length 92

90 TRAINER’S MANUAL
Assembling Paired-end Reads de novo Genome Assembly

How good does it look now?

Still not great Comment on:
Runtime Reduced runtime
Memory Lower memory usage
k-mer choice (Can you use k-mer 31 for a read of length 30 bp?) K-mer has to be
lower than the read length and the K-mer coverage should be sufficient to produce
results.
Does less data mean “worse” results? Not necessarily. If you have lots of data you
can safely remove poor data without too much impact on overall coverage.
How would a smaller/larger k-mer size behave?

Compare the results, produced during the last exercises, with each other:

Metric SRR022852 SRR023408 SRR023408.trimmed

Overall Quality (1-5)

bp Coverage

k-mer Coverage

N50 (k-mer used)

Table 8:

TRAINER’S MANUAL 91
de novo Genome Assembly Assembling Paired-end Reads

Metric SRR022852 SRR023408 SRR023408.trimmed

Overall Quality (1-5) 2 5 4

bp Coverage 136 x (36 bp;11,374,488) 95x (37bp; 7761796) 82x (32bp; 7761796)

k-mer Coverage 45x 43x (21); 33x (25) 30x (21); 20.5x (25)

N50 (k-mer used) 68,843 (25) 2,803 (21) 2,914 (21)

Table 9:

What would you consider as the “best” assembly? SRR022852

If you found a candidate, why do you consider it as “best” assembly? Overall data
quality and coverage
How else might you assess the the quality of an assembly? Hint: Hawkeye. By trying
to identify paired-end constraint violations using AMOS Hawkeye.

Hybrid Assembly
Like the previous examples, the data you will examine in this exercise is again from
Staphylococcus aureus which has a genome of around 3MB. The reads are 454 single
end and Illumina paired end with an insert size of 170 bp. You already downloaded
the required reads from the SRA in previous exercises. Specifically, the run data
(SRR022863, SRR000892, SRR000893) from the SRA experiments SRX007709 and
SRX000181.

The following exercise focuses on handing 454 long reads and paired-end reads with
velvet and the differences in setting parameters.

92 TRAINER’S MANUAL
Assembling Paired-end Reads de novo Genome Assembly

First move to the directory you made for this exercise, make a suitable named directory
for the exercise and check if all the three files are in place:
cd ~/NGS/velvet/part3
mkdir SRR000892-SRR022863
cd SRR000892-SRR022863
# 454 single end data
ln -s ~/NGS/Data/SRR00089[2-3].fastq.gz ./
# illumina paired end data
ln -s ~/NGS/Data/SRR022863_?.fastq.gz ./

The following command will run for a LONG time. This indicated the amount of
calculations being preformed by Velvet to reach a conclusion. To wait for velvet
to finish would exceed the time available in this workshop, but it is up to you
to either let it run over night or kill the process by using the key combination
CTRL+c.
velveth run_25 25 -fmtAuto -create_binary -long \
SRR00089?.fastq.gz -shortPaired -separate \
SRR022863_1.fastq.gz SRR022863_2.fastq.gz
time velvetg run_25

If you have decided to continue, we already inspected the weighted histograms

for the short and long read library separately, you can reuse this for the cut-off
values:
time velvetg run_25 -cov_cutoff 7 -long_cov_cutoff 9

What are your conclusions using Velvet in an hybrid assembly? 17 min: time
velvetg run 25

TRAINER’S MANUAL 93
Post-Workshop Information
Post-Workshop Information Access to Computational Resources

Access to Computational Resources

By the end of the workshop we hope you’re thinking one or more of the following:

• I’m interested in dabbling some more during my day-job!

• How do I access a Linux box like the one I’ve been using in the workshop - I really
don’t want the hassle of setting this all up myself!
• I’m hooked! I really want to get down and dirty with NGS data! What computational
resources do I need, what do I have access to and how do I access them?

