Download the full version of the ebook at

https://ebookfinal.com

Gene Essentiality Methods and Protocols 1st

Edition Long Jason Lu (Eds.)

https://ebookfinal.com/download/gene-essentiality-
methods-and-protocols-1st-edition-long-jason-lu-
eds/

Explore and download more ebook at https://ebookfinal.com

 Recommended digital products (PDF, EPUB, MOBI) that
you can download immediately if you are interested.

Microbial Gene Essentiality 1st Edition. Edition Andrei L.

Osterman

https://ebookfinal.com/download/microbial-gene-essentiality-1st-
edition-edition-andrei-l-osterman/

ebookfinal.com

Gene Expression Profiling Methods and Protocols 1st

Edition Richard A. Shimkets (Auth.)

https://ebookfinal.com/download/gene-expression-profiling-methods-and-
protocols-1st-edition-richard-a-shimkets-auth/

ebookfinal.com

Prenatal Gene Therapy Concepts Methods and Protocols 1st

Edition Charles Coutelle Md

https://ebookfinal.com/download/prenatal-gene-therapy-concepts-
methods-and-protocols-1st-edition-charles-coutelle-md/

ebookfinal.com

Gene Expression Profiling Methods and Protocols 2nd

Edition Olga L. Gurvich

https://ebookfinal.com/download/gene-expression-profiling-methods-and-
protocols-2nd-edition-olga-l-gurvich/

ebookfinal.com
Gene Mapping Discovery and Expression Methods and
Protocols 1st Edition Minou Bina (Auth.)

https://ebookfinal.com/download/gene-mapping-discovery-and-expression-
methods-and-protocols-1st-edition-minou-bina-auth/

ebookfinal.com

Heterologous Gene Expression in E coli Methods and

Protocols 1st Edition Evelina Angov

https://ebookfinal.com/download/heterologous-gene-expression-in-e-
coli-methods-and-protocols-1st-edition-evelina-angov/

ebookfinal.com

Serial Analysis of Gene Expression SAGE Methods and

Protocols 1st Edition Annabeth Laursen Høgh

https://ebookfinal.com/download/serial-analysis-of-gene-expression-
sage-methods-and-protocols-1st-edition-annabeth-laursen-hogh/

ebookfinal.com

Heterologous Gene Expression in E coli Methods and

Protocols 1st Edition Nicola A. Burgess-Brown (Eds.)

https://ebookfinal.com/download/heterologous-gene-expression-in-e-
coli-methods-and-protocols-1st-edition-nicola-a-burgess-brown-eds/

ebookfinal.com

Gene Knockout Protocols 1st Edition Martin J. Tymms

https://ebookfinal.com/download/gene-knockout-protocols-1st-edition-
martin-j-tymms/

ebookfinal.com
Gene Essentiality Methods and Protocols 1st Edition
Long Jason Lu (Eds.) Digital Instant Download
Author(s): Long Jason Lu (eds.)
ISBN(s): 9781493923977, 1493923978
Edition: 1
File Details: PDF, 6.18 MB
Year: 2015
Language: english
Methods in
Molecular Biology 1279

Long Jason Lu Editor

Gene
Essentiality
Methods and Protocols
METHODS IN M O L E C U L A R B I O LO G Y

Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK

For further volumes:

http://www.springer.com/series/7651
 Gene Essentiality

Methods and Protocols

Edited by

Long Jason Lu
Cincinnati Children’s Hospital Medical Center, Cincinnati, OH, USA
Editor
Long Jason Lu
Cincinnati Children’s Hospital Medical Center
Cincinnati, OH, USA

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-4939-2397-7 ISBN 978-1-4939-2398-4 (eBook)
DOI 10.1007/978-1-4939-2398-4

Library of Congress Control Number: 2014959295

Springer New York Heidelberg Dordrecht London

© Springer Science+Business Media New York 2015
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not
imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and
regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
express or implied, with respect to the material contained herein or for any errors or omissions that may have been made.

Printed on acid-free paper

Humana Press is a brand of Springer

Springer Science+Business Media LLC New York is part of Springer Science+Business Media (www.springer.com)
Preface

This book is an update of the previously published book Microbial Essential Genes in this
series. In the first eight chapters, we cover two main types of approaches that have been
widely used to determine essential genes: single-gene knockouts and transposon mutagen-
esis, in both prokaryotes and Candida albicans. Since the last edition was published, we
have seen significant advancement in the computational predictions of microbial essential
genes. In the next seven chapters, we cover four main types of approaches: comparative
genomics, supervised machine learning, constraint-based methods, and corrections of
transposon mutagenesis data. We also present databases and servers that are often used in
studying gene essentiality.
Finally, I would like to thank all the authors for the contributions. I would also like to
thank Dr. John Walker. Without his encouragement and guidance, I would not have been
able to complete this book.

Cincinnati, OH, USA Long Jason Lu

v
Contents

Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix

1 Microarray Transposon Tracking for the Mapping of Conditionally

Essential Genes in Campylobacter jejuni . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
Martin Stahl and Alain Stintzi
2 Identifying Essential Streptococcus sanguinis Genes Using Genome-Wide
Deletion Mutation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
Lei Chen, Xiuchun Ge, and Ping Xu
3 Defining Essential Genes and Identifying Virulence Factors
of Porphyromonas gingivalis by Massively Parallel Sequencing
of Transposon Libraries (Tn-seq) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
Brian A. Klein, Margaret J. Duncan, and Linden T. Hu
4 Identification of Essential Genes and Synthetic Lethal Gene Combinations
in Escherichia coli K-12 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45
Hirotada Mori, Tomoya Baba, Katsushi Yokoyama, Rikiya Takeuchi,
Wataru Nomura, Kazuichi Makishi, Yuta Otsuka, Hitomi Dose,
and Barry L. Wanner
5 Identification of Genes Essential for Leptospirosis . . . . . . . . . . . . . . . . . . . . . . 67
Thanatchaporn Bartpho and Gerald L. Murray
6 Identifying Essential Genes in Mycobacterium tuberculosis
by Global Phenotypic Profiling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
Jarukit E. Long, Michael DeJesus, Doyle Ward, Richard E. Baker,
Thomas Ioerger, and Christopher M. Sassetti
7 Essential Genes in the Infection Model of Pseudomonas aeruginosa-PCR-Based
Signature-Tagged Mutagenesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97
Irena Kukavica-Ibrulj and Roger C. Levesque
8 Genome-Wide Synthetic Genetic Screening by Transposon Mutagenesis
in Candida albicans . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125
Brooke N. Horton and Anuj Kumar
9 An Integrated Machine-Learning Model to Predict Prokaryotic
Essential Genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137
Jingyuan Deng
10 A Statistical Framework for Improving Genomic Annotations
of Transposon Mutagenesis (TM) Assigned Essential Genes . . . . . . . . . . . . . . 153
Jingyuan Deng
11 A Proposed Essential Gene Discovery Pipeline:
A Campylobacter jejuni Case Study . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 167
Mark Reuter, Duncan J.H. Gaskin, and Aline Metris

vii
viii Contents

12 Computational Prediction of Essential Metabolic Genes

Using Constraint-Based Approaches . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 183
Georg Basler
13 Three Computational Tools for Predicting Bacterial Essential Genes . . . . . . . . 205
Feng-Biao Guo, Yuan-Nong Ye, Lu-Wen Ning, and Wen Wei
14 Gene Essentiality Analysis Based on DEG 10, an Updated Database
of Essential Genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 219
Feng Gao, Hao Luo, Chun-Ting Zhang, and Ren Zhang
15 Discovering Essential Domains in Essential Genes . . . . . . . . . . . . . . . . . . . . . . 235
Yulan Lu, Yao Lu, Jingyuan Deng, Hui Lu, and Long Jason Lu

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 247
Contributors

TOMOYA BABA • Transdiscplinary Research Integration Center, Shizuoka, Japan

RICHARD E. BAKER • Department of Microbiology and Physiological Systems, University
of Massachusetts Medical School, Worcester, MA, USA
THANATCHAPORN BARTPHO • Department of Microbiology, Monash University, Clayton,
VIC, Australia
GEORG BASLER • Department of Environmental Protection, Estación Experimental del
Zaidín, Consejo Superior de Investigaciones Científicas (CSIC), Granada, Spain
LEI CHEN • Philips Institute, Virginia Commonwealth University, Richmond, VA, USA
MICHAEL DEJESUS • Department of Computer Science, Texas A&M University, College
Station, TX, USA
JINGYUAN DENG • Division of Biomedical Informatics, Cincinnati Children’s Hospital
Medical Center, Cincinnati, OH, USA
HITOMI DOSE • Graduate School of Biological Sciences, Nara Institute of Science
and Technology, Nara, Japan
MARGARET J. DUNCAN • Department of Microbiology, The Forsyth Institute, Cambridge,
MA, USA
FENG GAO • Department of Physics, Tianjin University, Tianjin, China
DUNCAN J.H. GASKIN • Institute of Food Research, Norwich Research Park, Norwich, UK
XIUCHUN GE • Philips Institute, Virginia Commonwealth University, Richmond, VA, USA
FENG-BIAO GUO • Computational, Comparative, Evolutionary and Functional Genomics
Group (CEFG), School of Life Science and Technology, University of Electronic Science
and Technology of China, Chengdu, China
BROOKE N. HORTON • Department of Molecular, Cellular, and Developmental Biology,
University of Michigan, Ann Arbor, MI, USA
LINDEN T. HU • Graduate Program of Molecular Microbiology, Tufts University School
of Medicine, Boston, MA, USA; Department of Geographical Medicine and Infectious
Disease, Tufts Medical Center, Boston, MA, USA
THOMAS IOERGER • Department of Computer Science, Texas A&M University, College
Station, TX, USA
BRIAN A. KLEIN • Graduate Program of Molecular Microbiology, Tufts University School
of Medicine, Boston, MA, USA
IRENA KUKAVICA-IBRULJ • Institut de biologie intégrative et des systèmes (IBIS), Faculté de
Médecine, Université Laval, Québec, QC, Canada
ANUJ KUMAR • Department of Molecular, Cellular, and Developmental Biology, University
of Michigan, Ann Arbor, MI, USA
ROGER C. LEVESQUE • Institut de biologie intégrative et des systèmes (IBIS), Faculté de
Médecine, Université Laval, Québec, QC, Canada
JARUKIT E. LONG • Department of Microbiology and Physiological Systems, University
of Massachusetts Medical School, Worcester, MA, USA
HUI LU • Shanghai Institute of Medical Genetics, Children’s Hospital of Shanghai,
Shanghai Jiao Tong University, Shanghai, China; Department of Bioengineering,
University of Illinois at Chicago, Chicago, IL, USA

ix
x Contributors

LONG JASON LU • Division of Biomedical Informatics, Cincinnati Children’s Hospital

Medical Center, Cincinnati, OH, USA; Division of Biostatics and Epidemiology,
Cincinnati Children’s Hospital Medical Center, Cincinnati, OH, USA; Department of
Computer Science, University of Cincinnati, Cincinnati, OH, USA; Department of
Environmental Health, University of Cincinnati, Cincinnati, OH, USA
YAO LU • Shanghai Institute of Medical Genetics, Children’s Hospital of Shanghai,
Shanghai Jiao Tong University, Shanghai, China
YULAN LU • State Key Laboratory of Genetic Engineering, Institute of Biostatistics, School of
Life Science, Fudan University, Shanghai, China
HAO LUO • Department of Physics, Tianjin University, Tianjin, China
KAZUICHI MAKISHI • Graduate School of Biological Sciences, Nara Institute of Science
and Technology, Nara, Japan
ALINE METRIS • Institute of Food Research, Norwich Research Park, Norwich, UK
HIROTADA MORI • Graduate School of Biological Sciences, Nara Institute of Science
and Technology, Nara, Japan
GERALD L. MURRAY • Department of Microbiology, Monash University, Clayton, VIC,
Australia
LU-WEN NING • Computational, Comparative, Evolutionary and Functional Genomics
Group (CEFG), School of Life Science and Technology, University of Electronic Science
and Technology of China, Chengdu, China
WATARU NOMURA • Graduate School of Biological Sciences, Nara Institute of Science
and Technology, Nara, Japan
YUTA OTSUKA • Graduate School of Biological Sciences, Nara Institute of Science
and Technology, Nara, Japan
MARK REUTER • Institute of Food Research, Norwich Research Park, Norwich, UK
CHRISTOPHER M. SASSETTI • Department of Microbiology and Physiological Systems,
University of Massachusetts Medical School, Worcester, MA, USA; Howard Hughes
Medical Institute, Chevy Chase, MD, USA
MARTIN STAHL • Division of Gastroenterology, BC’s Children’s Hospital, the Child
and Family Research Institute and the University of British Columbia, Vancouver,
BC, Canada; Department of Biochemistry, Microbiology and Immunology, Faculty
of Medicine, Ottawa Institute of Systems Biology, University of Ottawa, Ottawa,
ON, Canada
ALAIN STINTZI • Department of Biochemistry, Microbiology and Immunology, Faculty
of Medicine, Ottawa Institute of Systems Biology, University of Ottawa, Ottawa,
ON, Canada
RIKIYA TAKEUCHI • Graduate School of Biological Sciences, Nara Institute of Science
and Technology, Nara, Japan
BARRY L. WANNER • Department of Microbiology and Immunobiology, Harvard Medical School,
Boston, MA, USA
DOYLE WARD • Broad Institute, Cambridge, MA, USA
WEN WEI • Computational, Comparative, Evolutionary and Functional Genomics Group
(CEFG), School of Life Science and Technology, University of Electronic Science
and Technology of China, Chengdu, China
PING XU • The Philips Institute for Oral Health Research, Virginia Commonwealth
University, Richmond, VA, USA
 Contributors xi

YUAN-NONG YE • Computational, Comparative, Evolutionary and Functional Genomics

Group (CEFG), School of Life Science and Technology, University of Electronic Science
and Technology of China, Chengdu, China
KATSUSHI YOKOYAMA • Graduate School of Biological Sciences, Nara Institute of Science
and Technology, Nara, Japan
CHUN-TING ZHANG • Department of Physics, Tianjin University, Tianjin, China
REN ZHANG • Center for Molecular Medicine and Genetics, School of Medicine, Wayne State
University, Detroit, MI, USA
 Chapter 1

Microarray Transposon Tracking for the Mapping

of Conditionally Essential Genes in Campylobacter jejuni
Martin Stahl and Alain Stintzi

Abstract
Although whole genome approaches to the study of bacteria have grown substantially in the past decade,
there is still a need for quick and easy methods for the determination of which genes are essential for the
growth of these bacteria under specific growth conditions. There are numerous methods to accomplish
this depending on the resources and equipment available, each with their own advantages and disadvan-
tages. Here we describe a method we successfully employed to map the essential genes of Campylobacter
jejuni using a microarray transposon tracking approach where we constructed a saturated transposon
mutant library in the C. jejuni strain NCTC11168 and used a genomic microarray approach to identify
genes lacking transposon insertions under standard laboratory growth conditions. With a fully saturated
library, the absence of transposon insertions can be used as an indicator of a gene essential for the survival
and growth for the conditions used for the mutant library.

