TYPE Original Research

PUBLISHED 30 August 2022

DOI 10.3389/fphys.2022.979472

Physiological and muscle tissue

OPEN ACCESS responses in Litopenaeus
EDITED BY
Seema Ramniwas,
Chandigarh University, India
vannamei under hypoxic stress
REVIEWED BY
Divya Singh,
via iTRAQ
Chandigarh University, India
Youji Wang,
Shanghai Ocean University, China
Fengtong Chang 1,2, Na Li 1,2†, Xiang Shi 1,2, Volovych Olga 1,2,
Jia-Song Zhang, Xiaobing Wang 1,2,4*, Xiaoping Diao 1, Hailong Zhou 1,2,4* and
South China Sea Fisheries Research
Institute (CAFS), China Xianming Tang 3*
Xianyun Ren,
1
Yellow Sea Fisheries Research Institute State Key Laboratory of South China Sea Marine Resource Utilisation, Hainan University, Haikou,
(CAFS), China China, 2School of Life Sciences, Hainan University, Haikou, China, 3Hainan Provincial Key Laboratory of
Tropical Maricultural Technology, Hainan Academy of Ocean and Fisheries Sciences, Haikou, Hainan,
*CORRESPONDENCE China, 4One Health Institute, Hainan University, Haikou, Hainan, China
Xiaobing Wang,
[email protected]
Hailong Zhou,
[email protected]
Xianming Tang, White L. vannamei have become the most widely cultivated shrimp species
[email protected]
worldwide. Cultivation of L. vannamei is one of the predominant sectors in
†
These authors share first authorship
China’s aquaculture industry. This study focused on the physiological and
SPECIALTY SECTION biochemical responses, differential protein expression, and expression
This article was submitted to
Invertebrate Physiology, characteristics of the related crucial functional protein genes under low
a section of the journal oxygen conditions among different strains of L. vannamei. It was found that
Frontiers in Physiology
6 h of hypoxic stress caused a significant reduction in the total hemocyte
RECEIVED 27 June 2022 number in both strains, while the hypoxia-sensitive strain showed a stronger
ACCEPTED 02 August 2022
PUBLISHED 30 August 2022
reduction. In contrast, the hemocyanin concentration showed only an overall
upward trend. Proteomic analysis of L. vannamei muscle tissue revealed
CITATION
Chang F, Li N, Shi X, Olga V, Wang X, 3,417 differential proteins after 12 h of hypoxic stress. Among them,
Diao X, Zhou H and Tang X (2022), 29 differentially expressed proteins were downregulated and 244 were
Physiological and muscle tissue
responses in Litopenaeus vannamei
upregulated in the hypoxia-sensitive strain. In contrast, there were only
under hypoxic stress via iTRAQ. 10 differentially expressed proteins with a downregulation pattern and
Front. Physiol. 13:979472. 25 with an upregulation pattern in the hypoxia-tolerant strain. Five protein
doi: 10.3389/fphys.2022.979472
genes that responded significantly to hypoxic stress were selected for
COPYRIGHT
© 2022 Chang, Li, Shi, Olga, Wang, Diao,
quantitative real-time PCR analysis, namely, hemocyanin, chitinase, heat
Zhou and Tang. This is an open-access shock protein 90 (HSP 90), programmed death protein, and glycogen
article distributed under the terms of the phosphorylase. The results showed that the gene expression patterns were
Creative Commons Attribution License
(CC BY). The use, distribution or consistent with proteomic experimental data except for death protein and
reproduction in other forums is glycogen phosphorylase. These results can enrich the general knowledge of
permitted, provided the original
hypoxic stress in L. vannamei and the information provided differentially
author(s) and the copyright owner(s) are
credited and that the original expressed proteins which may be used to assist breeding programs of L.
publication in this journal is cited, in vannamei of new strains with tolerance to hypoxia.
accordance with accepted academic
practice. No use, distribution or
reproduction is permitted which does KEYWORDS
not comply with these terms.
Litopenaeus vannamei, hypoxia stress, physiological responses, proteome, real-time
quantitative PCR

