Answer Solution NEET-2023 (Code-H5) Final
Answer Solution NEET-2023 (Code-H5) Final
H5
Corporate Office : Aakash Tower, 8, Pusa Road, New Delhi-110005 | Ph.: 011-47623456
NEET (UG)-2023
Important Instructions :
1. The test is of 3 hours 20 minutes duration and the Test Booklet contains 200 multiple choice questions (four
options with a single correct answer) from Physics, Chemistry and Biology (Botany and Zoology).
50 questions in each subject are divided into two sections (A and B) as per details given below:
(a) Section A shall consist of 35 (Thirty-five) Questions in each subject (Question Nos. – 1 to 35, 51 to 85,
101 to 135 and 151 to 185). All Questions are compulsory.
(b) Section B shall consist of 15 (Fifteen) questions in each subject (Question Nos. – 36 to 50, 86 to 100,
136 to 150 and 186 to 200). In section B, a candidate needs to attempt any 10 (Ten) questions out of
15 (Fifteen) in each subject.
Candidates are advised to read all 15 questions in each subject of Section-B before they start attempting
the question paper. In the event of a candidate attempting more than ten questions, the first ten questions
answered by the candidate shall be evaluated.
2. Each question carries 4 marks. For each correct response, the candidate will get 4 marks. For each incorrect
response, 1 mark will be deducted from the total scores. The maximum marks are 720.
3. Use Blue / Black Ball point Pen only for writing particulars on this page / marking responses on Answer
Sheet.
4. Rough work is to be done in the space provided for this purpose in the Test Booklet only.
5. On completion of the test, the candidate must handover the Answer Sheet (ORIGINAL and OFFICE Copy)
to the Invigilator before leaving the Room/Hall. The candidates are allowed to take away this Test Booklet
with them.
6. The CODE for this Booklet is H5.
7. The candidates should ensure that the Answer Sheet is not folded. Do not make any stray marks on the
Answer Sheet. Do not write your Roll No. anywhere else except in the specified space in the Test
Booklet/Answer Sheet. Use of white fluid for correction is NOT permissible on the Answer Sheet.
8. Each candidate must show on-demand his/her Admit Card to the Invigilator.
9. No candidate, without special permission of the Centre Superintendent or Invigilator, would leave his/her seat.
10. Use of Electronic/Manual Calculator is prohibited.
11. The candidates are governed by all Rules and Regulations of the examination with regard to their conduct in
the Examination Room/Hall. All cases of unfair means will be dealt with as per Rules and Regulations of this
examination.
12. No part of the Test Booklet and Answer Sheet shall be detached under any circumstances.
13. The candidates will write the Correct Test Booklet Code as given in the Test Booklet / Answer Sheet in the
Attendance Sheet.
-1-
NEET (UG)-2023 (Code-H5)
PHYSICS
SECTION-A
1. A bullet is fired from a gun at the speed of 280 m s –1 in the direction 30° above the horizontal. The maximum
height attained by the bullet is (g = 9.8 m s–2, sin30° = 0.5)
(1) 1000 m (2) 3000 m
(3) 2800 m (4) 2000 m
Answer (1)
u 2 sin2
Sol. H =
2g
2 v 2v
=
v + 2v
4v
=
3
3. The venturi-meter works on
(1) The principle of parallel axes
(2) The principle of perpendicular axes
(3) Huygen’s principle
(4) Bernoulli’s principle
Answer (4)
Sol. Venturi-meter works on the Bernoulli’s principle.
-2-
NEET (UG)-2023 (Code-H5)
4. If the galvanometer G does not show any deflection in the circuit shown, the value of R is given by
Answer (1)
ig = 0
10 − 2 2 2 400
= R= = 100
400 R 8
5. For Young’s double slit experiment, two statements are given below:
Statement I : If screen is moved away from the plane of slits, angular separation of the fringes remains
constant.
Statement II : If the monochromatic source is replaced by another monochromatic source of larger
wavelength, the angular separation of fringes decreases.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false. (2) Statement I is false but Statement II is true.
(3) Both Statement I and Statement II are true. (4) Both Statement I and Statement II are false.
Answer (1)
Sol. For YDSE, angular fringe width is given by =
d
It does not depend on the distance of screen from the slit, so statement I is correct.
Angular fringe width
If → angular separation of fringes increases
So, statement I is true and statement II is false.
-3-
NEET (UG)-2023 (Code-H5)
6. In hydrogen spectrum, the shortest wavelength in the Balmer series is . The shortest wavelength in the
Bracket series is
(1) 9 (2) 16
(3) 2 (4) 4
Answer (4)
1 1 1
Sol. = R 2 – 2
n2 n1
For Balmer [n2 = 2, n1 = ]
1 1 1
= R –
4
4
= …(1)
R
For Bracket, (n2 = 4, n1 = )
1 1 1
= R –
16
16
= …(2)
R
Eqn (1)
Eqn (2)
= 4
7. A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a
load resistance. Which of these components remove the ac ripple from the rectified output?
(1) Capacitor (2) Load resistance
(3) A centre-tapped transformer (4) p-n junction diodes
Answer (1)
Sol. Capacitor removes the ac ripple from rectified output.
8. The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly (surface
tension of soap solution = 0.03 N m–1)
(1) 3.01 × 10–4 J (2) 50.1 × 10–4 J
(3) 30.16 × 10–4 J (4) 5.06 × 10–4 J
Answer (1)
Sol. Amount of energy required = [S × A] × 2
Energy required = [0.03 × 4 × × 4 × 10–4] × 2
= 3.015 × 10–4 J
9. The ratio of radius of gyration of a solid sphere of mass M and radius R about its own axis to the radius of
gyration of the thin hollow sphere of same mass and radius about its axis is
(1) 2:5 (2) 5:2
(3) 3:5 (4) 5:3
Answer (3*)
-4-
NEET (UG)-2023 (Code-H5)
2
Sol. Radius of gyration of solid sphere about its own axis = R
5
2
Radius of gyration of hollow sphere about its own axis = R
3
2 3 3
Required ratio = =
5 2 5
3
* None of the option is correct (correct answer is )
5
10. A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent.
The force that acts on the player while turning is
(1) Along north-east (2) Along south-west
(3) Along eastward (4) Along northward
Answer (1)
Sol.
P = Pf – Pi
Pf = muiˆ
Pi = mu(– jˆ)
P = mu(iˆ + jˆ)
P
F=
t
Direction of change of momentum and direction of force acting on the player will be same, so correct
answer is North east direction
11. The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to
th
1
of its initial value?
16
(1) 60 minutes (2) 80 minutes
(3) 20 minutes (4) 40 minutes
Answer (2)
A0
Sol. A =
2n
A 1
= n
A0 2
-5-
NEET (UG)-2023 (Code-H5)
1 1
= n
16 2
1 1
4
= n
2 2
n=4
t
n= , t = 4 T1 = 4 20
T1 2
2
= 80 minutes
12. In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at
a frequency of 2.0 × 1010 Hz and amplitude 48 V m–1. Then the amplitude of oscillating magnetic field is
(Speed of light in free space = 3 × 108 m s–1)
(1) 1.6 × 10–7 T (2) 1.6 × 10–6 T
(3) 1.6 × 10–9 T (4) 1.6 × 10–8 T
Answer (1)
Sol. From the properties of electromagnetic wave
E0
we know that, C =
B0
E0 Amplitude of oscillating electric field
B0 Amplitude of oscillating magnetic field
48
B0 = = 1.6 10−7 T
3 108
13. The magnetic energy stored in an inductor of inductance 4 H carrying a current of 2 A is
(1) 8 mJ (2) 8 J
(3) 4 J (4) 4 mJ
Answer (2)
Sol. Magnetic energy stored in an inductor
1
U = Li 2
2
1
4 10−6 ( 2)
2
=
2
= 8 × 10–6 J
U = 8 J
14. In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1 F and resistance R is 100 . The
frequency at which resonance occurs is
(1) 1.59 rad/s (2) 1.59 kHz
(3) 15.9 rad/s (4) 15.9 kHz
Answer (2)
1
Sol. For resonance frequency =
2 LC
-6-
NEET (UG)-2023 (Code-H5)
1 104
f = =
2 10 10−3 1 10−6 2
= 1.591 × 103
= 1.591 kHz
15. Light travels a distance x in time t1 in air and 10x in time t2 in another denser medium. What is the critical angle
for this medium?
t 10 t1
(1) sin−1 1 (2) sin−1
10 t 2 t2
t 10t2
(3) sin−1 2 (4) sin−1
t1 t1
Answer (2)
Sol.
2 sinic = 1
1
sinic =
2
c
=
V
1 V2
So sin ic = =
2 V1
10 xt1
sin ic =
t2 x
10t
ic = sin−1 1
t2
Answer (1)
1
Sol. XC =
C
-7-
NEET (UG)-2023 (Code-H5)
Sol. net = E dS = 0
s
18. The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm, potential
energy stored in it will be
(1) 8U (2) 16 U
(3) 2U (4) 4U
Answer (2)
1 2
Sol. Potential energy stored in spring U = Kx
2
1
U= K (2)2 where x = 2 cm
2
1
U= (K ) ·(4)
2
U=2K ….(i)
1
U = K (8)2
2
1
U = K 64 = 32K ….(ii)
2
On dividing (i) by (ii)
U 2K 1
= =
U 32K 16
U = 16 U
19. The equivalent capacitance of the system shown in the following circuit is
(1) 6 F (2) 9 F
(3) 2 F (4) 3 F
Answer (3)
-8-
NEET (UG)-2023 (Code-H5)
Sol. For parallel grouping
C1 = 3 + 3 = 6 F
For series grouping
C1C2 3 6 18
Ceq = = =
C1 + C2 3 + 6 9
Ceq = 2 F
20. The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage
supply are
(1) Least count errors (2) Random errors
(3) Instrumental errors (4) Personal errors
Answer (2)
Sol. The errors which cannot be associated with any systematic or constant cause are called random errors.
These errors can arise due to unpredictable fluctuations in experimental conditions. e.g., random change
in pressure, temperature, voltage supply etc.
