ASSIGNMENT 2

BIOL-1000-D01 – Biology: Foundations of Life (chapters 8 – 10 and 12)

1. What is the difference between asexual and sexual reproduction? What is the
difference only in terms of how genetic material is passed to offspring from parents?

Sexual reproduction requires the fusion of gametes, meaning that sexually reproducing
requires more than one organism and reproductive systems as well which is where the
reproduction process happens. Sexual reproduction is done through the process of
meiosis. As the cell reproduces, the DNA gets split evenly from both parents and get put
into the DNA of the offspring.

Asexual reproduction on the other hand, gives rise to a clone offspring that is identical to
the original. Asexual reproduction functions without needing a second parent to
reproduce like sexual reproduction. Instead, asexual reproduction is done through the
process of mitosis meaning it divides itself and transfers the exact same DNA into each
of the offspring.

The difference that they both have when genetic material is passed to offspring to
parents is the fact that in sexual reproduction, crossing-over occurs with the DNA and it
gives the offspring a unique combination of genes, making the variability of genes
widespread among organisms that utilizes sexual reproduction (except if there were
identical twins then they would have the same combination of genes. In asexual
reproduction, the offspring gets the exact same DNA makeup as the parent, like a clone
which gives them less unique combinations for their genes as they are all exactly the
same to one another.

2. Define in your words the terms chromosome, chromatin and chromatid. How are they
similar and how are they different?

Chromosome is a structure that is made up of DNA that is found in the nucleus of our
cells. It contains proteins and we have 23 pairs of chromosomes that we get from both
of our parents to create our genetic makeup. Chromosomes are made up of 2 sister
chromatids that are held by a centromere.
Chromatin is the complex DNA complex that chromosomes are made up of
Chromatid is the other identical half of a chromosome; 2 sister chromatids held together
by the centromere.

3. In order to understand the process of cell division better let’s consider the
consequences of skipping certain phases in the cycles involved. What would result
 from skipping the S phase of Interphase? Anaphase of Mitosis? Cytokinesis? Anaphase
I of Meiosis?

If you were to skip the S phase of interphase, then the cell wouldn’t be able to duplicate
its chromosomes and if the cell’s DNA isn’t duplicated then it cannot transfer the same
exact number of chromosomes into the other cell when it goes through the mitotic
phase (M phase).

If you were to skip Anaphase of Mitosis, each of the sister chromatids will not be able to
get separated and pulled apart towards opposite ends of the cell by the spindle fibers
and microtubules. If this doesn’t happen the cell won’t be able to prepare itself for
telophase. Though, before telophase, in anaphase if this step is missed, the DNA
(chromatids) will not be able to reach the desired spot for telophase to happen and for
the DNA to be ready.

If you were to skip Cytokinesis, we probably won’t be able to have two physical cells
when the replication of the DNA does happen. We’d just have one cell body and the
replicated DNA inside, not separated into a second cell, which makes it all very messy
and pretty much pointless considering the cell must divide physically.

If you were to skip Anaphase I of Meiosis (similarly with anaphase of mitosis) the
homologue chromosomes after crossing-over with each other, they get pulled apart, but
their chromatids still stay intact. The homologue chromosomes are pulled apart towards
opposite ends of the cell. If we skip this part, we wouldn’t have the variation of genes in
each cell when it separates and prepares for the second phase of meiosis.

4. In your own words explain Mendel’s Law of Independent Assortment and his Law of
Segregation. Considering his discoveries took place before the discovery of DNA, what
concepts of modern genetics was he basically describing without knowing it? If the
seven characters of pea plants that he used in his studies had involved linked genes,
how could that have ruined his conclusions?

Mendel’s Law of Independent Assortment explains how genes for one trait are not
inherited together with another trait, but independently are inherited His Law of
Segregation explains that only one of the two gene copies that an organism has is
distributed to each gamete which makes the allocation of these gene copies to be
completely random, getting one allele from each parent. Without knowing, Mendel was
describing the concept of inheritance. If the pea plants he used in his studies had
involved linked genes it could of ruined his conclusion on his experiment because if it
had linked genes then he wouldn’t be able to distinguish which alleles were passed on
from which plant and how he ended up with the different off springs of several
generations.
5. From Fig. 9.2D in your e-text, let’s use the letter A the denote the alleles for seed
colour and the letter B to denote the alleles for seed shape (Uppercase = dominant;
lowercase = recessive). You have some round yellow seeds of unknown genotype. By
doing a test dihybrid cross using wrinkled green seeds you get a phenotypic ratio of
50% round yellow and 50% wrinkled yellow seeds in the next generation of offspring
resultant from the cross. What is the unknown parental genotype? (You must include
the dihybrid cross that confirms your conclusion for full marks)

The unknown parental genotype of this cross when we test dihybrid cross using wrinkled
green seeds is the genotype AABb (wrinkled yellow seeds). When we get make a
dihybrid cross between the wrinkled green seeds and the wrinkled yellow seeds (AABb),
you’d get a phenotypic ratio of 50% round yellows seeds and 50% wrinkled yellow seeds
in the next generation of offspring. Therefore, the unknown parental genotype is AABb
(wrinkled yellow seeds; below is the dihybrid cross.).

AABb x aabb:
ab
AB AaBb
Ab Aabb

6. Translate the following open reading frame of a DNA molecule into its eventual amino
acid sequence (include the transcription of the RNA molecule that would be
constructed first for full marks)

TACAAGAACTTATCGACCTATACGATT
AUGUUCUUGAAUAGCUGGAUAUGCUAA

Met – Phe – Leu – Asn – Ser – Trp – Ile - Cys

(Note: Use Fig. 10.8A from your e-text to decipher the amino acid sequence.
Memorization of the information in this figure is NOT a requirement for this course
and this question is only meant to evaluate if your understanding is strong enough to
figure out how to use this chart)

7. From the previous question, let’s say the nucleotide sequence of this gene has
mutated to:

TACAAAAACTCATCGACCCATAACTATT
 Identify each of the mutations in the new sequence and for each give the appropriate
term to describe what type of mutation it is.

The mutations are bolded in green above.

There are 5 mutations done in total: 4 substitutions and 1 duplication. The first mutation
starting from the left is a substitution since the original nucleotide sequence previously
had a guanine and it was replaced by adenine in the mutated sequence. The second
mutation is also a substitution. The non-mutated sequence had a thymine and was
substituted by a cytosine. The third mutation is another substitution. The non-mutated
sequence had a thymine as well and was substituted by a cytosine like the second
mutation. The fourth mutation is a duplication, there is an extra adenine base added to
the mutated sequence. Lastly, the fifth duplication is another substitution. Th guanine
was substituted by a thymine at the end.

8. What are the 3 types of RNA described in your e-text? Give a brief explanation of the
role of each type.

mRNA: messenger RNA creates a mold or template for the protein synthesis during the
process of translation in the cell.
tRNA: transfer RNA gathers the amino acids together and interprets the genetic code
during the process of translation.
rRNA: ribosomal RNA are molecules that form the middle part of ribosomes in a cell
which is where the protein synthesis occurs in.

9. What is a plasmid? Describe one way in which it can be useful to the science of genetic
engineering.

Plasmid is a small structure of bacterial DNA that resides in the cell as separate units.
Plasmids are used in replicating short segments of DNA independently from the
chromosomes. Plasmids can be useful to the science of genetic engineering when
manipulating with genes in labs, when replicating.