Frontiers in Physiology 01 frontiersin.org

Chang et al. 10.3389/fphys.2022.979472

Introduction (Macrobrachium rosenbergii) and revealed a reduction in THC

by 36% after 12 h in a 2.75 mg/L DO concentration environment
Dissolved oxygen (DO) is an important factor in the aquatic (Cheng and Chen 2000). In response to hypoxia, shrimp can
environment and an indicator of water quality. The increase their HC to maintain oxygen transport. In a related
concentration of DO in water is normally approximately study, two strains of L. vannamei had significantly decreased
6 mg/L, while lower than 2.8 mg/L is referred hypoxia (Diaz THCs under hypoxic stress, while having significantly increased
and Rosenberg 1995). Global climate change and human HCs (Wei Y et al., 2016).
activities intensified hypoxic conditions in marine ecosystems The rapid development of proteomics technology in
especially in coastal areas around the world (Breitburg et al., recent years has allowed its wide application in the study of
2018). The expansion of hypoxic areas in the open ocean and aquatic crustacean pathogen infection (Chongsatja et al.,
coastal waters are expected to continue and will have a great 2007; Wang et al., 2007). For example, a combination of
impact on the ecosystem and biodiversity (Keeling, Kortzinger two-dimensional (2-DE) electrophoresis, mass
and Gruber 2010). spectrometry, and bioinformatics tools was used to discover
Animal responses to hypoxic stress are divided into the major allergen of freshwater prawn (Macrobrachium
physiological, biochemical, and behavioral responses. A rosenbergii) (Yadzir et al., 2012). However, only a few
physiological response includes changes in heart rate, studies have reported the hypoxic stress response in
respiratory metabolism, cell proliferation, and apoptosis, crustaceans using this approach, one of which is the
hemocyanin level, immune response, antioxidant capacity, and investigation of hypoxia effects on oriental river prawn
osmotic regulation ability. Hypoxic environments may also alter (Macrobrachium nipponense) muscle proteome using a 2D-
the expression of certain genes that subsequently leads to a series gel-based proteomics approach coupled with mass
of biochemical and physiological responses, which allow spectrometry (MS) (Sun et al., 2016).
organisms to survive in such conditions. In marine crustaceans, changes in gene expression often
It’s been reported that hypoxia can elicit adverse effects on underlie or reflect key physiological and biochemical
the behavior, growth, development, respiration, metabolism, acclimations to hypoxia, which has been verified by global
immunity, DNA damage, and gene expression of aquatic transcriptome profiling by microarrays (Li and Brouwer,
organisms (Levin et al., 2009; Guadagnoli, Tobita and Reiber 2013). Crustaceans also respond to hypoxia by altering
2011; Zhou et al., 2014; Li et al., 2016). Various studies found that levels of respiratory pigments, antioxidant proteins, and
the rate of growth, weight gain, and feed utilization in channel enzymes involved in glycolysis, amino acid and nucleotide
catfish (Ictalurus punctatus), Atlantic cod (Gadus morhua), fish metabolism (Brouwer et al., 2004; Abe et al., 2007; Jiang
(Leporinus elongates), and silver catfish (Rhamdia quelen) were et al., 2009). Particularly, the glycolytic enzymes hexokinase
decreased under hypoxic conditions (Buentello et al., 2000; (HK), phosphofructokinase (PFK), lactate dehydrogenase
Chabot and Biology. 2005; Filho et al., 2005; Riffel et al., (LDH) (Cota-Ruiz et al., 2015; Ulaje et al., 2019), and
2014). An extensive study of red-eared turtles under hypoxic glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
stress revealed changes in carbohydrate metabolism and the (Camacho-Jim´enez et al., 2018) can be induced
antioxidant defense system. Along with the increase in differentially in tissues of L. vannamei in response to
hypoxic duration, the contents of lactic acid and blood hypoxia.
glucose in the blood increased rapidly, while the glycogen in L. vannamei is one of the main species in the global shrimp
skeletal muscle and liver was gradually consumed (Ye et al., aquaculture business with important economic value. However,
2011). due to the rapid economic development of coastal zones, the
According to a report by Gray, Wu and Ying (2002), the higher frequency of hypoxia caused an increase in expenses for
anoxic resistance of aquatic animals decreases in the following rearing diets. Hypoxia has become one of the major problems
order: mollusks, annelids, echinoderms, crustaceans, and fish. that affect the normal growth and development of L. vannamei,
Shrimp and other marine invertebrates lack adaptive immune and it seriously restricts the sustainable aquaculture of the
mechanisms and rely on innate immune responses to cope with species.
environmental stress (Tassanakajon et al., 2018). Currently, Additionally, the muscle tissue of L. vannamei takes up most
research on the effects of hypoxia on prawns and other of the body mass and uses a lot of oxygen, however, the responses
crustaceans is mainly focused on changes in innate immune of shrimp muscle tissues to hypoxia remain unknown. Therefore,
system parameters, such as total hemocyte counts (THCs) and deep investigation of the hypoxia stress response of muscle tissue,
hemocyanin concentrations (HCs), which could reveal possible THC, HC and related genes, which can not only enrich a general
adaptations to hypoxic conditions. Chen et al. found that the understanding of the hypoxia effect and mechanisms of hypoxia
THC of scallop (Chlamys farreri) gradually and significantly tolerance, but also can provide novel insights into the assisting
decreased with a decline in the DO level to 2.5 mg/L (Chen breeding of new shrimp strains with higher resistance to low
et al., 2007). A similar study was performed on freshwater prawn oxygen conditions.