We’re ecstatic you’re thinking this way and want to help guide you! However, lets take
this one step at a time.
The quickest way to dabble is to use a clone of the operating system (OS) you’ve been
using during this workshop. That means you’ll have hassle-free access to a plethora of
pre-installed, pre-configured bioinformatics tools. You could even set it up to contain a
copy of all the workshop data and handouts etc to go through the hands-on practicals in
your own time!
We have created an image file (approx. 10 GBytes in size) of the NGS Training OS for
you to use as you wish:

https://swift.rc.nectar.org.au:8888/v1/AUTH_33065ff5c34a4652aa2fefb292b3195a/
VMs/NGSTrainingV1.2.1.vdi

We would advise one of the following two approaches for making use of it:

• Import it into VirtualBox to setup a virtual machine (VM) on your own computer.
• Instantiate a VM on the NeCTAR Research Cloud.

Setting up a VM using VirtualBox

This approach requires the least amount of mind-bending to get up and running. However,
you will need to install some software. If you do not have administrator access or your
system administrator is slow or unwilling to install the software, you may find using the
NeCTAR Research Cloud to be viable alternative.
This approach will use, at most, the computational resources available on your own
computer. If you are analysing non-microbial organisms or performing de novo assemblies,
you may find these resources are insufficient. If this is the case, you really should speak
to someone from IT support at your institution or get in touch with a bioinformatician
for advise.
The software you need is VirtualBox, a freely available, Open Source virtualisation product
from Oracle (https://www.virtualbox.org/). This software essentially allows you to

96 TRAINER’S MANUAL
Access to Computational Resources Post-Workshop Information

run an operating system (the guest OS) within another (the host OS). VirtualBox is
available for several different host OSes including MS Windows, OS X, Linux and Solaris
(https://www.virtualbox.org/wiki/Downloads). Once VirtualBox is installed on your
host OS, you can then install a guest OS inside VirtualBox. VirtualBox supports a lot of
different OSes (https://www.virtualbox.org/wiki/Guest_OSes).
Here are the steps to setting up a VM in VirtualBox with our image file:

1. Download and install VirtualBox for your OS: https://www.virtualbox.org/

wiki/Downloads

2. Start VirtualBox and click New to start the Create New Virtual Machine wizard

3. Give the VM a useful name like “NGS Training” and choose Linux and either
Ubuntu or Ubuntu (64-bit) as the OS Type

4. Give the VM access to a reasonable amount of the host Oses memory. i.e. somewhere
near the top of the green. If this value is < 2000 MB, you are likely to have insufficient
memory for your NGS data analysis needs.

5. For the virtual hard disk, select “Use existing hard disk” and browse to and select
the NGSTrainingV1.2.1.vdi file you downloaded.

6. Confirm remaining settings

7. Select the “NGS Training” VM and click Start to boot he machine.

8. Once booted, log into the VM as either ubuntu (a sudoer user; i.e. has admin rights)
or as ngstrainee (a regular unprivileged user). See table below for passwords.

Setting up a VM using the NeCTAR Research Cloud

All Australian researchers, who are members of an institution which subscribes to the
Australian Access Federation (AAF; http://www.aaf.edu.au/), have access to a small
amount of computing resources (2 CPU’s and 8 GBytes RAM) on the NeCTAR Research
Cloud (http://nectar.org.au/research-cloud).

TRAINER’S MANUAL 97
Post-Workshop Information Access to Computational Resources

Login to the NeCTAR Research Cloud Dashboard

The online dashboard is a graphical interface for administering (creating, deleting, reboot-
ing etc) your virtual machines (VMs) on the NeCTAR research cloud.

1. Go to the dashboard: http://dashboard.rc.nectar.org.au

2. When you see the following page, click the “Log In” button:

Figure 11:

3. At the following screen, simply choose your institution from the dropdown box and
click “Select”. Now follow the on screen prompts and enter your regular institutional
login details.

Figure 12:

4. If you see the following screen, congratulations, you have successfully logged into
the NeCTAR Research Cloud dashboard!

98 TRAINER’S MANUAL
Access to Computational Resources Post-Workshop Information

Figure 13:

Instantiating Your Own VM

We will now show you how to instantiate the “NGS Training” image using your own
personal cloud allocation.

