METHODS

crossm

Effective Soil Extraction Method for Cultivating Previously

Uncultured Soil Bacteria
Tuan Manh Nguyen,a,d Chan Seo,c Moongi Ji,c Man-Jeong Paik,c Seung-Woon Myung,b Jaisoo Kima

a Department of Life Science, College of Natural Sciences, Kyonggi University, Suwon, Gyeonggi-do, Republic
of Korea
b Department of Chemistry, College of Natural Sciences, Kyonggi University, Suwon, Gyeonggi-do, Republic of
Korea
c
College of Pharmacy and Research Institute of Life and Pharmaceutical Sciences, Sunchon National University,
Suncheon, Jeollanam-do, Republic of Korea
d Thai Nguyen University of Agriculture and Forestry, Quyet Thang, Thai Nguyen, Vietnam

ABSTRACT Here, a new medium, named intensive soil extract medium (ISEM),
based on new soil extract (NSE) using 80% methanol, was used to efficiently iso-
late previously uncultured bacteria and new taxonomic candidates, which ac-
counted for 49% and 55% of the total isolates examined (n ⫽ 258), respectively.
The new isolates were affiliated with seven phyla (Proteobacteria, Acidobacteria,
Firmicutes, Actinobacteria, Verrucomicrobia, Planctomycetes, and Bacteroidetes). The
result of chemical analysis showed that NSE included more diverse components of
low-molecular-weight organic substances than two conventional soil extracts made
using distilled water. Cultivation of previously uncultured bacteria is expected to ex-
tend knowledge through the discovery of new phenotypic, physiological, and func-
tional properties and even roles of unknown genes.
IMPORTANCE Both metagenomics and single-cell sequencing can detect unknown
genes from uncultured microbial strains in environments, and either method may
find the significant potential metabolites and roles of these strains. However, such
gene/genome-based techniques do not allow detailed investigations that are possi-

Downloaded from https://journals.asm.org/journal/aem on 30 July 2024 by 45.64.236.237.

ble with cultures. To solve this problem, various approaches for cultivation of uncul-
tured bacteria have been developed, but there are still difficulties in maintaining
pure cultures by subculture.
KEYWORDS cultivation, intensive soil extract medium (ISEM), isolation, low-
molecular-weight organic substances (LMWOS), new soil extract (NSE), new
taxonomic candidates, subculture, uncultured bacteria

M olecular tools revealed that prokaryotic species are very diverse and abundant in
soil and contain numerous unexplored potential metabolites (1–4). Although
these tools enable analysis of the broad range of metabolic diversity of microorganisms
Received 12 May 2018 Accepted 7
September 2018
Accepted manuscript posted online 5
without the need to isolate species, many bacterial characteristics are unknown be- October 2018
cause of limitations of cultivation (5, 6). Since the establishment of solid culture media, Citation Nguyen TM, Seo C, Ji M, Paik M-J,
secondary metabolites have been isolated from microorganisms cultured in laborato- Myung S-W, Kim J. 2018. Effective soil
extraction method for cultivating previously
ries. The lack of complex factors/conditions in the laboratory has contributed to the
uncultured soil bacteria. Appl Environ
inability to isolate various species (7, 8). Since the concept of uncultured bacteria was Microbiol 84:e01145-18. https://doi.org/10
published in 1990 (9) to refer to these bacteria not yet cultured in laboratories, several .1128/AEM.01145-18.
methods have been developed in an attempt to culture these bacteria. These methods Editor Harold L. Drake, University of Bayreuth
involved transporting bacteria from their natural environment to the laboratory for Copyright © 2018 American Society for
Microbiology. All Rights Reserved.
growth in artificial media/conditions similar to those in the natural environment by
Address correspondence to Jaisoo Kim,
modifying growth medium components (7) or growth conditions, such as pH and salt [email protected].
concentrations (9, 10), addition of inorganic compounds or metals lacking electron

December 2018 Volume 84 Issue 24 e01145-18 Applied and Environmental Microbiology aem.asm.org 1
Nguyen et al. Applied and Environmental Microbiology

donors/acceptors (11, 12), use of various factors (13), coculture with helper bacteria (14,
15), performance of soil extracts using water (16, 17) or aqueous buffers (18, 19), use of
diluted medium or serial dilution culture (20, 21), long incubation time (10, 22), etc.
Furthermore, sophisticated techniques were developed that allowed analysis of indi-
vidual cells in soil samples, such as iChip for in situ cultivation (23), the microbioreactor
(24), optical tweezers (25), and the micromanipulator (26). However, new artificial
media to maintain these cultures are needed. Although scientists can enrich slow-
growing microorganisms using diffusion chambers (27, 28) or soil substrate membranes
(29), most enriched bacteria do not grow on agar plates for isolation and further
cultivation. Without successful cultivation, it is difficult to detect and identify novel
organisms, obtain phenotypic and functional information, and determine the functions
of unknown genes (30). The most important factors affecting the cultivation of uncul-
tured bacteria and the most appropriate medium conditions remain unclear.
Here, we developed a simple culture method based on new soil extract (NSE) using
80% methanol without special equipment and successfully cultured many previously
uncultured bacterial strains. To evaluate our method, we checked the proportion of
uncultured strains among isolates as well as that of new taxa and analyzed chemical
components of NSE for comparisons to two traditional soil extracts (TSEs) that are
commonly used.

RESULTS
Composition of soil extracts utilized as culture supplements. For nutrition and
bacterial growth, heterotrophic soil bacteria depend on low-molecular-weight organic
substances (LMWOS) and inorganic compounds (31). Thus, in this study, we compared
the major LMWOS, such as amino acids, fatty acids, organic acids, and inorganic ions,
in three different extraction methods (NSE, new soil extraction, developed in this study;
TSE1, traditional soil extraction without autoclaving; TSE2, traditional soil extraction
with autoclaving) (Table 1). To obtain more diverse LMWOS, we used a mixture of
methanol and water to be consistent with 4:1 (80%) to extract bacterial nutrients from
soil rather than water or aqueous buffers and named this extract NSE. Briefly, 500 g dry
soil was prepared and shaken at 150 rpm with 1.3 liters of 80% methanol overnight at
room temperature. The supernatant was transferred to a new flask, and a fresh 1.3 liters
of 80% methanol was added to the remaining soil and mixed well for 1 h. The two
supernatants were combined, filtered, and evaporated. The NSE was stored at 4°C until

Downloaded from https://journals.asm.org/journal/aem on 30 July 2024 by 45.64.236.237.

use. For amino acids, NSE showed a total yield of 18.50 mg · liter⫺1, which is much
higher than that for the other two methods, which had values of 4.84 and 5.87
mg · liter⫺1, respectively (P ⬍ 0.004). Additionally, 21 amino acids were extracted,
including four more amino acids (valine, pipecolic acid, serine, and threonine), and a
very high concentration of tyrosine (9.29 mg · liter⫺1) compared to the other methods.
This higher concentration and diversity of amino acids in the NSE than in the other two
methods may cause better cultivability of uncultured soil bacteria. However, there was
little difference between methods TSE1 and TSE2 (PTSE1 versus TSE2 ⬍ 0.03), indicating
that autoclaving at 121°C had no significant effect on the extraction of more compo-
nents of amino acids in soil. The results of fatty acid analysis can be compared, because
the NSE method extracted a much higher total concentration (13.10 mg · liter⫺1 versus
0.79 mg · liter⫺1) and greater number (n ⫽ 16 versus n ⫽ 8) of fatty acids than the other
two (Table 1). For organic acids, the results showed that the NSE method had a lower
total yield of organic acids (25.14 mg · liter⫺1 versus 62.69 to 89.00 mg · liter⫺1; P ⬍
0.03) but a greater total number (n ⫽ 16 versus n ⫽ 11), including lactic acid, glycolic
acid, 2-hydroxybuyric acid, fumaric acid, and ␣-ketoglutaric acid (Table 1). The total
amounts of organic acids obtained by methods TSE1 and TSE2 were significantly
influenced by two major components, acetoacetic acid and oxaloacetic acid, but these
did not significantly affect the total amount for method NSE.
The total yields of inorganic compounds for each extraction were 748.03, 965.00, and
946.91 mg per liter of extract (Table 1). Although method NSE gave a lower concentration
of total inorganic compounds than the other methods (P NSE versus TSE1 or TSE2 ⬍ 0.002), the