22. The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the
same length is
(1) 1:3 (2) 3:1
(3) 1:2 (4) 2:1
Answer (4)
v
Sol. f0 = fopen pipe =
2l
v
fc = fclosed pipe =
4l
f0 v 4l
=
fc 2l v
f0 : fc = 2 : 1
-9-
NEET (UG)-2023 (Code-H5)
23. The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of
V volts is proportional to
1
(1) (2) V2
V
1
(3) V (4)
V
Answer (4)
hc
Sol. eV =
min
hc
min =
eV
1
min
V
24. The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are 2.14 eV, 2.30 eV and 2.75 eV
respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these
photosensitive surfaces may emit photoelectrons?
(1) K only (2) Na only
(3) Cs only (4) Both Na and K
Answer (3)
Sol. Energy of incident radiation = 2.80 eV
Work function of Cs → 2.14 eV
Work function of K → 2.30 eV
Work function of Na → 2.75 eV
Since the work function of potassium and sodium are more than energy of incident radiation hence
photons may be emitted from caesium.
25. A Carnot engine has an efficiency of 50% when its source is at a temperature 327°C. The temperature of the
sink is
(1) 100°C (2) 200°C
(3) 27°C (4) 15°C
Answer (3)
50 1
Sol. Efficiency = =
100 2
Efficiency of Carnot engine
T2
= 1−
T1
T2
= 1−
600
1 T
= 1− 2
2 600
T2 1
= T2 = 300 K
600 2
T2 = 300 – 273 = 27°C
- 10 -
NEET (UG)-2023 (Code-H5)
26. The net magnetic flux through any closed surface is
(1) Infinity (2) Negative
(3) Zero (4) Positive
Answer (3)
Sol. B ds = zero
Magnetic monopole doesn't exist.
Hence net magnetic flux through any closed surface is zero.
27. An electric dipole is placed at an angle of 30° with an electric field of intensity 2 × 10 5 N C–1. It experiences a
torque equal to 4 N m. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm.
(1) 4 mC (2) 2 mC
(3) 8 mC (4) 6 mC
Answer (2)
Sol. E = 2 × 105 N/C
l = 2 cm
= 4 Nm
= pE
4 = pEsin
4 = p × 2 × 105 × sin30°
p = 4 × 10–5 cm
p 4 10−5
q= = = 2 mC
l 0.02
28. Resistance of a carbon resistor determined from colour codes is (22000 ± 5%) . The colour of third band
must be
(1) Orange (2) Yellow
(3) Red (4) Green
Answer (1)
Sol. Resistance = (22 × 103) ± 5%
Third band corresponds to decimal multiplier.
Decimal multiplier = 103
Colour → Orange
29. A metal wire has mass (0.4 ± 0.002) g, radius (0.3 ± 0.001) mm and length (5 ± 0.02) cm. The maximum
possible percentage error in the measurement of density will nearly be
(1) 1.6% (2) 1.4%
(3) 1.2% (4) 1.3%
Answer (1)
Mass M
Sol. We know, = = 2
Volume r
Using the concept of errors we know,
M 2r
= + +
M r
- 11 -
NEET (UG)-2023 (Code-H5)
0.002 2 0.001 0.02
= + +
0.4 0.3 5
= 0.0156
% = 1.56% 1.6%
30. The magnitude and direction of the current in the following circuit is
5
(1) A from A to B through E (2) 1.5 A from B to A through E
9
(3) 0.2 A from B to A through E (4) 0.5 A from A to B through E
Answer (4)
Sol. Using Kirchhoff's law
10 − 5 5
i= =
10 10
i = 0.5 A
In clock-wise direction (from A to B)
31. The temperature of a gas is –50°C. To what temperature the gas should be heated so that the rms speed is
increased by 3 times?
(1) 3097 K (2) 223 K
(3) 669°C (4) 3295°C
Answer (4)
3RT
Sol. v rms = T1 = 273 − 50
m
vrms T = 223 K
vrms is increased by 3 times T2 = ?
So, final rms speed = v + 3v = 4v
v1 T
= 1
v2 T2
v 223 1 223
= =
4v T2 16 T2
T2 = 3568 K
T2 = 3568 – 273 = 3295°C
32. A 12 V, 60 W lamp is connected to the secondary of a step-down transformer, whose primary is connected to
ac mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding?
(1) 3.7 A (2) 0.37 A
(3) 0.27 A (4) 2.7 A
Answer (3)
- 12 -
NEET (UG)-2023 (Code-H5)
Sol.
Sol.
(R − x )2
=9
x2
R
x=
4
−Gm G(9m)
VP = −
x R−x
−Gm G(9m)
VP = −
R 3R
4 4
−4 Gm 12Gm
= −
R R
−16 Gm
=
R
34. Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end.
The longitudinal stress at any point of cross-sectional area A of the wire is
(1) W/2A (2) Zero
(3) 2W/A (4) W/A
Answer (4)
- 13 -
NEET (UG)-2023 (Code-H5)
Sol.
SECTION-B
36. For the following logic circuit, the truth table is
A B Y A B Y
0 0 1 0 0 0
(1) 0 1 0 (2) 0 1 0
1 0 1 1 0 0
1 1 0 1 1 1
A B Y A B Y
0 0 1 0 0 0
(3) 0 1 1 (4) 0 1 1
1 0 1 1 0 1
1 1 0 1 1 1
Answer (4)
Sol.
- 14 -
NEET (UG)-2023 (Code-H5)
Y = A · B = A+B
It is OR gate.
A B Y
0 0 0
0 1 1
1 0 1
1 1 1
37. Two thin lenses are of same focal lengths (f), but one is convex and the other one is concave. When they are
placed in contact with each other, the equivalent focal length of the combination will be
f
(1) (2) Infinite
2
f
(3) Zero (4)
4
Answer (2)
Sol. Convex lens f1 > 0, concave lens f2 < 0
1 1 1 1 1
= + = − =0
feq f1 f2 f f
feq =
1
The electric potential (in 102 V) at point P due to the dipole is (0 = permittivity of free space and =K)
4 0
8
(1) qK
5
8
(2) qK
3
3
(3) qK
8
5
(4) qK
8
Answer (3)
Kq
Sol. Electrostatic potential due to a point charge is given by
r
Kq Kq
Vnet at point P = −
2 10−2 8 10−2
Kq 102 1
= 1 − 4
2
3 3
= Kq 102 V = qK
8 8
- 15 -
NEET (UG)-2023 (Code-H5)
39. The x-t graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the
particle at t = 2 s is
2 2
(1) m s–2 (2) – m s–2
16 16
2 2
(3) m s–2 (4) – m s–2
8 8
Answer (2)
Sol. Position of particle as function of time
x = Asint
From figure,
A = 1
2
=
8
x = sin t
4
dx
v=
dt
v= cos t
4 4
dv
a=
dt
2
a=− sin t
16 4
at t = 2 s
2
a=− m/s2
16
40. 10 resistors, each of resistance R are connected in series to a battery of emf E and negligible internal
resistance. Then those are connected in parallel to the same battery, the current is increased n times. The
value of n is
(1) 1 (2) 1000
(3) 10 (4) 100
Answer (4)
- 16 -
NEET (UG)-2023 (Code-H5)
Sol. In series combination
Req = 10R
E
i=
10R
In parallel combination
R
Req =
10
E 10 E
i' = =
R R
10
i = 10 × 10 i = 100 i
n = 100
41. The resistance of platinum wire at 0°C is 2 and 6.8 at 80°C. The temperature coefficient of resistance of
the wire is
(1) 3 × 10–2 °C–1
(2) 3 × 10–1 °C–1
(3) 3 × 10–4 °C–1
(4) 3 × 10–3 °C–1
Answer (1)
Sol. Using R = R0(1 + T)
where is the thermal coefficient of resistance
6.8 = 2{1 + (80 – 0)}
6.8
− 1 = 80
2
3.4 − 1 2.4
= = = 0.03
80 80
= 3 × 10–2 °C–1
42. The radius of inner most orbit of hydrogen atom is 5.3 × 10 –11 m. What is the radius of third allowed orbit of
hydrogen atom?
(1) 1.59 Å
(2) 4.77 Å
(3) 0.53 Å
(4) 1.06 Å
Answer (2)
n2
Sol. rn =
Z
2
r1 1
=
r2 3
- 17 -
NEET (UG)-2023 (Code-H5)
43. A very long conducting wire is bent in a semi-circular shape from A to B as shown in figure. The magnetic field
at point P for steady current configuration is given by
0 i 2
(1) 1− pointed away from page
4R
0 i 2
(2) 1− pointed into the page
4R
0 i
(3) pointed into the page
4R
0 i
(4) pointed away from the page
4R
Answer (1)
Sol.
0i
BP due to wire 1 =
4R
0i
BP due to wire 3 =
4R
i
BP due to wire 2 = 0
4R
i i i 2 i 2
Bnet = − 0 + 0 = 0 − + 1 = 0 1−
2R 4R 4R 4R
Pointed away from page.
44. A satellite is orbiting just above the surface of the earth with period T. If d is the density of the earth and G is
3
the universal constant of gravitation, the quantity represents
Gd
(1) T3 (2) T
(3) T (4) T2
Answer (4)
Sol. Time period of satellite above earth surface
R3 R3
T = 2 = 2
GM 4
Gd R3
3
3
T = 2
4Gd
3 3
T= T2 =
Gd Gd
- 18 -
NEET (UG)-2023 (Code-H5)
45. A bullet from a gun is fired on a rectangular wooden block with velocity u. When bullet travels 24 cm through
u
the block along its length horizontally, velocity of bullet becomes . Then it further penetrates into the block
3
in the same direction before coming to rest exactly at the other end of the block. The total length of the block
is
(1) 28 cm (2) 30 cm
(3) 27 cm (4) 24 cm
Answer (3)
Sol.
between 1 to 2
2
u
3 = u − 2a 24
2
8u 2
2a ( 24 ) = ... (I)
9
between 2 to 3
2
u
0 = − 2as ... (II)
3
From equation (I) and (II)
2a ( 24 )
2as =
8
s = 3 cm
Length of wooden block is 24 + 3 = 27 cm
46. The net impedance of circuit (as shown in figure) will be
(1) 5 5 (2) 25
(3) 10 2 (4) 15
Answer (1)
50
Sol. L = mH
50
XL = 2 50 10−3 = 5
103
C= 10−6
- 19 -
NEET (UG)-2023 (Code-H5)
1 103
XC = = = 10
2 50 103 10−6 100
Z = ( XC − XL )2 + R 2
(1) 5 lL (2) 3 lL
(3) 3 lL (4) 5 lL
Answer (1)
Sol. Magnetic force acting on a current carrying wire is
F = I B
( )
= ILi 2i + 3 j − 4kˆ = 3ILkˆ + 4IL j
Magnitude of force
F = (3IL)2 + (4IL)2
= 5IL
48. Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains
stationary. The coefficient of static friction between the body and the floor is 0.15 (g = 10 m s–2).