Frontiers in Physiology 02 frontiersin.org

Chang et al. 10.3389/fphys.2022.979472

Materials and methods Protein extraction and digestion

Shrimp and hypoxia stress The muscle of the three individuals from each treatment were
mixed equally, so total nine samples for each group were
The shrimp (13 ± 0.5 cm) used in the experiment were all subjected to protein extraction. The muscle tissues of two
from Hainan Guangtai Marine Culture Co., Ltd. (Wenchang strains of L. vannamei after 0 h and 12 h hypoxia were
City, Hainan Province, China). Only shrimp in the inter-molt selected respectively as proteomics experimental materials. For
stage and similar size of juvenile shrimp were used in the the convenience of bioinformatics analysis of data, the samples of
experiments. Before the formal experiment, they were hypoxia with 0 h were defined as control I and experiment I
acclimated in the aquarium for 3 days, during which the respectively. Correspondingly, samples of hypoxia with 12 h were
seawater salinity was 1.9% ± 0.2%, the pH value was 8.1 ± defined as control II and experiment II respectively. The sample
0.2, and the temperature was 27°C ± 1°C. Food was given was ground with liquid nitrogen, transferred to precooled
twice a day (no feeding during molting and hypoxic stress), cracking buffer (8 M urea, 40 mM Tris-HCl or TEAB with
and half of the seawater was changed in the bucket every day. The 1 mM PMSF, 2 mM EDTA, and 10 mM DTT, pH = 8.5), and
content of DO under hypoxic stress was 0.5 ppm, and the stress ultrasonically treated for 2 min to release proteins. After
times were 0 p.m., 3 p.m., 6 h, and 12 h. The level of dissolved centrifugation at 25,000×g for 20 min at 4°C, the supernatant
oxygen was maintained by filling the barrel with nitrogen. was transferred to a new test tube, reduced with 10 mM
Two different strains of L. vannamei, namely Zhengda and dithiothreitol (DTT) at 56°C for 1 h, and alkylated for 45 min
A6410 were selected for this study. The former is hypoxia- in the dark with 55 mM iodoacetamide (IAM) at room
sensitive strain and the latter is hypoxia-tolerant strain. Study temperature. After centrifugation (25,000×g, 4 °C, 20 min), the
has shown that the HIF-1 (Hypoxia-inducible Factor 1) protein-rich supernatant was quantified by a standard Bradford
expression quantity of the strain Zhengda was always higher protein assay. The extracted protein samples were analyzed by
than strain A6410 in the whole phase of hypoxia, the SDS–PAGE electrophoresis with Coomassie brilliant blue gel
A6410 strain did not need more HIF-1 expression to regulate staining. The protein solution (100 µg) with 8 M urea was diluted
target genes to deal with hypoxic stress compared to strain 4-fold with 100 mM TEAB. Trypsin Gold (Promega, Madison,
Zhengda at the same level of hypoxia, which indicated that WI, United States) was used to digest the proteins at a protein:
strain A6410 has better hypoxia tolerance than strain Zhenda trypsin ratio of 40:1 at 37°C overnight. After trypsin digestion,
(Wei L et al., 2016). peptides were desalted with a Strata X C 18 column
(Phenomenex) and vacuum-dried according to the
manufacturer’s protocol.
Hemolymph collection and measuring of
total hemocyte counts and hemocyanin
concentrations Labeling and grading of polypeptides