December 2018 Volume 84 Issue 24 e01145-18 aem.asm.org 2

Cultivation of Uncultured Soil Bacteria Applied and Environmental Microbiology

TABLE 1 Components of soil extracts prepared in three different waysa

Amt (mg · literⴚ1) by soil extraction method
Ingredient NSE TSE1 TSE2
Amino acids
Alanine 0.47 0.10 0.18
Glycine 0.32 0.16 0.40
Valine 0.09 ND ND
Leucine 0.47 0.05 0.06
Isoleucine 0.20 0.03 0.03
Proline 0.21 0.63 0.69
␥-Aminobutric acid 0.76 0.62 0.69
Pipecolic acid 0.09 ND ND
Pyroglutamic acid 0.85 0.23 0.32
Serine 0.38 ND ND
Threonine 1.38 ND ND
Phenylalanine 0.22 0.03 0.04
Cysteine 0.22 0.12 0.29
Aspartic acid 0.27 0.08 0.31
Glutamic acid 0.55 0.40 0.39
Asparagine 0.57 0.41 0.52
Ornithine 0.77 0.46 0.45
Glutamine 0.55 0.67 0.66
Lysine 0.12 0.25 0.24
Tyrosine 9.29 0.10 0.09
Tryptophane 0.72 0.50 0.51
Total 18.50 4.84 5.87

Fatty acids
Decanoic acid 0.47 ND ND
Lauric acid 0.48 ND ND
Myristoleic acid 0.15 ND ND
Myristic acid 1.18 0.07 0.08
Isopentadecylic acid 0.09 ND ND
Isopalmitic acid 0.11 ND ND
Palmitoleic acid 0.35 0.09 0.08
Palmitic acid 1.29 0.12 0.11
Linoleic acid 0.40 ND ND
Oleic acid 0.40 ND ND
Stearic acid 2.54 0.09 0.17
Arachidic acid 1.08 0.07 0.07
Erucic acid ND 0.071 0.06

Downloaded from https://journals.asm.org/journal/aem on 30 July 2024 by 45.64.236.237.

Behenic acid 1.80 ND ND
Nervonic acid 0.07 ND ND
Lignoceric acid 2.60 0.093 0.08
Cerotic acid 0.09 0.182 0.14
Total 13.10 0.79 0.79

Organic acids
3-Hydroxybutyric acid 0.96 2.07 1.88
Pyruvic acid 0.40 4.31 5.75
Acetoacetic acid 1.47 28.75 27.25
Lactic acid 9.42 ND ND
Glycolic acid 8.03 ND ND
2-Hydroxybutyric acid 0.09 ND ND
Malonic acid 0.85 1.21 1.75
Succinic acid 1.43 2.18 1.78
Fumaric acid 0.05 ND ND
Oxaloacetic acid 0.17 18.35 44.84
␣-Ketoglutaric acid 0.11 ND ND
Malic acid 0.73 3.32 3.33
2-Hydroxyglutaric acid 0.50 0.93 0.72
Cis-aconitic acid 0.27 0.28 0.33
Citric acid 0.46 0.81 0.83
Isocitric acid 0.20 0.48 0.54
Total 25.14 62.69 89.00
(Continued on next page)

December 2018 Volume 84 Issue 24 e01145-18 aem.asm.org 3

Nguyen et al. Applied and Environmental Microbiology

TABLE 1 (Continued)
Amt (mg · literⴚ1) by soil extraction method
Ingredient NSE TSE1 TSE2
Inorganic compounds
Na⫹ 58.87 83.65 85.05
NH4⫹ 6.93 17.76 19.45
Mg2⫹ 29.24 27.52 27.95
K⫹ 15.98 58.95 61.32
Ca2⫹ 87.93 114.59 119.49
Cl⫺ 43.34 120.21 116.32
NO3⫺ 489.67 398.43 384.51
SO42⫺ 5.41 130.15 128.64
PO42⫺ 10.66 4.74 4.18
Total 748.03 956.00 946.91
aTheNSE method was developed in this study; the TSE1 method involves autoclaving at 121°C for 1 h; the
TSE2 method does not involve autoclaving. ND, not detected.

methanol-water mixture appeared to dissolve substances similarly to water and recovered

the same inorganic ions extracted with water (methods TSE1 and TSE2). In particular,
NO3⫺ and PO42⫺ were higher in NSE than TSEs, and SO42⫺ was much lower in NSE than
TSEs. Autoclaving did not significantly affect the dissolution of inorganic or organic
compounds in water between methods TSE1 and TSE2 (P ⬎ 0.3).
Method validation based on isolation rate of uncultured or new taxonomic
bacteria. To compare the three cultivation methods, the newly developed method for
isolation of previously uncultured soil bacteria using ISEM (intensive soil extract me-
dium; here simply called the new method), traditional soil extract culture medium (the
traditional method), and modified transwell culture method (the modified method), the
different bacterial strains (258, 243, and 252 for each method) were isolated from three
soil samples and identified as described in Materials and Methods. The ratio of previously
uncultured bacterial strains was significantly increased by 49% (126 isolated strains/
total 258 isolated strains) for the new method, with values of 5% (11 isolated strains/
total 243 isolated strains) for the traditional method and 15% (39 isolated strains/total
252 isolated strains) for the modified method (Fig. 1a; see also Tables S1 to S3 in the
supplemental material).
Taxonomic analysis also showed that this new method was much better than the

Downloaded from https://journals.asm.org/journal/aem on 30 July 2024 by 45.64.236.237.

two other methods in terms of new taxon isolation. In the new method, 142 new
species candidates were found among isolates, including 13 at the genus level and 1
at the family level, showing 55% (142/258) efficiency compared to 13% (32/243) and
26% (65/252) for the traditional and modified methods, respectively (Tables S1 to S3).
For the isolation efficiency for candidates at the genus level or higher, the new method
showed a value of 5.4% (14/258), which is much higher than the 0.0% (0/243) and 0.4%
(1/252) obtained for the other two methods (Fig. 1b). The new method isolated a
family-level candidate, while the other two methods did not. Furthermore, the new
method showed the highest ratio and largest number of new taxon candidates (at least
at the species level) among uncultured isolated strains (75.4%, 95/126) compared to the
other two methods, which showed values of 36.4% (4/11) and 48.7% (19/39), respec-
tively (Fig. 1c). In addition, our method can directly isolate bacterial strains from a soil
suspension without an enrichment culture step, saving time and labor.
Method validation through taxonomic analysis. As a standard reference, this
study tried to identify possible strains present in the same soil samples through a
molecular technique, which can give some information important to evaluate the
method developed. 16S amplicon sequencing data as a last generation method was
analyzed according to Chao1 estimation at a 3% evolutionary distance and revealed the
diversity of microbial community genomics in the soil samples, with 1,744 to 2,402
operational taxonomic units (Fig. S1a). Pyrosequencing analysis suggested that nine
identified bacterial phyla commonly present in all soil samples were Chloroflexi, Planc-
tomycetes, Verrucomicrobia, Bacteroidetes, Gemmatimonadetes, Actinobacteria, Acidobac-

December 2018 Volume 84 Issue 24 e01145-18 aem.asm.org 4

Cultivation of Uncultured Soil Bacteria Applied and Environmental Microbiology

Downloaded from https://journals.asm.org/journal/aem on 30 July 2024 by 45.64.236.237.