(1) 1.5 m s–2 (2) 50 m s–2
(3) 1.2 m s –2 (4) 150 m s–2
Answer (1)
Sol.
w.r.t. car
ab = 0
mamax = s mg
amax = s g = 0.15 × 10 = 1.5 m/s2
49. In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all
layers are thin)?
- 20 -
NEET (UG)-2023 (Code-H5)
1 1 1 1
= + +
feff f1 f2 f3
1 1 1
Also, = ( − 1) −
f 1
R R2
1 1 1 −0.6
= (1.6 − 1) − = 20
f1 20
1 1 1 0.5
= (1.5 − 1) − = 10
f2 20 −20
1 1 1 −0.6
= (1.6 − 1) − =
f3 −20 20
feff = –100 cm
50. A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically
upwards with a velocity 4 m s–1. The ball strikes the water surface after 4 s. The height of bridge above water
surface is (Take g = 10 m s–2)
(1) 64 m
(2) 68 m
(3) 56 m
(4) 60 m
Answer (1)
Sol.
1
s = ut − gt 2
2
1
= 16 − 10 16
2
= – 64 m
- 21 -
NEET (UG)-2023 (Code-H5)
CHEMISTRY
SECTION-A
2
51. For a certain reaction, the rate = k[A] [B], when the initial concentration of A is tripled keeping concentration
of B constant, the initial rate would
(1) Increase by a factor of nine (2) Increase by a factor of three
(3) Decrease by a factor of nine (4) Increase by a factor of six
Answer (1)
Sol. Rate (r) = k[A]2[B]
When concentration of A is tripled
[A] = [3A]
New rate, r = k[A]2[B] = k[3A]2[B] = 9k[A]2[B]
r = 9r
52. Select the correct statements from the following
A. Atoms of all elements are composed of two fundamental particles.
B. The mass of the electron is 9.10939 × 10–31 kg.
C. All the isotopes of a given element show same chemical properties:
D. Protons and electrons are collectively known as nucleons.
E. Dalton’s atomic theory, regarded the atom as an ultimate particles of matter
Choose the correct answer from the options given below
(1) A and E only (2) B, C and E only
(3) A, B and C only (4) C, D and E only
Answer (2)
Sol. • Atoms consist of three fundamental particles :
Electrons, protons and neutrons
• The mass of the electron is 9.10939 × 10–31 kg
• All the isotopes of a given element show same chemical properties.
• Protons and neutrons present in the nucleus are collectively called as nucleons.
• Dalton’s atomic theory, regarded the atom as the ultimate particle of matter
So, the correct statements are B, C, E only
53. Match List-I with List-II.
List-I List-II
A. Coke I. Carbon atoms are sp3 hybridised
B. Diamond II. Used as a dry lubricant
C. Fullerene III. Used as a reducing agent
D. Graphite IV. Cage like molecules
Choose the correct answer from the options given below :
(1) A-III, B-I, C-IV, D-II (2) A-III, B-IV, C-I, D-II
(3) A-II, B-IV, C-I, D-III (4) A-IV, B-I, C-II, D-III
Answer (1)
- 22 -
NEET (UG)-2023 (Code-H5)
Sol. • Coke is largely used as a reducing agent in metallurgy.
• In diamond, each carbon atom undergoes sp3 hybridisation and linked to four other carbon atoms
by using hybridised orbitals in tetrahedral fashion.
• Buckminsterfullerene contains six membered and five membered rings and hence is a cage like
molecule.
• Graphite is very soft and slippery. Hence, it is used as a dry lubricant in machines running at high
temperature.
54. Which one is an example of heterogenous catalysis?
(1) Decomposition of ozone in presence of nitrogen monoxide
(2) Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided
iron
(3) Oxidation of sulphur dioxide into sulphur trioxide in the presence of oxides of nitrogen
(4) Hydrolysis of sugar catalysed by H+ ions
Answer (2)
Sol. Combination of N2 and H2 to form NH3 in presence of finely divided Fe is an example of heterogeneous
catalysis.
is an example of ______.
(1) Allylic halide (2) Vinylic halide
(3) Benzylic halide (4) Aryl halide
Answer (1)
Sol. -carbon is sp3 carbon which is right next to
is allylic halide
- 23 -
NEET (UG)-2023 (Code-H5)
56. In Lassaigne’s extract of an organic compound, both nitrogen and sulphur are present, which gives blood
red colour with Fe3+ due to the formation of
(1) [Fe(CN)5NOS]4– (2) [Fe(SCN)]2+
(3) Fe4[Fe(CN)6]3xH2O (4) NaSCN
Answer (2)
Sol. In case, nitrogen and sulphur both are present in organic compound, sodium thiocyanate is formed. It
gives blood red colour and no Prussian blue since there are no free cyanide ions.
Na + C + N + S ⎯⎯→ NaSCN
57. Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R
In the light of the above statements, choose the correct answer from the options given below
(4) Both A and R are true and R is NOT the correct explanation of A
Answer (4)
Sol. • Helium is used as diluent for oxygen in modern diving apparatus because of its very low solubility
in blood.
CH3
|
(1) H2C = CH – C CH (2) H2C = C – CH = CH2
Cl
|
(3) H2C = CH – CH = CH2 (4) H2C = C – CH = CH2
Answer (4)
- 24 -
NEET (UG)-2023 (Code-H5)
59. Given below are two statements : one is labelled as Assertion A and the other is labelled as
Reason R :
Assertion A : A reaction can have zero activation energy.
Reasons R : The minimum extra amount of energy absorbed by reactant molecules so that their energy
becomes equal to threshold value, is called activation energy.
In the light of the above statements, choose the correct answer from the options given below :
(1) A is true but R is false
(2) A is false but R is true
(3) Both A and R are true and R is the correct explanation of A
(4) Both A and R are true and R is NOT the correct explanation of A
Answer (4)
Sol. • Few reactions can have zero activation energy for example radical reactions.
• Activation energy is defined as the minimum amount of extra energy absorbed by reactants to
achieve threshold energy.
60. Given below are two statements: one is labelled as Assertion A and the other is labelled as
Reason R
Assertion A : In equation rG = –nFEcell’ value of rG depends on n.
Reasons R : Ecell is an intensive property and rG is an extensive property.
In the light of the above statements, choose the correct answer from the options given below
(1) A is true but R is false
(2) A is false but R is true
(3) Both A and R are true and R is the correct explanation of A
(4) Both A and R are true and R is NOT the correct explanation of A
Answer (4)
Sol. The value of rG depends on n value as per the equation rG = –nFEcell
Where E is the emf of the cell and nF is the amount of charge passed.
So, assertion statement is correct
Ecell is an intensive property while rG is an extensive thermodynamic property
So, reason is correct but not explaining the assertion
61. Consider the following reaction and identify the product (P).
Product (P)
(1) (2)
Answer (3)
- 25 -
NEET (UG)-2023 (Code-H5)
Sol.
- 26 -
NEET (UG)-2023 (Code-H5)
(1) A is true but R is false
(4) Both A and R are true but R is NOT the correct explanation of A
Answer (1)
Sol. On dissolving alkali metal (sodium) in liquid ammonia, a deep blue solution is developed due to
ammoniated electron which absorbs energy in visible region of light and imparts blue colour. Due to
unpaired electron, solution is paramagnetic.
Answer (3)
Sol. • Complexes in which a metal is bound to only one kind of donor groups are called as homoleptic
complexes
K3[Al(ox)3]
It is a homoleptic complex
65. Amongst the given options which of the following molecules/ ion acts as a Lewis acid?
(1) BF3 (2) OH–
(3) NH3 (4) H2O
Answer (1)
Sol. Lewis acids are the one which accepts lone pair of electron due to presence of vacant orbital in
outermost shell.
66. The conductivity of centimolar solution of KCl at 25°C is 0.0210 ohm–1 cm–1 and the resistance of the cell
containing the solution at 25°C is 60 ohm. The value of cell constant is
(1) 1.26 cm–1 (2) 3.34 cm–1
Answer (1)
- 27 -
NEET (UG)-2023 (Code-H5)
Sol. Conductivity = conductance × cell constant
k = G G*
1
= G*
R
G* = k × R = 0.0210 × 60 = 1.26 cm–1
67. The relation between nm, (nm = the number of permissible values of magnetic quantum number (m)) for a
given value of azimuthal quantum number (l), is
n –1
(3) l= m (4) l = 2nm + 1
2
Answer (3)
Sol. Values of nm(magnetic quantum number) for given azimuthal quantum number can be calculated as
following
nm = 2l + 1
n –1
l= m
2
(1)
(2)
(3)
(4)
- 28 -
NEET (UG)-2023 (Code-H5)
Answer (3)
Sol. This reaction is Clemmensen reduction
70. The right option for the mass of CO2 produced by heating 20 g of 20% pure limestone is (Atomic mass of
(1) 2.64 g
(2) 1.32 g
(3) 1.12 g
(4) 1.76 g
Answer (4)
- 29 -
NEET (UG)-2023 (Code-H5)
Sol. CaCO3 ⎯⎯⎯
1200 K
⎯→ CaO + CO2
20
So, mass of pure CaCO3 = 20 = 4g
100
44
4 g CaCO3 → 4 g CO2
100
= 1.76 g CO2
[C] is ________
(1) (2)
(3) (4)
Answer (2)
Sol.
- 30 -
NEET (UG)-2023 (Code-H5)
72. The number of bonds, bonds and lone pair of electrons in pyridine, respectively are:
(1) 11, 3, 1 (2) 12, 2, 1
(3) 11, 2, 0 (4) 12, 3, 0
Answer (1)
Sol.
No. of bonds = 11
No. of bonds = 3
No. of lone pair of e– = 1
73. Which of the following reactions will NOT give primary amine as the product?
Answer (1)
Sol. (1)
(2)
(3)
(4)
- 31 -
NEET (UG)-2023 (Code-H5)
Sol. • All enzymes that utilize ATP in phosphate transfer require Mg as the co-factor.
• Bone in human body is not an inert and unchanging substance but is continuously being
solubilised and redeposited.
• Ca plays important role in neuromuscular function, interneuronal transmission, cell membrane
integrity and blood coagulation.