Key words Campylobacter jejuni, Essential genes, Microarray, Transposon based mutant library,
Dispensable genes

1 Introduction

With the recent and rapid increase in technologies available for

genome sequencing, the access to genomic data is no longer an
obstacle for the analysis of bacterial genomes. However, the more
difficult hurtle still remains, and that is assigning functions to each
identifiable gene and determining their relative importance to the
survival, functioning and pathogenesis of each type of bacteria in
its environment. For this, a useful approach has been to identify
genes that are conditionally essential for growth under a given
growth condition.
For the proper determination of gene essentiality, particularly
on a genomic scale, numerous techniques have been developed. The
basis of the approaches employed has revolved around methods of
detecting which genes throughout the genome cannot be disrupted
without the production of a lethal mutation. These methods include

Long Jason Lu (ed.), Gene Essentiality: Methods and Protocols, Methods in Molecular Biology, vol. 1279,
DOI 10.1007/978-1-4939-2398-4_1, © Springer Science+Business Media New York 2015

1
2 Martin Stahl and Alain Stintzi

the systematic deletion of single-genes throughout the genome

[1, 2], the construction of comprehensive transposon mutant librar-
ies [3–12], antisense RNA technology [13], the trapping of lethal
insertions [14], and through bioinformatic approaches [12, 15].
Each of these methods has its advantages and disadvantages based
on what resources are available and what kind of information is
sought.
Recently, we employed a microarray transposon tracking tech-
nique as a means for the identification of genes necessary for the
growth of the enteric pathogen Campylobacter jejuni under stan-
dard laboratory growth conditions. For this organism, these labo-
ratory conditions were growth in nutrient-rich Mueller-Hinton
broth under a microaerophilic atmosphere of 8 % O2, 10 % CO2,
4 % H2, and 68 % N2. Metris et al. and Salama et al. employed a
similar technique in both C. jejuni and the closely related bacte-
rium Helicobacter pylori respectively [5, 12]. The method relies on
the construction of a saturated transposon-mutant library. The key
in the construction of this library is that it must provide sufficient
coverage so as to include even small genes (<150 bp), which can be
easily missed through random transposon insertions in the genome.
Additionally, insertions need to be equally distributed throughout
the genome; otherwise, higher transposon events would be neces-
sary to overcome any insertion bias.
Once constructed, the next hurdle is to properly map the
insertion sites of each transposon within the library so as to deter-
mine which mutants are absent. This requires a method that will
allow for the mapping of large numbers of transposon insertions
simultaneously and accurately. The regions adjacent to each inser-
tion site needs to be amplified and its sequence mapped to its
location in the genome. This can be accomplished by sequencing
each of these sequences using any one of the high throughput
sequencing techniques now available, or as we employed in our
study [11], a microarray approach, whereas, each of the flanking
regions of the insertions is amplified by PCR, then hybridized to
a microarray slide to indicate its position on the genome. Figure 1
displays the workflow of conducting this study from the construc-
tion of the library to the final data analysis to assemble the list of
essential genes.

2 Materials

2.1 Mutant Library 1. E. coli harboring the transposon containing plasmid

Construction (pMOD-Cm).
(See Note 1) 2. EZ:Tn5 transposon kit (Epicentre).
3. T4 DNA Ligase (400 units/μl) and ligase buffer.
4. T4 Polymerase.
 Microarray Transposon Tracking for the Mapping of Conditionally Essential Genes… 3

Fig. 1 Flowchart of the experimental approach of the microarray transposon tracking and data analysis. The
transposon mutant library was divided into pools for PCR amplification and microarray hybridization. Ensuing
data was normalized to the background fluorescence intensity, was assigned a binomial value of 1 or 0 denot-
ing its presence or absence from each array, and its mean insertion value was calculated

5. Previously extracted chromosomal DNA from the target bacteria

(see Note 2).
6. PCR purification kit—Qiagen or equivalent.
7. Plasmid extraction kit—Qiagen miniprep kit or equivalent.
8. Spectrophotometer or other equipment/method of quantify-
ing DNA.
9. Thermocycler and reagents for conducting PCR.
10. Tabletop centrifuge.
11. 96-well plates with adhesive sealing film capable of storing
bacterial cultures at −80 °C.
12. Luria–Bertani (LB) media.
13. Ampicillin.
14. Mueller-Hinton (MH) media.
15. Chloramphenicol.
16. DMSO.

2.2 DNA Extraction 1. 0.5 M EDTA, pH 8.0.

(Hot Phenol Method) 2. 1 M Tris buffer, pH 8.0.
(See Note 2)
3. 10 % SDS, pH 7.2.
4 Martin Stahl and Alain Stintzi

4. TE buffer: 10 mM Tris, 1 mM EDTA, pH 8.0.

5. Extraction buffer: 50 mM Tris, 0.1 mM EDTA, 0.5 % SDS,
pH 8.0.
6. 10 M ammonium acetate.
7. 10 mg/ml RNase.
8. 20 mg/ml proteinase K.
9. Saturated phenol, pH 6.6.
10. Chloroform.
11. 100 and 70 % ethanol.

2.3 Microarray 1. Microarray slides: The microarray slides used in our study of
Hybridization Campylobacter were described previously [16–19]. Any com-
mercial or custom slide design with sufficient coverage of
the genome should suffice with the condition that it needs to
provide suitable binding targets for the amplified flanking
regions.
2. Coverslips: the design may also vary depending on the array
design, but they need to be sufficient in size to cover the whole
of the printed area of the array.
3. Fluorophores: succinimidyl esters of fluorescent indocarbocya-
nine (Cy3) and indodicarbocyanine (Cy5) are commonly used
ones for microarrays, but other options are available. The fluo-
rophores should be prepared based on manufacturer instruc-
tions. The Cy3 and Cy5 fluorophores used in our study were
obtained from GE healthcare and were resuspended in 60 μl
DMSO.
4. Microcon YM-30 filter (Millipore).
5. Vacuum centrifuge or other means of drying cDNA samples.
6. Sodium bicarbonate: 1 M, pH 9.0.
7. Amino-allyl dUTPs.
8. 20× SSC: 3 M NaCl, 0.3 M sodium citrate.
9. Hybridization buffer: 25 % formamide, 5× SSC, 0.1 % SDS,
1 % BSA (see Note 3).
10. Coverslip wash solution: 5× SSC, 0.1 % SDS (see Note 4).
11. Salmon sperm DNA.
12. Wash buffer 1: 2× SSC and 0.1 % SDS.
13. Wash buffer 2: 0.1× SSC.
14. Formamide.
 Microarray Transposon Tracking for the Mapping of Conditionally Essential Genes… 5

3 Methods

3.1 Transposon The preparation of the transposon containing DNA needs to be

Mutagenesis done with several points kept in mind in the experimental design.
When constructing the transposon mutant library into Campylo-
bacter jejuni, we took advantage of the ability of these naturally
competent bacteria to transform genomic DNA into its cell without
the need for heat-shock or chemical treatment and for these bacte-
ria to perform double strand recombination at the homologous
sites flanking to the transposon insertion. Other bacterial species
may require different approaches, and even other Campylobacter
strains may meet with varying success depending on the presence of
DNA-degrading restriction enzymes.
In our study, we utilized the EZ-Tn5-Cm transposon vector
that we have previously constructed by inserting the commonly
used Campylobacter CmR chloramphenicol cassette from the
pRY111 plasmid, into the EZ-Tn5 pMOD-3 <R6Kγori/MCS>
transposon construction vector available commercially from
Epicentre. The EZ-Tn5 transposase, also available from Epicentre
was used to insert the transposons into random segments of
C. jejuni genomic DNA, largely following a variant on the manu-
facturer’s protocols, which were as follows:
1. Grow E. coli containing EZ:Tn5 plasmid pMOD-Cm on ampi-
cillin containing LB agar at 37 °C overnight.
2. Use to inoculate liquid media (LB broth containing 50 μg/ml
ampicillin) and grow overnight (37 °C).
3. Extract plasmid using a plasmid miniprep kit from Qiagen or
an equivalent.
4. Use 1 μl of the extracted plasmid as template for PCR to amplify
the transposon using the pMODforward and pMODreverse
primers, standard reaction conditions for Taq polymerase in a
50 μl reaction volume and the following PCR conditions: 94 °C
for 2 min, 30 cycles of 94 °C for 30 s, 45 °C for 1 min, 72 °C
for 45 s, and finally, 72 °C for 4 min.
5. Purify and quantify the final PCR product.
6. Mix 1 μl of 10× transposase buffer, a 2:1 ratio of C. jejuni
chromosomal DNA and amplified transposon, and 1 μl trans-
posase from Epicentre in Eppendorf tube.
7. Incubate reaction for 2 h at 37 °C and stop the reaction with
1 μl of the 10× stop solution, incubate for 10 min at 70 °C to
inactivate the transposase.
8. Column-clean the reaction mixture using a column PCR
purification kit from Qiagen or equivalent and elute in 44 μl of
dH2O.
6 Martin Stahl and Alain Stintzi

9. Mix 5 μl 10× ligase buffer, 0.5 μl dNTPs (10 mM), 0.5 μl T4

polymerase (5 units/μl) in a 0.2 ml PCR tube and place in
a thermocylcer under the following conditions: 11 °C for
20 min, 75 °C for 15 min, 16 °C to the end.
10. To the previous reaction add 5 μl 10× ligase buffer, 43.5 μl
sterile dH2O, and 1.5 μl T4 DNA ligase (400 units/μl) and
incubate overnight at 16 °C.

3.2 Natural 1. Numerous methods of transformation into bacteria can be

Transformation done, and needs to be tailored to the bacterial species being
used (see Note 5). We used a common spot-plating method
for the natural transformation of C. jejuni as described in the
following steps.
2. Grow an overnight culture of wild-type C. jejuni NCTC11168
and use it to inoculate a biphasic flask and grow the biphasic
culture to log phase, which for this strain, corresponded
roughly to an O.D600 of 0.6. Spot 10 μl of culture to an MH
plate, and incubate under microaerophilic conditions for 2–3 h.
3. To each spotted bacterial culture add 10 μl of the DNA prod-
uct from the previous reactions and incubate for an additional
5–6 h. It can also be beneficial to serially dilute the PCR ampli-
con when adding to the C. jejuni spots as lower DNA concen-
trations can result in increased transformation efficiencies.
4. Use a loop to recover each C. jejuni spot on the MH plate and
resuspend in an aliquote of MH broth. Plate this suspension
onto selective MH plates containing 20 μg/ml chlorampheni-
col and incubate for 4–5 days under microaerobic conditions,
or until colonies are visible.
5. Patch all resistant colonies onto fresh Cm-MH plates to
confirm they are antibiotic resistant.
6. Pick 48 colonies/plate on a square grid and grow for 2 days.
7. In each well of 96-well plates—inoculate 230 μl of MH broth
with a single mutant.
8. After each 96-well plate is filled, incubate at 37 °C under micro-
aerophilic conditions for 4–6 h to allow culture to become
more established.
9. Add 30 μl of DMSO to each well, cover with sealing film and
store at −80 °C (see Note 6).

3.3 Transposon The growth medium used to construct the transposon mutant
Mutant Library Growth library and the following step in the process are critical to define
the growth conditions governing the determination of the essen-
tial genes. For example, patching mutants from the library and
growing them under new growth conditions would identify which
genes are not essential for growth on MH broth but are essential
Microarray Transposon Tracking for the Mapping of Conditionally Essential Genes… 7

for growth under the new growth condition. In our study, we

simply determined the essential genes under the basic growth con-
ditions, but the comparison of our results to those of Metris et al.
who analyzed the same strain of C. jejuni, can serve as an example
of the profound influence different growth conditions exert on
which genes are identified [12].
1. Thaw a 96-well plate from the library. Pipette 2 μl of frozen
culture onto a Cm-MH plate (48/plate on grid) and grow for
2–3 days (see Note 7).
2. Resuspend the colonies directly from the plate using 2–3 ml of
MH broth (be sure that there is no contamination on the
plate). Do this to create pools of up to 48 mutants.
3. Add up to 2 ml of culture into a 2 ml microcentrifuge tube and
proceed with DNA extraction from the combined pool of
48 mutants. The following steps in the protocol describe a hot
phenol extraction (see Note 2).
4. Pellet each of the tubes for 10 min at 9,000 × g and resuspend
the pellet in 100 μl of TE buffer.
5. Add 1 ml extraction buffer, followed by 4 μl RNase (10 mg/
ml) and incubate at 37 °C for 1 h.
6. Add 15 μl proteinase K (20 mg/ml) and incubate for at least
3 h at 42 °C.
7. Add 700 μl of phenol to each tube, mix by inverting gently and
incubate for 15 min at 37 °C.
8. Centrifuge at 10,000 × g for 5 min and recover the upper,
aqueous layer from each tube and add to a fresh 2 ml micro-
centrifuge tube. Be careful not to pipet the lower phenol layer
or middle precipitate layer into new tube.
9. Add 1 ml of chloroform to tube and mix by inverting gently.
Centrifuge at 10,000 × g for 1 min at room temperature.
Recover the upper aqueous layer from each tube and add to a
fresh 2 ml microcentrifuge tube.
10. Repeat step 9 at least once more. Additional chloroform
extraction steps will improve purity but reduce yield.
11. After the final chloroform extraction, add upper aqueous layer
into 10 ml falcon tube.
12. Prepare Pasteur pipettes by flaming the end to seal it and curve
into small hook.
13. Add 0.2 volumes of ammonium acetate and 2 volumes of
100 % ethanol.
14. Recover DNA strands with a Pasteur pipette (see Note 8),
wash in 70 % ethanol, air-dry, resuspend in 100 μl dH2O, and
store at −20 °C for later use.
8 Martin Stahl and Alain Stintzi

Fig. 2 Schematic diagram of the semi-degenerated PCR strategy. Nested prim-

ers AR54 or CM2 and the degenerate primers MS1 or MS3 are used for the first
PCR round. The resulting amplicon is purified and used as a template for the
second PCR amplification using the nested primers SqFP or SqRP and the primer
specific to the tail sequence, MS2

Table 1
List of primers used in our study [11]

Primer
name Sequence (5′–3′)
MS1 GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT
MS2 GGCCACGCGTCGACTAGTAC
MS3 GGCCACGCGTCGACTAGTACNNNNNNNNNNAGAG
AR54 AGAGCTTAGTACGTTAAACATGA
CM2 GGAACTATAGGGCGCAGGAT
SqFP GCCAACGACTACGCACTAGCCAAC
SqRP GAGCCAATATGCGAGAACACCCGAGAA
The primers MS1, MS2, and MS3 were designed based on primers used by Salama
et al. [5]. The primers pMOD forward, pMOD reverse, SqFP, and SqRP are primer
sequences commercially available with the Epicentre EZ:Tn5 transposon kit

3.4 Semi- This step serves to amplify both flanking sequences of the transposon
Degenerate PCR so as to increase the likelihood of properly identifying the transpo-
son insertion site. As outlined in Fig. 2, one primer is anchored on
transposon, while the other utilizes a degenerate sequence to allow
it to anneal to frequent locations within the genome. The second
step enriches the PCR product and adds the aminoallyl-dUTP
used for the fluorescent labeling. The DNA template in this step is
still the DNA extracted from the pool of 48 mutants.
1. Fifty nanograms of template DNA was added to a reaction
mixture containing 2 μM of the transposon-nested primer
AR54 or CM2, 1 μM of each degenerate primer MS1 and
MS3 (Table 1), 0.5 mM dNTPs, and 4.4 mM MgCl2 in 1×
PCR reaction buffer (Life Technologies). The PCR conditions
 Microarray Transposon Tracking for the Mapping of Conditionally Essential Genes… 9

used were the following: 94 °C for 2 min; followed by 6 cycles

at 94 °C for 30 s, 42 °C for 30 s, and 72 °C for 3 min, with
1 °C lowering of the annealing temperature (42 °C) on each
cycle; and 25 cycles at 94 °C for 30 s, 65 °C for 30 s and
72 °C for 3 min.
2. Purify the first PCR reaction using any commercially available
PCR purification kit and elute in 50 μl of sterile dH2O.
3. This second PCR mixture contained 0.5 mM each of dGTP,
dATP, and dCTP, 0.16 mM dTTP, 0.34 mM aminoallyl-dUTP,
0.4 μM of the transposon nested primer SqFP or SqRP, 0.4 μM
of primer MS2, 4.4 mM MgCl2, and 1× PCR reaction buffer
in a final reaction volume of 100 μl. The PCR amplification of
the transposon DNA flanking region was performed for 30
cycles at 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 2 min.
4. Column-purify the products from each PCR reaction with kit
from Qiagen or equivalent. This is also the step where the
products of each pool of 48 mutants can be combined into
larger pools (see Note 9).