FIG 1 Proportion of uncultured/cultured bacteria and new taxonomic candidates isolated from soil samples by using ISEM (newly developed method),
traditional soil extract culture medium, and a modified transwell culture method. (a) Percentage of uncultured species (126 individual species among a total
of 258, 11 of 243, and 39 of 252, respectively). Points of significance compared to two paired samples for means were determined by t test, as indicated by
one (P ⬍ 0.05), two (P ⬍ 0.01), and three (P ⬍ 0.001) asterisks. (b) Percentage of novel genus candidates (14/258, 0/243, and 1/252, respectively). (c) Proportion
of novel bacterial species and known species among 126, 11, and 39 previously uncultured species via the investigated methods. Error bars indicate standard
deviations.

teria, Proteobacteria, and Parcubacteria_OD1, and three unidentified phyla were Nitro-
spirae, Saccharibacteria_TM7, and AD3 (Fig. 2a). Proteobacteria and Acidobacteria were
the most dominant phyla. Other remaining minor phyla (each ⬍1% of the total,
together comprising 3.1%, and referred to here as ETC) were major lineages that have
cultured representatives (Chlorobi, Elusimicrobia, Armatimonadetes, Firmicutes, Chlamyd-
iae, Tenericutes, Latescibacteria, Omnitrophica, and Hydrogenedentes), candidate phyla
without cultured representatives (Kazan, Gracilibacteria, and Berkelbacteria), and other
phyla. Additionally, the distribution and relative abundance of species identified by
pyrosequencing in each soil sample were determined, showing that abundant species

December 2018 Volume 84 Issue 24 e01145-18 aem.asm.org 5

Nguyen et al. Applied and Environmental Microbiology

Downloaded from https://journals.asm.org/journal/aem on 30 July 2024 by 45.64.236.237.

FIG 2 Abundance of bacteria in soil samples determined by pyrosequencing. (a) The abundance deter-
mined at a 1% ETC cutoff. (b) Distribution and relative abundance of identified species. Approximately
8,143, 8,314, and 6,836 individual species were detected in A, B, and S soil samples, respectively; scale of
x axis, log2.

(more reads within a species) would be few and rare (fewer reads within a species
would be many) (Fig. 2b). Phylogenetically, the new method achieved successful
cultivation of strains from seven phyla among all bacteria present in the soils (Fig. 3):
Proteobacteria (␣, ␤, and ␥) (46.9%), Actinobacteria (43.4%), Bacteroidetes (4.7%), Firmi-
cutes (3.9%), Acidobacteria (0.4%), Verrucomicrobia (0.4%), and Planctomycetes (0.4%)
(Fig. S1b). In contrast, the two other methods did not recover strains in three phyla:
Acidobacteria, Verrucomicrobia, and Planctomycetes. Thus, the new method extended
the taxonomic range of cultivation at the phylum level. Pyrosequencing analysis
indicated that the three soil samples included 120 identified families, excluding 10%
unclassified sequences, and 38, 22, and 29% of the identified families were recovered
by the new, traditional, and modified methods, respectively (Fig. S2a). The isolates
obtained using the new method represented 100 genera (86 known and 14 novel
genera), which are compared with the 50 and 60 genera isolated using the traditional
and modified methods, respectively (Fig. S2b). For the comparison at the species level,
the new method independently cultivated soil bacteria compared to the other two
methods, as only one species among the 258 species overlapped with the traditional

December 2018 Volume 84 Issue 24 e01145-18 aem.asm.org 6

Cultivation of Uncultured Soil Bacteria Applied and Environmental Microbiology

Downloaded from https://journals.asm.org/journal/aem on 30 July 2024 by 45.64.236.237.

FIG 3 Network topology tree for microbial cultivation based on full-length 16S rRNA gene sequencing. Only bootstrap
support values of ⱖ50% are shown in the tree. Accession numbers for 16S rRNA gene sequences revealed close relationships
with previously uncultured bacteria, and those cultured as new species and novel genera are shown in the tree.

December 2018 Volume 84 Issue 24 e01145-18 aem.asm.org 7

Nguyen et al. Applied and Environmental Microbiology

TABLE 2 Number of bacterial isolates used to evaluate NSE and other media
No. of isolates by level
Species Genus
Soil Previously
sample Previously uncultured, Previously uncultured, Previously uncultured, Previously cultured, uncultured,
type novel known novel novel novel family Total
A 24 12 2 3 41
B 28 9 3 1 41
S 34 10 3 1 1 49
Total 86 31 8 5 1 131

method (none with the modified method), while the two other methods showed 31
species overlapping each other (Fig. S2c). This result indicated that the new method
was more specific for the growth of uncultured bacteria than cultured bacteria. Until
now, uncultured isolates from the new method were distributed in 53 genera of six
phyla, while the other two methods showed a very limited taxonomic distribution: 5
genera in two phyla and 20 genera in three phyla, respectively (Fig. S2d).
Method validation through subculture of novel isolates. We tested 7 different
media to compare their ability to support subculture of newly isolated bacteria: basic
salts (BS; negative control), BS plus micronutrients, BS plus vitamin B, BS plus D-amino
acids, BS plus NSE, NSE only, and full ISEM (as a positive control). Here, 131 bacterial
isolates (i.e., 131 species), including 126 previously uncultured bacteria and 5 novel
genus candidates (Table 2 and Table S4), obtained using our developed culture method
and three different soil samples, were used to determine the effectiveness of the
various nutrient components by forming visible colonies on agar plates after streaking.
While NSE and BS plus NSE showed 100% growth recovery (n ⫽ 131/131), BS plus
D-amino acids showed a value of 8% (n ⫽ 11/131) and other components had a value
of 0% (n ⫽ 0/131). Therefore, NSE and NSE-containing media can be more effective for
isolating and subculturing uncultured soil bacteria than other media.

DISCUSSION
Soil contains elements necessary for living organisms. An aqueous soil extraction
method was established previously (17) (the extract is included in, for example, ATCC
medium 654 or DSMZ medium 80) and remains widely used. Most mineral or organic

Downloaded from https://journals.asm.org/journal/aem on 30 July 2024 by 45.64.236.237.

ingredients, such as ionic salts, vitamins, antibiotics, plant hormones, and plant-promoting
growth factors, among others, can be dissolved in distilled water, while some organic
components, such as nonpolar compounds, cannot be sufficiently dissolved in distilled
water or aqueous buffers. Thus, we used 80% methanol to overcome this problem and
achieved higher concentrations and more different types of organic ingredients than when
we used distilled water (Table 1). Although methanol and water are polar protic solvents
that easily solubilize polar molecules, methanol is less polar than water based on their
polarity values of 5.1 and 10.2, respectively. Therefore, methanol may more easily
dissolve or extract a greater amount of hydrophobic or amphipathic molecules in soil
than water. In contrast, based on their dielectric constants according to Harris (32),
water (approximately 80) is more likely to dissolve inorganic compounds than metha-
nol (approximately 30).
NSE contained 21 amino acids, which was greater than the number obtained using
water extraction methods, 17 in this study (Table 1), and even less in previous studies:
16 amino acids were obtained using 6 N HCl (33), and 14 amino acids were obtained
using morpholinepropanesulfonic acid buffer (31). Fatty acids contain a polar carboxylic
group and nonpolar hydrocarbon group of 4 to 36 carbons, making only short-chain
fatty acids more or less water soluble. Thus, a combination of methanol and water
improved their dissolution. This led to significant differences in the total number and
amount of fatty acids between methods NSE and TSE1 (P ⬍ 0.002), but the total fatty
acids obtained for the two comparative methods (methods TSE1 and TSE2) were similar
to each other (P ⬎ 0.9) (Table 1). Greater amounts and larger numbers of fatty acids