• The daily requirement of Mg and Ca in the human body is estimated to be 200 - 300 mg
(0.2 - 0.3 g).
75. Taking stability as the factor, which one of the following represents correct relationship?
Answer (2)
Sol. As we move down the group, due to poor shielding effect of intervening d and f orbitals, the increased
effective nuclear charge holds ns electrons tightly and therefore restricting their participation in
bonding.
So, the relative stability of +1 O.S increases for heavier elements.
E° for In3 + |In+ = − 0.16 V
76. A compound is formed by two elements A and B. The element B forms cubic close packed structure and
atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is AxBy, then the value of x + y
is in option
(1) 3 (2) 2
(3) 5 (4) 4
Answer (3)
Sol. Number of atoms of element B is N
1
So, the number of atoms of element A is 2N
3
The formula of the compound is A 2 BN = A2B3
N
3
So, x = 2
y=3
x+y=5
77. The element expected to form largest ion to achieve the nearest noble gas configuration is
(1) N (2) Na
(3) O (4) F
Answer (1)
Sol. For isoelectronic species, as the charge on anion increases, ionic size increases
So, N forms N3– anion with largest ionic size
- 32 -
NEET (UG)-2023 (Code-H5)
78. The stability of Cu2+ is more than Cu+ salts in aqueous solution due to
Answer (1)
Sol. The stability of Cu2+(aq) is more than Cu+(aq) is due to the much more negative hydH° of Cu2+(aq)
than Cu+(aq), which more than compensates for second ionisation enthalpy of Cu.
79. Some tranquilizers are listed below. Which one from the following belongs to barbiturates?
(1) Valium
(2) Veronal
(3) Chlordiazepoxide
(4) Meprobamate
Answer (2)
80. Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with
(1) 30 (2) 18
(3) 16 (4) 32
Answer (4)
= 32 g
- 33 -
NEET (UG)-2023 (Code-H5)
81. Amongst the following the total number of species NOT having eight electrons around central atom in its
outermost shell, is
(1) 4 (2) 1
(3) 3 (4) 2
Answer (3)
Sol.
(1) (2)
(3) (4)
Answer (4)
- 34 -
NEET (UG)-2023 (Code-H5)
Sol.
83. Intermolecular forces are forces of attraction and repulsion between interacting particles that will include :
A. dipole - dipole forces
B. dipole - induced dipole forces
C. hydrogen bonding
D. covalent bonding
E. dispersion forces
Choose the most appropriate answer from the options given below :
(1) A, B, C, E are correct (2) A, C, D, E are correct
(3) B, C, D, E are correct (4) A, B, C, D are correct
Answer (1)
Sol. Intermolecular forces are the forces of attraction and repulsion between interacting molecules. This
term does not include covalent bonds as covalent bond holds atoms of a molecule together.
Hence, dipole - dipole forces, dipole - induced dipole forces, hydrogen bonding and dispersion forces
are intermolecular forces.
84. Which amongst the following options is correct graphical representation of Boyle’s law?
(1) (2)
(3) (4)
Answer (4)
- 35 -
NEET (UG)-2023 (Code-H5)
Sol. According to Boyle’s law,
PV = nRT
1
P = nRT
V
1
P versus gives straight line graph with slope nRT.
V
(1) 1s < *1s < 2s < *2s < 2pz < *2pz < (2px = 2py) < (*2px = *2py)
(2) 1s < *1s < 2s < *2s < (2px = 2py) < (*2px = *2py) < 2pz < *2pz
(3) 1s < *1s < 2s < *2s < (2px = 2py) < 2pz < (*2px = *2py) < *2pz
(4) 1s < *1s < 2s < *2s < 2pz < (2px = 2py) < (*2px = *2py) < *2pz
Answer (3)
Sol. For molecules like B2, C2, N2 etc. the increasing order of energies of various molecular orbitals is
1s < *1s < 2s < *2s < (2px = 2py) < 2pz < (*2px = *2py) < *2pz
SECTION-B
86. The equilibrium concentrations of the species in the reaction A + B C + D are 2, 3, 10 and 6 mol L–1,
respectively at 300 K. Gº for the reaction is (R = 2 cal/mol K)
(1) –1381.80 cal (2) –13.73 cal
(3) 1372.60 cal (4) –137.26 cal
Answer (1)
A +B C+D
Sol.
at equilibrium 2 3 10 6
10 6
keq = = 10
23
Gº = –RT ln K
= –2.303 RT log K
= –2.303 × 2 ×300 × log10
= –1381.8 cal
- 36 -
NEET (UG)-2023 (Code-H5)
87. What fraction of one edge centred octahedral void lies in one unit cell of fcc?
1 1
(1) (2)
4 12
1 1
(3) (4)
2 3
Answer (1)
Sol. The total number of octahedral voids in FCC are four
Octahedral voids in FCC = Edge centres + Body centre
1
The contribution of edge centre =
4
1
Fraction of one edge centred octahedral void in one unit cell of FCC =
4
- 37 -
NEET (UG)-2023 (Code-H5)
89. The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range
Answer (3)
90. Which amongst the following will be most readily dehydrated under acidic conditions?
(1) (2)
(3) (4)
Answer (4)
Sol.
- 38 -
NEET (UG)-2023 (Code-H5)
Choose the correct answer from the options given below:
(1) C and D only (2) B and C only
(3) A and E only (4) B and D only
Answer (1)
Sol. All transitions metals except Sc from MO oxides which are ionic.
• The highest oxidation number corresponding to the group number in transition metal oxides in
attained in Sc2O3 to Mn2O7.
• Acidic character increases from V2O3 to V2O4 to V2O5.
• V2O4 dissolves in acids to give VO2+.
• CrO is basic but Cr2O3 is amphoteric.
92. Pumice stone is an example of
(1) Solid sol (2) Foam
(3) Sol (4) Gel
Answer (1)
Sol. Pumice stone is a solid sol.
Dispersed phase : Gas
Dispersed medium : Solid
3 – OH ⎯⎯→ major product
(1) (2)
(3) (4)
Answer (1)
- 39 -
NEET (UG)-2023 (Code-H5)
Sol. Ammoniacal silver nitrate solution is Tollens’ reagent. Tollens’ reagent can be used to distinguish
aldehyde & ketone as aldehyde upon warming with Tollens’ reagent produces a silver mirror due to
formation of silver metal in alkaline medium. Aldehyde is oxidised to corresponding carboxylate anion.
Sol.
- 40 -
NEET (UG)-2023 (Code-H5)
96. Which amongst the following options is the correct relation between change in enthalpy and change in
internal energy?
(1) H – U = –nRT (2) H + U = nR
(3) H = U – ngRT (4) H = U + ngRT
Answer (4)
Sol. Correct relation between change in enthalpy and change in internal energy is
H = U + ngRT
97. Which complex compound is most stable?
Answer (1)
Sol. Chelating ligands in general form more stable complexes than their monodentate analogs
The most stable complex is
CoCl2 ( en ) NO3
2
(1) (2)
(3) (4)
Answer (1)
Sol.
- 41 -
NEET (UG)-2023 (Code-H5)
Answer (3)
Sol. Using Ion electron method :
Cr2O72− + 3SO32− ⎯⎯
→ 2Cr 3+ + 3SO24− + 4H2O
100. Identify the final product [D] obtained in the following sequence of reactions.
CH3CHO ⎯⎯⎯⎯
i) LiAIH4
ii) H O+
→ [A] ⎯⎯⎯→
H2SO4
[B]
3
(1) C4H10
(2) HC C Na +
(3)
(4)
Answer (3)
Sol.
- 42 -
NEET (UG)-2023 (Code-H5)
BOTANY
SECTION-A
101. Given below are two statements :
Statement I : The forces generated transpiration can lift a xylem-sized column of water over 130 meters
height.
Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees evaporative cooling.
In the light of the above statements, choose the most appropriate answer from the options given below :
(1) Statement I is correct but Statement II is incorrect
(2) Statement I is incorrect but Statement II is correct
(3) Both Statement I and Statement II are correct
(4) Both Statement I and Statement II are incorrect
Answer (3)
Sol. Statement I is correct as measurements reveal that the forces generated by transpiration can create
pressures sufficient to lift a xylem sized column of water up to 130 meters high.
Statement II is also correct as transpiration cools leaf surfaces, sometimes 10 to 15 degrees, by
evaporative cooling.
102. What is the function of tassels in the corn cob?
(1) To disperse pollen grains
(2) To protect seeds
(3) To attract insects
(4) To trap pollen grains
Answer (4)
Sol. Tassels in the com cob represents stigma and style which wave in the wind to trap pollen grains.
103. Movement and accumulation of ions across a membrane against their concentration gradient can be
explained by
(1) Passive Transport
(2) Active Transport
(3) Osmosis
(4) Facilitated Diffusion
Answer (2)
Sol. Movement and accumulation of ions across a membrane against their concentration gradient can be
explained by active transport. It uses energy to transport molecules from lower concentration to a higher
concentration.
104. The reaction centre in PS II has an absorption maxima at
(1) 660 nm
(2) 780 nm
(3) 680 nm
(4) 700 nm
Answer (3)
Sol. In PS-I, the reaction centre chlorophyll a has an absorption peak at 700 nm, while in PS-II, reaction
centre has an absorption maxima at 680 nm.
- 43 -
NEET (UG)-2023 (Code-H5)
- 44 -
NEET (UG)-2023 (Code-H5)
Sol. For every CO2 molecule entering the Calvin cycle, 3 molecules of ATP and 2 of NADPH2 are required.
To make one molecule of glucose, 6 turns of the cycle are required. Thus, ATP and NADPH 2 molecules
required for synthesis of one molecule of glucose during Calvin cycle will be
3ATP 18ATP and
→ 6 =
2NADPH2 12NADPH2
110. What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
(1) Transcription of precursor of mRNA
(2) Transcription of only snRNAs
(3) Transcription of rRNAs (28S, 18S and 5.8S)
(4) Transcription of tRNA, 5S rRNA and snRNA
Answer (4)
Sol. In eukaryotes there are three major types of RNA polymerases.
RNA polymerase I transcribes : 5.8S, 18S, 28S rRNAs
RNA polymerase II transcribes : hnRNAs (precurssor of mRNA)
RNA polymerase III transcribes : tRNAs, ScRNA, 5S rRNA and snRNA
111. The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
(1) Diplotene
(2) Diakinesis
(3) Zygotene
(4) Pachytene
Answer (4)
Sol. The process of recombination occurs at Pachytene stage of prophase I. This stage is characterised by
the appearance of recombination nodules.