3.5 Purify and Label 1. Add samples to Microcon YM-30 filter and bring to 450 μl
Aminoallyl-Labeled with distilled water and centrifuge for 8 min at 9,000 × g in the
cDNA corresponding microcentrifuge tube (Millipore) (see Note 10).
2. Discard the flow-through and repeat the wash four times.
3. Concentrate the sample using an additional centrifugation
step. The precise length of the centrifugation step can vary
depending on the concentration of DNA in the sample, but an
8-min centrifugation is usually sufficient.
4. Invert the column and collect the retentate with a 1 min
centrifugation at 10,000 × g.
5. If the volume collected is over 9 μl, then reduce the volume
using a vacuum centrifuge; otherwise add sterile dH2O to
bring the sample volume to 9 μl.
6. Add 1 μl 1 M NaHCO3, pH 9.
7. Add 10 μl of a solution containing the monoreactive dye Cy-3
or Cy-5, one for each reaction condition.
8. Incubate for 60 min at room temperature in the dark.
9. Add 55 μl sterile dH2O and 35 μl of 100 mM NaOAc, pH 5.2
to the reaction tube.
10. Purify labeled cDNA using any appropriate PCR purification
kit, with the following alterations: Instead of a single ethanol
wash, wash the sample four times and elute the sample twice
using 30 μl sterile dH2O to maximize sample recovery.
10 Martin Stahl and Alain Stintzi

3.6 Microarray 1. Incubate each slide in pre-warmed hybridization buffer for

Slide Hybridization 45 min at 42 °C.
(See Note 11) 2. Simultaneously prepare the coverslips by submerging them for
5 min in the coverslip wash buffer (5× SSC and 0.1 %SDS).
3. Also during the incubation of the slides in the pre-hybridization
buffer, prepare the probes by completely drying them down
using a vacuum centrifuge.
4. When dry, resuspend each probe in 7.5 μl dH2O and combine
both probes into a single PCR tube, then add the following in
order while mixing: 2.5 μl of 10 mg/ml salmon sperm DNA,
9 μl of 20× SSC, 0.36 μl of 10 % SDS, and 9 μl of formamide.
5. Denature probe in a thermocycler, 99 °C for 2 min, cool to
42 °C, then hold at this temperature until ready to apply them
to the slide. While doing this, pre-warm the hybridization
chambers to 42 °C.
6. Rinse the array slides in dH2O, then spin or air-dry each slide
thoroughly (see Note 12).
7. Carefully apply probes to the coverslip and gently lay the
microarray slide to the coverslip. Remove any visible bubbles
with a pipette tip, then place in the hybridization chamber and
incubate overnight at 42 °C.
8. Incubate for 5 min in 100 ml wash buffer 1 (2× SSC and 0.1 %
SDS) (see Note 13), and remove the coverslip (see Note 14).
9. Wash four times for 1 min in 400 ml wash buffer 2 (0.1× SSC).
Rinse the slides in dH2O, and spin or air-dry (see Note 12).
10. Array Scanning: As with the slide hybridization, this should be
done using whichever scanner and analysis software is appro-
priate for the microarray slide design being used. We utilized a
ScanArray Gx from PerkinElmer to scan the slides and the
accompanying ScanArray Express software to collect fluores-
cence intensities. Both the Cy3 and Cy5 channels were collected
and analyzed separately. Additionally, we manually inspected
the results of the ScanArray Express software to confirm the
presence or absence of spots and to confirm they were properly
identified and outlined by the software.

3.7 Data Analysis 1. To consider a spot to be present, it has to possess a mean fluo-
rescent intensity greater than 2 standard deviations above the
background.
2. Based on this threshold, assign each gene a binomial value of 0
for absent or 1 for present to indicate the probability of inser-
tion. Calculate the probability of insertion by adding together
the results from each replicate, and dividing the sum of the
probability of insertion for each gene by the total number of
replicates. This will produce a mean insertion value for each gene.
 Microarray Transposon Tracking for the Mapping of Conditionally Essential Genes… 11

We set the threshold for considering a gene to be absent from

the library to be less than 0.125. We determined this value by
evaluating which number would maximize the number of known
essential genes while minimizing the numbers of false positives.
A different threshold may be appropriate depending on the
number and quality of the microarray results obtained.

3.8 Error Analysis 1. The determination of essential genes using a transposon

insertion library is only as good as the library initially created.
To calculate the likelihood that a gene might be lacking
a transposon insertion, we used the following formula:
P = 1 − (1 − (l/g))n, whereas P is the probability of detecting an
insertion in a given gene, l is the length of the gene in bp, g is
the size of the genome, and n is the number of mutants in the
library. For example, we determined that there would be a less
than 90 % probability of having a transposon inserted into
gene of 500 bp or less. For the calculation of the probability of
insertion in a 500 bp gene within the C. jejuni NCTC11168
genome, using our library of 7,201 mutants, the equation is:
P = 1 − (1 − (500/1,641,481))7,201.

4 Notes

1. Any method or kit for random transposon mutagenesis can be

used for transposon tracking. We utilized the EZ:Tn5 transpo-
son kit (Epicentre) for our study in Campylobacter (Stahl et al.,
2011) and protocols for the use of this transposon are described
here. If another transposon is used, then this method can still
be used, but with the replacement of our transposon nested
primers with primers appropriate for the new transposon.
2. To extract DNA from the desired bacterial strain for the trans-
poson library construction, any of the common techniques can
be used. These can include, but are not limited to the com-
mercially available DNA extraction kits, or more traditional
methods such as the phenol–chloroform extraction we emp-
loyed in our study. The main condition is that the DNA must
be extracted from a stationary phase culture, so as to limit the
amount of DNA replication taking place. A higher rate of
growth will result in the isolation of more bacterial chromo-
somes in the process of DNA replication, and so bias the trans-
poson insertion towards the origin of replication.
3. To prepare 100 ml of hybridization buffer, add 25 ml of
formamide to 25 ml of dH2O. Stir in 1 ml from a 10 % SDS
stock solution while stirring on a hotplate set to 60 °C, then add
25 ml of 20× SSC and 1 g of BSA. Use dH2O to bring the solu-
tion to 100 ml and stir at 60 °C until everything is dissolved.
12 Martin Stahl and Alain Stintzi

Keep the solution warm at 42 °C until needed, otherwise the

SDS may precipitate out of solution.
4. To prepare 100 ml of the coverslip wash solution, add 25 ml of
20× SSC to 74 ml of dH2O while stirring at 60 °C. Carefully
add 1 ml of 10 % SDS to the solution and stir under heat until
the SDS is fully dissolved. As with the hybridization buffer,
maintain at 42 °C to prevent precipitation of the SDS. If the
SDS does precipitate, reheat the solution to 60 °C until it
dissolves.
5. The transformation of the transposon-containing genomic
DNA segments into the host bacteria needs to be done in
whatever method is suitable to the bacterial strain being used.
Our work with C. jejuni made this step relatively straight-
forward as C. jejuni is naturally competent to the uptake of
DNA, and additionally possesses the necessary machinery for
the homologous recombination of the foreign DNA into its
genome. Bacterial species lacking any of these characteristics, or
which contain restriction enzymes for the degradation of exog-
enous DNA may require a different approach.
6. We used DMSO when freezing down each bacterial strain in a
96-well plate. This allowed them to be safely frozen using
a small amount of DMSO, while maximizing the volume of
culture added. The mutant library could also be frozen using
glycerol at a 20 % final concentration.
7. It should be noted that some individual mutants in the library
may become contaminated with foreign bacteria or will not be
recoverable from freezing. Be prepared for the final number of
mutants in the library to be less than the total number origi-
nally created and frozen down.
8. When recovering the DNA with a glass Pasteur pipette, use a
flame to seal the end of the pipette and curve it into a hook
shape to make it easier to fish the DNA precipitate from the
solution.
9. The size of each pool depends on how many arrays can be used.
We combined samples to produce samples containing DNA
from approximately 2,400 individual mutants. This allowed us
to cover the entire library using only three microarray slides.
Having fewer mutants in each pool will reduce the chance
of individual mutants being missed, but increase the number of
slides needed to cover the full library.
10. This step is for the condensation of DNA. The YM-30 filter is
designed to allow fluid to pass through while retaining nucleic
acid. Any other filters or methods for condensing the sample
could probably be substituted for this step.
 Microarray Transposon Tracking for the Mapping of Conditionally Essential Genes… 13

11. The microarray hybridization should be done using whatever

protocols are appropriate for the slides being used. In our
study, we used protocols already optimized in previous studies
for our slide design and preparation [11, 17–19].
12. When rinsing the slides with dH2O, a convenient way to do it
is to prepare 1 or 2 l of water in graduated cylinders, then pour
the water over the array slide. This also works well for the cov-
erslips, but more attention needs to be made not to break them
under the force of the water.
13. Washing: The slides should not be allowed to dry in between
washes and should be protected from light as much as
possible.
14. Ideally, the coverslip should slide off easily as you remove the
array slide from the first wash buffer. If it does not, this often
indicates that the array slide dried out slightly during the over-
night incubation. In this case, use a pair of tweezers to gently
pry it off of the slide.

References
1. Kobayashi K, Ehrlich SD, Albertini A, Amati collection of single-gene deletion mutants of
G, Andersen KK, Arnaud M, Asai K, Ashikaga Acinetobacter baylyi ADP1. Mol Syst Biol
S, Aymerich S, Bessieres P, Boland F, Brignell 4:174. doi:10.1038/msb.2008.10
SC, Bron S, Bunai K, Chapuis J, Christiansen 3. Akerley BJ, Rubin EJ, Novick VL, Amaya K,
LC, Danchin A, Debarbouille M, Dervyn E, Judson N, Mekalanos JJ (2002) A genome-
Deuerling E, Devine K, Devine SK, Dreesen scale analysis for identification of genes required
O, Errington J, Fillinger S, Foster SJ, Fujita Y, for growth or survival of Haemophilus influen-
Galizzi A, Gardan R, Eschevins C, Fukushima zae. Proc Natl Acad Sci U S A 99(2):966–971.
T, Haga K, Harwood CR, Hecker M, Hosoya doi:10.1073/pnas.012602299
D, Hullo MF, Kakeshita H, Karamata D, 4. Sassetti CM, Boyd DH, Rubin EJ (2003)
Kasahara Y, Kawamura F, Koga K, Koski P, Genes required for mycobacterial growth
Kuwana R, Imamura D, Ishimaru M, Ishikawa defined by high density mutagenesis. Mol
S, Ishio I, Le Coq D, Masson A, Mauel C, Microbiol 48(1):77–84
Meima R, Mellado RP, Moir A, Moriya S,
Nagakawa E, Nanamiya H, Nakai S, Nygaard 5. Salama NR, Shepherd B, Falkow S (2004)
P, Ogura M, Ohanan T, O’Reilly M, O’Rourke Global transposon mutagenesis and essential
M, Pragai Z, Pooley HM, Rapoport G, Rawlins gene analysis of Helicobacter pylori. J Bacteriol
JP, Rivas LA, Rivolta C, Sadaie A, Sadaie Y, 186(23):7926–7935. doi:10.1128/JB.186.23.
Sarvas M, Sato T, Saxild HH, Scanlan E, 7926-7935.2004
Schumann W, Seegers JF, Sekiguchi J, 6. Glass JI, Assad-Garcia N, Alperovich N,
Sekowska A, Seror SJ, Simon M, Stragier P, Yooseph S, Lewis MR, Maruf M, Hutchison
Studer R, Takamatsu H, Tanaka T, Takeuchi CA 3rd, Smith HO, Venter JC (2006) Essential
M, Thomaides HB, Vagner V, van Dijl JM, genes of a minimal bacterium. Proc Natl Acad
Watabe K, Wipat A, Yamamoto H, Yamamoto Sci U S A 103(2):425–430. doi:10.1073/
M, Yamamoto Y, Yamane K, Yata K, Yoshida K, pnas.0510013103
Yoshikawa H, Zuber U, Ogasawara N (2003) 7. Liberati NT, Urbach JM, Miyata S, Lee DG,
Essential Bacillus subtilis genes. Proc Natl Acad Drenkard E, Wu G, Villanueva J, Wei T,
Sci U S A 100(8):4678–4683. doi:10.1073/ Ausubel FM (2006) An ordered, nonredun-
pnas.0730515100 dant library of Pseudomonas aeruginosa strain
2. de Berardinis V, Vallenet D, Castelli V, Besnard PA14 transposon insertion mutants. Proc
M, Pinet A, Cruaud C, Samair S, Lechaplais C, Natl Acad Sci U S A 103(8):2833–2838.
Gyapay G, Richez C, Durot M, Kreimeyer A, doi:10.1073/pnas.0511100103
Le Fevre F, Schachter V, Pezo V, Doring V, 8. Gallagher LA, Ramage E, Jacobs MA, Kaul R,
Scarpelli C, Medigue C, Cohen GN, Marliere P, Brittnacher M, Manoil C (2007) A compre-
Salanoubat M, Weissenbach J (2008) A complete hensive transposon mutant library of Francisella
14 Martin Stahl and Alain Stintzi

novicida, a bioweapon surrogate. Proc 14. Knuth K, Niesalla H, Hueck CJ, Fuchs TM
Natl Acad Sci U S A 104(3):1009–1014. (2004) Large-scale identification of essential
doi:10.1073/pnas.0606713104 Salmonella genes by trapping lethal insertions.
9. French CT, Lao P, Loraine AE, Matthews BT, Mol Microbiol 51(6):1729–1744
Yu H, Dybvig K (2008) Large-scale transposon 15. Parrish JR, Yu J, Liu G, Hines JA, Chan JE,
mutagenesis of Mycoplasma pulmonis. Mol Mangiola BA, Zhang H, Pacifico S, Fotouhi F,
Microbiol 69(1):67–76. doi:10.1111/j.1365- DiRita VJ, Ideker T, Andrews P, Finley RL Jr
2958.2008.06262.x (2007) A proteome-wide protein interaction
10. Kraemer PS, Mitchell A, Pelletier MR, map for Campylobacter jejuni. Genome Biol
Gallagher LA, Wasnick M, Rohmer L, 8(7):R130. doi:10.1186/gb-2007-8-7-r130
Brittnacher MJ, Manoil C, Skerett SJ, Salama 16. Stintzi A (2003) Gene expression profile of
NR (2009) Genome-wide screen in Francisella Campylobacter jejuni in response to growth
novicida for genes required for pulmonary temperature variation. J Bacteriol 185(6):
and systemic infection in mice. Infect 2009–2016
Immun 77(1):232–244. doi:10.1128/IAI. 17. Reid AN, Pandey R, Palyada K, Whitworth L,
00978-08 Doukhanine E, Stintzi A (2008) Identification
11. Stahl M, Stintzi A (2011) Identification of of Campylobacter jejuni genes contributing to
essential genes in C. jejuni genome highlights acid adaptation by transcriptional profiling and
hyper-variable plasticity regions. Funct Integr genome-wide mutagenesis. Appl Environ
Genomics 11(2):241–257. doi:10.1007/ Microbiol 74(5):1598–1612. doi:10.1128/
s10142-011-0214-7 AEM. 01508-07
12. Metris A, Reuter M, Gaskin DJ, Baranyi J, van 18. Reid AN, Pandey R, Palyada K, Naikare H,
Vliet AH (2011) In vivo and in silico determi- Stintzi A (2008) Identification of Campylo-
nation of essential genes of Campylobacter bacter jejuni genes involved in the response to
jejuni. BMC Genomics 12:535. doi:10.1186/ acidic pH and stomach transit. Appl Environ
1471-2164-12-535 Microbiol 74(5):1583–1597. doi:10.1128/
13. Ji Y, Zhang B, Van SF, Horn WP, Woodnutt G, AEM. 01507-07
Burnham MK, Rosenberg M (2001) Iden- 19. Palyada K, Sun YQ, Flint A, Butcher J, Naikare
tification of critical staphylococcal genes using H, Stintzi A (2009) Characterization of the
conditional phenotypes generated by anti- oxidative stress stimulon and PerR regulon of
sense RNA. Science 293(5538):2266–2269. Campylobacter jejuni. BMC Genomics 10:481.
doi:10.1126/science.1063566 doi:10.1186/1471-2164-10-481
 Chapter 2

Identifying Essential Streptococcus sanguinis Genes

Using Genome-Wide Deletion Mutation
Lei Chen, Xiuchun Ge, and Ping Xu

Abstract
Essential genes in pathogens are important for the development of antibacterial drugs. In this report, we
described a protocol to identify essential genes in the Streptococcus sanguinis SK36 strain using genome-
wide deletion mutation. A fusion PCR-based method is used to construct gene deletion fragments, which
contain kanamycin resistance cassettes with two flanking arms of DNA upstream and downstream of the
target gene. The linear fused PCR amplicons were transformed into S. sanguinis SK36 cells. No kanamycin-
resistant transformants suggested the gene essentiality because the deletion of the essential gene renders a
lethal phenotype of the transformants. The putative essential genes were further confirmed by independent
transformations up to five attempts. The false nonessential genes were also identified by removing double-
band mutants.

