SCIENTIFIC ARTICLE

https://doi.org/10.1590/1808-1657000042024 Agricultural Entomology

Exploration of entomopathogenic bacteria as potential

control agents for brown stink bug Euschistus heros (F.)
(Hemiptera: Pentatomidae)
Silvia Fernanda Esparza-Mora1,* https://orcid.org/0000-0003-4982-3633
Luís Garrigós Leite1 https://orcid.org/0000-0001-7947-5698
Fernando Berton Baldo1 https://orcid.org/0000-0002-7105-7923
Ricardo Harakava2 https://orcid.org/0000-0003-1431-2665
Maria del Pilar Rodríguez-Rodriguez3 https://orcid.org/0000-0003-2124-6336

1. Instituto Biológico – Centro Avançado de Pesquisa em Proteção de Plantas e Saúde Animal – Campinas (SP), Brazil.
2. Instituto Biológico – Centro de Pesquisa e Desenvolvimento de Sanidade Vegetal São Paulo – São Paulo (SP), Brazil.
3. Instituto Nacional de Ciência e Tecnología de bioinsumos Inovadores - São Paulo (SP), Brazil.
*Corresponding author: [email protected]

ABSTRACT
The brown stink bug, Euschistus heros, is considered one of the main pests in Brazil, causing significant damage to several crops.
Currently, the principal method of control involves the excessive use of insecticides, leading to the development of resistant
populations and environmental contamination. Therefore, it becomes crucial to explore more sustainable control alternatives,
with biological agents, particularly entomopathogenic bacteria, emerging as promising due to their proven toxic activity against
various insect and insect families. Thus, this study aimed to explore the potential of entomopathogenic bacteria in the control
of E. heros. The initial screening of 125 bacteria identified 19 efficient strains, which were tested at 10% concentration under
laboratory conditions. Molecular identification was conducted by polymerase chain reaction amplification of the 16S, gyrB, and
rpoD genes, followed by sequencing and comparison in EzBioCloud 16S and GenBank. Additionally, the survival rate of E. heros
was evaluated at bacterial concentrations of 10, 20, 40, 80, and 100%. Among the isolates tested at 10% concentration,
strains 292B3, 457C4, 365BNP6, 742D, 427B, 321B, and Photorhabdus luminescens emerged as the most virulent. Molecular
analysis of these strains revealed high similarity to the species Serratia marcescens, Bacillus toyonensis, and Bacillus cereus. The
survival rates of E. heros suggested that control efficiency is not solely linked to bacterial concentration, but it also depends on
the mechanisms of action and the ability to colonize and interact with the pest.
Keywords: agricultural pest, hemipteran insect, biocontrol, microbial agents, insecticidal activity.

INTRODUCTION
Agriculture plays a fundamental role in food security and economic stability worldwide. It faces significant challenges
due to the presence of pests that affect crops, as well as their productivity and quality (ARORA, 2018; SOUTO et al., 2021).
Among these pests, Euschistus heros (Fabricius, 1798) (Hemiptera: Pentatomidae), native to the Neotropical Region, is
considered one of the main and most abundant in Brazil (SILVA et al., 2012). It is a sucking insect present in different
stages of leguminous plant development, causing significant damage and economic losses for farmers, resulting in losses
that can exceed R$ 12 billion annually per harvest (SMANIOTTO; PANIZZI, 2015; PORTAL DO AGRONEGÓCIO, 2024).
Effective management of E. heros control has seen various strategies developed and implemented over the years,
with insecticides being the main method in use nowadays, including neonicotinoids, pyrethroids, and organophosphates
(RIBEIRO et al., 2016; TUELHER et al., 2018). The availability of only three active ingredients for its control and the
indiscriminate application of these compounds on the plants have caused biodiversity losses, affecting non-target
organisms, human health, and providing the presence of resistant pest populations (ADEMOKOYA et al., 2022).

Received: Apr 12, 2024. Accepted: Oct 15, 2024

Associate Editor: Silvia Galleti
Peer Review History: Double-blind Peer Review

Arq. Inst. Biol., São Paulo, v.91, 1-13, e00042024, 2024 1

 S.F. Esparza-Mora et al.

In this context, the implementation of less impactful control strategies, such as biological control, has gained much
importance because it allows the restoration of the biological balance between pests and their natural enemies, resulting in
more sustainable insect control and reducing the economic damage (SINDHU et al., 2017).
The biological control agents for E. heros include parasitoids, nematodes, fungi, and bacteria. Egg parasitoids are the
most studied and implemented method, but their efficiency has decreased considerably due to incorrect use of chemical
products, in addition to limitations in the commercial-scale production of parasitoids (CORRÊA-FERREIRA; SOSA-GÓMEZ,
2017; SILVA et al., 2019).
Nematodes and their symbiotic bacteria have been tested against some species of hemipterans, including stink bugs, and
have shown promising results, with significant insect mortality rates (MARRERO et al., 2015). However, their efficiency has been
compromised by host insect specificity, requiring the use of different strains to control pests in the same crop (FRANCE, 2013).
Although entomopathogenic fungi species like Metarhizium anisopliae and Beauveria bassiana have been recommended
for stink bug control, their effectiveness may be compromised due to the instability of essential environmental conditions for
their establishment in the field, such as exposure to ultraviolet radiation, variations in humidity and temperature fluctuations
(RESQUÍN-ROMERO et al., 2020; SILVA-SANTANA et al., 2022).
A promising alternative is the use of bacteria from the Bacillaceae family, which have demonstrated proven toxic activity
against various groups of insects and mites and can form thermotolerant endospores that are harmless to vertebrates and
plants (MONTEIRO et al., 2005). Some species of Bacillus genus are also known for their ability to form crystals, which
holds promise for pest control, an aspect that has been studied and explored by the market. Furthermore, other species can
induce antagonistic responses in plant diseases and promote plant growth (LANA FILHO et al., 2010). Despite the potential
of the bacteria in pest control of stink bugs, the quantity of biological products derived from them remains limited, reflecting
a lack of research and highlighting the need to invest in this alternative control strategy.
The Reference Laboratory Unit for Biological Control, located at the Advanced Center for Research in Plant Protection
and Animal Health of the Instituto Biológico, in Campinas, SP, Brazil, has a collection of Entomopathogenic Bacteria with a
wide variety of strains that have not yet been tested against stink bugs. This research allows the development of sustainable
pest management strategies that involve the use of bacteria as biological control agents.

MATERIAL AND METHODS

The study was conducted at the Reference Laboratory Unit for Biological Control, located at the Advanced Center for
Research in Plant Protection and Animal Health of the Instituto Biológico, in Campinas.