112. In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :
(1) Synergids, Zygote and Primary endosperm nucleus
(2) Synergids, antipodals and Polar nuclei
(3) Synergids, Primary endosperm nucleus and zygote
(4) Antipodals, synergids, and primary endosperm nucleus
Answer (1)
Sol. Synergids are the cells of gametophyte and hence these are haploid Zygote is formed by fusion of two
gametes and thus it is diploid.
Primary endosperm nucleus is formed by the fusion of diploid secondary nucleus with a male gamete.
Therefore, it is triploid.
113. Which of the following stages of meiosis involves division of centromere?
(1) Anaphase II
(2) Telophase
(3) Metaphase I
(4) Metaphase II
Answer (1)
Sol. Splitting of centromere occurs during anaphase of mitosis or anaphase II of meiosis.
During Metaphase I and II, chromosomes align at the equator.
During telophase, chromosomes reach the respective poles.
- 45 -
NEET (UG)-2023 (Code-H5)
- 46 -
NEET (UG)-2023 (Code-H5)
119. Unequivocal proof that DNA is the genetic material was first proposed by
(1) Avery, Macleoid and McCarthy
(2) Wilkins and Franklin
(3) Frederick Griffith
(4) Alfred Hershey and Martha Chase
Answer (4)
Sol. The unequivocal proof that DNA is the genetic material came from the experiment of Alfred Hershey
and Martha Chase.
Avery, Macleoid and McCarty gave the biochemical characterisation of Transforming Principle.
The transformation experiments by using Pneumococcus was conducted by Frederick Griffith.
Wilkins and Franklin produced X-ray diffraction data of DNA.
120. In gene gun method used to introduce alien DNA into host cells, microparticles of ________ metal are used.
(1) Tungsten or gold
(2) Silver
(3) Copper
(4) Zinc
Answer (1)
Sol. Option (1) is the correct answer because in gene gun method, microparticles of tungsten or gold are
used. Gold or tungsten are inert in nature so they do not alter the chemical composition of cells.
121. In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This
phenomenon may be called as
(1) Development
(2) Senescence
(3) Differentiation
(4) Dedifferentiation
Answer (4)
Sol. In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This
phenomenon may be called as dedifferentiation.
Dedifferentiation is a phenomenon by which the living differentiated plant cells, that by now have lost
the capacity to divide can regain the capacity of division under certain conditions.
- 47 -
NEET (UG)-2023 (Code-H5)
- 48 -
NEET (UG)-2023 (Code-H5)
127. Frequency of recombination between gene pairs on same chromosome as a measure of the distance
between genes to map their position on chromosome, was used for the first time by
(1) Alfred Sturtevant
(2) Henking
(3) Thomas Hunt Morgan
(4) Sutton and Boveri
Answer (1)
Sol. Alfred Sturtevant used the frequency of recombination between gene pairs on the same chromosome
as a measure of the distance between genes and ‘mapped’ their position on the chromosome.
Sutton and Boveri proposed chromosomal theory of inheritance.
Henking discovered X-chromosome.
Thomas Hunt Morgan proved chromosomal theory of inheritance and proposed the concept of linkage.
128. Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?
(1) Alien species invasions
(2) Co-extinctions
(3) Habitat loss and fragmentation
(4) Over exploitation for economic gain
Answer (3)
Sol. Habitat loss and fragmentation is the most important cause driving animals and plants to extinction.
129. Given below are two statements : One labelled as Assertion A and the other labelled as Reason R:
Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R : Protonema develops directly from spores produced in capsule.
In the light of the above statements, choose the most appropriate answer from options given below:
(1) A is correct but R is not correct
(2) A is not correct but R is correct
(3) Both A and R are correct and R is the correct explanation of A
(4) Both A and R are correct but R is NOT the correct explanation of A
Answer (3)
Sol. The predominant stage of the life cycle of a moss is the gametophyte which consists of two stages.
The first stage is the protonema stage, which develops directly from a spore. Capsule of the sporophyte
contains spore which gives rise to protonema. Thus, reason correctly explains the assertion.
- 49 -
NEET (UG)-2023 (Code-H5)
131. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : Late wood has fewer xylary elements with narrow vessels.
Reason R : Cambium is less active in winters.
In the light of the above statements, choose the correct answer from the options given below :
(1) A is true but R is false
(2) A is false but R is true
(3) Both A and R are true and R is the correct explanation of A
(4) Both A and R are true but R is NOT the correct explanation of A
Answer (3)
Sol. In winter, the cambium is less active and forms fewer xylary elements that have narrow vessels, and
this wood is called autumn wood or late wood.
132. The historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year
(1) 1986
(2) 2002
(3) 1985
(4) 1992
Answer (4)
Sol. The historic convention on Biological Diversity, “The Earth Summit” was held in Rio de Janeiro in the
year 1992. It called upon all nations to take appropriate measures for conservation of biodiversity and
sustainable utilisation of its benefits.
133. Large, colourful, fragrant flowers with nectar are seen in
(1) Bat pollinated plants
(2) Wind pollinated plants
(3) Insect pollinated plants
(4) Bird pollinated plants
Answer (3)
Sol. Large, colourful, fragrant flowers with nectar attract biotic pollinators (insects), thus, they are seen in
insect pollinated plants.
134. Among eukaryotes, replication of DNA takes place in :
(1) G1 phase
(2) G2 phase
(3) M phase
(4) S phase
Answer (4)
Sol. Replication of DNA takes place in S-phase of cell cycle in eukaryotes. Most of the cell organelles
duplicate in G1 phase.
135. Which micronutrient is required for splitting of water molecule during photosynthesis?
(1) Magnesium
(2) Copper
(3) Manganese
(4) Molybdenum
Answer (3)
Sol. Manganese plays a major role in the splitting of water to liberate oxygen during photosynthesis.
Copper is essential for the overall metabolism in plants.
Molybdenum is included in nitrogen metabolism.
Magnesium activates several enzymes involved in photosynthesis and respiration.
- 50 -
NEET (UG)-2023 (Code-H5)
SECTION-B
136. Which one of the following statements is NOT correct?
(1) Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem
dynamics of the water body
(2) The amount of some toxic substances of industrial waste water increases in the organisms at
successive trophic levels
(3) The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body
consume a lot of oxygen causing the death of aquatic organisms
(4) Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries
Answer (4)
Sol. Algal bloom imparts a distinct colour to the water bodies. It causes deterioration of the water quantity
and fish mortality.
137. Which of the following statements are correct about Klinefelter’s Syndrome?
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine developement is also
expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.
Choose the correct answer from the options given below:
(1) B and E only
(2) A and E only
(3) A and B only
(4) C and D only
Answer (1)
Sol. Klinefelter's syndrome is caused due to the presence of an additional copy of X-chromosome resulting
into a karyotype of 47, XXY. Such an individual has overall masculine development, however, the
feminine development is also expressed. Such individuals are sterile. Thus, statement B and E are
correct regarding Klinefelter's syndrome.
Statement A, C and D are incorrect w.r.t. Klinefelter’s syndrome as they are associated with Down’s
syndrome.
138. Identify the correct statements:
A. Lenticels are the lens-shaped openings permitting the exchange of gases.
B. Bark formed early in the season is called hard bark.
C. Bark is a technical term that refers to all tissues exterior to vascular cambium.
D. Bark refers to periderm and secondary phloem.
E. Phellogen is single-layered in thickness.
Choose the correct answer from the options given below:
(1) A, B and D only
(2) B and C only
(3) B, C and E only
(4) A and D only
Answer (4)
Sol. Lenticels are lens shaped opening permitting exchange of gases between the outer atmosphere and
internal tissue of the stem.
Bark that is formed early in the season is called early or soft bark. Towards the end of the season late
or hard bark is formed.
Bark is non-technical term that refer to all tissues exterior to vascular cambium.
Bark refers to a number of tissue types, viz periderm and secondary phloem.
Phellogen is couple of layers thick
Therefore, only statement A and D are correct.
- 51 -
NEET (UG)-2023 (Code-H5)
139. Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
(1) Lipase
(2) Dinitrogenase
(3) Succinic dehydrogenase
(4) Amylase
Answer (3)
Sol. Option (3) is correct answer of this question because malonate is a competitive inhibitor of enzyme
succinate dehydrogenase.
Inhibition of succinic dehydrogenase by malonate occurs due to close resemblance of malonate with
substrate succinate in structure. Competitive inhibitors are often used in the control of bacterial
pathogens.
140. Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct
sequence.
A Insertion of recombinant DNA into the host cell
B Cutting of DNA at specific location by restriction enzyme
C Isolation of desired DNA fragment
D Amplification of gene of interest using PCR
Choose the correct answer from the options given below :
(1) C, B, D, A
(2) B, D, A, C
(3) B, C, D, A
(4) C, A, B, D
Answer (3)
Sol. The correct answer is option (3) because recombinant DNA technology involves several steps in
specific sequence such as isolation of DNA, fragmentation of DNA by restriction endonucleases,
isolation of desired DNA fragment, ligation of the DNA fragment into a vector, transferring the
recombinant DNA into the host, culturing the host cells in a medium at large scale and extraction of the
desired product.
141. Match List I with List II:
List I List II
A. Iron I. Synthesis of auxin
B. Zinc II. Component of nitrate reductase
C. Boron III. Activator of catalase
D. Molybdenum IV. Cell elongation and differentiation
Choose the correct answer from the options given below:
(1) A-III, B-I, C-IV, D-II
(2) A-II, B-IV, C-I, D-III
(3) A-III, B-II, C-I, D-IV
(4) A-II, B-III, C-IV, D-I
Answer (1)
Sol. Iron activates catalase enzyme.
Zinc is needed in the synthesis of auxin.
Boron is required for cell elongation and cell differentiation.
Molybdenum is component of nitrogenase and nitrate reductase enzyme.
Therefore, option (1) is correct.
- 52 -
NEET (UG)-2023 (Code-H5)
- 53 -
NEET (UG)-2023 (Code-H5)
- 54 -
NEET (UG)-2023 (Code-H5)
147. Given below are two statements : One labelled as Assertion A and the other labelled as Reason R :
Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air
currents.
Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are
discharged and pollen tube is not formed.