December 2018 Volume 84 Issue 24 e01145-18 aem.asm.org 8

Cultivation of Uncultured Soil Bacteria Applied and Environmental Microbiology

may improve the cultivability of uncultured soil bacteria. Organic acids are widely
present in soil (31), and low-molecular-weight organic acids are typically miscible in
water. Thus, the three extraction methods were relatively effective. Although methanol
extracted lower concentrations than water, more diverse organic acids were extracted,
increasing the spectrum of either carbon or electron donors/acceptors for microorgan-
isms. Because inorganic substances typically dissolve well in water and even in pure
methanol (34), 80% methanol can extract large amounts of inorganic compounds (5.41
to 489.67 mg/liter) from soil, although smaller amounts than those of the two water
extraction methods. We supposed that the components present only in NSE, or present
at greater concentrations than in the two TSEs, would stimulate growth of uncultured
bacteria. Overall, NSE was superior to the two TSEs and other extraction methods,
because greater concentrations and types of LMWOS were obtained, which may be
required to support most soil bacteria, including uncultured bacteria.
Although an enhanced medium (traditional soil extract culture medium) derived
from soil extract (TSE) containing yeast extract, tryptone, and salts was designed to
support various soil bacteria (17), necessary elements for many uncultured bacteria may
be absent, so that most isolates (⬃96%) seemed to belong to previously cultured groups
(Fig. 1a; also see Table S2 in the supplemental material). Additionally, the modified method
with R2A, a complex efficient artificial media for cultivating heterotrophic bacteria, includ-
ing fast-growing and slow-growing bacteria (35), showed better results and isolated a
greater number of bacteria and new taxon candidates than the traditional method did (Fig.
1a and 2a and b; Table S3). Although this method is better than the traditional method, the
isolation step shows limited recovery of various enriched uncultured soil bacteria. In
particular, ISEM developed in this study allowed cultivation of large numbers of isolates of
various uncultured bacteria and new taxa candidates compared to the numbers obtained
using the other two methods. Thus, the new method more effectively isolated uncultured
bacteria and new bacterial taxa present in soil. The most important aspect of this new
method (ISEM) is the inclusion of NSE (described above). The direct isolation from a soil
suspension using ISEM agar plates can be an effective method, because during the
enrichment step, fast-growing microorganisms may overcome slow-growing bacteria. For
any new cells to be formed, substrate complexes, including nutrients, supporting growth
factors, etc., are required. Under in vitro conditions, artificially nutrient limited, most of the
energy may be consumed by fast-growing bacteria, while slow-growing bacteria need
longer times for the cell division process. When the fast-growing bacteria reach the highest

Downloaded from https://journals.asm.org/journal/aem on 30 July 2024 by 45.64.236.237.

growth rate, nutrient concentrations in culture media may shortly be too low or completely
consumed. This leads to nutritional physiological stress (starvation) for slow-growing spe-
cies (13). In addition, antibiotic produced by some fast-growing species may also be a
growth-inhibiting factor for slower-growing species (13). As a result, the diversity of
bacterial species can be reduced.
Among recently introduced methods, Kakumanu and Williams (36) developed a soil
diffusion system and found uncultured bacteria in the phyla Proteobacteria, Bacte-
roidetes, Verrucomicrobia, Planctomycetes, and OP10 but only 8 uncultured bacteria at
the species level. Furthermore, the study suggested conducting only enrichment
culture, with no method for isolation of pure bacterial strains. Another study found that
27% of species belonged to 20 unnamed family-level groupings among 350 isolates
(37), but these species were isolated from many different artificial media, not including
soil extracts, and the effectiveness of each medium on the cultivability of uncultured
soil bacteria was not determined. Various methods for cultivating uncultured soil
bacteria have been developed: modification of growth media, modification of growth
conditions, community culture, coculture, transwell plates with membranes, microma-
nipulator, optical tweezers, laser microdissection, high-throughput microbioreactor,
simulated natural environments using diffusion chambers, single-cell encapsulation
combined with flow cytometry, multiwell microbial culture chip (or iChip), and en-
trapped gelating agent coated with polymer (30). However, these methods exhibit low
isolation efficiency of uncultured bacteria or lack strategies for subsequent pure culture.
The new method developed in this study showed high isolation efficiency (49%), a

December 2018 Volume 84 Issue 24 e01145-18 aem.asm.org 9

Nguyen et al. Applied and Environmental Microbiology

100% recovery rate of isolated uncultured soil bacteria, and easier application in
laboratories than most previously developed methods.
Although Acidobacteria were the second most abundant phylum in pyrosequencing
analysis for three soil samples, only one isolate was obtained by our new method, since
the medium (ISEM) is not acidic (pH 6.8), while Acidobacteria subgroups 1, 2, 3, 12, 13,
and 15 exhibit the most abundance at a soil pH of ⬍6.5 (38–40). In the future, using
ISEM with low pH or low/high temperature may lead to the successful isolation of more
uncultured or novel Acidobacteria or other bacteria.
In summary, our new method showed a much higher isolation rate of new taxon
candidates among uncultured isolates and greater isolation rate of uncultured soil
bacteria and new taxon candidates than for traditional and modified methods tested in
this study. Additionally, isolation was simpler, did not require enrichment culture, and
could be directly subcultured to obtain more uncultured bacterial pure cultures for
further experiments. Further, the variety of uncultured soil bacteria or new taxon
candidates can be extended with ISEM by altering the cultivation conditions such as
incubation temperature, pH, salt concentration, and anaerobic conditions or by using
various soil samples and other samples.

MATERIALS AND METHODS

Soil sample used for making soil extracts. Rhizosphere soil where Robinia pseudoacacia L.
dominated was collected at Kyonggi University (154-42 Gwanggyosan-ro, Iui-dong, Yeongtong-gu,
Suwon, Gyeonggi-do, South Korea; 37°30=04== N, 127°03=58== E) during June 2016. Fresh soil was dried
at room temperature for 48 h by spreading soil samples on surface of aluminum foil and using an air
conditioner in dry mode (25 to ⬃30°C), and then any plant debris, gravel, and rocks were removed by
a 0.2-mm sieve. To determine physicochemical properties of soil, the soil was dried at 110°C for 24 h and
cooled at room temperature. Soil contained approximately 78% sand, 17% silt, and 5% clay. Its pH (5.7)
was measured directly from fresh soil.
Preparing NSE in 1 liter of medium. Approximately 1,000 g of the dry soil, sieved at room
temperature, was divided into two equal parts (500 g each) in a 2-liter flask and then mixed with 1.3 liters
of 80% methanol (494291; methanol [high-performance liquid chromatography grade of purity, ⱖ99.9%];
Sigma-Aldrich, St. Louis, MO, USA) in deionized water and shaken at 150 rpm overnight at room
temperature (below 25°C). After settling for 30 min, the supernatant was transferred to a new flask, and
then 1.3 liters of 80% methanol was added to the soil and mixed well for 1 h. The two supernatants were
combined and filtered through Whatman paper (number 1001-150; ␾, 150 mm; GE Healthcare, Little
Chalfont, UK). Methanol was removed by a general rotary evaporator (⬃40°C). The NSE was adjusted to
a final volume of 200 ml with deionized water, sterilized through a 0.22-␮m nitrocellulose filter
(GSWP04700; Merck Millipore Ltd., Billerica, MA, USA) using a vacuum pump, stored in a dark Schott

Downloaded from https://journals.asm.org/journal/aem on 30 July 2024 by 45.64.236.237.