Key words Essential genes, Streptococcus sanguinis, Fusion PCR, Deletion mutation, Genome-wide

1 Introduction

Essential genes are defined as those that are indispensable for cel-
lular life [1, 2]. Identification of essential bacterial genes is impor-
tant for the development of antibacterial drugs, for designing new
bacterial strains for synthetic biology, and for understanding the
origins of life [2]. However, systematic identification of essential
genes remains challenging because of various limitations.
Streptococcus sanguinis is a member of human indigenous oral
microflora that forms dental plaques, and is one of the most recog-
nized agents of infective endocarditis [3–5]. The transformation
frequency of S. sanguinis is high [6] and its relatively small genome
has been completely sequenced [7]. Hence, S. sanguinis is an ideal
candidate for genome-wide identification of essential genes. We
performed genome-wide essential gene identification and identi-
fied a clearly defined set of essential genes in S. sanguinis [2, 8].
In this study, a fusion PCR-based method was used to construct
gene deletion fragments that contain a kanamycin resistance cassette

Long Jason Lu (ed.), Gene Essentiality: Methods and Protocols, Methods in Molecular Biology, vol. 1279,
DOI 10.1007/978-1-4939-2398-4_2, © Springer Science+Business Media New York 2015

15
16 Lei Chen et al.

with flanking arms of the upstream and downstream DNA of the

target gene. Subsequently, the linear fused PCR amplicon was used
for direct transformation into S. sanguinis SK36. Genes were iden-
tified as essential by either absence of the kanamycin-resistant
transformants or presence of double-band transformants after five
attempts. We finally identified 218 essential genes from a total
2,266 ORFs. Among these, 60 yielded no transformants and 158
were double-band transformants [2, 8]. These essential genes
resulted in a simplified model for gene essentiality in S. sanguinis,
which will greatly facilitate the prediction and validation of essen-
tial genes in other pathogenic species.

2 Materials

Prepare all solutions using ultrapure water and analytical grade

reagents, and store all prepared reagents at room temperature
unless indicated otherwise. Follow all waste disposal regulations
when disposing waste materials.
1. PCR components: High Fidelity PCR buffer, 10 mM dNTP
mixture, 50 mM MgSO4, and Platinum Taq High Fidelity
DNA polymerase; Mix the required components and store in
PCR tubes placed on ice.
2. 96-well PCR plate.
3. 50× TAE buffer: 2.0 M Tris–acetic acid and 50 mM EDTA
(pH 8.0).
4. Ethidium bromide and 10 mg/ml stock solution in water;
working concentration, 0.5 μg/ml.
5. 48-well or 96-well high-throughput agarose gel electrophore-
sis system.
6. Todd Hewitt (TH) broth: adjust pH to 7.6 using 10 N NaOH,
heat to boiling point, then cool to room temperature and ster-
ilize using 0.22-μm polystyrene filters. Before use, add 300 μl
of heat-inactivated horse sera (HS) to a final concentration to
2.5 % in 11.7 ml TH broth in 15-ml conical tubes to obtain
TH + HS medium.
7. 35 ng/μl S. sanguinis SK36 competence stimulating
peptide [9 ].
8. Brain heart infusion (BHI) agar/broth.
9. 500 mg/ml stock kanamycin solution.
10. Mart anoxomat system [10, 11].
 Identifying Essential Streptococcus sanguinis Genes 17

3 Methods

3.1 Primer Design 1. Primers are designed on the basis of the S. sanguinis SK36
and Construction genome sequence. Three sets of primers: F1/R1, F2/R2, and
of Gene Deletion F3/R3 are designed for amplification of approximately 1 kb
Fragments upstream sequence of the target gene, the aphA-3 encoding
kanamycin resistance (Kmr) protein, and approximately 1 kb
downstream sequence of the target gene (see Note 1), respec-
tively (Fig. 1). Primers R1 and F3 are designed to contain
25 bp adaptor sequences at their 5′ end that are complemen-
tary to the aphA-3. The primers are designed such that their
melting temperatures would be as close as possible to 60 °C,
facilitating a uniform annealing temperature for all PCR reac-
tions in 96-well plates (see Note 2).
2. Primers F1, R1, F3, and R3 are ordered in 96-well plates based
on gene order. Each plate contains one type of primers in the
same gene order.
3. Dilute the primers in 96-well plates to a final concentration of
10 μM for PCR amplification using a multichannel pipette to
obtain the working primer plate (see Note 3).
4. PCR amplification: For the aphA-3 (see Note 4), perform large
scale PCR amplification only once to create single-gene dele-
tion constructs. Digest plasmids containing Kmr cassettes using

F1
F2 F3

Upstream Kmr Downstream

R1 R2 R3

F1

Fusion PCR Upstream Downstream

Kmr R3

Upstream Kmr Downstream

Transformation and
homologous recombination

Upstream Target gene Downstream

Fig. 1 Schematic construction of the gene deletion fragment by fusion PCR. PCRs are performed using F1/R1,
F2/R2, and F3/R3 primers. The three amplicons are purified and mixed in equal amounts as template and a
fusion PCR amplicon is obtained using F1/R3, which is used for the following transformation and homologous
recombination
18 Lei Chen et al.

EcoRI to serve as a PCR template (see Note 5). Purify digested

plasmid using a QIAquick PCR purification kit and dilute the
linear plasmid DNA to a final concentration of 10 ng/μl.
Prepare 25 μl mixtures for Kmr cassette amplicons by adding
16.4 μl ddH2O, 2.5 μl 10× High Fidelity PCR buffer, 2 μl of
10 mM dNTP mixture, 1 μl of 50 mM Mg SO4, 1 μl of
10 μM F2, 1 μl of 10 μM R2, 1 μl of linear plasmid DNA, and
0.1 μl of Platinum Taq High Fidelity DNA polymerase.
Perform PCR amplification at 94 °C for 1 min, followed by 30
cycles of 94 °C for 30 s, 55 °C for 30 s, and 68 °C for 1 min.
Examine PCR amplicon using electrophoresis on 1 % agarose
gels. Pool Kmr cassette amplicons from ten individual PCR
reactions after purification using a QIAquick PCR purification
kit. Adjust amplicon concentrations to 10 ng/μl.
5. To amplify approximately 1 kb upstream or downstream
regions of target S. sanguinis genes, prepare PCR mixtures on
ice in 15-ml conical tubes containing 1,640 μl ddH2O, 250 μl
10× High Fidelity PCR buffer, 200 μl of 10 mM dNTP mix-
ture, 100 μl of 50 mM MgSO4, 100 μl of 10 ng/μl S. sanguinis
SK36 genomic DNA, and 10 μl Platinum Taq High Fidelity
DNA polymerase, and transfer 23 μl of the mixture into each
well of a 96-well PCR plate using a multichannel pipette.
Transfer 1 μl of corresponding F1 and R1 (or F3 and R3)
primers from 10 μM working primer plates to the PCR plate
using a multichannel pipette. Seal the PCR plate and perform
amplification at 94 °C for 1 min, followed by 30 cycles of
94 °C for 30 s, 54 °C for 30 s, and 68 °C for 1.5 min.
6. DNA agarose electrophoresis: Prepare 1 % agarose gels con-
taining ethidium bromide with 48 wells to allow for multi-
channel pipette loading. Mix 4 μl of PCR amplicon with 1 μl
of 5× DNA loading buffer in 96-well plates and load the sam-
ples onto agarose gels using a 10-μl multichannel pipette. Run
electrophoresis in 1× TAE buffer at 135 V for 30 min. Check
bands on gels according to the UVP documentation and analy-
sis system (see Note 6).
7. PCR amplicon purification: Purify PCR amplicons using a
PureLink 96 PCR purification kit, and centrifugation according
to the manufacturer’s instructions. To elute DNA, add 30 μl of
sterile ddH2O to the wells of binding plates. Randomly select
several purified amplicons on the plate and check DNA concen-
trations using a NanoDrop spectrophotometer. Adjust the con-
centration of amplicons on the plate to about 10 ng/μl.
8. Fusion PCR: To obtain the final linear recombinant PCR
amplicon, combine 1 μl aliquots of the three PCR fragments
from above (in nearly equal-molar amounts) in single PCR
plate wells as the template. Add 14.4 μl ddH2O, 2.5 μl 10×
High Fidelity PCR Buffer, 2 μl of 10 mM dNTP mixture,
 Identifying Essential Streptococcus sanguinis Genes 19

1 μl of 50 mM Mg SO4, 1 μl of 10 μM F1, 1 μl of 10 μM R3,

and 0.1 μl Platinum Taq High Fidelity DNA polymerase.
Perform PCR reactions at 94 °C for 2 min, followed by 30
cycles of 94 °C for 30 s, 55 °C for 30 s, and 68 °C for
3.5 min, and final extension at 68 °C for 4 min. Check the
PCR amplicons on agarose gels. Purify and quantify the PCR
amplicons as described above. Freeze the recombined
PCR amplicons at −20 °C.

3.2 Cell 1. Prepare fresh TH + HS medium and aliquot into 2- and 10-ml
Transformation tubes.
2. Inoculate 5 μl of stock S. sanguinis SK36 (stored at −80 °C) in
2-ml TH + HS medium, cap tightly and culture overnight at
37 °C, and pre-incubate 10-ml TH + HS tubes concomitantly.
3. After incubation overnight, transfer 50 μl aliquots of cultures
into 10-ml TH + HS tubes and incubate at 37 °C for 3 h to
obtain OD660 of 0.07–0.08, and use immediately for
transformations.
4. Cell transformation: Add 2 μl of 70 ng S. sanguinis SK36 com-
petence stimulating peptide and 2 μl of linear recombinant
PCR amplicon (approximately 50 ng) to Eppendorf tubes on
96-well blocks and pre-warm at 37 °C. Transfer 330 μl of
SK36 cultures incubated for 3 h in each tube. Incubate at
37 °C for 1 h. Replace DNA with sterile ddH2O as a control
(see Note 7).
5. Place the block on ice and spread 100 μl of each transforma-
tion on BHI agar plates (see Note 8) containing 500 μg/ml
kanamycin. Incubate the plates at 37 °C for 2 days under
microaerobic conditions.

3.3 Identification 1. Check transformants on kanamycin plates. If no transformants

of Essential Genes are present, the target gene is identified as an essential gene
candidate.
2. If transformants are present on the kanamycin plates, record
the approximate number of total colonies on each plate (see
Note 9). Randomly select two individual colonies and check if
they are correct mutants using the following protocols.
3. Randomly select two individual colonies, inoculate into 5 ml of
BHI containing 500 μg/ml kanamycin, and incubate the inoc-
ulum microaerobically overnight at 37 °C (see Note 10).
4. To determine whether the mutants contain the expected gene
replacements, perform colony PCR for each mutant using F1
and R3 primers in 96-well PCR plates. Use 1 μl aliquots from
overnight cultures of individual colonies as the DNA template
in 25 μl PCR reactions. Perform PCR at 94 °C for 5 min,
followed by 32 cycles of 94 °C for 30 s, 55 °C for 30 s, and
68 °C for 3.5 min, and final extension at 68 °C for 4 min.
20 Lei Chen et al.

5. To accurately identify double-band mutants or contaminant

PCR amplicons, examine the PCR amplicons by electrophore-
sis for 4 h using >12 cm long 1 % agarose gels containing
ethidium bromide. Under these electrophoresis conditions,
amplicons with ≥100 bp differences can be clearly identified.
When bands from the Kmr cassette and the wild-type gene are
anticipated to differ by <100 bp, an internal T1 primer is used
to determine whether the wild-type gene fragment can be
detected by PCR (see Note 11).
6. To confirm correctness of the deletion, purify amplicons using
a PureLink 96 PCR purification kit, and then sequence using
the P1 primer for the Kmr cassette.
7. Target genes are identified as essential after five attempts if
(1) no transformants are obtained at step 1, or (2) if both the
selected colonies are confirmed as double-band mutant or a
wild-type gene fragment can be detected by PCR at step 5, or
(3) the sequencing results reveal that the deletion is incorrect
as expected at step 6 (Fig. 2; see Note 12).

Gene deletion fragment construction

Transformation

No colony Colonies

Colony PCR and agarose gel

Double bands Single band

Difference<100 bp Difference>100 bp

Internal PCR

Double bands One band Sequencing

Not correct Correct

Essential Gene Non- essential Gene

Fig. 2 Flowchart of essential genes identification

 Identifying Essential Streptococcus sanguinis Genes 21

4 Notes

1. Lengths of flanking sequences upstream and downstream of

the target gene may vary. In this study, flanking sequences were
limited to approximately 1 kb based on the following factors:
(a) the total length of the PCR-amplifiable amplicon (approxi-
mately 3 kb: 1 kb for the aphA-3 and 2 kb of flanking sequences)
and (b) on the feasibility of sequencing flanking regions from
both ends (approximately 1 kb) by Sanger’s method.
2. The specificity of PCR primers is critical. We found that high
primer melting temperatures (>58 °C), longer primer sizes
(>21 bp) and unique primer binding sites in the genome of
S. sanguinis are important. In addition, it is crucial that only
a single gene-specific product is obtained from the final PCR
amplification [8].
3. When diluting the primers in 96-well plates using a multichan-
nel pipette, it is important to avoid cross-contamination between
neighboring wells. Thus, discard the 96-well plate sealing film
after each opening to avoid possible cross-contamination.
4. For studies that aim to identify essential genes, it is preferable
to include the native promoter of the aphA-3 in the deletion
construct to address instances of poor expression of the ahpA-3.
For studies of functional mutant constructs, a promoterless
Kmr cassette is preferred to eliminate possible polar transcrip-
tional effects on neighboring genes.
5. A thorough digestion using EcoRI is important to avoid pos-
sible false positive transformants in the following cell transfor-
mation steps.
6. If there are no PCR amplicon or the amplicon is not a single
band in one or more wells of the 96-well plate, each PCR reac-
tion must be optimized individually.
7. Negative controls will show transformants if wild type S. san-
guinis SK36 samples are contaminated with kanamycin resis-
tant mutants. In this case, use backup S. sanguinis SK36 stocks
and repeat the cell transformation steps.
8. Essential genes are defined as those with lethal consequences
under certain environmental conditions [2]; therefore, essential
genes are conditional. Differences in screening conditions may
cause differences in essential gene identification. As we found
for S. sanguinis, the use of minimal medium results in identifi-
cation of additional essential genes compared with use of BHI
medium.
9. Genes can be falsely identified as essential because of low trans-
formation frequency. Hence, high transformation frequencies
are critical for identification of essential genes. After optimiza-
tion of the S. sanguinis SK36 transformation efficiency, up to
22 Lei Chen et al.