In the light of the above statements, choose the correct answer from the options given below :
(1) A is true but R is false
(2) A is false but R is true
(3) Both A and R are true and R is the correct explanation of A
(4) Both A and R are true but R is NOT the current explanation of A
Answer (1)
Sol. Assertion is correct but reason is false as in gymnosperms the pollen grains are released from the
microsporangium and they are carried in air currents. They come in contact with the opening of the
ovules borne on megasporophylls. The pollen tube carrying the male gametes grows towards
archegonia in the ovules and discharge their contents near the mouth of the archegonia.
148. Match List I with List II :
List I List II
(Interaction) (Species A and B)
A. Mutualism I. +(A), 0(B)
B. Commensalism II. –(A), 0(B)
C. Amensalism III. +(A), –(B)
D. Parasitism IV. +(A), +(B)
Choose the correct answer from the options given below:
(1) A-IV, B-III, C-I, D-II
(2) A-III, B-I, C-IV, D-II
(3) A-IV, B-II, C-I, D-III
(4) A-IV, B-I, C-II, D-III
Answer (4)
Sol. (+, +) Mutualism : In this interaction, both the interacting species are benefitted.
(+, 0) Commensalism : Only one species is benefitted and the other species remains unharmed.
(–, 0) Amensalism : Neither species is benefitted. One remains unharmed and the other is harmed.
(+, –) Parasitism : One species is benefitted and other is negatively effected.
149. How many different proteins does the ribosome consist of?
(1) 40
(2) 20
(3) 80
(4) 60
Answer (3)
Sol. The ribosome consists of structural RNAs and about 80 different proteins.
150. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral
meristem.
Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at
successive node instead of leaves.
In the light of the above statements, choose the correct answer from the options given below :
(1) A is true but R is false
(2) A is false but R is true
(3) Both A and R are true and R is the correct explanation of A
(4) Both A and R are true but R is NOT the correct explanation of A
Answer (3)
Sol. A flower is a modified shoot wherein the shoot apical meristem changes to floral meristem.
Internodes do not elongate and the axis gets condensed. The apex produces different kinds of floral
appendages laterally at the successive nodes instead of leaves.
Therefore, both A and R are true and R is correct explanation of A.
- 55 -
NEET (UG)-2023 (Code-H5)
ZOOLOGY
SECTION-A
151. Given below are two statements:
Statement I: Ligaments are dense irregular tissue.
Statement II: Cartilage is dense regular tissue.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false
(2) Statement I is false but Statement II is true
(3) Both Statement I and Statement II are true
(4) Both Statement I and Statement II are false
Answer (4)
Sol. Option (4) is the correct answer because ligament is an example of dense regular connective
tissue so Statement I is incorrect and cartilage is an example of specialised connective tissue
and not dense regular tissue. Therefore Statement II is also incorrect.
152. Given below are two statements:
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false.
(2) Statement I is false but Statement II is true.
(3) Both Statement I and Statement II are true.
(4) Both Statement I and Statement II are false.
Answer (3)
Sol. RNA being unstable, mutate at a faster rate. Consequently, viruses having RNA genome and having
shorter life span mutate and evolve faster.
153. Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its
early treatment?
(1) Polymerase Chain Reaction (PCR) technique
(2) Enzyme Linked Immuno-Sorbent Assay (ELISA) technique
(3) Recombinant DNA Technology
(4) Serum and Urine analysis
Answer (4)
Sol. The correct answer is option (4) because using conventional methods of diagnosis like serum and urine
analysis, etc, do not help in early diagnosis. Recombinant DNA technology, Polymerase Chain
Reaction [PCR] and Enzyme Linked Immuno-Sorbent Assay (ELISA) are some of the techniques that
serve the purpose of early diagnosis.
154. In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
(1) Basophils
(2) Eosinophils
(3) TH cells
(4) B-lymphocytes
Answer (3)
Sol. The correct answer is option (3) because HIV enters into helper T-lymphocytes (T H), replicates and
produces progeny viruses. The progeny viruses released into blood attack other helper lymphocytes.
- 56 -
NEET (UG)-2023 (Code-H5)
Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-
terminal) and the right end represented by last amino acid (N-terminal).
Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of type and two
subunits of type.)
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is true but Statement II is false. (2) Statement I is false but Statement II is true.
(3) Both Statement I and Statement II are true (4) Both Statement I and Statement II are false.
Answer (2)
Sol. The correct answer is option (2) as a protein is imagined as a line, the left end represented
by the first amino acid and the right end is represented by the last amino acid. The first
amino acid is also called N-terminal amino acid. The last amino acid is called the C-terminal
amino acid.
(1) (2)
(3) (4)
Answer (4)
Sol. The symbol representing mating between relatives (consanguineous mating) in human pedigree
analysis is
- 57-
NEET (UG)-2023 (Code-H5)
159. Vital capacity of lung is _________.
(1) IRV + ERV + TV – RV (2) IRV + ERV + TV
(3) IRV + ERV (4) IRV + ERV + TV + RV
Answer (2)
Sol. Option (2) is the correct answer because vital capacity is the maximum volume of air a person can
breathe in after forced expiration. This includes ERV, TV and IRV.
160. Match List I with List II.
List I List II
A. P-wave I. Beginning of systole
B. Q-wave II. Repolarisation of ventricles
C. QRS complex III. Depolarisation of atria
D. T-wave IV. Depolarisation of ventricles
Choose the correct answer from the options given below :
(1) A-II, B-IV, C-I, D-III (2) A-I, B-II, C-III, D-IV
(3) A-III, B-I, C-IV, D-II (4) A-IV, B-III, C-II, D-I
Answer (3)
Sol. The correct answer is option (3) as in a standard ECG, P-wave represents the electrical excitation (or
depolarisation) of the atria which leads to the contraction of both the atria.
• QRS complex represents the depolarisation of ventricles which initiates the ventricular contraction.
• T-wave represents the return of the ventricles from excited to normal state.
161. Radial symmetry is NOT found in adults of phylum ______.
(1) Coelenterata (2) Echinodermata
(3) Ctenophora (4) Hemichordata
Answer (4)
Sol. Option (4) is the correct answer because hemichordates are bilaterally symmetrical animals.
Option (1) is not the answer because coelenterates are radially symmetrical organisms.
Option (2) is not the answer because adult echinoderms are radially symmetrical in adult stage.
Option (3) is not the answer because ctenophores are radially symmetrical organisms.
162. Match List I with List II
List I List II
(Cells) (Secretion)
A. Peptic cells I. Mucus
B. Goblet cells II. Bile juice
C. Oxyntic cells III. Proenzyme pepsinogen
D. Hepatic cells IV. HCl and intrinsic factor for absorption of vitamin B12
Choose the correct answer from the options given below:
(1) A-III, B-I, C-IV, D-II (2) A-II, B-IV, C-I, D-III
(3) A-IV, B-III, C-II, D-I (4) A-II, B-I, C-III, D-IV
Answer (1)
Sol. Option (1) is the correct answer because gastric glands have three major types of cells namely-
(i) Mucus neck cells which secrete mucus
(ii) Peptic or chief cells which secrete the proenzyme pepsinogen
(iii) Parietal or oxyntic cells which secrete HCl and intrinsic factor for absorption of vitamin B12.
- 58 -
NEET (UG)-2023 (Code-H5)
163. Match List I with List II.
List I List II
A. Taenia I. Nephridia
B. Paramoecium II. Contractile vacuole
C. Periplaneta III. Flame cells
D. Pheretima IV. Urecose gland
Choose the correct answer from the options given below:
(1) A-III, B-II, C-IV, D-I (2) A-II, B-I, C-IV, D-III
(3) A-I, B-II, C-III, D-IV (4) A-I, B-II, C-IV, D-III
Answer (1)
Sol. Option (1) is the correct answer because protonephridia or flame cells are the excretory structures in
platyhelminthes. Nephridia are the tubular excretory structures of earthworms (Pheretima) and other
annelids. Single celled organisms like Paramoecium have contractile vacuoles for excretion. Urecose
glands are present in cockroach.
164. Match List I with List II.
List I List II
A. Vasectomy I. Oral method
B. Coitus interruptus II. Barrier method
C. Cervical caps III. Surgical method
D. Saheli IV. Natural method
Choose the correct answer from the options given below:
(1) A-II, B-III, C-I, D-IV (2) A-IV, B-II, C-I, D-III
(3) A-III, B-I, C-IV, D-II (4) A-III, B-IV, C-II, D-I
Answer (4)
Sol. Option (4) is the correct answer because
(i) Vasectomy is a surgical method of contraception
(ii) Coitus interruptus is a natural method of contraception
(iii) Cervical cap is a barrier method of contraception
(iv) Saheli is an oral method of contraception which is a non-steroidal pill
165. Match List I with List II.
List I List II
A. CCK I. Kidney
B. GIP II. Heart
C. ANF III. Gastric gland
D. ADH IV. Pancreas
Choose the correct answer from the options given below :
(1) A-II, B-IV, C-I, D-III (2) A-IV, B-II, C-III, D-I
(3) A-IV, B-III, C-II, D-I (4) A-III, B-II, C-IV, D-I
Answer (3)
Sol. The correct answer is option (3) as
• Cholecystokinin (CCK) acts on both gall bladder and pancreas and stimulates the secretion of
bile juice and pancreatic enzymes respectively.
• GIP inhibits gastric secretion and motility.
• Atrial Natriuretic Factor (ANF) is released from the atrial wall of our heart.
• Anti-diuretic hormone (ADH) acts mainly on the kidney and stimulates resorption of water and
electrolytes by the distal tubules.
- 59-
NEET (UG)-2023 (Code-H5)
166. Broad palm with single palm crease is visible in a person suffering from-
(1) Klinefelter’s syndrome (2) Thalassemia
(3) Down’s syndrome (4) Turner’s syndrome
Answer (3)
Sol. Down’s syndrome is caused by an additional copy of chromosome number 21. Its symptoms
include–
a. Broad palm with characteristic palm crease
b. Short statured with small round head
c. Furrowed tongue and partially open mouth, etc.
167. Match List I with List II.
List I List II
(Interacting species) (Name of interaction)
A. A Leopard and a Lion in a forest/grassland I. Competition
B. A Cuckoo laying egg in a Crow’s nest II. Brood parasitism
C. Fungi and root of a higher plant in Mycorrhizae III. Mutualism
D. A cattle egret and a Cattle in a field IV. Commensalism
Choose the correct answer from the options given below.