Stink bugs rearing

Brown stink bugs utilized in this study were reared in 20 × 30 cm plastic cages, maintained in a climate-controlled
room with conditions set at 25°C and relative humidity of 60 ± 5%, under a 12-hour photophase. To sustain their growth,
the stink bugs were fed a natural diet consisting of bean pods (Phaseolus vulgaris), peanuts (Arachis hypogaea), sunflower
seeds (Helianthus annuus), and filtered water.

Bacterial isolates
Bacterial strains were obtained from “Oldermar Cardim Abreu’’ Collection of Entomopathogenic Microorganisms,
housed at the Reference Laboratory Unit for Biological Control of Instituto Biológico, stored in cryopreservation tubes
at -20 and -80°C with 15 and 20% glycerol, respectively. These isolates were activated by inoculating 1 mL into Schott
bottles containing 50 mL of nutrient broth (NB) (beef extract – 1 g/L, yeast extract – 2 g/L, peptone – 5 g/L, and sodium
chloride – 5 g/L) and maintained under agitation 150 rpm at 28°C for 72 hours.

Bacterial rates
Initially, a screening of 125 bacteria from the collection was conducted (data not shown), from which the 19 bacteria
that stood out as the most efficient, based on stink bug mortality percentages, were selected. Subsequently, these bacteria
underwent another test at a concentration of 10%.

2 Arq. Inst. Biol., São Paulo, v.91, 1-13, e00042024, 2024

 Exploration of entomopathogenic bacteria as potential control agents for brown stink bug Euschistus heros (F.) (Hemiptera: Pentatomidae)

For the experiments, each treatment was subjected to six repetitions. Each repetition was represented by a plastic
container (250 mL) containing 20 mL of sterile vermiculite, a natural diet composed of bean pods, peanuts, sunflower
seeds, and filtered water, along with five adult brown stink bugs and 7 mL of bacteria-diluted to the concentration of 10%
in sterile distilled water. The control treatment consisted of only NB medium.

Molecular identification
Molecular identification was performed through polymerase chain reaction (PCR) amplification of the 16S ribosomal
gene and specific genes gyrB and rpoD of the bacteria, followed by sequencing and comparison of sequences on the databases
EzBioCloud 16S and GenBank.
To begin, bacteria were activated in NB medium, following the previously described methodology, and individually
inoculated onto Petri dishes containing solid nutrient agar culture medium (peptone – 5 g/L; HM peptone B – 1.5 g/L; yeast
extract – 1.5 g/L; sodium chloride – 5 g/L; agar – 15 g/L), then incubated at 30°C for 24 hours.
Following growth, genomic DNA extraction was carried out following the Cationic hexadecyl trimethyl ammonium
bromide (CTAB) protocol (ROMANO; BRASILEIRO, 1999).
The 16S rDNA ribosomal gene was amplified by PCR using the fD1 (5’ – AGAGTTTGATCCTGGCTCAG – 3’) e
rP1 (5’ – ACGGTTACCTTGTTACGACTT – 3’) primers (WEISBURG et al., 1991). An approximately 880-pb fragment
of the gyrB gene was amplified for Bacillus with gyrB-F (5’ – GTNYAYCGTGAYGGNAAAATYC – 3’) and gyrB-R
(5’ – GCAGARTCWCCCTCTACRATATA – 3’) primers, and an approximately 800-bp fragment of the rpoD gene was amplified for
Serratia with rpoD-F (5’ – TAYATGMGNGARATGGGNACNGT – 3’) and rpoD-R (5’ – TTNGCYTCNACCATYTCYTTYTT – 3’)
primers developed by Dr. Ricardo Harakava, scientific researcher at the Laboratory Reference Unit in Applied Molecular
Biology of the Instituto Biológico.
Amplification was carried out using a T100 BioRad thermocycler, consisting of a denaturation step at 94°C/2 min, followed
by 40 cycles of 94°C/10 s, primer annealing at 60°C/30 s, an extension at 72°C/1 min, and a final extension at 74°C/4 min.
Samples were subjected to electrophoresis on a 1.5% agarose gel. Subsequently, the size and concentration of amplified
fragments were verified in a photodocumentator coupled to a ultraviolet transilluminator.
Amplified products were purified by precipitation with PEG 6000 (SCHMITZ; RIESNER, 2006) and sequenced using the
Big Dye 3.1 reagent (Applied Biosystems) and the 3,500-xL capillary sequencer (Applied Biosystems). Obtained sequences
were compared with strains deposited in EzBioCloud 16S and GenBank. For the construction of phylogenetic trees, the
Neighbor Joining method with 1,000 bootstrap repetitions was used in the MEGA 6.0 program (TAMURA et al., 2013).

Survival rates
Survival rates obtained from the test with a 10% bacterial concentration were plotted. The seven most promising strains
were selected, and different concentrations of each bacterium were prepared, including 10, 20, 40, 80, and 100% by cell
counting using a Neubauer chamber and diluting.
For each concentration, six repetitions were conducted, and the control treatment was performed only with NB medium. Mortality
assessments of the stink bugs were carried out over five days, with the counting and removal of dead individuals in each treatment.
The results were documented and utilized to calculate survival rates for each treatment. A pairwise comparison of
mortality rate ranks between treatments was conducted using a Wilcoxon rank sum test, incorporating a Bonferroni
correction to account for multiple comparisons.

Statistical analysis
The experiments were conducted following a completely randomized design. The data obtained from the bacteria
screening were normalized using the formula proposed by ABBOTT (1925) (Eq. 1):

number of dead individuals per replication-dead individual in control

% mortality = x 100  (1)
100-dead individuals in control

The results were expressed in percentages of mortality (%), transformed using the arcsine square root transformation, and
subjected to analysis of variance (ANOVA) to assess the significance of the observed differences between treatments. Additionally,
means were compared and analyzed using the SCOTT and KNOTT algorithm (1974) with the statistical software SISVAR.

Arq. Inst. Biol., São Paulo, v.91, 1-13, e00042024, 2024 3

 S.F. Esparza-Mora et al.

RESULTS AND DISCUSSION

In the initial screening stage, E. heros mortality rates varied between 0 and 53% among the 125 strains evaluated (data not
shown). Bacteria that caused more than 30% E. heros mortality rates were chosen for subsequent tests at 10% concentration.

40
a
35
a
30
a a a a a
% of mortality

25 a

20
b b b b b
15 b b
b b b b
10

0
Control

459B”.2

388B

89A

292B3

447A

518B

457C4

365”2A1

365BNP6

742D”

281A

459B”2

739A”

427B

321B

MM05

305

P. luminescens

B. subtils
Figure 1. Mortality of Euschistus heros in bacterial concentration tests at 10%. Treatments labeled with the same letter do not differ
statistically, according to the Scoot & Knott test (0.5%).
Source: Elaborated by the authors.