2 × 106 mutant colonies could be obtained from 107 bacterial

cells with nonessential gene transformations [6, 8], indicating
that S. sanguinis SK36 is an ideal system for identification of
essential genes. We found that essential gene deletions are
almost always accompanied by low colony numbers (or no
colony at all) on kanamycin plate after cell transformation,
although low numbers of colonies do not necessarily indicate
that a gene is essential. In this case, inclusion of a control that
indicates high transformation frequency in every experiment is
preferred. Therefore, nonessential gene deletion constructs
that are known to show over 1,000 colonies on the kanamycin
plates are used (we used ssa_0169 [11]).
10. Some transformants demonstrate tiny colonies on kanamycin
plates and grow slowly in liquid BHI medium. In this case,
incubate the inoculum for another day under the same condi-
tions. In most cases, poor viability indicates that the deleted
gene is important but not essential.
11. Use wild-type SK36 as a positive control strain for this PCR. If
a band with the expected size is amplified from the mutant
using the internal primer, the mutant is identified as a double-
band because the presence of kanamycin cassette in the mutant
is confirmed by kanamycin selection and subsequent DNA
sequencing using the P1 primer.
12. In this study, two types of essential genes were identified in
S. sanguinis. Deletion of the first type yielded no transformants.
Thus, new amplicons for these genes were re-amplified from the
beginning and were re-transformed in a second cycle.
Subsequently, 60 genes in S. sanguinis SK36 were not success-
fully deleted after five independent attempts, and were classified
as essential. The second category of essential genes was identi-
fied by mutant colonies producing double-bands in PCR ampli-
fications using F1 and R3 flanking primers. In general, one of
the bands corresponded to the size expected for the replacement
mutant, whereas the other matched the wild-type gene. We
interpreted this as an indication that these genes were also essen-
tial because selection for kanamycin resistance resulted in dupli-
cation of the target gene [12]. After five independent attempts,
we identified a total of 158 double-band essential genes.

Acknowledgment

The authors thank Xiaojing Wang, Yuetan Dou, Jerry Z. Xu,

Jenishkumar R Patel, Victoria Stone, My Trinh, Karra Evans, Todd
Kitten, Danail Bonchev, and Gregory A. Buck for their contribu-
tions in this research. The research is supported by grants
R01DE018138 (PX) and R01DE023078 (PX) from the National
Institutes of Health.
 Identifying Essential Streptococcus sanguinis Genes 23

References

1. Juhas M, Eberl L, Church GM (2012) 7. Xu P, Alves JM, Kitten T, Brown A, Chen Z

Essential genes as antimicrobial targets and et al (2007) Genome of the opportunistic
cornerstones of synthetic biology. Trends pathogen Streptococcus sanguinis. J Bacteriol
Biotechnol 30:601–607 189:3166–3175
2. Xu P, Ge X, Chen L, Wang X, Dou Y et al 8. Ge X, Xu P (2012) Genome-wide gene dele-
(2011) Genome-wide essential gene identifi- tions in Streptococcus sanguinis by high
cation in Streptococcus sanguinis. Sci Rep throughput PCR. J Vis Exp 69:e4356
1:125 9. Gaustad P, Havardstein LS (1997)
3. Chen L, Ge X, Wang X, Patel JR, Xu P (2012) Competence-pheromone in Streptococcus san-
SpxA1 involved in hydrogen peroxide produc- guis. Identification of the competence gene
tion, stress tolerance and endocarditis viru- comC and the competence pheromone. Adv
lence in Streptococcus sanguinis. PLoS One Exp Med Biol 418:1019–1021
7(6):e40034 10. Das S, Kanamoto T, Ge X, Xu P, Unoki T et al
4. Nyvad B, Kilian M (1987) Microbiology of (2009) Contribution of lipoproteins and lipo-
the early colonization of human enamel and protein processing to endocarditis virulence in
root surfaces in vivo. Scand J Dent Res Streptococcus sanguinis. J Bacteriol 191:
95:369–380 4166–4179
5. Mylonakis E, Calderwood SB (2001) Infective 11. Turner LS, Das S, Kanamoto T, Munro CL,
endocarditis in adults. N Engl J Med Kitten T (2009) Development of genetic tools
345:1318–1330 for in vivo virulence analysis of Streptococcus
6. Paik S, Senty L, Das S, Noe JC, Munro CL sanguinis. Microbiology 155:2573–2582
et al (2005) Identification of virulence deter- 12. De Berardinis V, Vallenet D, Castelli V, Besnard
minants for endocarditis in Streptococcus san- M, Pinet A et al (2008) A complete collection of
guinis by signature-tagged mutagenesis. Infect single-gene deletion mutants of Acinetobacter
Immun 73:6064–6074 baylyi ADP1. Mol Syst Biol 4:174
 Chapter 3

Defining Essential Genes and Identifying Virulence

Factors of Porphyromonas gingivalis by Massively
Parallel Sequencing of Transposon Libraries (Tn-seq)
Brian A. Klein, Margaret J. Duncan, and Linden T. Hu

Abstract
Porphyromonas gingivalis is a keystone pathogen in the development and progression of periodontal
disease. Obstacles to the development of saturated transposon libraries have previously limited transposon
mutant-based screens as well as essential gene studies. We have developed a system for efficient transposon
mutagenesis of P. gingivalis using a modified mariner transposon. Tn-seq is a technique that allows for
quantitative assessment of individual mutants within a transposon mutant library by sequencing the trans-
poson–genome junctions and then compiling mutant presence by mapping to a base genome. Using Tn-seq,
it is possible to quickly define all the insertional mutants in a library and thus identify nonessential genes
under the conditions in which the library was produced. Identification of fitness of individual mutants
under specific conditions can be performed by exposing the library to selective pressures.

Key words Porphyromonas gingivalis, Transposon mutagenesis, Essential genes, Mariner, Tn-seq

Abbreviations
BAM Binary alignment/map format
Pg Porphyromonas gingivalis
PCR Polymerase chain reaction
BHIHKSbcStgC Supplemented brain–heart infusion
BAPHK Supplemented blood agar plate
BROP Bioinformatics resource oral pathogens
BED Browser extensible data format
SAM Sequence alignment/map format
BLAST Basic local alignment search tool
DEG Database of essential genes
WT Wild-type

Long Jason Lu (ed.), Gene Essentiality: Methods and Protocols, Methods in Molecular Biology, vol. 1279,
DOI 10.1007/978-1-4939-2398-4_3, © Springer Science+Business Media New York 2015

25
26 Brian A. Klein et al.

1 Introduction

Porphyromonas gingivalis, a gram-negative, anaerobic, asaccharolytic,

black-pigmenting bacterium, is a keystone pathogen in the devel-
opment and progression of periodontal disease [1–3]. While many
important virulence factors of P. gingivalis have been identified,
tools for high-throughput screening of genic and intergenic func-
tion have been limited until recently [4–7]. Transposon mutagen-
esis, an important tool for creating inactivation mutants, utilizes
a mobile genetic element to generate insertional mutations. The
value of transposon mutagenesis is based on the ability of the trans-
posable element to randomly insert into sites throughout the host
genome, while giving only one insertion per strain. While transpo-
son mutagenesis has been used to great effect in many bacterial
species, early attempts to create transposon mutant libraries of
P. gingivalis using transposons based on Tn4435 and Tn4400 were
limited by preferential insertion into “hot-spots,” cryptic vector
insertions, and a limited range of P. gingivalis strains that could be
mutagenized [8–10]. The Mariner transposon, first identified and
described in Drosophila melanogaster, has been highly effective for
in vitro bacterial mutagenesis in phylogenetically, physiologically,
and metabolically diverse species [11–13]. The only well docu-
mented constraint or preference for Mariner transposition is
preferential insertion into “TA” nucleotide sequences, which are
abundant throughout genomes even in the face of GC-content
skewing. A recent advance in analysis of bacterial transposon librar-
ies has been the application of massively parallel sequencing tech-
nology to quantitatively identify the location of the transposon
insertions in a library pool by sequencing of the transposon–
genome junctions [14, 15]. These strategies have been variously
named Tn-seq, HITS, or INSeq [16–18]. In this chapter, we
describe modifications in the processes of transposon library cre-
ation and screening by Tn-seq that we developed to optimize
the systems for use with P. gingivalis [19]. Steps involved include
library creation, testing of library complexity by nested semi-
random PCR, preparation of the library for high-throughput
screening, and bioinformatic analysis of outputs from Tn-seq.

2 Materials

2.1 Transposon 1. Bacterial strains and plasmids.

Mutagenesis [16, 19] ● P. gingivalis.
● E. coli S17-1 λpir.
● Plasmids pSAM and pSAM_Bt.
 Defining Essential Genes and Identifying Virulence Factors of Porphyromonas… 27

2. Media.
● P. gingivalis solid media:
Blood agar plates (BAPHK).
– Trypticase soy agar.
– Defibrinated sheep’s blood (5.0 % vol/vol).
– Hemin (5.0 μg/ml).
– Vitamin K (0.5 μg/ml).
P. gingivalis liquid culture:
● Brain–Heart Infusion Broth (BHIHKSbcStgC).
– Brain–heart infusion.
– Yeast extract (1.0 mg/ml).
– Hemin (5.0 μg/ml).
– Vitamin K (0.5 μg/ml).
– Sodium bicarbonate (1.0 mg/ml).
– Sodium thioglycolate (0.25 mg/ml).
– Cysteine (0.5 mg/ml).
● P. gingivalis antibiotics gentamicin (25–50 μg/ml) and
erythromycin (2–10 μg/ml).
● E. coli Luria broth base (LB) or Luria agar.
● E. coli antibiotic carbenicillin (50 μg/ml).
3. GasPak™ EZ Anaerobe Pouch System (BD Biosciences)
(http://www.bdbiosciences.com/).

2.2 Nested Semi- 1. DNeasy (Qiagen) (http://www.qiagen.com/).

random PCR 2. Nuclease-free water (Ambion) (Invitrogen) (http://www.
lifetechnologies.com/).
3. GoTaq DNA Polymerase (Promega) (http://www.promega.com/).