1. In the NeCTAR Research Cloud dashboard, click “Images & Snapshots” to list all the
publicly available images from which you can instantiate a VM. Under “Snapshots”
Click the “Launch” button for the latest version of the “NGSTraining” snapshot:

TRAINER’S MANUAL 99
Post-Workshop Information Access to Computational Resources

Figure 14:

2. You will now see a “Launch Instances” window where you are required to enter some
details about how you want the VM to be setup before clicking “Launch Instance”.
In the “Launch Instances” pop-up frame choose the following settings:

Server Name A human readable name for your convenience. e.g. “My NGS VM”
Flavor The resources you want to allocate to this VM. I suggest a Medium sized VM
(2 CPUs and 8 GBytes RAM). This will use all your personal allocation, but
anything less will probably be insufficient. You could request a new allocation
of resources if you want to instantiate a larger VM with more memory.
Security Groups Select SSH.

3. Click the “Launch Instance” button

100 TRAINER’S MANUAL

Access to Computational Resources Post-Workshop Information

Figure 15:

4. You will be taken to the “Instances” page and you will see the “Status” and “Task”
column for your new VM is “Building” and “Spawning”. Once the “IP Address” cell
is populated, take a note of it as you will need it for configuring the NX Client later
on.

TRAINER’S MANUAL 101

Post-Workshop Information Access to Computational Resources

Figure 16:

5. Once the Status and Task for the VM change to “Active and “None” respectively,
your VM is powered up and is configuring itself. Congratulations, you have now
instantiated a Virtual Machine! If you try to connect to the VM too quickly, you
might not be successful. The OS may still be configuring itself, so give it a few
minutes to finish before continuing.

Figure 17:

102 TRAINER’S MANUAL

Access to Computational Resources Post-Workshop Information

VM Stuck Building and Spawning

Sometimes, the cloud experiences a “hiccup” and a newly instantiated VM will get stuck
in the “Build” and “Spawning” state (step 3) for more than a few minutes. This can be
rectified by terminating the instance and creating a new VM from scratch:

1. Selecting “Terminate Instance” under the “Edit Instance” dropdown box:

Figure 18:

2. Go back to step 1 of “Instantiating Your Own VM” and create the VM from scratch:

Remote Desktop with the NoMachine NX Client

During the workshop you were using the free NX client from NoMachine (http://www.
nomachine.com/) to provide a remote desktop-like connection to VMs running on the
NeCTAR Research Cloud. Therefore, we provide information on how to setup your local
computer to connect to the VM you just instantiated in the steps above.
We assume that:

• You have administrator rights on your local computer for installing software.

NoMachine NX Client Installing

We show you instructions below for the MS Windows version of the NX Client, but
procedures for other supported OSes (Linux, Mac OSX and Solaris) should be very
similar.

1. Go to the NoMachine download page: http://www.nomachine.com/download.php

2. Click the download icon next to the NX Client for Windows:

TRAINER’S MANUAL 103

Post-Workshop Information Access to Computational Resources

Figure 19:

3. On the ”NX Client for Windows” page, click the ”Download package” button:

Figure 20:

4. Run the file you just downloaded (accepting defaults is fine)

5. Congratulations, you just installed the NoMachine NX Client!

NoMachine NX Client Configuration

Now we have the NoMachine NX Client installed, we need to configure a new NX ”session”
which will point to the VM we instantiated in the NeCTAR Research Cloud.
We assume that:

• You know the IP address of the VM you want to remote desktop into.

1. Start the NX Connection Wizard and click ”Next” to advance to the ”Session”
settings page.

104 TRAINER’S MANUAL

Access to Computational Resources Post-Workshop Information

Figure 21:

2. On the ”Sessions” settings page enter the following details:

Session A memorable name so you know which VM this session is pointing at. You
could use the same name you chose for the VM you instantiated earlier e.g.
”NGS Training”.
Host Enter the IP address of the VM you instantiated on the NeCTAR Research
Cloud.