Three shrimps were randomly selected from each replicate, After trypsin digestion, the peptides were dissolved by adding
and there have three replicates at different hypoxia treatments, 30 µl of 0.5 M TEAB, and the iTRAQ labeling reagents were
which used to measure the parameter of THC and HC. transferred and combined with samples at room temperature.
Pericardial blood was drawn from shrimp with a 1 ml syringe Peptide labeling was performed using the iTRAQ reagent 8-Plex
and mixed with anticoagulants (30 mM trisodium citrate, 0.34 M kit, according to the manufacturer’s operating procedures.
sodium chloride, 10 mM EDTA, and 0.115 M glucose) of the Labeled peptides of different reagents were desalted with a
same volume on the ice. A hemolymph volume of 10 µl was combination of Strata X C18 columns (Phenomenex) and
absorbed by a microtransfer gun and counted under a light vacuum-dried according to manufacturer specifications. The
microscope, and the appropriate amount of hemolymph was peptides were separated by the Shimadzu LC-20AB HPLC
centrifuged at 4°C and 5,000×g for 10 min. Then, 100 µl Pump system coupled with a high pH RP column. The
supernatant was taken and mixed with 2,900 µl of buffer peptides were reconstituted with buffer A [ACN:H2O (1:19),
solution (50 mM Tris, 10 mM CaCl2, and pH = 8.0). The pH = 9.8 adjusted with ammonia] to a total volume of 2 ml and
absorbance values of the diluted plasma were measured at loaded onto a column containing 5 μm particles (Phenomenex).
335 nm using a UV spectrophotometer (1 cm path length) The peptides were separated at a flow rate of 1 ml/min in the
(PerkinElmer Lambda 25). The hemocyanin concentration following sequence: 5% buffer B [H2O:ACN (1:19), pH =
(unit: mg.ml−1) was calculated using the following formula: 9.8 adjusted with ammonia] for 10 min, 5%–35% buffer B for
E335 nm (mg.ml−1) = 2.3×OD335 nm (E stands for HC; 2.3 is 40 min, and 35%–95% buffer B for 1 min. The system was
the extinction coefficient of hemocyanin for mg.mL−1) (Yang and maintained in 95% buffer B for 3 min and then in 5% buffer
Pan 2013; Wei Y et al., 2016). B for 1 min before equilibration with 5% buffer B for 10 min.

Frontiers in Physiology 03 frontiersin.org

Chang et al. 10.3389/fphys.2022.979472

Elution was monitored by measuring the absorbance at 214 nm, PDCD4, and GP genes was individually determined with
and its fractions were collected every minute. The eluted peptides quantitative real-time-PCR (qRT–PCR). SYBR green Master I
were pooled as 20 fractions and dried by vacuum. (Roche) was used to perform qRT–PCR using obtained cDNA
samples (2 μl) in a 20 μl reaction mixture on a ROCHE
LightCycler 96 Real-Time Cycler PCR Detection System
HPLC analysis (Roche Applied Science, Mannheim, Germany) using the
following primers (Table 1). Ribosomal protein L8 was chosen
Each fraction was resuspended in buffer A (2% ACN and as a reference housekeeping gene (Rojas-Hernandez et al., 2019).
0.1% FA in water) and centrifuged at 20,000×g for 10 min. The qRT–PCR was performed with the following cycling conditions:
supernatant was loaded onto a C18 trap column at 5 μl/min for 94°C, 10 min; (94°C, 15 s; 60°C, 1 min) × 40 cycles. All samples
8 min using an LC-20AD nano-HPLC instrument (Shimadzu, were examined in triplicate on the same plate. qRT–PCR data
Kyoto, Japan) by an autosampler. The peptides were eluted with a were normalized using ribosomal protein L8 expression as a
trap column and then separated by an analytical C18 column reference gene (Rojas-Hernandez et al., 2019). qRT–PCR data
(inner diameter 75 μm) packed in-house. The gradient was run at were analyzed using the 2-△△Ct method (Livak and Schmittgen
a rate of 300 nl/min starting with 8%–35% buffer B (2% H2O and 2001) and expressed as an n-fold value against the control
0.1% FA in ACN) for 35 min and then 60% buffer B for 5 min sample.
followed by 80% buffer B for 5 min. At the final stage, 5% buffer B
was used for 0.1 min and equilibrated for 10 min.
Results and discussion
Bioinformatics analysis Physiological responses of two strains
under the hypoxic stress
High-resolution mass spectrometry data were used for
further analysis. The DDA data were evaluated using In this study, overall, there was no significant change in THC
MaxQuant’s integrated Andromeda engine with further of the two strains after 3 h of hypoxic stress compared to 0 h.
spectrum library generation with Spectronaut. For large-scale However, after 6 and 12 h of hypoxic stress, the THC parameters
DIA data, Spectronaut was used constructed spectral database of the two strains were significantly reduced (p < 0.05).
information to complete deconvolution extraction of data, and Compared with 3 h of hypoxia, 6 h of hypoxia significantly
the mProphet algorithm was used to complete quality control of decreased the THC parameter (p < 0.05). Compared with
data analysis by obtaining a large number of reliable quantitative hypoxia for 6 h, THC decreased significantly after 12 h of
results. GO, COG, and pathway annotation analysis were also hypoxia (p < 0.05). The THC of the hypoxic-sensitive strain
performed during this step. The cohort of differentially expressed was significantly lower than that of the hypoxic-tolerant strain
proteins among different comparison groups was identified after 12 h and 6 h of hypoxia treatment. However, there was no
based on these results. significant difference in THC content between the two strains at
the same time of hypoxia treatment (3, 6, and 12 h) (p > 0.05)
(Figure 1A). The HC of hypoxic and sensitive strains showed an
Total RNA extraction, reverse overall upward trend, but compared with 0 h, hypoxic treatment
transcription, and quantitative real- for 3, 6, and 12 h had no significant effect on HC (p > 0.05)
time-PCR (Figure 1B).