2.3 Library 1. 2 ml round-bottom microfuge tubes.

Preparation 2. Branson 450 sonifier.
for Tn-seq [18–20]
3. High intensity cup horn.
4. Circulating water bath.
5. TdT enzyme (Promega) (http://www.promega.com/).
6. 5× TdT reaction buffer (Promega) (http://www.promega.com/).
7. Dideoxy CTP (Affymetrix) (www.affymetrix.com/).
8. dCTP.
9. dNTP mix.
10. Easy-A DNA polymerase mix (Agilent) (www.agilent.com/).
Random documents with unrelated
content Scribd suggests to you:
Il loro vestiario, come quattrocento anni fa, si compone ancora d’un
semplice sottanino di foglie intrecciate, il guayaco come lo chiamano
loro, e le loro armi non hanno cambiato possedendo ancora le
cerbottane, le mazze e qualche arpione per uccidere gli alligatori ed i
lamantini.
Gli uomini che erano improvvisamente comparsi e che s’inseguivano
gettando urla furiose, accapigliandosi, graffiandosi, picchiandosi coi
pugni e coi piedi, parevano veramente ebbri, come aveva detto il
dottore. Non si erano ancora accorti della presenza degli uomini
bianchi, i quali avevano eseguita una prudente ritirata nella
scialuppa, armando, per maggior precauzione, i fucili.
— Ma cosa fanno? — chiese Alonzo, che non li perdeva di vista.
— Si picchiano, come ben vedi, — rispose il dottore. — Sono
ubbriachi di niopo.
— Di rhum o di cascara, forse?
— No, è una polvere composta di foglie di mimosa e d’una calce
estratta dalle conchiglie d’un mollusco molto comune su questo
fiume,
— È una specie di tabacco adunque, — disse don Raffaele.
— Ha le stesse proprietà del tabacco, dell’oppio e del betel [5] che
masticano gl’Indocinesi ed i Malesi, ma l’abuso produce una strana
malattia che rende litigiosi, battaglieri. Gli Ottomachi approfittano
sempre di quella eccitazione per sfogare i loro rancori.
— Finchè si limitano ai pugni ed ai calci poco male, — disse Alonzo.
— Fanno di peggio, giovanotto, — disse il dottore. Si bagnano le
unghie, che usano portare lunghe, nel succo velenoso del curare,
producendo ben sovente delle ferite mortali.
Gli Ottomachi intanto, sempre battagliando, erano giunti sulla
sponda del fiume, a cinquanta passi dalla capanna. Erano tanto
assorti nella loro lotta che non si erano ancora accorti degli
spettatori.
Ad un tratto un di loro, impotente a far fronte all’avversario, cadde
nel fiume, su di un bassofondo. Subito si vide sollevarsi a lui
d’intorno un nembo di spuma, apparire una testa mostruosa ed una
coda armata di scaglie ossee, poi si udì un grido acuto, straziante.
L’indiano aveva risalita prontamente la sponda, ma metà del suo
braccio sinistro era rimasta fra le mascelle d’un caimano che
sonnecchiava sul bassofondo.
Quel caso inaspettato parve che facesse sfumare di colpo l’ebbrezza
dei combattenti e che assopisse tutto d’un tratto i loro rancori.
Di comune accordo si erano slanciati verso il compagno, dal cui
braccio mozzato sfuggiva, a rapide pulsazioni, un largo getto di
sangue spumoso.
Yaruri ed i tre uomini bianchi avevano afferrato i remi e spinto la
scialuppa verso la sponda per soccorrere il disgraziato, il quale
minacciava di morire per la violenta emorragia.
— Vengo a guarirti, — disse il medico balzando rapidamente a terra
e dirigendosi verso il mutilato.
Gli Ottomachi, vedendo quegli uomini sbarcare, non avevano tradito
alcuna sorpresa. Si erano limitati a gettare uno sguardo più sulla
scialuppa che ammiravano, che sui nuovi arrivati.
— Mostrami il tuo braccio, — disse Velasco, al mutilato. — Sono un
piaye [6].
— Dammi dell’aguardiente [7] se ne hai, — rispose invece il ferito. —
Mi farà meglio delle tue cure.
— Ma, disgraziato, tu morrai se non mi lasci fasciare la ferita.
Un sorriso sprezzante apparve sulle labbra dell’indiano, il quale
pareva non provasse il menomo dolore, tanto è potente in loro la
forza d’animo.
— Ne sappiamo più dei piaye degli uomini bianchi, — disse poi. —
Ecco chi mi guarirà!
Un indiano, che era poco prima entrato nella foresta, ritornava
armato di un coltello di recente arrotato e munito di parecchi oggetti
involti in alcune grandi foglie.
— A te! — disse il mutilato, stendendo il braccio sanguinante.
— Lo rovinerà, — disse Alonzo. — Impeditegli di operare, dottore.
— Lasciamolo fare, giovanotto, — rispose Velasco. — Vedrai che
valenti operatori sono questi selvaggi.
Il ferito si era inginocchiato stendendo il braccio sul tronco di un
albero abbattuto. La mutilazione era spaventevole: l’osso era stato
sfracellato di colpo dalle formidabili mascelle del mostro, e la carne
presentava degli strappi come se quel povero braccio fosse stato
dilaniato da un ingranaggio. Pure l’indiano conservava una calma
impassibile, straordinaria; solamente un freddo sudore che
bagnavagli la fronte, tradiva le sue atroci sofferenze.
L’operatore prese l’estremità di quel membro che emetteva di tratto
in tratto dei getti di sangue, impugnò il coltello, recise nettamente
l’osso, poi tagliò i brandelli di carne con una maestria ammirabile e
senza che il ferito emettesse un solo gemito.
Livellata la mutilazione, prese un po’ di musco secco, lo bagnò
copiosamente con un liquido che era racchiuso in una zucca, lo
applicò sul moncherino, poi vi sovrappose uno strato di creta e fasciò
il tutto con alcune foglie ed una liana.
Era tempo: lo sventurato, indebolito dalla perdita di sangue, si era
lasciato cadere sull’erba, emettendo un profondo sospiro.
— Ecco fatto, — disse Velasco.
— Guarirà? — chiese Alonzo.
— Fra un mese la ferita sarà rimarginata.
— Ma che liquido ha versato sul musco?
— L’uenuba, la panacea indiana delle piaghe, un succo che ha la
proprietà di essiccare prontamente le ferite.
In quell’istante il mutilato si era rialzato. Egli additò ai compagni il
fiume dicendo:
— Il mio braccio è rimasto là.
— Lo ritroveremo, — risposero i suoi compagni.
— Mi occorre il cuore del caimano.
— Lo mangerai presto.
— Ed il mio braccio.
— Lo riavrai.
Ciò detto gli Ottomachi coricarono il loro compagno in un’amaca che
avevan tesa fra due rami, gli fecero bere una lunga sorsata di liquore
estratto dalle radici del manioca fermentato, poi si diressero verso il
fiume e si misero a scrutare le acque con profonda attenzione.
— Cosa fanno? — chiese Alonzo.
— Si preparano a vendicare il loro compagno, — rispose don
Raffaele. — Fra poco uccideranno il caimano.
— Colle freccie?
— Lo prenderanno col laccio. Eccoli al lavoro.
Gli Ottomachi, dopo un breve consiglio, erano rientrati nella foresta
nella quale dovevano sorgere le loro abitazioni. Dopo un quarto d’ora
erano di ritorno con altri dieci compagni, tutti carichi di corti pali
acuminati che accumularono sulla sponda. Ripartirono e tornarono
con altri nè si arrestarono finchè non ne ebbero trasportati
moltissimi.
Allora cominciarono a scendere sul bassofondo ed a piantarli
formando un semicerchio, ma che aveva una stretta apertura verso il
punto ove l’acqua era più profonda.
In quel passaggio tesero il laccio destinato al caimano, formato da
un nodo scorsoio di fibre di tucum e d’un giovane albero fortemente
piegato e tendente a riprendere la posizione verticale.
Terminato quel lavoro, compiuto in un tempo brevissimo, ritornarono
verso la sponda, un solo eccettuato, il quale era rimasto nascosto nel
recinto tenendo in braccio un piccolo pecari, una specie di cinghiale
selvatico che puzza di muschio.
— Attento, Alonzo, — disse il dottore. — Fra poco il goloso caimano
giungerà.
— Verrà a gettarsi stupidamente nel laccio.
— Il pecari è un boccone ghiotto. Odi?... Il piccolo cinghiale aveva
emesso un grido acuto. L’indiano che lo teneva in braccio,
pizzicavagli fortemente gli orecchi per farlo urlare.
Il caimano però, messo forse in sospetto da quella cinta che poco
prima non esisteva, si manteneva nascosto in fondo al fiume. La sua
ingordigia però doveva vincere ben presto la sua diffidenza.
Infatti, udendo le urla sempre più acute del pecari, dopo dieci minuti
si vide l’acqua rigonfiarsi dinanzi all’apertura del recinto. Il ghiottone
giungeva, ma con mille precauzioni e tenendosi nascosto sott’acqua
per non farsi scorgere.
Quelle grida che promettevano una preda appetitosa, esercitavano
su di lui un fascino irresistibile.
Gl’indiani non fiatavano. Armati delle loro pesanti mazze, di qualche
scure e di qualche arpione, attendevano il momento opportuno per
scendere sul bassofondo. Don Raffaele ed i suoi compagni stavano
pure zitti, ma avevano armato i fucili per aiutare gli Ottomachi nella
pericolosa impresa.
Ad un tratto si scorse il muso del caimano presso la cinta. Il mostro
esitò un istante ancora, poi si cacciò nella stretta apertura, ma non
potendo passare, con urto violento spostò i primi pali. L’albero si
rizzò improvvisamente facendo scattare il laccio ed il saurio, preso a
mezzo corpo da quella robusta corda che gli si era stretta intorno, si
sentì strappare dall’acqua e sollevare in alto.
Quale spettacolo offrì allora il mostro sospeso all’albero!... Era lungo
cinque metri, aveva le mascelle armate di una doppia fila di denti
formidabili, bianchi come l’avorio e triangolari, e una coda enorme,
coperta di grosse scaglie rugose. Si dibatteva furiosamente facendo
scricchiolare l’albero, sbarrava gli occhi sanguigni, ma che avevano
dei lampi giallastri, demoliva i pali colla possente coda ed emetteva
certi brontolìi paragonabili al tuono udito in lontananza.
Gl’indiani si erano slanciati nel recinto mandando urla di trionfo ed
agitando furiosamente le loro mazze, le scuri e gli arpioni, ma non
osavano avvicinarsi al mostro che si dibatteva con crescente furore,
minacciando di accopparli a colpi di coda.
— A noi, — disse don Raffaele, puntando il fucile.
Attesero che il caimano mostrasse loro il ventre, poi fecero fuoco
simultaneamente. Il mostro fece un ultimo e più tremendo balzo,
agitò furiosamente la coda per alcuni istanti, poi si distese,
penzolando dall’albero come un appiccato.
Gli Ottomachi recisero la corda facendolo cadere sul bassofondo, lo
trascinarono sulla sponda e lo sventrarono a colpi di scure,
frugandogli nelle viscere.
Pochi istanti dopo un indiano offriva al povero mutilato, che era
sempre disteso nella sua amaca, il suo pezzo di braccio che il
caimano aveva inghiottito intero come fosse un semplice zuccherino.
— Dov’è il cuore? — chiese il ferito.
— Eccolo, — disse l’indiano porgendogli il cuore del mostro che
ancora palpitava, tanto è potente la vitalità di quei saurii.
Un lampo di soddisfazione balenò negli occhi del ferito.
— Sono vendicato, — disse.
E lo addentò rabbiosamente, crudo come era, masticandolo con
invidiabile appetito.
 VIII.
Le testuggini dell’Orenoco.

Gli Ottomachi, riconoscenti per l’aiuto ricevuto, si degnarono d’offrire

agli uomini bianchi un pezzo di coda di caimano, boccone scelto per
loro, ma niente affatto gradito ai palati europei che non riescono a
vincere l’acuto odore di muschio che appesta quella carne.
Don Raffaele, a nome dei compagni, pur ringraziando, rifiutò l’offerta
con maggior soddisfazione degli indiani, anzi regalò loro una bottiglia
di rhum che fu in un lampo vuotata da quegli ubbriaconi.
In cambio però, chiese loro se avessero scorto su quel tratto di
fiume un canotto montato da indiani armati di fucile, ma non riuscì a
sapere nulla. Dei canotti ne erano passati parecchi in quindici giorni,
ma nessun Ottomaco aveva fatto caso se gli indiani che li montavano
erano armati o inermi. Prevedendo che non avrebbero ricavato altre
notizie, lasciarono quei selvaggi occupatissimi ad arrostire la preda
gigante, e sciolte le vele ripresero la navigazione per raggiungere la
foce del Maniapure.
Le sponde del fiume erano ridiventate deserte non essendovi, in quei
dintorni, a quanto pareva, altre tribù di Ottomachi, ed avevano
inoltre subìto dei cambiamenti. Frequenti fiumi rompevano le foreste,
riuniti fra di loro da canali interni chiamati comunemente neirim-
igarape, ossia sentieri dei canotti, secondo l’espressione indiana. Si
vedevano pure degli ampi stagni che comunicavano col fiume, delle
agoas redonde.
Sopra quegli stagni ripieni di piante acquatiche colle foglie immense,
cicalavano o strillavano bande di carpideira o choradeira, vale a dire
uccelli piagnoni perchè hanno un canto così lamentevole che si
direbbe che piangano. Sulle sponde invece si vedevano correre e
saltellare numerosi capibara, grossi roditori grossi come un cane, col
mantello nero, terribili devastatori delle piantagioni, ma poco pregiati
come selvaggina, avendo la carne assai calorosa; apparivano anche,
ma più rari, dei gamba, marzupiali somiglianti ai conigli, che hanno
una tasca sotto all’addome ove ripongono i piccini e che quando
sono inseguiti sprigionano un odore così fetente da arrestare non
solo i cacciatori, ma perfino i cani. Anche la carne di questi animali è
poco buona, essendo nera e coriacea, ma gl’indiani non la sdegnano.
Verso il mezzodì, mentre i naviganti si preparavano ad assalire la
colazione allestita nella scialuppa, si vide Yaruri balzare rapidamente
in piedi, mentre con un rapido colpo faceva cadere la randa.
— Cos’hai? — chiesero i tre bianchi.
— Là.... sulla sponda, — disse l’indiano.
Guardarono nella direzione indicata e su di una riva bassa e sabbiosa
videro trascinarsi penosamente con delle mosse ridicole dei larghi
corpi che parevano usciti allora dal fiume.
Erano trenta o quaranta testuggini, ma della specie più grande,
poichè misuravano almeno due metri di larghezza su una lunghezza
di cinquanta o sessanta centimetri. I loro gusci avevano dei riflessi
verdastri ma marmorizzati di nero.
— Sono testudos mejolas, — disse don Raffaele. — Un arrosto che
merita di venire assaggiato.
— Ma ne vedo altre su quel banco di sabbia, — disse il dottore. —
Sono le careto.
Infatti un po’ più lontano, su di un banco, si vedevano altre
testuggini più piccole bensì, ma col guscio assai più bello e più
pregiato. Erano di colore bruno, chiazzate di macchie rossastre
irregolari, ma i loro gusci sono formati di tredici lamine poste sopra e
dodici sotto. È dalle prime solamente che si ricava la tartaruga
messa in commercio.
— Ma cosa fanno tutte quelle testuggini? — chiese Alonzo.
— Stanno seppellendo le loro uova, — rispose il dottore. — Andiamo
a fare una frittata.
Yaruri aveva già afferrati i remi e spingeva lentamente la scialuppa
verso la sponda. Le testuggini però vegliavano e accortesi della
presenza dei nemici facendo sforzi disperati raggiunsero il fiume e si
tuffarono rapidamente.
— Non monta, — disse don Raffaele. — Ci rifaremo colle uova.
Toccata la sponda, s’affrettarono a sbarcare, ma Alonzo, con sua
grande sorpresa, non vide alcun uovo.
— Ma dove sono? — chiese.
— Sotto la sabbia, — disse don Raffaele, — ma ti sfido a trovarle.
Solamente gl’indiani sono capaci di scoprirle.
— Avranno lasciato qualche segno dove le hanno sepolte.
— Nessuno, cugino; puoi accertartene.
Alonzo si mise a percorrere la sponda in tutti i sensi, ma non trovò
alcun segno che indicasse ove le uova erano state nascoste. Yaruri lo
osservava sorridendo maliziosamente.
— Fulmini e lampi! — esclamava il giovanotto stizzito, frugando e
rifrugando le sabbie, ma senza successo.
— A te, Yaruri, disse don Raffaele. — Se aspettiamo che mio cugino
le trovi, la frittata si farà attendere fino a domani.
L’indiano si mise a percorrere la sponda con passo rapido, sulla
punta dei piedi, ma con un’andatura inquieta. Ad un tratto si curvò,
si mise a scavare la sabbia e mise allo scoperto un gruppo d’uova
rotonde, un po’ più grosse di quelle di gallina, che si trovava sepolto
a otto o dieci centimetri di profondità.
— Ma io non ho veduto alcuna traccia sopra quella covata, — disse
Alonzo, che aveva seguito l’indiano.
— Le testuggini, te l’ho detto, non ne lasciano e livellano le sabbie
con cura estrema per impedire che le ova vengano trovate, — disse
don Raffaele.
— Ma come fanno allora a scoprirle?
— Non lo si sa.... ma to’!... Cos’è questa traccia? — chiese,
mostrando sulla sabbia una buca che aveva la forma d’un pesce, ma
un po’ arrotondata.
— Se ne trovano soventi sulle rive di questo fiume, — rispose il
dottore. — Si dice che in quelle buche vadano a dormire le razze, ed
infatti vedete che hanno precisamente la forma di quei pesci.
— Che sia vero?
— Non lo so, ma così dicono i pescatori e gl’indiani.
— E quell’animale che striscia laggiù e che cerca di guadagnare quel
crepaccio, cosa sarà? — chiese Alonzo, imbracciando il fucile.
— Una testuggine, — disse il dottore.
— Una testuggine! Ma se è priva del guscio? Io vi dico che è un
rettile di nuova specie.
— T’inganni, giovanotto, è una vera testuggine e della specie careto.
— Ma non vedete che è un mostro orribile e pare scorticato di
recente?
— Uccidilo e mangeremo un buon arrosto, — disse il dottore,
sorridendo.
Il giovanotto non si fece ripetere il comando e con una palla ben
aggiustata stese a terra quello strano animale, proprio sull’orlo del
crepaccio che stava per raggiungere.
Il cacciatore si slanciò innanzi seguito dal dottore, mentre Yaruri e
don Raffaele accendevano il fuoco per preparare la promessa
frittata.
Il dottore aveva detto il vero: quel rettile era realmente una
testuggine careto, ma ridotta in uno stato compassionevole. Non
aveva più il suo bellissimo guscio bruno chiazzato di macchie
rossastre e trasparenti, pareva che fosse stato strappato
brutalmente. Il dorso era tutto una piaga sanguinante, ma coperto
qua e là da un principio di sostanza cornea ed ineguale.
— Mille fulmini! — esclamò Alonzo, stupito. — Chi ha ridotto in
questa raccapricciante condizione questo povero rettile? I caimani
forse?
— No, — disse il dottore, — i cacciatori di tartaruga.
— Cosa volete dire?
— Che i cacciatori hanno strappato il guscio a questa testuggine, per
impadronirsi della scaglia.
— Spiegatevi meglio, dottore.
— Voglio compiacerti, giovanotto. Ti dirò adunque che sull’Orenoco,
sull’Amazzone e sui grandi fiumi di tutta l’America del Sud, vi sono
bande d’uomini che fanno una caccia spietata a questi disgraziati
rettili. Se le testuggini prese sono grasse (e per accertarsene
praticano una profonda incisione sotto la coda) le uccidono
impadronendosi del guscio e del grasso da cui si ricava un olio
limpido, dai riflessi verdognoli, di una squisitezza incredibile,
superiore a tutti gli olii conosciuti. Se le testuggini sono magre, le
privano del guscio facendo subire a quelle disgraziate una atroce
tortura, mediante una lama taglientissima, poi le abbandonano
perchè abbiano il tempo d’ingrassarsi ancora.
— Ma non muoiono dopo così crudele trattamento?
— No, poichè hanno la vita dura. Vanno a rannicchiarsi in un
crepaccio che diventa il loro ospedale e colà attendono che la natura,
più pietosa degli uomini, le ricopra d’un nuovo guscio, il quale non
sarà mai nè così bello, nè così perfetto come il primo.
— Sembra impossibile che possano ancora guarire, dottore.
— Hanno una vitalità incredibile questi rettili. Mi ricordo che uno
scienziato dell’America settentrionale ebbe un giorno il capriccio di
aprire il cranio ad una tartaruga gigante dell’Himalaja, privandola
con bel garbo del cervello. Richiusa la scatola ossea, nutrì per alcuni
giorni il rettile, il quale, incredibile a dirsi, rifece il cervello, s’ingrassò
e visse ancora cinquant’anni.
— Hanno vita lunga questi rettili, dottore?
— Vivono dei secoli, a quanto pare, poichè so che un piantatore
della Florida, qualche anno fa, prese una testuggine sul cui guscio
portava incise queste parole: «Presa da Ferdinando Gomez nella
riviera del San Sebastiano l’anno 1700.» Quel rettile aveva adunque
circa 145 anni. Si dice che le tartarughe giganti dell’Himalaja e delle
isole Mascarene vivano, racchiuse nelle loro rocce secolari, ben
cinquecent’anni.
— E ne distruggono molte i cacciatori di gusci?
— Le migliaia, poichè la caccia è facile e senza pericoli, bastando
rovesciare i poveri rettili sul dorso per impedir loro di fuggire. Su
certi fiumi cominciano già a diventare rari e la scaglia non abbonda
più come vent’anni or sono sui mercati. Se la distruzione continua,
fra un secolo forse non si troverà più scaglia sufficiente per montare
gli occhiali alle generazioni, sempre più miopi, che si succedono.
Basta, sento il profumo della frittata e odo la voce di don Raffaele
che ci invita a colazione. Prendi la tua selvaggina che ci servirà
d’arrosto domani mattina.
Alonzo si caricò della testuggine e raggiunsero i compagni che
avevano già preparata una appetitosa e gigantesca frittata esalante
un profumo delizioso. Il giovanotto fece più che onore a quel pasto e
ripetè più volte la porzione, lodando la squisitezza di quelle uova che
non la cedevano a quelle delle migliori galline.
Avevano accese le sigarette e stavano per sdraiarsi sulla sabbia,
all’ombra di una palma colossale, quando udirono uno strano
gorgoglìo che usciva da una macchia di mucusumù.
— Cosa c’è ancora? — chiese Alonzo alzandosi. — Delle altre
testuggini che vengono a deporre delle uova?
— Vediamo, — disse don Raffaele, balzando in piedi. — Potrebbe
esservi qualche serpente.
Alonzo l’aveva già preceduto e aveva già raggiunta la macchia. Vi
gettò entro uno sguardo, ma tosto indietreggiò facendo un gesto di
ribrezzo ed esclamando:
— Oh! l’orribile rospo!...
— Cos’è? — chiese don Raffaele, avvicinandosi ai mucusumù. — Ah!
Un pipa!...
— Una pipa! Ma che pipa! È un rospo, cugino mio, e dei più brutti.
— Ma dei più interessanti, Alonzo. Guardalo attentamente: è un vero
pipa, tale è il nome datole dalla signora Sibilla di Meriam, che vide
per la prima volta questi strani batraci nel Surinam, due secoli or
sono.
Il giovanotto, vincendo il proprio ribrezzo, tornò ad appressarsi alla
macchia. Là in mezzo si trovava nascosto un grossissimo rospo col
corpo piatto e quasi quadrangolare, col muso aguzzo, le dita delle
zampe davanti terminanti in quattro punte invece di cinque, e la
pelle nera, ma senza essere lucida.
— Guarda cos’ha sul dorso, Alonzo, — disse il dottore che lo aveva
raggiunto.
Il giovanotto guardò e con grande stupore vide che il dorso di
quell’orribile rospo era coperto di piccole cellette in ognuna delle
quali stava nascosto un rospicino.
— Oh che strana cosa! — esclamò.
— È una particolarità dei pipa! — disse il dottore. — Gli altri rospi
depongono le loro uova in acqua, formando dei piccoli cordoncini;
questi pipa invece li collocano sul dorso delle femmine in quelle
cellette che tu vedi e vi rimangono finchè possono procurarsi il cibo
da loro. È una cosa assai curiosa, ma verissima, come ben vedi.
— Lo vedo, dottore.
— Ma questi rospi hanno anche un’altra particolarità, cioè sono privi
della lingua.
— Ciò non impedisce che siano ben brutti, dottore.
— Lo credo. Lasciamo che il pipa si diverta coi suoi piccini e noi
andiamo a schiacciare un sonnellino in attesa della brezza. È appena
mezzodì e abbiamo del tempo per giungere al Suapure.
 IX.
Una freccia mortale.