(1) A-III, B-IV, C-I, D-II (2) A-II, B-III, C-I, D-IV
(3) A-I, B-II, C-III, D-IV (4) A-I, B-II, C-IV, D-III
Answer (3)
Sol. A leopard and a lion in a forest/grassland exemplify competition where both the species are competing
for the same resources.
A cuckoo laying egg in a crow’s nest is brood parasitism where cuckoo is the parasitic bird that lays its
egg in the nest of crow (host bird).
Fungi and root of a higher plant in mycorrhizae exemplify mutualism where both the species are
benefitted. The fungi help the plant in the absorption of essential nutrients from the soil while the plant
in turn provides the fungi with energy yielding carbohydrates.
A cattle egret and a cattle in a field exemplify commensalism where one species benefits and the other
remains unaffected.
The egrets always forage close to where cattle are grazing because the cattle, as they move, stir up
and flush out insects from the vegetation that otherwise might be difficult for the egrets to find and
catch.
168. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Endometrium is necessary for implantation of blastocyst.
Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of
endometrium.
In the light of the above statements, choose the correct answer from the options given below:
(1) A is true but R is false.
(2) A is false but R is true.
(3) Both A and R are true and R is the correct explanation of A.
(4) Both A and R are true but R is NOT the correct explanation of A.
Answer (4)
Sol. Option (4) is the correct answer because both Assertion and Reason are true.
Implantation is embedding of the blastocyst into endometrium of uterus.
Correct explanation of reason is
Corpus luteum secretes large amount of progesterone which is essential for maintenance of
endometrium of uterus. In absence of fertilisation, the corpus luteum degenerates hence the decrease
in the level of progesterone hormone will cause disintegration of endometrium leading to menstruation.
- 60 -
NEET (UG)-2023 (Code-H5)
169. Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R.
Assertion A : Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health
Care Programme.
Reason R : Ban on amniocentesis checks increasing menace of female foeticide.
In the light of the above statements, choose the correct answer from the options given below.
(1) A is true but R is false.
(2) A is false but R is true.
(3) Both A and R are true and R is the correct explanation of A.
(4) Both A and R are true and R is NOT the correct explanation of A.
Answer (2)
Sol. The correct answer is option (2) as ‘Reproductive and Child Health Care (RCH) programme’ deals with
creating awareness among people about various reproduction related aspects and providing facilities
and support for building up a reproductively healthy society.
Amniocentesis is basically used to test for the presence of certain genetic disorders such as Down’s
syndrome, haemophilia, etc., to determine the survivability of the foetus.
Amniocentesis is not a sex determination technique in India and is not a strategy of RCH.
170. Which of the following functions is carried out by cytoskeleton in a cell?
(1) Motility (2) Transportation
(3) Nuclear division (4) Protein synthesis
Answer (1)
Sol. An elaborate network of filamentous proteinaceous structures consisting of microtubules,
microfilaments and intermediate filaments present in cytoplasm is collectively referred to as the
cytoskeleton. It is involved in many functions such as mechanical support, motility, maintenance of the
shape of the cell.
171. Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
(1) Mole, Flying squirrel, Tasmanian tiger cat (2) Lemur, Anteater, Wolf
(3) Tasmanian wolf, Bobcat, Marsupial mole (4) Numbat, Spotted cuscus, Flying phalanger
Answer (4)
Sol. Option (4) is the correct answer because numbat, spotted cuscus and flying phalanger are Australian
marsupials exhibiting adaptive radiation.
Option (1) is incorrect because mole and flying squirrel are placental mammals.
Option (2) is incorrect because lemur and wolf are placental mammals.
Option (3) is incorrect because bobcat is a placental mammal.
172. Which of the following statements are correct regarding female reproductive cycle?
A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
B. First menstrual cycle begins at puberty and is called menopause.
C. Lack of menstruation may be indicative of pregnancy.
D. Cyclic menstruation extends between menarche and menopause.
Choose the most appropriate answer from the options given below.
(1) A, B and C only (2) A, C and D only
(3) A and D only (4) A and B only
Answer (2)
Sol. The correct answer is option (2) as first menstrual cycle that begins at puberty is called menarche.
Cyclic menstruation is an indicator of normal reproductive phase and extends between menarche and
menopause.
In primates, cyclical changes during reproduction are called menstrual cycle.
- 61-
NEET (UG)-2023 (Code-H5)
173. Match List I with List II.
List I List II
A. Gene ‘a’ I. -galactosidase
B. Gene ‘y’ II. Transacetylase
C. Gene ‘i’ III. Permease
D. Gene ‘z’ IV. Repressor protein
Choose the correct answer from the options given below:
(1) A-III, B-IV, C-I, D-II (2) A-III, B-I, C-IV, D-II
(3) A-II, B-I, C-IV, D-III (4) A-II, B-III, C-IV, D-I
Answer (4)
Sol. In a lac operon,
Gene a codes for enzyme transacetylase.
Gene y codes for enzyme permease.
Gene i codes for repressor protein
Gene z codes for enzyme -galactosidase.
174. Match List I with List II.
List I (Type of Joint) List II (Found between)
A. Cartilaginous Joint I. Between flat skull bones
B. Ball and Socket Joint II. Between adjacent vertebrae in vertebral column
C. Fibrous Joint III. Between carpal and metacarpal of thumb
D. Saddle Joint IV. Between Humerus and Pectoral girdle
Choose the correct answer from the options given below:
(1) A-I, B-IV, C-III, D-II (2) A-II, B-IV, C-III, D-I
(3) A-III, B-I, C-II, D-IV (4) A-II, B-IV, C-I, D-III
Answer (4)
Sol. Option (4) is the correct answer because cartilaginous joint is present in between the adjacent vertebrae
in the vertebral column.
Option (1) is not the answer because cartilaginous joint is not present between flat skull bones.
Option (2) is not the answer because fibrous joint is not present in between the carpal and metacarpal
of thumb.
Option (3) is not the answer because saddle joint is not present in between humerus and pectoral girdle.
175. Given below are two statements:
Statement I: Electrostatic precipitator is most widely used in thermal power plant.
Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) Statement I is correct but Statement II is incorrect.
(2) Statement I is incorrect but Statement II is correct.
(3) Both Statement I and Statement II are correct.
(4) Both Statement I and Statement II are incorrect.
Answer (1)
Sol. Electrostatic precipitator is most widely used in thermal power plants.
It can remove over 99 percent particulate matter present in the exhaust from a thermal power plant.
- 62 -
NEET (UG)-2023 (Code-H5)
176. Which one of the following common sexually transmitted diseases is completely curable when detected early
and treated properly?
(1) Hepatitis-B (2) HIV Infection
(3) Genital herpes (4) Gonorrhoea
Answer (4)
Sol. The correct answer is option (4) because except for hepatitis-B, genital herpes and HIV infection other
STIs are completely curable if detected early and treated properly.
Gonorrhoea is a bacterial disease which can be treated and cured completely, other diseases
mentioned are viral diseases.
177. Which of the following statements is correct?
(1) Presence of large amount of nutrients in water restricts ‘Algal Bloom’
(2) Algal Bloom decreases fish mortality
(3) Eutrophication refers to increase in domestic sewage and waste water in lakes.
(4) Biomagnification refers to increase in concentration of the toxicant at successive trophic levels.
Answer (4)
Sol. Increase in the concentration of the toxicant at successive trophic level is called
biomagnification.
Large amount of nutrients in water promotes growth of algal bloom. Algal bloom increases fish mortality.
Eutrophication refers to the natural aging of a lake by nutrient enrichment of its water.
178. Given below are two statements :
Statement I : Low temperature preserves the enzyme in a temporarily inactive state whereas high
temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II : When the inhibitor closely resembles the substrate in its molecular structure and inhibits the
activity of the enzyme, it is known as competitive inhibitor.
In the light of the above statements, choose the correct answer from the options given below :
(1) Statement I is true but Statement II is false.
(2) Statement I is false but Statement II is true.
(3) Both Statement I and Statement II are true.
(4) Both Statement I and Statement II are false.
Answer (3)
Sol. The correct answer is option (3) as low temperature preserves the enzyme in a temporarily inactive
state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
• Competitive inhibitor due to its close structural similarity with the substrate, competes with the
substrate for the substrate-binding site of the enzyme.
179. Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by
(1) Gastro-oesophageal sphincter
(2) Pyloric sphincter
(3) Sphincter of Oddi
(4) Ileo-caecal valve
Answer (4)
Sol. Option (4) is the correct answer because the undigested food (faeces) enters into caecum of the large
intestine through ileo-caecal valve, which prevents the backflow of the faecal matter.
Option (1) is not the answer because a muscular sphincter i.e., the gastro-oesophageal sphincter
regulates the opening of oesophagus into the stomach.
Option (2) is not the answer because pyloric sphincter regulates the opening in between stomach and
duodenum.
Option (3) is not the answer because the opening of common hepato-pancreatic duct is guarded by
sphincter of Oddi.
- 63-
NEET (UG)-2023 (Code-H5)
180. Match List I with List II.
List I List II
A. Ringworm I. Haemophilus influenzae
B. Filariasis II. Trichophyton
C. Malaria III. Wuchereria bancrofti
D. Pneumonia IV. Plasmodium vivax
Choose the correct answer from the options given below:
(1) A-III, B-II, C-I, D-IV (2) A-III, B-II, C-IV, D-I
(3) A-II, B-III, C-IV, D-I (4) A-II, B-III, C-I, D-IV
Answer (3)
Sol. Option (3) is the correct answer because:
(i) Ringworm is caused by Trichophyton.
(ii) Filariasis is caused by Wuchereria bancrofti.
(iii) Malaria is caused by Plasmodium species.
(iv) Pneumonia is caused by Haemophilus influenzae.
181. Which of the following are NOT considered as the part of endomembrane system?
A. Mitochondria
B. Endoplasmic reticulum
C. Chloroplasts
D. Golgi complex
E. Peroxisomes
Choose the most appropriate answer from the options given below:
Since the functions of the mitochondria, chloroplast and peroxisomes are not coordinated with
the above components, these are not considered as part of endomembrane system.
182. Match List I with List II with respect to human eye.
List I List II
A. Fovea I. Visible coloured portion of eye that regulates diameter of
pupil.
B. Iris II. External layer of eye formed of dense connective tissue.
C. Blind spot III. Point of greatest visual acuity or resolution.
D. Sclera IV. Point where optic nerve leaves the eyeball and
photoreceptor cells are absent.