Among these 19 bacterial strains, 292B3, 457C4, 365BNP6, 742D, 427B, 321B, and Photorhabdus luminescens proved
to be the most virulent, showing mortality rates of brown stink bugs between 26.67 and 36.67% when bacterial suspensions
were tested at 10% of the initial concentration. It is believed that the toxic effect of these bacterial isolates on E. heros can be
attributed to the invasion of bacterial cells or the production of secondary metabolites with insecticidal activity, as previously
noted in the management of other insect pests.
In the molecular analysis of these bacteria, through the sequencing of the 16s ribosomal gene, the highest similarity
was found in strains 427B, 292B3, 321B, and 365BNP6 with Serratia species, specifically S. nematodiphila, S. marcescens,
and S. ureilytica, as shown in Table 1 and Figure 2. Additionally, sequencing the rpoD gene in those isolates allowed for
their closest identification with S. marcescens, as depicted in Figure 3.

Table 1. EzBioCloud 16S Sequences Matching strains 427B, 292B3, 321B, and 365BNP6, identified through BLAST Analysis of
16S rRNA.
Size of the Completeness Similarity
Isolate Taxon name Accession
fragment (bp) (%) (%)
Serratia nematodiphila (DSM 21420) 1,415 100 99.58 JPUX01000001
427B Serratia marcescens (ATCC 13880) 1,413 100 99.44 JMPQ01000005
Serratia ureilytica (NiVa 51) 1,406 99.5 98.94 AJ854062
Serratia marcescens (ATCC 13880) 1,405 100 99.50 JMPQ01000005
292B3 Serratia nematodiphila (DSM 21420) 1,405 100 99.50 JPUX01000001
Serratia ureilytica (NiVa 51) 1,398 99.5 99.01 AJ854062
Serratia nematodiphila (DSM 21420) 1,410 100 99.58 JPUX01000001
321B Serratia marcescens (ATCC 13880) 1,408 100 99.44 JMPQ01000005
Serratia ureilytica (NiVa 51) 1,399 99.5 98.8 AJ854062
Serratia nematodiphila (DSM 21420) 1,417 100 99.58 JPUX01000001
365BNP6 Serratia marcescens (ATCC 13880) 1,415 100 99.44 JMPQ01000005
Serratia ureilytica (NiVa 51) 1,408 99.5 98.95 AJ854062
Source: Elaborated by the authors.

4 Arq. Inst. Biol., São Paulo, v.91, 1-13, e00042024, 2024

 Exploration of entomopathogenic bacteria as potential control agents for brown stink bug Euschistus heros (F.) (Hemiptera: Pentatomidae)

40
427B

50
365BNP6

82 321B

292B3

99
50
Serratia ureilytica NiVa 51 (AJ854062)

Serratia marcescens ATCC 13880(JMPQ01000005)

89

84 Serratia nematodiphila DSM 21420 (JPUX01000001)

86
Serratia surfactantfaciens YD25 (KM093865)
93

Serratia odorifera DSM 4582(ADBY01000001)

Serratia entomophila DSM 12358 (AJ233427)

79
Serratia ficaria NCTC 12148 (LT906479)

Serratia fonticola strain 1223-11 (OM714815.1)

93
Serratia myotis strain 12 (KJ739884.1)

Xenorhabdus nematophila DSM 3370 (NR 042821)

Figure 2. Phylogenetic tree of bacterial isolates 427B, 292B3, 321B, and 365BNP6, constructed from the molecular sequencing
of the 16S ribosomal gene.
Source: Elaborated by the authors.

Table 2. GenBank sequences matching strains 427B, 292B3, 321B and 365BNP6, based on gyrB gene analysis.

Size of the Completeness Similarity

Isolate Taxon name Accession
fragment (bp) (%) (%)

Serratia marcescens (14BL09) 1,672 100 99.35 AP028476.1

427B Serratia marcescens (UMH6) 1,666 100 99.24 CP018926.1

Serratia ureilytica (CM2016) 1,666 100 99.24 CP091121.1

Serratia marcescens (14BL09) 1,694 100 99.57 AP028476.1

292B3 Serratia marcescens (UMH6) 1,688 100 99.46 CP018926.1

Serratia ureilytica (CM2016) 1,688 100 99.46 CP091121.1

Serratia marcescens (14BL09) 1,781 100 99.49 AP028476.1

321B Serratia marcescens (UMH6) 1,775 100 99.39 CP018926.1

Serratia ureilytica (CM2016) 1,775 100 99.39 CP091121.1

Serratia marcescens (14BL09) 1,692 100 99.57 AP028476.1

365BNP6 Serratia marcescens (UMH6) 1,687 100 99.46 CP018926.1

Serratia ureilytica (CM2016) 1,687 100 99.46 CP091121.1

Source: Elaborated by the authors.

Arq. Inst. Biol., São Paulo, v.91, 1-13, e00042024, 2024 5

 S.F. Esparza-Mora et al.

61 321B

99 365BNP6

292B3
71
52 427B

Serratia marcescens 14BL09 (AP028476.1)

Serratia marcescens E53 (AP028517.1)

92 75

64
Serratia marcescens strain UMH6 (CP018926.1)

95 Serratia ureilytica strain CM2016 (CP091121.1)

100
Serratia ureilytica CCUG:50595 (NZ JABXOF010000004)

96 Serratia ureilytica FDAARGOS 1089 (NZ CP068214)

Serratia nematodiphila CGMCC 1.6853 (NZ FMUT01000006)

46
79 Serratia surfactantfaciens YD25 (CP016948)

97 Serratia ficaria NCTC12148 (LT906479)

77 Serratia entomophila A1 (CP082787)

34 Serratia plymuthica NCTC12961 (LS483469)

93 Serratia liquefaciens ATCC 27592 (CP006252)

Serratia odorifera NCTC11214 (LR134117)

Serratia rubidaea FDAARGOS 926 (CP065640)

100 Serratia rhizosphaerae KUDC3025 (CP041764)

Xenorhabdus nematophila ATCC 19061 (NC 014228)

Figure 3. Phylogenetic tree of bacterial isolates 427B, 292B3, 321B, and 365BNP6, based on molecular sequencing of the
rpoD gene.
Source: Elaborated by the authors.

Table 3. EzBioCloud 16S Sequences Matching Strains 742D, and 457C4, identified through BLAST Analysis of 16S rRNA.
Size of the Completeness Similarity
Isolate Taxon name Accession
fragment (bp) (%) (%)

Bacillus toyonensis (BTC 7112) 1,430 100 100 CP006863

Bacillus mobilis (0711P9-1) 1,429 100 99.93 MACF01000036

742D
Bacillus pacificus (EB422) 1,429 100 99.93 KJ812450

Bacillus paramobilis (BML BC017) 1,428 98.50 99.86 MW674728

Bacillus paranthracis (Mn5) 1,420 100 100 MACE01000012

457C4 Bacillus nitratireducens (4049) 1,420 100 99.93 KJ812430

Bacillus cereus (ATCC 14579) 1,419 100 99.86 AE016877

Source: Elaborated by the authors.