I giorni seguenti, volendo affrettare la marcia per giungere alle

grandi cateratte prima che il fiume toccasse la massima piena,
avendo già da tre mesi cominciato il suo periodico innalzamento,
navigarono quasi senza interruzione, non facendo che brevissime
fermate per procacciarsi un po’ di carne fresca.
Più nulla di straordinario era accaduto. Degli indiani armati di fucile
nulla avevano saputo, non avendoli più veduti, nè avendo incontrato
nessun’altra banda di Ottomachi, sicchè li avevano dimenticati.
Avevano invece superate le foci di numerosi e grossi fiumi che si
riversavano con grande impeto nella grande fiumana.
Avevano già oltrepassato il Maciapure, grosso affluente di destra,
che gli indiani chiamano Amarapuri, noto soltanto per una
gigantesca cascata situata presso la sua sorgente, ma che produce
tale fracasso da udirsi perfino alla foce; poi il Suapure più sotto,
grosso affluente pieno di cascate e di passi assai pericolosi, che
bagna un paese ricchissimo di mele selvatiche ed abitato dalla tribù
dei Pafechi; quindi il Pao, il Cauxi, il Vacari, il Sinaruco, il Capure che
viene considerato da taluni come un ramo del Meta e pel quale
sarebbe disceso Barreo, il primo dei conquistatori spagnuoli che
tentò d’impadronirsi di quella immensa e ricca regione.
Dieci giorni dopo la loro partenza dalla piantagione, toccavano la
foce del Cassanare, grande fiume che scaricasi nell’Orenoco venti
leghe a settentrione del Meta, che si può navigare un mese intero
senza toccare le sue sorgenti e che bagna un paese dei più fertili
della Columbia.
Un tempo le sue sponde erano gremite di borgate erette dai gesuiti,
ma gl’indiani ben presto le disertarono per ritornare all’antica vita
selvaggia, ben più cara a loro della vita civile e sedentaria.
Anche sulle sponde dei fiumi vicini, sull’Urupi che lanciasi
nell’Orenoco da una rupe altissima detta la Tigre, e sul Sinaruco, nel
diciassettesimo secolo i gesuiti avevano raccolto in borgate le tribù
dei Cirecoi e degli Jaruri, ma anche quelle ben presto scomparvero
per opera della potente tribù dei Caribbi che già distrusse, nello
scorso secolo, un grande numero di nazioni orenochesi, fino a che, a
sua volta, venne poi fiaccata e per sempre, dalle grandi tribù alleate
dei Caveri e dei Guipunavi.
Essendo la foce del Cassanare deserta e mancando la brezza, don
Raffaele decise di arrestarsi una giornata per dare un po’ di riposo ai
compagni ed anche per rifornirsi di carne fresca. Non voleva toccare
le provviste di riserva che potevano diventare indispensabili durante
la grande piena, nel caso che dovessero trovarsi, in quell’epoca,
ancora sul fiume gigante.
Il luogo scelto per l’accampamento era l’estremità d’una penisola che
divideva i due fiumi, ombreggiata da alcuni gruppi di candelabri
(curopia), strani alberi, curiosissimi per la regolare disposizione dei
loro rami e per le tinte argentine delle foglie e che producono frutti
grossi quanto quelli degli alberi del pane, ma di forma più cilindrica.
Ancorata la scialuppa sulla sponda e assicurata solidamente per
impedire alle correnti di trascinarla via, i viaggiatori tesero fra i rami
degli alberi le loro comode amache per preservarsi dai serpenti che
sono numerosissimi in quelle regioni.
Essendo già il sole prossimo al tramonto, rimandarono la battuta dei
boschi all’indomani, contentandosi per quella sera d’un arrosto di
pappagalli.
Erano in procinto di spegnere il fuoco per non attirare l’attenzione di
qualche tribù d’indiani, persone più da temere che da avvicinare,
quando l’acuto udito dell’indiano fu colpito da un legger rumore che
si udiva in mezzo alle piante di legno cannone che costeggiavano
una piccola palude non ancora visitata.
— Là, — diss’egli stendendo il braccio verso la palude.
— Uomo od animale? — chiese don Raffaele.
— Animale, — rispose l’indiano, sempre avaro di parole.
— È per te, Alonzo, disse il piantatore.
— Quando si tratta di procurarci delle bistecche, sono sempre
pronto, — rispose il giovanotto.
— Purchè non siano di giaguaro, — disse il dottore. — In tal caso, te
le lascio, poichè, oltre essere pericolose a guadagnarsi, puzzano di
selvatico.
— Molti animali, — disse Yaruri, — che ascoltava sempre.
— Vieni, Yaruri, — disse Alonzo.
L’indiano si armò della sua cerbottana e di tre freccie e seguì il
giovane cacciatore il quale si era già messo in cammino.
Faceva ancora abbastanza chiaro per poter distinguere la selvaggina,
non essendo il sole ancora del tutto tramontato. Bisognava però
affrettarsi, poichè sotto l’equatore il crepuscolo è di breve durata.
Procedendo rapidamente, pur con precauzione, in pochi minuti
l’indiano ed Alonzo raggiunsero il margine della palude, la quale
aveva una estensione notevole. Colà giunti videro che le piante di
legno cannone si muovevano a circa quattrocento passi da loro,
verso l’estremità della grande foresta che si stendeva sulle sponde
dei due fiumi.
— Credo che siano tapiri, — disse Yaruri.
— Che animali sono? — chiese Alonzo.
— Grossi molto, ma la loro carne è un po’ coriacea.
— Sono pericolosi?
— Niente affatto.
— Allora li uccideremo più facilmente.
Approfittando degli ultimi bagliori del crepuscolo, girarono la palude
e giunsero là dove si agitavano i fusti lucenti del legno cannone.
Un animale grosso come un vitello, ma col corpo male tagliato che
rassomigliava a quello d’un maiale, con un muso allungato che
terminava in una piccola proboscide, colla pelle rugosa come quella
degli ippopotami e coperta di peli fini e radi sul dorso, ma più fitti sul
collo e presso la coda, era occupato a masticare molto
rumorosamente delle radici che cercava sott’acqua.
— Non mi ero ingannato, — disse Yaruri. — È un tapiro.
— Lo uccido con una palla nel cranio, — disse Alonzo.
Aveva già alzato il fucile, quando l’indiano glielo abbassò.
— Cos’hai? — chiese il giovanotto, sorpreso.
— Guarda!
— Non vedo nulla.
— Dietro al tapiro.
Alonzo alzò gli occhi e vide un oggetto nero lungo lungo, grosso
come la coscia d’un uomo, sorgere dalla palude dietro al tapiro ed
avanzarsi silenziosamente.
— Un serpente? — chiese Alonzo, rabbrividendo.
— Sì.
— Preferisco uccidere il serpente.
— È inutile.
— Perchè?
— Lo ucciderà il tapiro.
— Tu vuoi burlarmi. Nessun animale resiste alle strette terribili di
quei serpenti d’acqua.
— Yaruri ha veduto i tapiri uccidere i serpenti. Guarda!...
Il serpente, un enorme boa acquatico, che doveva misurare
l’incredibile lunghezza di dodici o tredici metri, si era rapidamente
disteso ed in un baleno aveva stretta la vittima fra le sue potenti
spire.
È noto che i boa, sia il constrictor che vive nelle regioni aride ed
infuocate dell’America del Sud, come il scitale o anaconda che vive
nelle paludi o lungo i fiumi, posseggono tale forza da stritolare, fra le
loro anella, perfino i buoi. Nondimeno il tapiro, pur sentendosi a
stringere, non sembrava per nulla spaventato.
Alonzo, che non lo perdeva di vista, lo vide ad un tratto impicciolirsi
come se avesse emessa tutta l’aria che aveva nei polmoni, per
gonfiarsi rapidamente e diventare una volta e mezza più grosso di
prima. Il boa, che aveva stretto le anella, non ebbe il tempo di
svolgerle. Si udì uno scricchiolìo come se la colonna vertebrale fosse
stata bruscamente distaccata, poi il gigantesco serpente svincolò la
coda e cadde al suolo come un pacco di biancheria umida.
— Il furbo! — esclamò una voce dietro ad Alonzo.
Era il dottore che li aveva raggiunti per vedere con quale specie di
selvaggina avevano da fare.
— Ma ora gli mando una palla, — disse Alonzo.
— È inutile, giovanotto, non ne vale la pena. Quel povero tapiro è
affatto inoffensivo e la sua carne è così secca e di gusto così
sgradevole, che persino certe tribù indiane la sdegnano. Lascialo
andare, chè si è meritata l’esistenza.
— Pure mi hanno detto che gl’indiani lo cacciano attivamente.
— Sì, ma per averne la pelle, la quale, essendo molto resistente,
serve per fabbricare scudi e delle ottime scarpe.
— Ma che animali sono questi tapiri? Che esistenza conducono? Non
sono carnivori?
— Sono solitarii, di umore piuttosto malinconico e niente affatto
carnivori; perciò inoffensivi. Vivono isolati in fondo alle più folte
foreste che non abbandonano che al tramonto per recarsi nelle
paludi. Talvolta però, durante i giorni piovosi, escono anche di
giorno, ma di rado però. Sono dei veri anfibi, poichè prediligono
l’acqua e vi s’immergono con facilità per cercare il loro nutrimento il
quale consiste in radici acquatiche che scavano con quella corta
proboscide che tu vedi mobilissima.
— È vero, dottore, che i tapiri formano delle strade in mezzo ai
boschi?
— Sì, Alonzo. Facendo sempre la medesima via dal loro covo alla
palude più vicina e così pure nel ritorno, senza mai deviare d’una
linea, finiscono col tracciare in mezzo ai boschi dei veri sentieri che
diventano molto pericolosi per loro, poichè i cacciatori ne
approfittano per trovare i covi degli animali.
— Somigliano ai porci per abitudini? Vedo che quel tapiro si diverte
ad avvoltolarsi nel fango come un vero maiale.
— T’inganni, poichè invece sono assai puliti. Quando si sarà bene
inzaccherato di fango si laverà per bene.
— Ma ditemi, dottore, come ha fatto a uccidere quel serpente?
— Quel boa acquatico?... È un modo che i soli tapiri possono usare,
poichè quegli anaconda, così si chiamano quei pericolosi serpenti,
posseggono tale forza da stritolare perfino i giaguari. Avendo i tapiri
dei polmoni enormi, appena si sentono afferrare emettono tutta l’aria
diventando più piccini. I serpenti ne approfittano per stringere di più,
ma allora gli altri riempiono rapidamente i polmoni, si gonfiano d’un
tratto e in tal modo spezzano gli anelli vertebrali dei nemici.
— Un sistema molto curioso.
— Ma molto utile, lo hai veduto, Alonzo, e se....
Un grido acuto echeggiato in mezzo alla cupa foresta, gli tagliò la
frase. Era ancora quel grido enigmatico, strano, che avevano già
udito e che rassomigliava a quello del tucano, ma assai più potente.
Yaruri era balzato innanzi emettendo una sorda esclamazione.
— Ancora! — disse il dottore, aggrottando la fronte.
— Ma è un segnale adunque? — chiese Alonzo.
— Sì, un segnale, — disse Velasco.
— Qualcuno adunque ci segue o ci precede.
— Lo temo, Alonzo.
— Ma che non si possa scoprirlo?
— Chi lo troverebbe in mezzo a queste foreste oscure?
— Ma domani farà chiaro e cercheremo l’autore o gli autori di questi
segnali.
— Se questa notte non fuggiranno.
— Sorveglieremo le sponde del fiume.
Yaruri era tornato verso di loro: era inquieto ed in preda ad una viva
emozione.
— Hai veduto nulla? — gli chiese Velasco.
— No.
— Ma chi credi che siano?
— Un indiano tutto non può sapere.
— Ritorniamo all’accampamento, — disse Alonzo. — Non è prudente
lasciare solo mio cugino.
— Hai ragione, Alonzo.
Si misero in cammino costeggiando la palude, tenendo in mano le
armi per essere pronti a respingere qualunque aggressione.
Avevano già percorso duecento passi, quando Yaruri s’arrestò
bruscamente. Un uccello si era alzato rumorosamente, forse un
grosso pappagallo od una arà, emettendo un grido di spavento.
Si era levato a trenta o quaranta passi di distanza verso la loro
destra.
Ad un tratto si udì un sibilo appena percettibile ed un cannello
adorno all’estremità d’un piccolo tappo di midolla di legno cannone,
andò a piantarsi nel tronco d’una palma, a due soli pollici dal capo di
Yaruri.
— Una freccia! — aveva esclamato il dottore. — Fuoco, Alonzo.
Fecero fuoco a casaccio verso la direzione ove era venuto quel
messaggero di morte. Appena cessate le due detonazioni, udirono
uno spezzarsi di rami, poi più nulla.
L’indiano si era scagliato in mezzo alla foresta brandendo la sua
cerbottana, ma si era subito trovato dinanzi ad una muraglia di
verzura così fitta e così irta di spine, che aveva dovuto arrestarsi e
tornare indietro.
Staccò la freccia che era formata d’un leggero cannello terminante in
un’acuta spina e se la mise sulle labbra.
— È intinta nel curare, — diss’egli, sputando.
— Ma ti avveleni! — esclamò Alonzo.
— Non temere, — disse il dottore. — Il curare è mortale solamente
se si mescola al sangue dell’uomo colpito, ma si può assaggiarlo
impunemente.
— Era destinata a noi quella freccia?
— A Yaruri, — disse il dottore. — Gl’indiani non falliscono mai e se
l’avessero destinata a noi, saremmo stati colpiti. Fortunatamente il
nostro indiano ha udito il sibilo a tempo ed ha potuto evitarla.
— Qualcuno adunque ha interesse a sopprimere Yaruri?
— Così la penso anch’io.
— Ma a quale scopo? Perchè lui invece di noi?
— Per privarci della guida che ci conduce alla città dell’oro; tale è il
mio sospetto. Affrettiamoci a ritornare prima che ci piova addosso
qualche altra freccia.
Si ripiegarono in fretta verso la sponda dove trovarono don Raffaele
assai inquieto ed in procinto di raggiungerli. Informato di ciò che era
avvenuto, approvò la proposta del dottore di vegliare attentamente
sul fiume e l’indomani battere la foresta per cercar di scoprire quei
nemici misteriosi.
 X.
Fra i pecari e le mosche-cartone.