Duran bottle at 4°C, and used within 1 week.
Medium for isolation of soil bacteria. The medium containing 0.23 g KH2PO4, 0.23 g K2HPO4, 0.23 g
MgSO4·7H2O, 0.33 g NH4NO3, and 0.25 g NaHCO3 as a group of mineral salts and 15 g agar in 1 liter of
water was sterilized at 121°C for 15 min. Fifteen grams of agar (A7049; Sigma-Aldrich) was treated several
times with distilled water to discard any trace nutrients or elements before use (making purified agar).
The following elements then were added to the medium: 5-mg quantities of various D-amino acids
(D-valine, D-methionine, D-leucine, D-phenylalanine, D-threonine, and D-tryptophan), 1 ml vitamin B
(vitamin stock solution containing 50 mg each thiamine hydrochloride, riboflavin, niacin, pyridoxine HCl,
inositol, calcium pantothenate, and ␤-aminobenzoic acid and 25 mg biotin in 100 ml distilled water,
sterilized through a 0.2-␮m syringe filter, stored at 4°C in a dark Schott Duran bottle, and used within 1
month), 0.2 liters of NSE, 2 ml of selenite-tungstate solution (41) (composition in 1 liter of distilled water:
0.5 g NaOH, 3 mg Na2SeO3·5H2O, 4 mg Na2WO4·2H2O; the solution was filter sterilized, stored at 4°C, and
used within 1 month), and 2 ml of trace element SL-10 (42) (ingredients included 10 ml of HCl [25%,
vol/vol], 1.5 g of FeCl2·4H2O, 70 mg of ZnCl2, 100 mg of MnCl2·4H2O, 6 mg of H3BO3, 190 mg of
CoCl2·6H2O, 2 mg of CuCl2·2H2O, 24 mg of NiCl2·6H2O, and 36 mg of Na2MoO4·2H2O in a final volume of
1 liter). This solution then was passed through a 0.2-␮m filter and added directly in the medium after
autoclaving). The final volume was 1 liter, and the pH was 6.8 ⫾ 0.2. The complex medium was named
intensive soil extract medium (ISEM). The medium should be prepared freshly and used within 1 week.
In this study, we used 150- by 20-mm petri dishes (SPL Life Science Co., Ltd., Gyeonggi-do, South Korea).
The larger dish allows for increased separation of colonies at high dilution concentrations during
isolation.
Preparation of various media to recover previously uncultured soil bacterial isolates. We used
multiple combinations to find the best growth medium, as described above, to identify the most
important elements for supporting the growth of previously uncultured soil bacteria. Several examina-
tions were carried out based on the strains obtained in this study, namely, (i) basic salts (BS) only as a
negative control, (ii) BS with selenite-tungstate solution and SL-10, (iii) BS plus D-amino acids, (iv) BS with
vitamin B, (v) BS with NSE, (vi) NSE only, and a (vii) mixture of all components (ISEM) as a positive control,
and then 15 g purified agar was added to each medium. Agar plates were incubated at 25°C for 4 weeks

December 2018 Volume 84 Issue 24 e01145-18 aem.asm.org 10

Cultivation of Uncultured Soil Bacteria Applied and Environmental Microbiology

under aerobic conditions. To prevent the plates from drying out, two cups of distilled water was placed
in the incubator.
Soil sampling sites and preparation of soil samples. Three soil samples were acquired in South
Korea in June 2016, including Ansan (sample A) (Il-dong, Sangnok-gu, Ansan, Gyeonggi-do;
37°17=58==N, 126°53=57== E), Suwon (sample B) (Buksu-dong, Paldal-gu, Suwon, Gyeonggi-do;
37°16=42== N, 127°00=17== E), and Seoul (sample S) (Itaewon-ro, Yongsan-gu, Seoul; 37°31=06== N,
127°01=04== E). For each sample, approximately 10 g soil from ten different locations within a 150-m
diameter was collected and mixed well. The sample was passed through a 0.1-mm sieve and
isolated/enriched directly using three methods. A 25-g sieved soil sample was mixed with 250 ml
sterile saline (0.9%, wt/vol, NaCl), stirred for 15 min, and allowed to separate between suspension
and sediment before use.
Newly developed method for isolation of previously uncultured soil bacteria. For the newly
developed method, first 100 ␮l of each dilution of soil suspension was spread onto three agar plates of
ISEM (to ensure uniformly distributed suspension on the surface of the medium, 100 ␮l of each the
dilution plus 100 ␮l of ISEM liquid is recommended). These agar plates were incubated at 25°C for
6 weeks. A few colonies appeared after 1 week of incubation. The number of directly observable colonies
was increased after 2 weeks, and tiny colonies were picked up and streaked onto fresh ISEM until
morphologically pure colonies were obtained. Cells on fresh ISEM typically require at least 1 week of
incubation. Uncultured bacteria generally showed weak growth; thus, in some cases pure colonies were
activated in ISEM broth in a shaking incubator at 25°C, 150 rpm, for 1 to 2 weeks before being transferred
onto the agar plate.
Traditional soil extract culture medium. Approximately 1,000 g air-dried soil in 1.3 liters of
deionized water was autoclaved at 121°C for 1 h and allowed to cool. The supernatant was filtered
through Whatman paper before centrifugation in a 500-ml bottle at 5,009 ⫻ g for 30 min at room
temperature. One liter of the supernatant (TSE) was obtained. Soil extract agar was enhanced by
supplementation (17) with 0.04% K2HPO4, 0.005% MgSO4·7H2O, 0.01% NaCl, 0.001% FeCl3, 0.05%
tryptone, 0.05% yeast extract, and 1.5% agar in 1 liter of soil extract liquid with a final pH of 6.8, and then
100 ␮l of each dilution of three soil samples was dispersed onto three soil extract agar plates and
cultivated at 25°C for 6 weeks. Colonies were restreaked until pure colonies were obtained.
Modified transwell culture method. A transwell plate system (35006; SPLInsert hanging; SPL Life
Sciences) was used to enrich the bacterial community, especially for uncultured soil bacteria from soil
samples, and contains 6 inserts with 6 wells in a plate. An insert has two different sized frames (upper,
28-mm outer diameter and 26.65-mm inner diameter; lower, 26.6-mm outer diameter and 23.3-mm inner
diameter), with 28-mm height and 4.52-cm2 area of growth for each insert. The lower frame is covered
with a 0.4-␮m polycarbonate membrane. Its membrane specification is 25-mm diameter and 7- to
⬃10-␮m thickness. Approximately 3 g of soil sample was added to a transwell plate, 3 ml R2A medium
(3.15 g of the powder in 1 liter of distilled water; MB-R2230; MB Cell, Los Angeles, CA, USA) was
supplemented into the soil-containing wells, and then we put the insert on the wet soil. One hundred
␮l of the suspension and 1 ml R2A medium next was inoculated into the insert. The transwell culture
system was covered with Parafilm to prevent evaporation. The system was shaken at 120 rpm and
25°C for 4 weeks. Sevenfold dilutions of the culture enriched were established in R2A broth medium;
100 ␮l of each dilution was spread onto three R2A agar plates and incubated at 25°C for 6 weeks.

Downloaded from https://journals.asm.org/journal/aem on 30 July 2024 by 45.64.236.237.