Furthermore, in the molecular analysis of strain 742D using the 16S ribosomal gene, a greater similarity to
B. toyonensis, B. mobilis, and B. pacificus was observed. In contrast, isolate 457C4 showed similarities to Bacillus paranthracis,
B. nitratireducens, and B. cereus sensu stricto, as presented in Table 3. Through the gyrB gene sequencing, it was determined
that bacterium 742D exhibited higher similarity to the specimen B. toyonensis (BCT-7112), with an identity of 99.51%,
and strain 457C4 exhibited similar sequences to B. cereus sensu stricto specimens (ATCC 14579), with 99,88% similarity,
as evidenced in Figure 5 and Table 4.

6 Arq. Inst. Biol., São Paulo, v.91, 1-13, e00042024, 2024

 Exploration of entomopathogenic bacteria as potential control agents for brown stink bug Euschistus heros (F.) (Hemiptera: Pentatomidae)

63 Bacillus paranthracis Mn5 (MACE01000012)

75
Bacillus nitratireducens 4049 (KJ812430)
48
457C4

31 Bacillus cereus ATCC 14579 (AE016877)

Bacillus albus N35-10-2 (MAOE01000087)

Bacillus luti TD41 (MACI01000041)

40 48
Bacillus sanguinis BML-BC004 (MW674727)
43

46 Bacillus albus N35-10-2(MAOE01000087)

8
Bacillus wiedmannii FSL W8-0169 (LOBC01000053)

40 Bacillus proteolyticus TD42 (MACH01000033)

1

Bacillus mobilis 0711P9-1 (MACF01000036)

22 Bacillus paramobilis BML-BC017 (MW674728)

48 Bacillus hominis BML-BC059 (MW674729)

742D

22 Bacillus toyonensis BCT-7112 (CP006863)

Bacillus pacificus EB422 (KJ812450)

Bacillus psychrosaccharolyticus (AB021195.1)

100 Bacillus asahii (AB109209.1)

Figure 4. Phylogenetic tree of bacterial isolates 742D and 457C4, constructed from the molecular sequencing of the 16S
ribosomal gene.
Source: Elaborated by the authors.

Table 4. GenBank sequences matching strains 742D and 457C4, based on GyrB gene analysis.
Size of the Completeness Similarity
Isolate Taxon name Accession
fragment (bp) (%) (%)

Bacillus toyonensis (BTC 7112) 1,480 100 99.51 CP006863

742D Bacillus thuringiensis (ATCC 10792) 1,397 100 97.66 CP020754

Bacillus mycoides (ATCC 6462) 1,125 100 91.64 CP0923291

Bacillus cereus (ATCC 14579) 1,496 100 99.88 CP034551

457C4 Bacillus anthracis (Vollum) 1,153 100 92.26 CP076225

Bacillus thuringiensis (ATCC 10792) 1,003 100 88.93 CP020754

Source: Elaborated by the authors.

The seven isolates classified in the genera Photorhabdus, Serratia and Bacillus demonstrated the highest potential for
controlling the E. heros insect pest. In particular, P. luminescens, a gram-negative bacterium, is associated with the nematodes
(NEPs) Heterorhabditis bacteriophora (FISCHER-LE SAUX et al., 1999). Released by NEPs inside the insect, P. luminescens
recognizes the presence of the amino acid L-proline in the host’s hemolymph. This interaction triggers the production of
toxins, antibiotics, and other metabolites by the bacterium, leading to the degradation of the insect’s hemocoel and preventing
the formation of nodules that result in its death (CRAWFORD et al., 2010).
In this study, the strain P. luminescens caused a mortality of 30% in E. heros. This finding aligns with the research
conducted by NANZER et al. (2021), in which two strains of the symbiotic bacterium P. luminescens and seven species of
Xenorhabdus against the stink bugs E. heros and Dichelops melacanthus were tested. Here, P. luminescens was the second-best
bacterium, causing a mortality of 37% in the brown stink bug.

Arq. Inst. Biol., São Paulo, v.91, 1-13, e00042024, 2024 7

 S.F. Esparza-Mora et al.

99 742D

100 Bacillus toyonensis BCT-7112 (CP006863)

Bacillus thuringiensis ATCC 10792 (CP020754)

99
100 Bacillus thuringiensis ATCC 10792 (FR850503)

52 Bacillus luti TD41 (NZ MACI01000065)

43 Bacillus nitratireducens 4049 (NZ MAOC01000040)

88
Bacillus mobilis 0711P9-1 (NZ MACF01000014)

Bacillus mycoides DSM 2048 (CP093291)

99 Bacillus paramycoides NH24A2 (NZ MAOI01000084)

91

100 Bacillus cereus ATCC 14579 (CP034551)

100
Bacillus cereus ATCC 14579 (FR850502)

457C4

100 Bacillus albus N35-10-2 (NZ MAOE01000098)

60
Bacillus anthracis Vollum (CP076225)
100
Bacillus tropicus N24 (NZ MACG01000023)
54
Bacillus pacificus EB422 (NZ MACD01000023)
82

98 Bacillus paranthracis Mn5 (NZ MACE01000017)

Bacillus cytotoxicus NVH 391-98 (CP000764)

Bacillus pseudomycoides DSM 12442 (NZ CM000745)

Bacillus atrophaeus NRRL NRS 213 (NZ LSBB01000001)

Figure 5. Phylogenetic tree of bacterial isolates 742D and 457C4, based on molecular sequencing of the gyrB gene.
Source: Elaborated by the authors.