The muscle of the three individuals from each treatment were

mixed equally, so total nine samples for each group were Principal component analysis and sample
subjected to total RNA extraction. The muscle tissues of two correlation analysis
strains of L. vannamei after 0 h and 12 h hypoxia were selected
respectively as the experimental materials used in RNA Principal component analysis (PCA) can reflect the
extraction, which were consistent with those used in proteome variability between and within groups through the original
analysis. RNAiso Plus (TaKaRa) was used for total RNA data and present the trend of intergroup separation in the
extraction following the manufacturer’s protocol. The experimental model. To master the aggregation and separation
obtained RNA samples were treated with DNase I (Promega) of experimental Group I, experimental group II, control I, and
to remove contaminating DNA. Next, approximately 2000 μg of control group II experimental groups, four histone protein
total RNA was reverse transcribed into cDNA using a GoScript expression datasets were treated as four variables and
reverse transcription system (Promega) in a 25 μL reaction analyzed by PCA with SPSS software (Figure 2). The analysis
mixture. The expression of the hemocyanin, chitinase, HSP90, results show good independence of the four groups of variables,

Frontiers in Physiology 04 frontiersin.org

Chang et al. 10.3389/fphys.2022.979472

TABLE 1 Primer sequence of the selected genes.

Genes primers (59 to 39) Accession numbers

L8 F:TAGGCAATGTCATCCCCATT DQ316258.1
R:TCCTGAAGGAAGCTTTACACG
Hemocyanin F:AGTGGGCATCCTTTGTCGG KY695246.1
R:CTGTTGGTGAAGAGGTGCGG
Chitinase F:ATCGCAACCCATCAAACCTCG AF315689.1
R:ACAATCGTCGCAGACACGGT
HSP 90 F:GGGTCACGTCCAACAGCAAC QCYY01001690.1
R:TCGCCTTCACAGACACMGAGC
PDCD4 F:GATTAACTGTGCCAACCAGTCCAAAG XM_027364270.1
R:CATCCACCTCCTCCACATCATACAC
GP F:CCAGAATCCTCCACATAACT MK721970.1
R:GGAATACTGGCTCCATCAC