Choose the correct answer from the options given below:
(1) A-I, B-IV, C-III, D-II (2) A-II, B-I, C-III, D-IV
(3) A-III, B-I, C-IV, D-II (4) A-IV, B-III, C-II, D-I
- 64 -
NEET (UG)-2023 (Code-H5)
Answer (3)
Sol. Option (3) is the correct answer because
(i) Fovea is the point of greatest visual acuity or resolution.
(ii) Iris is the visible coloured portion of the eye that regulates diameter of pupil.
(iii) Blind spot is the point where optic nerve leaves the eye-ball and photoreceptor cells are absent.
(iv) Sclera is the external layer of eye formed of dense connective tissue.
183. Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a
region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone
octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is correct but Statement II is false.
(2) Statement I is incorrect but Statement II is true.
(3) Both Statement I and Statement II are true.
(4) Both Statement I and Statement II are false.
Answer (2)
Sol. In prokaryotes, the negatively charged DNA is held with some positively charged proteins in a region
termed as nucleoid.
In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer
to form a structure called nucleosome.
184. Match List I with List II.
List I List II
A. Heroin I. Effect on cardiovascular system
B. Marijuana II. Slow down body function
C. Cocaine III. Painkiller
D. Morphine IV. Interfere with transport of dopamine
Choose the correct answer from the options given below:
(1) A-IV, B-III, C-II, D-I (2) A-III, B-IV, C-I, D-II
(3) A-II, B-I, C-IV, D-III (4) A-I, B-II, C-III, D-IV
Answer (3)
Sol. The correct answer is option (3) as
Heroin belongs to the category of opioids and it is a depressant that slows down body functions.
Marijuana is known for its effect on the cardiovascular system of the body.
Cocaine interferes with the transport of the neurotransmitter dopamine.
Morphine is used is a sedative and painkiller.
185. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex
and medulla.
Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop
of Henle.
- 65-
NEET (UG)-2023 (Code-H5)
In the light of the above statements, choose the correct answer from the options given below:
(1) A is true but R is false.
(2) A is false but R is true.
(3) Both A and R are true and R is the correct explanation of A.
(4) Both A and R are true but R is NOT the correct explanation of A.
Answer (1)
Sol. The correct answer is option (1) because Assertion is true as there are two types of nephrons, i.e.,
cortical nephrons and juxtamedullary nephrons based on their relative position in the cortex and
medulla. Reason is not correct as loop of Henle in juxtamedullary nephrons is very long and runs deep
into the medulla. Therefore, Assertion is true but Reason is false.
SECTION-B
186. Which one of the following is NOT an advantage of inbreeding?
(1) Elimination of less desirable genes and accumulation of superior genes takes place due to it.
(2) It decreases the productivity of inbred population, after continuous inbreeding.
(3) It decreases homozygosity.
(4) It exposes harmful recessive genes but are eliminated by selection.
Answer (2)
Sol. Option (2) is the correct answer because decreasing the productivity of inbred population is not an
advantage of inbreeding.
Options (4) and (1) are not the answers because they are the advantages of inbreeding.
Option (3) is an incorrect statement.
187. Given below are two statements:
Statement I : During G0 phase of cell cycle, the cell is metabolically inactive.
Statement II : The centrosome undergoes duplication during S phase of interphase.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) Statement I is correct but Statement II is incorrect.
(2) Statement I is incorrect but Statement II is correct.
(3) Both Statement I and Statement II are correct
(4) Both Statement I and Statement II are incorrect.
Answer (2)
Sol. Cells in the G0 stage remain metabolically active but no longer proliferate unless called on to do so
depending on the requirement of the organism.
In animal cells, during the S-phase, DNA replication begins in the nucleus, and the centriole duplicates
in the cytoplasm.
188. The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure,
rage, fear etc. are:
(1) Brain stem and epithalamus (2) Corpus callosum and thalamus
(3) Limbic system and hypothalamus (4) Corpora quadrigemina and hippocampus
Answer (3)
Sol. Option (3) is the correct answer because limbic system along with hypothalamus regulate the sexual
behaviour, expression of excitement, pleasure, rage, fear, etc.
Option (1), (2) and (4) are not correct because corpora quadrigemina is a part of the midbrain and
consists of four round swellings. Corpus callosum is a tract of nerve fibres that connects right and left
cerebral hemispheres. Thalamus is a major coordinating centre in the forebrain for sensory and motor
signalling. Midbrain, pons and medulla oblongata together form the brain stem.
- 66 -
NEET (UG)-2023 (Code-H5)
189. Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
(1) Presence of sclerites (2) Presence of anal cerci
(3) Dark brown body colour and anal cerci (4) Presence of anal styles
Answer (4)
Sol. Option (4) is the correct answer because anal styles are present in male cockroaches and absent in
female cockroaches.
Option (1), (2) and (3) are not the correct answers because sclerites, anal cerci and dark brown body
colour are common features of both male and female cockroaches.
190. The unique mammalian characteristics are:
(1) hairs, pinna and indirect development
(2) pinna, monocondylic skull and mammary glands
(3) hairs, tympanic membrane and mammary glands
(4) hairs, pinna and mammary glands
Answer (4)
Sol. Option (4) is correct answer because presence of hairs, pinna and mammary glands are
unique features of mammals.
Options (1), (2) and (3) are not correct because, monocondylic skull is present in reptiles and
aves whereas mammals have dicondylic skull. Tympanic membrane is present in amphibians
also, so it is not considered as unique feature.
Indirect development is not seen in mammals.
191. Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA
formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
(1) 5’ ATCGATCGATCGATCGATCGATCGATCG 3’
(2) 3’ ATCGATCGATCGATCGATCGATCGATCG 5’
(3) 5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’
(4) 3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’
Answer (1)
Sol. The sequence of coding strand is same as RNA except thymine at the place of uracil.
Template strand 3’-TAGCTAGCTAGCTAGCTAGCTAGCTAGC-5’
Coding strand 5’-ATCGATCGATCG ATCGATCGATCGATCG-3’
Transcription
mRNA 5’ AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’
- 67-
NEET (UG)-2023 (Code-H5)
Answer (1)
Sol. Option (1) is the answer because,
In cockroach, excretion is brought about by Malpighian tubules, fat body, nephrocytes and urecose
glands.
Urecose glands are present in male cockroach of some species. They synthesise uric acid.
Nephrocytes are large, colourless, ovoid, binucleate cells attached to the dorsal diaphragm in the body
cavity. Fat body accumulates, produces and stores uric acid.
Phallic gland is the structure of male reproductive system of cockroach and it secretes the outer layer
of spermatophore. Collaterial gland is the structure of female reproductive system of cockroach and it
secretes the hard egg-case or ootheca around fertilised eggs.
193. Which of the following statements are correct regarding skeletal muscle?
A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.
B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.
D. M line is considered as functional unit of contraction called sarcomere.
Choose the most appropriate answer from the options given below:
(1) A, C and D only
(2) C and D only
(3) A, B and C only
(4) B and C only
Answer (4)
Sol. Option (4) is the correct answer because statements B and C are only correct statements
while A and D are incorrect statements.
Muscle bundles are held together by collagenous connective tissue layer called fascia. Muscle bundles
are called fascicles. The portion of the myofibril between two successive ‘Z’ lines is considered as
functional unit of contraction called sarcomere.
194. Which of the following are NOT under the control of thyroid hormone?
A. Maintenance of water and electrolyte balance
B. Regulation of basal metabolic rate
C. Normal rhythm of sleep-wake cycle
D. Development of immune system
E. Support the process of RBCs formation
Choose the correct answer from the options given below:
(1) C and D only (2) D and E only
(3) A and D only (4) B and C only
Answer (1)
Sol. Option (1) is the correct answer because thyroid hormones play an important role in the
regulation of basal metabolic rate, maintenance of water and electrolyte balance and support the
process of RBCs formation, whereas this hormone is not involved in regulating normal rhythm of
sleep-wake cycle and development of immune system.
195. Which of the following statements are correct?
- 68 -
NEET (UG)-2023 (Code-H5)
Choose the correct answer from the options given below:
(1) B and C only (2) A and B only
(3) D and E only (4) C and E only
Answer (1)
Sol. Option (1) is the answer because, basophils secrete histamine, serotonin, heparin etc. and
are involved in inflammatory response.
Option (4) is not the answer because, basophils are granulocytes.
Option (2) is not the answer because, neutrophils are the most abundant cells (60–65 %) of the total
WBCs whereas basophils are least (0.5–1%) abundant of all WBCs.
Option (3) is not the answer because, monocytes have a kidney-shaped nucleus.
- 69-
NEET (UG)-2023 (Code-H5)
198. Select the correct statements.
A. Tetrad formation is seen during Leptotene.
B. During Anaphase, the centromeres split and chromatids separate.
C. Terminalization takes place during Pachytene.
D. Nucleolus, Golgi complex and ER are reformed during Telophase.
E. Crossing over takes place between sister chromatids of homologous chromosome.
Choose the correct answer from the options given below:
(1) A, C and E only (2) B and E only
(3) A and C only (4) B and D only
Answer (4)
Sol. • Tetrad formation is seen during zygotene stage
• During Anaphase, the centromeres split and chromatids separate.
• Terminalisation of chiasmata takes place during diakinesis.
• Nucleolus, golgi complex and ER are reformed during telophase.
• Crossing over takes place between non-sister chromatids of homologus chromosomes.
199. Match List I with List II.
List I List II
A. Logistic growth I. Unlimited resource availability condition
B. Exponential growth II. Limited resource availability condition
C. Expanding age pyramid III. The percent individuals of pre-reproductive age is largest followed
by reproductive and post reproductive age groups
D. Stable age pyramid IV. The percent individuals of pre-reproductives and reproductive age
group are same
Choose the correct answer from the options given below:
(1) A-II, B-IV, C-I, D-III (2) A-II, B-IV, C-III, D-I
(3) A-II, B-I, C-III, D-IV (4) A-II, B-III, C-I, D-IV
Answer (3)
Sol. Logistic growth occurs when there is limited resource availability condition.
- 70 -
NEET (UG)-2023 (Code-H5)
Answer (1)
Sol. Option (1) is the correct answer because,
● Areolar connective tissue contains fibroblasts (cells that produce and secrete fibres), macrophages
and mast cells.
● Inner surface of bronchioles is lined by ciliated epithelium.
● Blood is a specialised connective tissue.
● Tubular parts of nephron are lined by cuboidal epithelium.
- 71-