However, in another study conducted by MARRERO et al. (2015), P. luminescens caused the complete mortality of two
species of stink bugs (Piezodorus guildinii and Nezara viridula). These results contrast with those obtained in E. heros, suggesting
that the brown stink bug is more resistant to the specific action of P. luminescens compared to other stink bug species.
Serratia sp., a gram-negative bacterium with antifungal and antibacterial activity, is naturally present in the soil,
and it produces a variety of enzymes and metabolites that impact the survival and reproduction of insects (GRIMONT;
GRIMONT, 2006). Specifically, S. marcescens exhibit pathogenic and saprophytic characteristics, capable of synthesizing
chitinases including ChiA, ChiB, and ChiC, which have been the subject of studies due to their potential use in biological
control (SOMEYA et al., 2001).
Extensive research on the biocontrol with S. marcescens in different agricultural pests has been conducted. In the
context of insects, this bacterium is recognized for inducing bacteremia and rapid mortality in these organisms (GRIMONT;
GRIMONT, 2006; ISHII et al., 2014). Recent studies highlighted the promising potential of S. marcescens in the control
of insects, covering species such as Meloidogyne incognita, Aedes aegypti, and Culex quinquefasciatus, larvae of Plodia
interpunctella, and Ephestia Kuehniella (RAGVENDRAN; NATARAJAN, 2017; BIDARI et al., 2018; HEGAZY et al., 2019).
On the other hand, the Bacillus cereus group is composed of eight species, namely B. anthracis, B. cereus stricto sensu,
B. cytotoxicus, B. mycoides, B. pseudomycoides, B. thuringiensis, B. weihenstephanensis, and B. toyonensis, the latter being
recently included (JÍMENEZ et al., 2013).
B. toyonensis is a gram-positive, aerobic, endospore-forming bacterium that exhibits antimicrobial compounds
(WILLIAMS et al., 2009). Additionally, its ability to promote plant growth, coupled with its safety for humans, animals,
and the environment, highlights it as a sustainable alternative to biological control (CONTRERAS-PÉREZ et al., 2019).
Specific studies emphasize the effectiveness of B. toyonensis in different biological contexts. BYUNG-RYUN et al.
(2018) demonstrated its efficacy in suppressing the bacterium Pectobacterium carotovorum. Furthermore, the antifungal
activity of B. toyonensis has been confirmed against Botrytis cinerea (ROJAS-SOLIS et al., 2020). Additionally, other studies
revealed significant inhibition of mycelial growth and germination of Fusarium oxysporum (SHIN et al., 2023), as well as
the evaluation of 93 strains of Bacillus sp. for the control of Alternaria alternata, highlighting B. toyonensis as one of the
top four strains with potential for biocontrol (PANE; ZACCARDELLI, 2015).
To date, few studies assessed the insecticidal activity of B. toyonensis spores in different insect species, revealing its
potential for biocontrol in Anthonomus grandis and Cydia pomonella (SAUKA et al., 2022). Still, more studies are needed

8 Arq. Inst. Biol., São Paulo, v.91, 1-13, e00042024, 2024

 Exploration of entomopathogenic bacteria as potential control agents for brown stink bug Euschistus heros (F.) (Hemiptera: Pentatomidae)

to explore the potential of this bacterium in other insect pests of the hemipteran group given the limited research available
on its use as a biological control agent.
Bacillus cereus, a gram-positive, facultatively anaerobic, endospore-forming bacterium, is commonly found in soil and
recognized for its activity in promoting plant growth (SARRÍAS et al., 2002).
Some studies highlight its potential as a biological control agent. The antagonistic effect of B. cereus against various
phytopathogenic fungi, such as Penicillium expansum, Botrytis cinerea, Penicillium italicum, Geotrichum citri-aurantii, as well
as strong inhibition of Aspergillus niger and Aspergillus carbonarius, was demonstrated (ABDALLAH et al., 2022; KHADIRI
et al., 2023). In addition to this, the antifungal activity of B. cereus against Fusarium oxysporum, attributing this antifungal
effect to the production of hydrolytic enzymes and volatile compounds, was also observed (RAMÍREZ et al., 2022).
Regarding biological control of nematodes, B. cereus exerts a strong direct suppression on Meloidogyne incognita (YIN et
al., 2021). Furthermore, the formation of a biofilm on the surface of the plant roots by this bacterium stimulates growth and
provides protection against the pest, which contributes to systemic resistance against pests (NIU et al, 2011; YIN et al., 2021).
This interaction highlights the promising potential of B. cereus as a biological control agent. However, current research
focuses primarily on the control of phytopathogenic fungi, shedding light to explore its potential in managing insects,
especially against hemipteran pests. Future studies in this direction can broaden our understanding of the various roles
that B. cereus can play in pest management in agriculture, as well as a deeper understanding in host-bacterial interactions.

100%

75%
Survival probability

50%

25%
p < 0.0001

0%
0 25 50 75 100
Concentration
321B 427B 457C4 Control
Treatment:
292B3 365BNP6 742D P. lumin
Figure 6. Comparison of survival rates for 10, 20, 40, 80, and 100% concentrations of bacterial isolates 321B, 365BNP6, 292B3,
457C4, 427B, 742D, and Photorhabdus luminescens. In analyses, significant differences were not detected between treatments.
Source: Elaborated by the authors.

In general, survival rates did not show significant variation among the different treatments and concentrations, suggesting
that the effectiveness in the mortality of E. heros adults is not necessarily linked to the concentration of bacteria, but rather
to their mechanism of action and their ability to colonize and interact with insect pests and the production of secondary
metabolites–toxins–, capable of inhibiting the growth and development of insects, leading to their death. Additionally, it
was suggested that enzymes and secondary metabolites produced by bacteria play a crucial role in the control and regulation
of pest population (CRAWFORD et al., 2010; STOCK et al., 2017; MAHARANA et al., 2022).
According to the results of this study, it is possible to infer that the bacteria may be valuable as control agents for
E. heros stink bugs. However, there is a scarcity of available studies on the action of these bacteria as biological control agents
of insects, with most of them limited to microbial control. It is imperative to conduct additional research to identify new
promising microbiological products in the sustainable management of the brown stink bug and enhance our understanding
of the mechanisms of action of these bacteria in controlling this insect (SCHÜNEMANN et al., 2014). This approach will
enable the development of more efficient and sustainable control strategies, contributing to the reduction of chemical use
and environmental preservation.

Arq. Inst. Biol., São Paulo, v.91, 1-13, e00042024, 2024 9

 S.F. Esparza-Mora et al.

CONCLUSIONS
Bacteria are potential agents for biological control in agricultural pest management programs, given their ease of multiplication,
application, and effectiveness, aiming to reduce the use of insecticides and preserve the environment. Specifically, the bacteria
S. marcescens and B. toyonensis emerge as promising agents in the biocontrol of E. heros pest, demonstrating effectiveness even
at low concentrations. These findings highlight the importance of continuing to investigate and evaluate the performance of
these bacteria under field conditions, as well as their compatibility with integrated pest management approaches.

AUTHORS’ CONTRIBUTIONS
Conceptualization: Esparza-Mora, S.F. Investigation: Esparza-Mora, S.F.; Leite, L.G.; Baldo, F.B.; Harakava, R.; Rodríguez-
Rodriguez, M.P. Funding acquisition: Leite, L.G.; Baldo, F.B. Methodology: Esparza-Mora, S.F.; Leite, L.G.; Baldo, F.B.; Harakava,
R.; Rodríguez-Rodriguez, M.P. Writing – original draft: Esparza-Mora, S.F. Writing – review & editing: Esparza-Mora, S.F.; Leite,
L.G.; Baldo, F.B.
AVAILABILITY OF DATA AND MATERIAL
The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable
request.
FUNDING
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior
Finance Code 001

Conselho Nacional de Desenvolvimento Científico e Tecnológico

Grant No.: 578453/2008-8
CONFLICTS OF INTEREST
The authors declare that they have no conflicts of interest.
ETHICAL APPROVAL
Not applicable.
ACKNOWLEDGEMENTS
To the Unidade Laboratorial de Referência em Controle Biológico and the postgraduate program of the Instituto Biológico.