so four groups of data can be used for subsequent comparative significantly upregulated, and 25 proteins had downregulated
analysis. To quantitatively reflect the correlation between the expression levels (p < 0.05). In the control group II vs control
four groups of proteins, the Pearson correlation coefficient of group I comparison group, a total of 1,448 proteins were
protein expression between each group was calculated by SPSS detected, among which 1,175 proteins had no significant
software and presented in the form of a heat map difference in expression level (p > 0.05), 29 proteins were
(Supplementary Figure S1). Pearson correlation coefficients of significantly upregulated, and 244 proteins were significantly
protein expression in all four groups were between 0.9 and 1.0, downregulated (p < 0.05). In contrast, among the
which indicated a strong correlation between all groups. 1,525 proteins detected in the experimental group II vs
control group II comparison group, 1,460 detected proteins
had no significant difference in expression (p > 0.05),
Statistical analysis of differential proteins 49 proteins had significantly upregulated expression, while
16 proteins had significantly downregulated expression (p <
The extraction of ion peak areas was first performed by 0.05). The volcanogram illustrates the differential protein
Spectronaut software, and the MSstats software package was used expression in the three comparison groups in a more intuitive
to calibrate and normalize the data within the system. In this manner (Supplementary Figure S3).
study, three comparison groups were set up, namely,
experimental group II vs. experiment I, control group II vs.
control I, and experimental group II vs. control group II, and the Gene ontology classification of differential
differences in the expression of various comparison histones were proteins
assessed according to the set comparison group and the linear
mixed effect model. When the condition of fold change ≥1.5 and In the GO (Gene Ontology) classification diagram of
corrected p value (adj_p value) < 0.05 was met, the difference was experimental group II vs. experimental group I, proteins in
considered significant. experimental group II related to biological process, cellular
In this study, four groups of protein expression data were first component, and molecular function category, were mostly
analyzed by data-dependent acquisition (DDA) mass upregulated compared to experimental group I, such as genes
spectrometry and all detectable nonredundant high-quality involved in signaling, metabolic process, response to stimuli,
MS/MS spectrogram information was obtained after database regulation of the biological processes, and membrane systems
identification in MaxQuant software, which was used as the (Figure 3A). However, all differentially expressed proteins in the
spectrogram database for subsequent DIA (Supplementary category of multicellular biological processes were
Figure S2). The total number of peptide and the number of downregulated. In the GO classification diagram of control
protein detected in the three comparison groups were 16,603 and group II vs. group I, control group II had upregulated
3417, respectively. A total of 1,452 proteins were detected in the proteins mostly from the category belonging to biological
experimental group II vs experimental group I comparison process, cellular component, and molecular function.
group; among them, 1,417 proteins had no significant (Figure 3B). Among them, proteins were identified that were
difference in expression level (p > 0.05), 10 proteins were involved in responses to stimuli, negative and positive regulation

Frontiers in Physiology 05 frontiersin.org

Chang et al. 10.3389/fphys.2022.979472

FIGURE 1
THC and HC in two strains of L. vannamei. (A) THC in two strains of L. vannamei, (B) HC in two strains of L. vannamei. Each bar represents the
mean value of three determinations. The same letters in the data bar indicate no significant difference (p > 0.01), while different letters indicate
significant difference (p < 0.01).

Frontiers in Physiology 06 frontiersin.org

Chang et al. 10.3389/fphys.2022.979472

FIGURE 2
Principal Component Analysi X-axis displays the first principal
component and y-axis displays the second principal component.
The orange circles indicates experiment I, the green circles
indicates experiment II, the blue circles indicates control I and
the purple circles indicates control II.

of the biological processes, signal transduction, growth, immune

system processes, locomotion, pigmentation, membrane-
enclosed lumen, extracellular regions, supramolecular
complex, cell junction, and antioxidant activity. In the GO
classification diagram of experimental group II vs control
group II, some proteins were related to biological processes,
cellular components, and molecular functions, while the other
part was downregulated in control group II compared with
experimental group II (Figure 3C). Among the upregulated
proteins were those involved in cellular component
organization or biogenesis, organelles, supramolecular
complexes, molecular transducer activity, and structural
molecule activity. However, the expression of differential
proteins associated with the stress response, extracellular FIGURE 3
region part, and membrane were downregulated. Barplot of the Gene Ontology analysis. (A) experiment II vs.
experiment I, (B) control II vs. control I, (C) experiment II vs. control
II. The bar chart shows the distribution of corresponding GO terms.
Different colors represent different GO categories.
Eukaryotic orthologous groups
classification of differential proteins

In this study, the identified proteins were compared with the and metabolism) and the cytoskeleton, as well as post-
KOG (eukaryotic orthologous groups) database to predict and translational modification and protein turnover (chaperones)
classify their possible functions. In the KOG classification (Figure 4A). In the KOG classification diagram of control
diagram of experimental group II vs. experimental group I, group II vs. control group I, in addition to proteins with
the main difference among the proteins was associated with uncertain functions, there were many differences within
post-translational modification function (amino acid transport proteins involved in post-translational modification, protein