Colonies were subcultured on R2A medium to obtain individual colonies (see Table S5 in the
supplemental material).
Identification of 16S rRNA gene sequences and accession numbers of 16S rRNA gene se-
quences. Near-full-length 16S rRNA sequences were identified, and similarity to valid species was
calculated using the EzTaxon Database Update (https://www.ezbiocloud.net) for comparison with pub-
lished uncultured gene sequences via the nucleotide BLAST search at NCBI (https://www.ncbi.nlm.nih
.gov/). In this study, based on full 16S rRNA similarity to validly published species, with four temporary
divisions, candidates of novel species were defined by comparison of 16S rRNA similarity at a threshold
of 98.7% (43), 95.3 to 90.0% novel genus level (44), and novel family level at an off-limit lower than 90.0%.
All sequence data of the isolates were submitted to the GenBank database.
DNA extraction from soil. Using a FastDNA SPIN kit for soil (116560-200; MP Biomedicals), soil
DNA from 0.5 g of fresh soil was extracted and purified by following the manufacturer’s instructions.
DNA quality was checked by 1.2% agarose gel electrophoresis in 0.5⫻ Tris-acetate-EDTA (TAE)
buffer, and DNA concentration was determined via MaestroNano spectrophotometer (Mastrogen).
DNA samples then were held at ⫺20°C until use.
PCR amplification and pyrosequencing. Pure isolated DNA soil samples were subjected to ampli-
fication of the target V1 to V3 regions located in the 16S rRNA gene by PCR using the barcoding primers
27F 5=-CCTATCCCCTGTGTGCCTTGGCAGTCTCAGACGAGTTTGATCMTGGCTCAG-3= and 518R 5=-CCATCTCA
TCCCTGCGTGTCTCCGACTCAGXACWTTACCGCGGCTGCTGG-3= (X directs the unique barcode for each
subject) (https://www.ezbiocloud.net). The reaction was conducted with initial denaturation at 95°C for
5 min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension
at 72°C for 30 s, and then final elongation at 72°C for 5 min. The amplicons next were evaluated by 2%
agarose gel electrophoresis and observed with a Gel Doc system (Bio-Rad, Hercules, CA, USA). A QIAquick
PCR purification kit (28106; Qiagen, Hilden, Germany) was used to purify the PCR products. An AMPure
beads kit (Agencourt Bioscience, Beverly, MA, USA) was used to enhance the quality of the sample and
remove nontarget products by following the manufacturer’s instructions. Quality and target size were
estimated with a Bioanalyzer 2100 (Agilent, Santa Clara, CA, USA) using a DNA 7500 chip. PCR products

December 2018 Volume 84 Issue 24 e01145-18 aem.asm.org 11

Nguyen et al. Applied and Environmental Microbiology

next were mixed by emulsion PCR and deposited on picotiter plates. Target sequencing was conducted
with a GS Junior sequencing system (Roche, Basel, Switzerland) according to the manufacturer’s
instructions.
Analysis of pyrosequencing data. Pyrosequencing results were analyzed as follows. Unique bar-
codes for each amplicon as a standard were sorted from distinctive samples, and readings were obtained.
Removal of either of these nontarget sequences, including the barcode, linker, and primers, or more than
two ambiguous nucleotides, resulted in low-quality score of less than 25 through Trimmomatic, version
0.321 (45), and reads shorter than 300 bp from the original sequencing reads. Additionally, the Bellero-
phon method was used to discard chimeric sequences, and then a full sequence was compared both in
the forward and reverse directions via BLASTN (46). The similarity of each full sequence to valid published
type strains was determined using the EzTaxon-e database (http://eztaxon-e.ezbiocloud.net) or an
uncultured bacterium clone in the GenBank database (https://blast.ncbi.nlm.nih.gov). Chao1 estimation
at a 3% distance (47) and Shannon diversity index (48) were used to confirm the levels of richness and
diversity of each sample. Phylogenetic analysis of microbial communities was estimated via Fast UniFrac
(49) combined with principle coordinate analysis. Finally, XOR analysis in the CLcommunity program
(Chunlab Inc., Seoul, South Korea) was used to compare the number of operational taxonomic units
among samples.
Determining and comparison of soil extract ingredients. To determine the impacts of different
ingredients, the rhizosphere soil (Robinia pseudoacacia L.) at Kyonggi University was collected and
prepared via three methods. The first was NSE. The second was TSE1, where sample was autoclaved at
121°C for an hour and allowed to cool and settle, and then the supernatant was passed through a
0.22-␮m-filter nitrocellulose membrane using a vacuum pump, followed by a rotary evaporator bath at
40°C to reduce water to 200 ml. The third method was TSE2, which is similar to TSE1 except sterilization
(at 121°C) was replaced with shaking overnight at room temperature to compare variations in soil
components at high temperature. Three samples obtained from the supernatant after soil extraction
methods were lyophilized at ⫺54°C to produce 6.36 g powder (NSE), 4.65 g for TSE1, and 4.73 g for TSE2.
These powders were stored at 4°C until analysis. For inorganic composition and carbohydrates, soils were
prepared and analyzed directly from a final volume of 1 liter of deionized water without adding any
substrates. Experiments were repeated three times to ensure accuracy, and chemical data were prepared
and analyzed individually in triplicate.
Sample preparation for simultaneous profiling analysis of amino acids, organic acids, and fatty
acids in soil extract. Amino acids, organic acids, and fatty acids were simultaneously profiled in soil
samples as their ethoxycarbonylation (EOC), methoximation (MO), and tert-butyldimethylsilyl (TBDMS)
derivatives as described previously (50, 51). Briefly, 2.5 mg soil extract was dissolved in distilled water
containing 0.1 ␮g of norvaline, 3,4-dimethoxybenzoic acid, and pentadecanoic acid as internal standards.
The solution pH was adjusted to ⱖ12 with 5.0 M sodium hydroxide and mixed with dichloromethane
(2.0 ml) containing 40 ␮l ethyl chloroformate, which was converted to the EOC derivative. This was
converted to the MO derivative via a reaction with methoxyamine hydrochloride at 60°C for 60 min. The
aqueous phase as sequential EOC/MO derivatives was acidified (pH ⱕ2.0 with 10% sulfuric acid),
saturated with sodium chloride, and extracted with diethyl ether (3 ml two times). The extracts were
evaporated to dryness using a gentle nitrogen stream. Dry residues containing amino acids, organic

Downloaded from https://journals.asm.org/journal/aem on 30 July 2024 by 45.64.236.237.

acids, and fatty acids were reacted at 60°C for 30 min with trimethylamine (5 ␮l), toluene (15 ␮l), and
N-methyl-N-(tert-butyldimethylsilyl)trifluoroacetamide (20 ␮l) to form the TBDMS derivative. All samples
were prepared individually in triplicate and examined directly by gas chromatography-mass spectrom-
etry (GC-MS) in selected ion monitoring (SIM) mode.
Inorganic ingredients. The cations Li⫹, Na⫹, Mg2⫹, K⫹, Ca2⫹, and NH4⫹ were detected using a
Dionex ICS3000 (Sunnyvale, CA, USA) with an IonPac CS12A column (4 by 250 mm; Dionex) and detector
(suppressed conductivity, CSRS URTRA [4 mm], recycle mode). The oven temperature was 30°C, injection
volume was 25 ␮l, samples were eluted with 20 mM methanesulfonic acid at a flow rate 1 ml/min, and
run time was 20 min according to the IonPac CS12A manual (Thermo Fisher Scientific). A Dionex ICS3000
was also used to detect the anions F⫺, Cl⫺, Br⫺, NO2⫺, NO3⫺, SO42⫺, and PO42⫺ with standards, and the
column was an IonPac AS20 (4 by 250 mm; Dionex); the detector was a suppressed-conductivity ASRS
URTRA II (4 mm) in recycle mode. Gradient elution was conducted for 0 to 8 min (12 mM KOH), 8 to
12 min (30 mM KOH), 12 to 17 min (30 mM KOH), 17 to 18 min (12 mM KOH), and 18 to 20 min (12 mM
KOH) at a flow rate 1 ml/min. The oven temperature was 30°C, and injection volume was 25 ␮l. All
processes were conducted as described in the IonPac AS20 anion-exchange column product manual
(Thermo Fisher Scientific).
Accession number(s). Newly determined sequence data have been deposited in GenBank under
accession numbers KY117487 to KY117530, KY121981 to KY122022, KY176921 to KY176989, KY381872 to
KY381896, KY445600 to KY445722, MH688754 to MH688835, MH698624 to MH698830, and MH699124
to MH699292.