Cenato in fretta, si concertarono tosto per impedire ai nemici di

prendere il largo e di risalire la grande fiumana.
Yaruri, il più valente di tutti nel dirigere la scialuppa, fu incaricato
della vigilanza della foce del Cassanare incrociando anche
nell’Orenoco; Alonzo, della sorveglianza d’una penisola che si
estendeva per lungo tratto nel fiume e che doveva, da quel posto,
tenere d’occhio un grande tratto di sponda. Raffaele e Velasco
s’incaricarono di vigilare i due margini dell’immensa foresta.
Visitate le armi per essere più certi dei loro colpi, i tre bianchi si
recarono nei luoghi indicati, portando con loro una coperta per
difendersi dall’umidità della notte, mentre Yaruri prendeva il largo a
bordo della scialuppa.
La notte era limpida e chiara, essendo la luna appena allora alzata;
solamente le rane ed i rospi rompevano il silenzio che regnava sulla
grande fiumana, ma a lunghi intervalli.
I tre bianchi e l’indiano tendevano gli orecchi sperando di raccogliere
qualche grido o lo sbattere delle pagaie di qualche canotto o lo
spezzarsi di rami nella foresta e aguzzavano gli occhi in tutte le
direzioni, ma nulla udivano; nulla appariva nè sulla argentea distesa
del fiume, nè sulle sponde, nè sotto i giganteschi alberi.
Solamente verso la mezzanotte parve a loro di vedere attraverso alle
piante un rapido bagliore, ma che subito si spense. Forse era stato
prodotto da qualche banda di moscas de luz, quantunque Yaruri ne
fosse poco convinto.
L’alba li sorprese ancora in agguato. Gli uccelli si svegliavano
empiendo l’aria di grida acute e di cicalecci interminabili e le scimmie
ricominciavano i loro concerti diabolici.
— Battiamo la foresta, — disse don Raffaele ai compagni, che si
erano riuniti. — Forse riusciremo a scoprire quei nemici che ci
seguono con tanta ostinazione e contemporaneamente rinnoveremo
le nostre provviste di carne fresca. Io e Yaruri ci terremo sulle
sponde del Cassanare per non perdere di vista la nostra scialuppa e
tu Alonzo e voi Velasco frugherete le foreste che si estendono sulle
sponde dell’Orenoco.
— Andiamo, dottore, — disse Alonzo. — So che siete un valente
cacciatore e se non troveremo quei nemici misteriosi, torneremo
almeno con un carico completo di carne fresca.
— Le mie gambe non sono giovani come le tue, ma sono ancora
robuste, — rispose il dottore. — In marcia.
— Un momento, — disse don Raffaele. — In caso di pericolo sparate
tre colpi ad intervalli di mezzo minuto l’un dall’altro.
— Siamo d’accordo, — rispose Alonzo.
Si separarono: Yaruri e don Raffaele internandosi nelle foreste
costeggianti il Cassanare e Alonzo ed il dottore quelle dell’Orenoco.
— Andiamo, giovanotto, — disse il dottore ad Alonzo. — Faremo un
lungo giro e ti mostrerò un bel tratto di una delle nostre foreste
vergini.
— Non chiedo di meglio, — rispose il giovane cacciatore.
— Bada però ove posi il piede, poichè in queste boscaglie i serpenti
abbondano.
— Ve ne sono di velenosi?
— Di quelli che ti uccidono in meno di cinque secondi.
— Diavolo!... Voi mi spaventate.
— Bisogna procedere con prudenza. Animo, entriamo in piena
foresta.
Quella foresta meritava il nome di vergine. Non vi erano sentieri, ma
solo radi passaggi aperti senza dubbio dalle fiere, così stretti e
tortuosi che a malapena permettevano d’inoltrarsi.
Era una confusione enorme di vegetali dalle foglie gigantesche, le
quali proiettavano una cupa ombra. Si vedevano macchioni di palme
della cera (ceroscylum andicola), superbe piante i cui tronchi
raggiungono sovente un’altezza di cinquanta metri e dalle cui foglie
si estrae una eccellente cera chiamata carnanbeira; macchioni di
palme tucumà, murumcerù e ayri, colle cui foglie si fabbricano dei
tessuti finissimi mentre dalla polpa delle frutta si ricava dell’olio;
delle palme assuly le cui frutta danno pure olio o vengono anche
adoperate per la fabbricazione d’un liquore che chiamasi appunto
assuly; dei papaya, o alberi dei poponi, somigliando le loro frutta a
quei cucurbitacei, quantunque siano meno saporiti; poi dei grandi
simaruba la cui scorza ha proprietà toniche mentre i fiori sono
avidamente mangiati dalle testuggini, e quindi ammassi inestricabili
di calupi diavolo i cui semi, messi in infusione nell’acquavite, danno
uno specifico contro i morsi dei serpenti; di batolo le cui foglie messe
a macerare servono a guarire le febbri, e di bambù colossali,
fortissimi, che resistono perfino alle scuri e che sono adoperati per
fabbricarsi quei lunghi canotti.
Gli animali non mancavano, ma non erano reputati degni di figurare
alla tavola dei cacciatori. Erano per lo più quadrumani e sopratutto
bande numerosissime di scimmie urlanti le quali facevano un
baccano indescrivibile. Chiamansi anche scimmie rosse, avendo il
pelame rossastro.
Sono alte un metro e quaranta centimetri od un metro e mezzo;
hanno il muso appuntito, la coda assai lunga, ma sono sopratutto
notevoli per la potenza della loro voce. Il loro pomo d’Adamo è
grosso quanto un uovo di gallina, ma quando lo gonfiano diventa un
vero gozzo ed allora lanciano dei potenti hon!... hon!... e dei muggiti
così formidabili che si odono a ben cinque chilometri di distanza.
Al pari delle scimmie barbado o preganti, si radunano in circolo sul
tronco degli alberi e sui rami, il capo si colloca in mezzo ed intuona il
concerto, ma le altre devono limitarsi a fare le parti dei coristi,
poichè se ardiscono interromperlo, quello strano direttore corale
distribuisce calci e scapaccioni con prodigiosa rapidità.
Si vedevano però degli animali che avrebbero ben meritato una
palla, ma si tenevano lontani. Erano delle iguane, bruttissimi rettili
somiglianti alle lucertole, ma lunghi un metro e mezzo, con una
cresta che corre sul loro dorso fino all’estremità della coda, colla
testa di forma piramidale a quattro faccie, le dita delle zampe
ineguali e la pelle color verde cupo quasi nera.
Quei rettili, che vivono per lo più sugli alberi, al pari dei camaleonti
d’Africa, hanno la proprietà di cambiar colore, specialmente se sono
irritati, e quantunque al vederli siano ributtanti, sono squisiti a
mangiarsi, somigliando la loro carne al pollo giovane o alla coscia dei
ranocchi.
— È una vera disgrazia, — diceva il dottore, — il non poter
abbatterne almeno uno; si farebbe una colazione squisita.
— Ma sono ben brutti, dottore, — diceva Alonzo, facendo un gesto di
ribrezzo.
— Ma dinanzi ad un arrosto d’iguana non saresti tanto schizzinoso,
giovanotto mio.
— Vi sono altre specie, oltre quella che abbiamo veduta?
— Sì, — disse il dottore. — Vi sono anche iguane tubercolate che
hanno la pelle del ventre d’un colore giallo-verdognolo, il dorso
azzurro ed i fianchi solcati da striscie brune. Sono ancora più lunghe,
poichè raggiungono perfino i cinque piedi.
— Eccellenti anche quelle?
— Squisitissime.
— Allora possiamo....
— Zitto!...
Il dottore si era bruscamente arrestato, lasciandosi cadere dietro il
tronco d’una palma, ma armando rapidamente il fucile.
— Cosa avete veduto? — chiese Alonzo impaziente di sapere il
motivo di quella fermata.
— Ho udito un grugnito.
— Dove?
— Mi pare che uscisse da quella macchia di niku, da quel gruppo di
gambi sarmentosi colla scorza bruna e che somigliano alle liane.
— Che animale può essere?
— Forse un orso formichiere.
— Un buon arrosto?
— Lo assaggerai, — disse il dottore puntando rapidamente il fucile e
facendo fuoco.
Un grugnito soffocato, seguito poco dopo da un grido acuto come
quello d’un maiale quando riceve la mazzata sul cranio, rispose alla
detonazione.
— Toccato! — gridò Alonzo. — Ho veduto laggiù cadere l’animale!
Accorriamo!...
Il dottore, invece di slanciarsi innanzi, aveva afferrato il compagno
per le braccia dicendogli rapidamente:
— Presto!... Arrampicatevi su questo albero!...
— Arrampicarmi su quest’albero! — esclamò il giovanotto
guardandolo con sorpresa. — Ma è nella macchia che la selvaggina è
caduta!
— Lasciala andare. Obbedisci, se ti preme la pelle.
— Ma se....
— Basta!... Arrampicati!... Stanno per venire!...
Alonzo avrebbe voluto chiedere al dottore se aveva perduto il
cervello, ma dinanzi a quell’ordine che non ammetteva altri ritardi,
con un balzo s’aggrappò ai rami d’un enorme simaruba, mettendosi
in salvo sul tronco. Velasco, malgrado non fosse più giovane, con tre
mosse s’issò e lo raggiunse.
Era tempo!... Attraverso ai cespugli ed agli alberi si udivano
echeggiare grugniti furiosi, come si avvicinasse una banda di
cinghiali pronta alla lotta.
— Eccoli, — disse il dottore. — Fortunatamente siamo al sicuro; ma
un minuto di ritardo e per noi era finita.
Trenta o quaranta animali s’avanzavano correndo e grugnendo, cogli
occhi sfavillanti di furore e mostrando delle lunghe ed acute zanne.
Somigliavano a cinghiali, ma parevano più svelti e più robusti. In un
lampo giunsero sotto l’albero e lo circondarono emettendo grida
acute e battendo le lunghe zanne con un rumore minaccioso.
— Cosa sono? — chiese Alonzo, che pareva tranquillissimo.
— Queiscadas, o se ti piace meglio, pecari.
— Cinghiali insomma.
— Press’a poco.
— E avete tanta paura?
— Ti fanno in pezzi in mezzo minuto, mio caro. Vi è meno pericolo
ad affrontare un giaguaro che una banda di pecari.
— Così feroci sono?
— Non temono le armi da fuoco, e quando un loro compagno cade,
accorrono a vendicarlo, dovessero affrontare un battaglione di
cacciatori.
— Saranno buoni a mangiarsi?
— Come i cinghiali, ma però è necessario levar loro una ghiandola
che è ripiena d’un liquido che sa di muschio. Senza questa
precauzione, la loro carne puzzerebbe come quella d’un caimano.
— Ed ora ci assedieranno?
— E per un bel pezzo.
— Diavolo!... E abbiamo lasciato i fucili a terra!...
— Sì, per nostra disgrazia.
— Fortunatamente abbiamo i nostri coltelli da caccia e la colazione in
tasca.
— A cosa ci gioveranno tali armi?... Ecco che cominciano ad
inquietarsi; fortunatamente non hanno nè ali, nè unghie per
arrampicarsi.
I pecari vedendo che i cacciatori non si decidevano a scendere, si
erano scagliati furiosamente contro l’albero staccando, colle acute e
lunghe zanne, dei larghi pezzi di corteccia, e alzandosi sulle zampe
posteriori colla speranza di raggiungere i rami, e spiccando dei salti.
Dovettero però ben presto convincersi dell’inutilità dei loro sforzi,
poichè il simaruba non si scuoteva nemmeno.
— Vi guasterete i denti inutilmente, — disse Alonzo ridendo.
— Ah!... tu ridi! — esclamò il dottore. — E non pensi, briccone, che
questo assedio può durare una settimana?
— Così cocciuti sono questi pecari?... Ma mio cugino e Yaruri, non
vedendoci ritornare, verranno in nostro aiuto.
— Non dico di no, ma non sarà facile trovarci in questa immensa
foresta. Oh!... Diavolo!... La situazione minaccia di complicarsi!
— Cosa c’è di nuovo?
— C’è che siamo presi fra due pericoli, uno più spietato dell’altro. A
basso i pecari ed in alto le mosche-cartone.
— Non vi comprendo, dottore.
— Guarda lassù, su quel ramo. Non vedi nulla?
Welcome to our website – the ideal destination for book lovers and
knowledge seekers. With a mission to inspire endlessly, we offer a
vast collection of books, ranging from classic literary works to
specialized publications, self-development books, and children's
literature. Each book is a new journey of discovery, expanding
knowledge and enriching the soul of the reade

Our website is not just a platform for buying books, but a bridge
connecting readers to the timeless values of culture and wisdom. With
an elegant, user-friendly interface and an intelligent search system,
we are committed to providing a quick and convenient shopping
experience. Additionally, our special promotions and home delivery
services ensure that you save time and fully enjoy the joy of reading.

Let us accompany you on the journey of exploring knowledge and

personal growth!

ebookfinal.com