REFERENCES
ABBOTT, W.S. A method of computing the effectiveness of an insecticide. Journal of Economic Entomology, v.18, n.2, p. 265-267, 1925.
https://doi.org/10.1093/jee/18.2.265a

ABDALLAH, Y.; HASSAN, Z.U.; AL-THANI, R.; AL-SHAMARY, N.; AL-YAFEI, T.; ALNAIMI, H.; JAOUA, S. Prevalence of toxigenic
mycobiota and mycotoxins in date palm fruits and investigation on Bacillus cereus 342-2 as biocontrol agent. Biocontrol Science and
Technology, v.32, n.12, p.1372-1388, 2022. https://doi.org/10.1080/09583157.2022.2122404

ADEMOKOYA, B.; ATHEY, K.; RUBERSON, J. Natural enemies and biological control of stink bugs (Hemiptera: Heteroptera) in North
America. Insects, v.13, n.10, p.932, 2022. https://doi.org/10.3390/insects13100932

ARORA, N.K. Agricultural sustainability and food security. Environmental Sustainability, v.1, p.217-219, 2018. https://doi.org/10.1007/
s42398-018-00032-2

BIDARI, F.; SHAMS-BAKHSH, M.; MEHRABADI, M. Isolation and characterization of a Serratia marcescens with insecticidal activity
from Polyphylla olivieri (Col.: Scarabaeidae). Journal of Applied Entomology, v.142, n.1-2, p.162-172, 2018. https://doi.org/10.1111/jen.12421

BYUNG-RYUN, K.; MYUNG-SOO, P.; KWANG-SEOP, H.; SOO-SANG, H.; IN-HEE, P.; JAE-KUEONG, S. Biological control using Bacillus toyonensis
strain CAB12243-2 against soft rot on Chinese cabbage. Korean Journal Organic Agriculture, v.26, n.1, p.129-140, 2018. https://www.researchgate.
net/publication/324083462_Biological_Control_using_Bacillus_toyonensis_Strain_CAB12243-2_against_Soft_Rot_on_Chinese_Cabbage

10 Arq. Inst. Biol., São Paulo, v.91, 1-13, e00042024, 2024

 Exploration of entomopathogenic bacteria as potential control agents for brown stink bug Euschistus heros (F.) (Hemiptera: Pentatomidae)

CONTRERAS-PÉREZ, M.; HERNÁNDEZ-SALMERÓN, J.; ROJAS-SOLÍS, D.; ROCHA-GRANADOS, C.; OROZCO-MOSQUEDA,

M.C.; PARRA-COTA, F.I.; SANTOS-VILLALOBOS, S.; SANTOYO, G. Draft genome analysis of the endophyte, Bacillus toyonensis
COPE52, a blueberry (Vaccinium spp. var. Biloxi) growth-promoting bacterium. 3 Biotechnology, v.9, p.370, 2019. https://doi.org/10.1007/
s13205-019-1911-5

CORRÊA-FERREIRA, B.S.; SOSA-GÓMEZ, D.R. Percevejos e o sistema de produção soja-milho. Londrina: Embrapa Soja, 2017. https://
www.infoteca.cnptia.embrapa.br/infoteca/handle/doc/1086374

CRAWFORD, J.M.; KNONTNIK, R.; CLARDY, J. Regulating alternative lifestyles in entomopathogenic bacteria. Current Biology, v.20,
n.1, p.69-74, 2010. https://doi.org/10.1016/j.cub.2009.10.059

FISCHER-LE SAUX, M.; VIALLARD, V.; BRUNEL, B.; NORMAND, P.; BOEMARE, N. E. Polyphasic classification of the genus Photorhabdus
and proposal of new taxa: P. luminescens subsp. luminescens subsp. nov., P. luminescens subsp. akhurstii subsp. nov., P. luminescens subsp.
laumondii subsp. nov., P. temperata sp. nov., P. temperata subsp. temperata subsp. nov. and P. asymbiotica sp. nov. International Journal
Systematic and Evolutionary Microbiology, v.49, n.4, p.1645-1656, 1999. https://doi.org/10.1099/00207713-49-4-1645

FRANCE, I.A. Uso de nemátodos entomopatógenos para el control de insectos. Quillota: Instituto de Investigaciones Agropecuarias, 2013.
n. 260. https://hdl.handle.net/20.500.14001/7587

GRIMONT, F.; GRIMONT, P.A.D. The genus Serratia. In: DWORKIN, M.; FALKOW, S.; ROSENBERG, E.; SCHLEIFER, K.H.;
STACKERBRANDT, E. (eds.). The Prokaryotes. New York: Springer, 2006. p.219-244. https://doi.org/10.1007/0-387-30746-X_11

HEGAZY, M.I.; SALAMA, A.S.A.; El-ASHRY, R.M.; OTHMAN, E.I. Serratia marcescens and Pseudomonas aeruginosa are promising
candidates as biocontrol agents against root-knot nematodes (Meloidogyne spp.). Middle East Journal of Agriculture Research, v.8, n.3,
p.828-838, 2019. Available from: https://www.researchgate.net/publication/335856106_Serratia_marcescens_and_Pseudomonas_
aeruginosa_are_promising_candidates_as_biocontrol_agents_against_root-knot_nematodes_Meloidogyne_spp. Access on: Feb. 3, 2024.

ISHII, K.; ADACHI, T.; HARA, T.; HAMAMOTO, H.; SEKIMIZU, K. Identification of a Serratia marcescens virulence factor that promotes
hemolymph bleeding in the silkworm, Bombyx mori. Journal of Invertebrate Pathology, v.117, p.61-67, 2014. https://doi.org/10.1016/j.
jip.2014.02.001

JÍMENEZ, G.; URDIAIN, M.; CIFUENTES, A.; LÓPEZ-LÓPEZ, A.; BLANCH, A.R.; TAMAMES, J.; KÄMPFER, P.; KOLSTO, A.-B.;
RAMÓN, D.; MARTÍNEZ, J.F.; CODOÑER, F.M.; ROSSELLÓ-MÓRA, R. Description of Bacillus toyonesis sp. nov., a novel species of
the Bacillus cereus group, and pairwise genoma comparisons of the species of the group by means of ANI calculations. Systematic Applied
Microbiology, v.36, n.6, p.383-391, 2013. https://doi.org/10.1016/j.syapm.2013.04.008

KHADIRI, M.; BOUBAKER, H.; ASKARNE, L.; EZRARI, S.; RADOUANE, N.; FARHAOUI, A.; El HAMSS, H.; TAHIRI, A.; BARKA,
E.A.; LARHLALI, R. Bacillus cereus B8W8 an effective bacterial antagonist against major postharvest fungal pathogens of fruit. Postharvest
Biology and Technology, v.200, 112315, 2023. https://doi.org/10.1016/j.postharvbio.2023.112315

LANA FILHO, R.; FERRO, H.M.; PINHO, R.S.C. Controle biológico mediado por Bacillus subtilis. Revista Trópica, v.4, n.2, p.12, 2010.
Available from: https://periodicoseletronicos.ufma.br/index.php/ccaatropica/article/view/145. Acess on: Mar. 11, 2023.