Figure 22:

TRAINER’S MANUAL 105

Post-Workshop Information Access to Computational Resources

3. Click ”Next” to advance to the ”Desktop” settings page. You should use the ”Unix
GNOME” setting.

Figure 23:

4. Click ”Next” and ”Finish” to complete the wizard.

Connecting to a VM
If you just completed the NX Connection Wizard described above, the wizard should have
opened the NX Client window. If not, run the ”NX Client”. You will be presented with a
window like this:

Figure 24:

106 TRAINER’S MANUAL

Access to Computational Resources Post-Workshop Information

The ”Login” and ”Password” boxes in the NX Client are for user accounts setup on the
VM. By default our image, from which you instantiated your VM, has two preconfigured
users:

Figure 25:

Unless you know what you are doing, we suggest you use the ngstrainee user account
details to initiate an NX connection to your VM. In less than a minute, you should see an
NX Window showing the desktop of your VM:

Figure 26:

TRAINER’S MANUAL 107

Post-Workshop Information Access to Computational Resources

NX Connection Failure
In the event that you don’t get the NX Window with your VM’s desktop displaying inside
it. The most common errors are:

• You failed to select the ”ssh” security group when instantiating the VM. You’ll need
to terminate the instance and create a new VM from scratch

• You failed to select ”Unix GNOME” when you configured the NX Client session.
You’ll need to reconfigure the session using the NX Client

• Your institutions firewall blocks TCP port 22. You may need to request this port to
be opened by your local network team or configure the NX client to use a proxy
server.

Advanced Configuration
In the session configuration, you can configure the size of the NX Window in which the
desktop of the VM is drawn:

Figure 27:

This can be useful if you want to:

108 TRAINER’S MANUAL

Access to Computational Resources Post-Workshop Information

• Have the NX Window occupy the entire screen, without window decorations. This
is often desirable if you wish to ”hide” the host OS from the person sitting at the
computer running the NX Client.

• Have the NX Window spread over multiple monitors.

TRAINER’S MANUAL 109

Post-Workshop Information Access to Workshop Documents

Access to Workshop Documents

This document has been written in LATEX and deposited in a public github repository
(https://github.com/nathanhaigh/ngs_workshop). The documentation has been re-
leased under a Creative Commons Attribution 3.0 Unported License (see the Licence page
at the beginning of this handout).
For convienience, you can access up-to-date PDF versions of the LATEX documents at:

Trainee Handout
https://github.com/nathanhaigh/ngs_workshop/raw/master/trainee_handout.pdf
Trainer Handout
https://github.com/nathanhaigh/ngs_workshop/raw/master/trainer_handout.pdf

Access to Workshop Data

Once you have created a VM from our image file, either locally using VirtualBox or on the
NeCTAR Research Cloud, you can configure the system with the workshop documents
and data. This way you can revisit and work through this workshop in your own time.
In order to do this, we have provided you with access to a shell script which should be
executed on your NGS Training VM by the ubuntu user. This pulls approx. 3.3 GBytes
of data from the NeCTAR Cloud storage and configures the system for running this
workshop:
# As the ubuntu user run the following commands:
cd /tmp
wget https://github.com/nathanhaigh/ngs_workshop/raw/master/\
workshop_deployment/NGS_workshop_deployment.sh
bash NGS_workshop_deployment.sh

While you’re at it, you may also like to change the timezone of your VM to match that of
your own. To do this simply run the following commands as the ubuntu user:
TZ="Australia/Adelaide"
echo "$TZ" | sudo tee /etc/timezone
sudo dpkg-reconfigure --frontend noninteractive tzdata

For further information about what this script does and possible command line arguments,
see the script’s help:
bash NGS_workshop_deployment.sh -h

For further information about setting up the VM for the workshop, please see:

https://github.com/nathanhaigh/ngs_workshop/blob/master/workshop_deployment/
README.md

110 TRAINER’S MANUAL

Space for Personal Notes or Feedback
Space for Personal Notes or Feedback

112 TRAINER’S MANUAL

 Space for Personal Notes or Feedback

TRAINER’S MANUAL 113

Space for Personal Notes or Feedback

114 TRAINER’S MANUAL

 Space for Personal Notes or Feedback

TRAINER’S MANUAL 115