SUPPLEMENTAL MATERIAL
Supplemental material for this article may be found at https://doi.org/10.1128/AEM
.01145-18.
SUPPLEMENTAL FILE 1, PDF file, 0.5 MB.

December 2018 Volume 84 Issue 24 e01145-18 aem.asm.org 12

Cultivation of Uncultured Soil Bacteria Applied and Environmental Microbiology

ACKNOWLEDGMENTS
This research was supported by the Basic Science Research Program through the
National Research Foundation of Korea (NRF) funded by the Ministry of Education
(2016R1D1A1A09916982).

REFERENCES
1. Ling LL, Schneider T, Peoples AJ, Spoering AL, Engels I, Conlon BP, agar medium. J Biosci Bioeng 99:485– 492. https://doi.org/10.1263/jbb
Mueller A, Schäberle TF, Hughes DE, Epstein S, Jones M, Lazarides L, .99.485.
Steadman VA, Cohen DR, Felix CR, Fetterman KA, Millett WP, Nitti AG, 19. Vilain S, Luo Y, Hildreth MB, Brozel VS. 2006. Analysis of the life cycle of
Zullo AM, Chen C, Lewis K. 2015. A new antibiotic kills pathogens the soil saprophyte Bacillus cereus in liquid soil extract and in soil. Appl
without detectable resistance. Nature 517:455– 459. https://doi.org/10 Environ Microbiol 72:4970–4977. https://doi.org/10.1128/AEM.03076-05.
.1038/nature14098. 20. Janssen PH, Yates PS, Grinton BE, Taylor PM, Sait M. 2002. Improved
2. Lewis K, Epstein S, D’Onofrio A, Ling LL. 2010. Uncultured microorgan- culturability of soil bacteria and isolation in pure culture of novel
isms as a source of secondary metabolites. J Antibiot 63:468 – 476. members of the divisions Acidobacteria, Actinobacteria, Proteobacteria,
https://doi.org/10.1038/ja.2010.87. and Verrucomicrobia. Appl Environ Microbiol 68:2391–2396. https://doi
3. Doroghazi JR, Albright JC, Goering AW, Ju KS, Haines RR, Tchalukov KA, .org/10.1128/AEM.68.5.2391-2396.2002.
Labeda DP, Kelleher NL, Metcalf WW. 2014. A roadmap for natural 21. Schoenborn L, Yates PS, Grinton BE, Hugenholtz P, Janssen PH. 2004.
product discovery based on large-scale genomics and metabolomics. Liquid serial dilution is inferior to solid media for isolation of cultures
Nat Chem Biol 10:963–968. https://doi.org/10.1038/nchembio.1659. representative of the phylum-level diversity of soil bacteria. Appl Environ
4. Milshteyn A, Schneider JS, Brady SF. 2014. Mining the metabiome: Microbiol 70:4363–4366. https://doi.org/10.1128/AEM.70.7.4363-4366
identifying novel natural products from microbial communities. Chem .2004.
Biol 21:1211–1223. https://doi.org/10.1016/j.chembiol.2014.08.006. 22. Janssen PH. 2008. Accessing uncultured microorganisms: from the
5. Gawad C, Koh W, Quake SR. 2016. Single-cell genome sequencing: environment to organisms and genomes and back. ASM Press, Wash-
current state of the science. Nat Rev Genet 17:175–188. https://doi.org/ ington, DC.
10.1038/nrg.2015.16. 23. Nichols D, Cahoon N, Trakhtenberg EM, Pham L, Mehta A, Belanger A,
6. Heath JR, Ribas A, Mischel PS. 2016. Single-cell analysis tools for drug Kanigan T, Lewis K, Epstein SS. 2010. Use of iChip for high-throughput in
discovery and development. Nat Rev Drug Discov 15:204 –216. https:// situ cultivation of “uncultivable” microbial species. Appl Environ Micro-
doi.org/10.1038/nrd.2015.16. biol 76:2445–2450. https://doi.org/10.1128/AEM.01754-09.
7. Vartoukian SR, Palmer RM, Wade WG. 2010. Strategies for culture of 24. Amanullah A, Otero JM, Mikola M, Hsu A, Zhang J, Aunins J, Schreyer HB,
“unculturable” bacteria. FEMS Microbiol Lett 309:1–7. https://doi.org/10 Hope JA, Russo AP. 2010. Novel micro-bioreactor high throughput tech-
.1111/j.1574-6968.2010.02000.x. nology for cell culture process development: reproducibility and scal-
8. Stewart EJ. 2012. Growing unculturable bacteria. J Bacteriol 194: ability assessment of fed-batch CHO cultures. Biotechnol Bioeng 106:
57– 67. https://doi.org/10.1002/bit.22664.
4151– 4160. https://doi.org/10.1128/JB.00345-12.
25. Zhang H, Liu KK. 2008. Optical tweezers for single cells. J R Soc Interface
9. Ward DM, Weller R, Bateson MM. 1990. 16S rRNA sequences reveal
5:671– 690. https://doi.org/10.1098/rsif.2008.0052.
numerous uncultured microorganisms in a natural community. Nature
26. Fröhlich J, König H. 2000. New techniques for isolation of single pro-
345:63– 65. https://doi.org/10.1038/345063a0.
karyotic cells. FEMS Microbiol Rev 24:567–572. https://doi.org/10.1111/j
10. Stott MB, Crowe MA, Mountain BW, Smirnova AV, Hou S, Alam M,
.1574-6976.2000.tb00558.x.
Dunfield PF. 2008. Isolation of novel bacteria, including a candidate
27. Kaeberlein T, Lewis K, Epstein SS. 2002. Isolating “uncultivable” micro-
division, from geothermal soils in New Zealand. Environ Microbiol 10:
organisms in pure culture in a simulated natural environment. Science
2030 –2041. https://doi.org/10.1111/j.1462-2920.2008.01621.x.
296:1127–1129. https://doi.org/10.1126/science.1070633.

Downloaded from https://journals.asm.org/journal/aem on 30 July 2024 by 45.64.236.237.