MAHARANA, C.; KUMAR, P.V.; HUBBALLI, A.B.; RAJ, M. Secondary metabolites of microbials as potential pesticides. In: CHAKRABARTI,
S.K.; SHARMA, S.; SHAH, M.A. (eds.). Sustainable management of potato pests and diseases. Singapore: Springer, 2022. p.111-142. https://
doi.org/10.1007/978-981-16-7695-6_5

MARRERO, L.; SUÁREZ, Y.; O’RELLY, J.; FERNÁNDEZ, M.; ACOSTA, J.; TORREN, J. Patogenicidad de Heterorhabditis bacteriophora
(Poinar) sobre las chinches de la soya Piezodorus guildinii West y Nezara viridula (L.) (Hemiptera: Pentatomidae). Fitosanidad, v.19, n.3,
p.227-232, 2015. Available from: http://www.redalyc.org/articulo.oa?id=209150672005. Access on: Sept. 15, 2023.

MONTEIRO, L.; MARIANO, R.L.R.; SOUTO-MAIORL, A.M. Antagonism of Bacillus spp. Against Xanthomonas campestris pv. campestris.
Brazilian Archives of Biology and Technology, v.48, n.1, p.23-29, 2005. https://doi.org/10.1590/S1516-89132005000100004

Arq. Inst. Biol., São Paulo, v.91, 1-13, e00042024, 2024 11

 S.F. Esparza-Mora et al.

NANZER, S.L.L.; RECCHIA, G.H.; OROZCO, J.G.C.; ABE SILVA, R.S.; CARDOSO, J.F.M.; LEITE, L.G. Assessment of entomopathogenic
nematodes and their symbiotic bacteria to control the stink bugs Euschistus heros and Dichelops melacanthus (Heteroptera: Pentatomidae)
in the soybean-corn succession system. Turkish Journal of Zoology, v.45, n.8, p.356-371, 2021. https://doi.org/10.3906/zoo-2104-53

NIU, D.D.; LIU, H.X.; JIANG, C.H.; WANG, Y.P.; WANG, Q.Y.; JIN, H.L.; GUO, J.-H. The plant-growth-promoting rhizobacterium Bacillus
cereus AR156 induces systemic resistance in Arabidopsis thaliana by simultaneously activating salicylate and jasmonate/ethylene-dependent
signaling pathways. Molecular Plant-MicrobeInteractions, v.24, n.5, p.533-542, 2011. https://doi.org/10.1094/MPMI-09-10-0213

PANE, C.; ZACCARDELLI, M. Evaluation of Bacillus strains isolated from solanaceous phylloplane for biocontrol of Alternaria early
blight of tomato. Biological Control, v.84, p.11-18, 2015. https://doi.org/10.1016/j.biocontrol.2015.01.005

PORTAL DO AGRONEGÓCIO. Maior infestação de pragas, como percevejo-marrom e mosca branca, impactou produtividade da soja,
aponta pesquisa, 2024. Available from: https://www.portaldoagronegocio.com.br/agricultura/pragas-e-doencas/noticias/maior-infestacao-
de-pragas-como-percevejo-marrom-e-mosca-branca-impactou-produtividade-da-soja-aponta-pesquisa. Access on: Oct. 21, 2024.

RAGVENDRAN, C.; NATARAJAN, D. Serratia marcescens (Enterobacteriaceae): An alternate biocontrol agent for mosquito vectors
Aedes aegypti and Culex quinquefasciatus. PTB Reports, v.3, n.1, p.14-20, 2017. https://www.researchgate.net/publication/315766738_
Serratia_marcescens_Enterobacteriaceae_An_alternate_biocon-trol_agent_for_mosquito_vectors_Aedes_aegypti_and_Culex_quinque-
fasciatus_Diptera_Culicidae_1

RAMÍREZ, V.; MARTÍNEZ, J.; BUSTILLOS-CRISTALES, M.R.; CATAÑEDA-ANTONIO, D.; MUNIVE, J.A.; BAEZ, A. Bacillus cereus
MH778713 elicits tomato plant protection against Fusarium oxysporum. Journal of Applied Microbiology, v.132, n.1, p.470-482, 2022.
https://doi.org/10.1111/jam.15179

RESQUÍN-ROMERO, G.; CABRAL-ANTÚNEZ, C.; SARUBBI-ORUE, H.; GARRIDO-JURADO, I.; VALVERDE-GARCÍA, P.; SCHADE,
M.; BUTT, T.M. Virulence of Metarhizium brunneum (Ascomycota: Hypocreales) Strains Against Stinkbugs Euschistus heros and Dichelops
furcatus (Hemiptera: Pentatomidae). Journal of Economic Entomology, v.113, n.5, p.2540-2545, 2020. https://doi.org/10.1093/jee/toaa150

RIBEIRO, F.C.; ROCHA, F.S.; LEMUS ERASMO, E.A.; MATOS, E.P.; COSTA, S.J. Manejo com inseticidas visando o controle de percevejo
marrom na soja intacta. Revista de Agricultura Neotropical, v.3, n.2, p.48-53, 2016. https://doi.org/10.32404/rean.v3i2.1132

ROJAS-SOLIS, D.; VENCES-GUZMÑAN, M.A.; SOHLENKAMP, C.; SANTOYO, G. Bacillus toyonensis COPE52 modifies lipid and
fatty acid composition, exhibits antifungal activity, and stimulates growth of tomato plants under saline conditions. Current Microbiology,
v.77, n.10, p.2735-2744, 2020. https://doi.org/10.1007/s00284-020-02069-1

ROMANO, E.; BRASILEIRO, A.C.M. Extração de DNA de plantas. Biotecnologia, Ciência & Desenvolvimento, v.2, n.9, p.40-43, 1999.
Available from: https://edisciplinas.usp.br/pluginfile.php/7703428/mod_resource/content/1/Artigo%20-%20extra%C3%A7%C3%A3o%20
de%20DNA%20de%20plantas.pdf Access on: Mar. 5, 2024.