11. Hobbie JE, Hobbie EA. 2013. Microbes in nature are limited by carbon
28. Bollmann A, Lewis K, Epstein SS. 2007. Incubation of environmental
and energy: the starving-survival lifestyle in soil and consequences for
samples in a diffusion chamber increases the diversity of recovered
estimating microbial rates. Front Microbiol 4:1–11. https://doi.org/10
isolates. Appl Environ Microbiol 73:6386 – 6390. https://doi.org/10.1128/
.3389/fmicb.2013.00324. AEM.01309-07.
12. Pierra M, Carmona-Martínez AA, Trably E, Godon JJ, Bernet N. 2015. 29. Ferrari BC, Binnerup SJ, Gillings M. 2005. Microcolony cultivation on a
Microbial characterization of anode-respiring bacteria within biofilms soil substrate membrane system selects for previously uncultured soil
developed from cultures previously enriched in dissimilatory metal- bacteria. Appl Environ Microbiol 71:8714 – 8720. https://doi.org/10.1128/
reducing bacteria. Bioresour Technol 195:283–287. https://doi.org/10 AEM.71.12.8714-8720.2005.
.1016/j.biortech.2015.07.010. 30. Pham VHT, Kim J. 2012. Cultivation of unculturable soil bacteria. Trends
13. Davis KER, Joseph SJ, Peter H, Janssen PH. 2005. Effects of growth Biotechnol 30:475– 484. https://doi.org/10.1016/j.tibtech.2012.05.007.
medium, inoculum size, and incubation time on culturability and isola- 31. Liebeke M, Brözel VS, Hecker M, Lalk M. 2009. Chemical characterization
tion of soil bacteria. Appl Environ Microbiol 71:826 – 834. https://doi.org/ of soil extract as growth media for the ecophysiological study of bac-
10.1128/AEM.71.2.826-834.2005. teria. Appl Microbiol Biotechnol 83:161–173. https://doi.org/10.1007/
14. Burmølle M, Johnsen K, Al-Soud WA, Hansen LH, Sørensen SJ. 2009. The s00253-009-1965-0.
presence of embedded bacterial pure cultures in agar plates stimulate 32. Harris DC. 2010. Quantitative chemical analysis, 8th edition. WH Freeman
the culturability of soil bacteria. J Microbiol Methods 79:166 –173. and Company, New York, NY.
https://doi.org/10.1016/j.mimet.2009.08.006. 33. Friedel JK, Scheller E. 2002. Composition of hydrolysable amino acids in
15. D’Onofrio A, Crawford JM, Stewart EJ, Witt K, Gavrish E, Epstein S, Clardy soil organic matter and soil microbial biomass. Soil Biol Biochem 34:
J, Lewis K. 2010. Siderophores from neighboring organisms promote the 315–325. https://doi.org/10.1016/S0038-0717(01)00185-7.
growth of uncultured bacteria. Chem Biol 17:254 –264. https://doi.org/ 34. Stenger VA. 1996. Solubilities of various alkali metal and alkaline earth
10.1016/j.chembiol.2010.02.010. metal compounds in methanol. J Chem Eng Data 41:1111–1113. https://
16. Taylor CB. 1951. Nature of the factor in soil-extract responsible for doi.org/10.1021/je960124k.
bacterial growth-stimulation. Nature 168:115–116. https://doi.org/10 35. Reasoner DJ, Geldreich EE. 1985. A new medium for the enumeration
.1038/168115a0. and subculture of bacteria from potable water. Appl Environ Microbiol
17. Taylor CB. 1951. The nutritional requirements of the predominant bac- 49:1–7.
terial flora of the soil. J Appl Microbiol 14:101–111. https://doi.org/10 36. Kakumanu ML, Williams MA. 2012. Soil diffusion system enriches the
.1111/j.1365-2672.1951.tb01999.x. growth of diverse and previously uncultivated bacterial taxa. Soil Sci Soc
18. Hamaki T, Suzuki M, Fudou R, Jojima Y, Kajiura T, Tabuchi A, Sen K, Shibai Am J 76:463– 474. https://doi.org/10.2136/sssaj2011.0227.
H. 2005. Isolation of novel bacteria and actinomycetes using soil-extract 37. Joseph SJ, Hugenholtz P, Sangwan P, Osborne CA, Janssen PH. 2003.

December 2018 Volume 84 Issue 24 e01145-18 aem.asm.org 13

Nguyen et al. Applied and Environmental Microbiology

Laboratory cultivation of widespread and previously uncultured soil 16S rRNA-based phylogenetic tree of all sequenced type strains. Syst
bacteria. Appl Environ Microbiol 69:7210 –7215. https://doi.org/10.1128/ Appl Microbiol 31:241–250. https://doi.org/10.1016/j.syapm.2008.07
AEM.69.12.7210-7215.2003. .001.
38. Sait M, Davis KE, Janssen PH. 2006. Effect of pH on isolation and 45. Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: a flexible trimmer for
distribution of members of subdivision 1 of the phylum Acidobacteria Illumina sequence data. Bioinformatics 30:2114 –2120. https://doi.org/10
occurring in soil. Appl Environ Microbiol 72:1852–1857. https://doi.org/ .1093/bioinformatics/btu170.
10.1128/AEM.72.3.1852-1857.2006. 46. Huber T, Faulkner G, Hugenholtz P. 2004. Bellerophon: a program to
39. Jones RT, Robeson MS, Lauber CL, Hamady M, Knight R, Fierer NA. 2009. detect chimeric sequences in multiple sequence alignments. Bioinfor-
Comprehensive survey of soil acidobacterial diversity using pyrose- matics 20:2317–2319. https://doi.org/10.1093/bioinformatics/bth226.
quencing and clone library analyses. ISME J 3:442– 453. https://doi.org/ 47. Chao A. 1984. Non-parametric estimation of the number of classes in a
10.1038/ismej.2008.127. population. Scand J Stat 11:265–270.
40. Kielak AM, Barreto CC, Kowalchuk GA, van Veen JA, Kuramae EE. 2016.
48. Ludwig JA, Reynolds JF. 1988. Statistical ecology: a primer on methods
The ecology of Acidobacteria: moving beyond genes and genomes.
and computing. Wiley, New York, NY.
Front Microbiol 7:744. https://doi.org/10.3389/fmicb.2016.00744.
49. Hamady M, Lozupone C, Knight R. 2010. Fast UniFrac: facilitating high-
41. Tschech A, Pfennig N. 1984. Growth yield increase linked to caffeate
throughput phylogenetic analyses of microbial communities including
reduction in Acetobacterium woodii. Arch Microbiol 137:163–167. https://
doi.org/10.1007/BF00414460. analysis of pyrosequencing and PhyloChip data. ISME J 4:17–27. https://
42. Widdel F, Kohring GW, Mayer F. 1983. Studies on dissimilatory sulfate- doi.org/10.1038/ismej.2009.97.
reducing bacteria that decompose fatty acids. Arch Microbiol 134: 50. Paik MJ, Kim KR. 2004. Sequential ethoxycarbonylation, methoximation and
286 –294. https://doi.org/10.1007/BF00407804. tert-butyldimethylsilylation for simultaneous determination of amino acids
43. Browne HP, Forster SC, Anonye BO, Kumar N, Neville BA, Stares MD, and carboxylic acids by dual-column gas chromatography. J Chromatogr A
Goulding D, Lawley TD. 2016. Culturing of “unculturable” human micro- 1034:13–23. https://doi.org/10.1016/j.chroma.2004.02.032.
biota reveals novel taxa and extensive sporulation. Nature 533:543–546. 51. Paik MJ, Lee HJ, Kim KR. 2005. Simultaneous retention index analysis of
https://doi.org/10.1038/nature17645. urinary amino acids and carboxylic acids for graphic recognition of
44. Yarza P, Richter M, Peplies J, Euzeby J, Amann R, Schleifer KH, Ludwig W, abnormal state. J Chromatogr B Anal Technol Biomed Life Sci 821:
Glöckner FO, Rosselló-Móra R. 2008. The all-species living tree project: a 94 –104. https://doi.org/10.1016/j.jchromb.2005.04.011.

Downloaded from https://journals.asm.org/journal/aem on 30 July 2024 by 45.64.236.237.

December 2018 Volume 84 Issue 24 e01145-18 aem.asm.org 14