SARRÍAS, J.A.; VALERO, M.; SALMERO, N.M.C. Enumeration, isolation and characterization of Bacillus cereus strains from Spanish
raw rice. Food Microbiology, v.19, n.6, p.589-595, 2002. https://doi.org/10.1006/fmic.2002.0514

SAUKA, D.H.; PERALTA, C.; PÉREZ, M.P.; ONCO, M.I.; FIODOR, A.; CABALLERO, J.; CABALLERO, P.; BERRY, C.; del VALLE,
E.E.; PALMA, L. Bacillus toyonensis biovar thuringiensis: A novel entomopathogen with insecticidal activity against lepidopteran and
coleopteran pests. Biological Control, v.167, 104838, 2022. https://doi.org/10.1016/j.biocontrol.2022.104838

SCHMITZ, A.; RIESNER, D. Purification of nucleic acids by selective precipitation with polyethylene glycol 6000. Analytical Biochemistry,
v.354, n.2, p.311-313, 2006. https://doi.org/10.1016/j.ab.2006.03.014

SCHÜNEMANN, R.; KNAAK, N.; FIUZA, L.M. Mode of action and specificity of Bacillus thuringiensis toxins in the control of caterpillars
and stink bugs in soybean culture. ISRN Microbiology, p.1-12, 2014. https://doi.org/10.1155/2014/135675

SCOTT, A.J.; KNOTT, M. A cluster analysis method for grouping means in the analysis of variance. Biometrics, v.30, n.3, p.507-512,
1974. https://doi.org/10.2307/2529204

12 Arq. Inst. Biol., São Paulo, v.91, 1-13, e00042024, 2024

 Exploration of entomopathogenic bacteria as potential control agents for brown stink bug Euschistus heros (F.) (Hemiptera: Pentatomidae)

SHIN, J.H.; LEE, H.K.; LEE, S.C.; HAN, Y.K. Biological control of Fusarium oxysporum, the causal agent of fusarium basal rot in onion
by bacillus spp. Plant Pathology Journal, v.39, n.6, p.600-613, 2023. https://doi.org/10.5423/PPJ.OA.08.2023.0118

SILVA, G.V.; BUENO, A.F.; FAVETTI, B.M.; NEVES, P.M.O.J. Use of low temperature storage to preserve host and parasitoid to improve the
rearing of Telenomus podisi (Hymenoptera: Platygastridae) on Euschistus heros (Hemiptera: Pentatomidae) Eggs. Neotropical Entomology,
v.48, p.126-135, 2019. https://doi.org/10.1007/s13744-018-0609-4

SILVA, M.C.; SIQUEIRA, H.A.A.; MARQUES, E.J.; SILVA, L.M.; BARROS, R.; LIMA, J.V.M.; SILVA, S.M.F. Bacillus thuringiensis isolates
from northeastern Brazil and their activities against Plutella xylostella (Lepidoptera: Plutellidae) and Spodoptera frugiperda (Lepidoptera:
Noctuidae). Biocontrol Science and Technology, v.22, n.5, p.583-599, 2012. https://doi.org/10.1080/09583157.2012.670802

SILVA-SANTANA, M.F.; ALVES, L.F.A.; FERREIRA, T.T.; BONINI, A.K. Selection and characterization of Beauveria bassiana fungus
and their potential to control the brown stink bug. Biocontrol Science and Technology, v.32, n.1, p.90-102, 2022. https://doi.org/10.1080
/09583157.2021.1970716

SINDHU, S.S.; SEHRAWAT, A.; SHARMA, R.; KHANDELWAL, A. Biological control of insect pests for sustainable agriculture. In:
ADHYA, T.; MISHRA, B.; ANNAPURNA, K.; VERMA, D.; KUMAR, U. (eds.). Advances in soil microbiology: recent trends and future
prospects. Microorganisms for Sustainability. Singapore: Springer, 2017. v.4. p.189-218. https://doi.org/10.1007/978-981-10-7380-9_9

SMANIOTTO, L.F.; PANIZZI, A.R. Interactions of selected species of stink bugs (Hemiptera: Heteroptera: Pentatomidae) from leguminous
crops with plants in the neotropics. Florida Entomologist, v.98, n.1, p.7-17, 2015. https://doi.org/10.1653/024.098.0103

SOMEYA, N.; NAKAJIMA, M.; HIRAYAE, K.; HIBI, T.; AKUTSU, K. Synergistic antifungal activity of chitinolytic enzimes and prodigiosin
produced by biocontrol bacterium, Serratia marcescens strain B2 against gray mold pathogen, Botrytis cinerea. Journal of General Plant
Pathology, v.67, p.312-317, 2001. https://doi.org/10.1007/PL00013038

SOUTO, A.L.; SYLVESTRE, M.; TOLKE, E.D.; TAVARES J.F.; BARBOSA-FILHO, J.M.; CEBRIÁN-TORREJÓN, G. Plant-derived pesticides
as an alternative to pest management and sustainable agricultural production: prospects, applications and challenges. Molecules, v.26,
n.16, p.4835, 2021. https://doi.org/10.3390/molecules26164835

STOCK, S.P.; KUSAKABE, A.; OROZCO, R.A. Secondary metabolites produced by Heterorhabditis symbionts application in agriculture:
what we know and what to do next. Journal of Nematology, v.49, n.4, p.373-383, 2017. https://doi.org/10.21307/jofnem-2017-084

TAMURA, K.; STECHER, G.; PETERSON, D.; FILIPSKI, A.; KUMAR, S. MEGA6: molecular evolutionary genetics analysis version 6.0.
Molecular Biology and Evolution, v.30, n.12, p.2725-2729, 2013. https://doi.org/10.1093/molbev/mst197

TUELHER, E.S.; SILVA, E.H.; RODRIGUES, H.S.; HIROSE, E.; GUEDES, R.N.C.; OLIVEIRA, E.E. Area-wide spatial survey of the
likelihood of insecticide control failure in the neotropical brown stink bug Euschistus heros. Journal of Pest Science, v.91, p.849-859, 2018.
https://doi.org/10.1007/s10340-017-0949-6

WEISBURG, W.G.; BARNS, S.M.; PELLETIER, D.A.; LANE, D.J. 16S ribosomal DNA amplification for phylogenetic study. Journal of
Bacteriology, v.173, n.2, p.697-703, 1991. https://doi.org/10.1128/jb.173.2.697-703.1991

WILLIAMS, L.D.; BURDOCK, G.A.; JIMÉNEZ, G., CASTILLO, M. Literature review on the safety of Toyocerin a non-toxigenic and
non-pathogenic Bacillus cereus var. toyoi preparation. Regulatory Toxicology and Pharmacology, v.55, n.2, p.236-246, 2009. https://doi.
org/10.1016/j.yrtph.2009.07.009

YIN, N.; ZHAO, J.-L.; LIU, R.; LI, Y.; LING, J.; YANG, Y.-H.; XIE, B.-Y.; MAO, Z.-C. Biocontrol efficacy of Bacillus cereus strain Bc-cm103
against Meloidogyne incognita. Plant Disease, v.105, n.8, 2021. https://doi.org/10.1094/PDIS-03-20-0648-RE

Arq. Inst. Biol., São Paulo, v.91, 1-13, e00042024, 2024 13