Frontiers in Physiology 07 frontiersin.org

Chang et al. 10.3389/fphys.2022.979472

FIGURE 4
Barplot of the KOG analysis. (A) experiment II vs. experiment I, (B) control II vs. control I, (C) experiment II vs. control II. Eukaryotic orthologous
groups (KOGs) were delineated by comparing protein sequences encoded in complete genomes, representing major phylogenetic lineages. X-axis
displays the KOG term, y-axis displays the corresponding protein count illustrating the protein number of different function.

turnover, chaperones, translation, ribosome structure and programmed cell death protein gene and glycogen phosphorylase
biogenesis, and signal transduction mechanisms (Figure 4B). gene were significantly increased in hypoxia-sensitive and hypoxia-
In the KOG classification diagram of experimental group II tolerant families (p < 0.05), and the expression levels of these genes
vs. the control group, most proteins were related to post- were significantly different in the two families (p < 0.05). The
translational modification, protein turnover, chaperones, expression of chitinase gene in the two families was significantly
translation, ribosomal structure and biogenesis, carbohydrate decreased (p < 0.05), and the expression of chitinase gene was
transport, and metabolism (Figure 4C). significantly different (p < 0.05). The expression level of heat shock
protein 90 gene in hypoxic-sensitive family was significantly
increased (p < 0.05), while the expression level of heat shock
Expression analysis of important protein 90 gene in hypoxic-resistant family was not significantly
functional protein genes under the changed (p > 0.05).
hypoxic stress in L. Vannamei

Hemocyanin gene, chitinase gene, heat shock protein 90 gene, Discussion

programmed cell death protein gene and glycogen phosphorylase
gene were selected for expression analysis (Figure 5). After 12 h of The dynamic changes in protein expression in the muscle
hypoxia stress, the expression levels of hemocyanin gene, tissue of L. vannamei under hypoxic stress were studied by the

Frontiers in Physiology 08 frontiersin.org

Chang et al. 10.3389/fphys.2022.979472

FIGURE 5
Expression of five genes in different periods of hypoxia in two strains of L. vannamei. X-axis displays the KOG term, y-axis displays the
corresponding protein count illustrating the protein number of different function.

iTRAQ technique. A total of 3417 proteins were detected. The and play a crucial role in crustacean immune defense (Liu
possible functions of all identified proteins were annotated et al., 2020). A number of animal hemocytes often change in
according to GO, KEGG, and DEPS databases. By comparing response to environmental changes or pathogenic
the proteome of the control group and the experimental group, microorganism infection (Qiu et al., 2011), so they are a
detailed information about the proteome response to hypoxic marker of body health and immune capacity. Under the
stress could be obtained. Low oxygen levels affect the immune condition of low oxygen (1.5 PPM), THC of green-lipped
function of L. vannamei. Crustaceans have nonspecific mussel (Perna viridis) (Wang et al., 2012) and scallop
immunity, where hemocytes are the main effector of the (Chlamys farreri) (Chen et al., 2007) decreased gradually with
immune response (Huang and Ren, 2019). Hemocytes have decreasing DO value. In this experiment, the THC of the two
the ability to wrap, engulf, and degrade invading pathogens strains of L. vannamei showed a downward trend at 0 h and 3 h

Frontiers in Physiology 09 frontiersin.org

Chang et al. 10.3389/fphys.2022.979472

after hypoxia treatment, without reaching a significant in shrimp due to the expression of various immune related genes
difference. THC was significantly decreased at 6 and 12 h after and other functional proteins with antibacterial and antiviral
hypoxia treatment (p < 0.05), which was similar to the above activities was widely changed in LvChi5 silencing shrimp (Niu
results. et al., 2018).
Hemocyanin is the most important plasma protein of Heat shock proteins are an important molecular chaperone
crustaceans and can bind and transport O2 and CO2 to serve as in eukaryotic cells (Zininga, Ramatsui and Shonhai, 2018). They
the respiratory protein of prawns. In addition to its main function as play a role in protecting cells from stress and oncogenic
an oxygen carrier, hemocyanin has been identified as a nonspecific transformation, providing cell cycle regulation, antigen
innate immune defense molecule of crustaceans (Coates and Nairn presentation, and participation in cellular stress responses,
2014) with antiviral and antibacterial properties (Lee, Lee and including changes in environmental conditioning stress (Kühl
Soderhall 2003). It can be functionally converted into phenolic and Rensing 2000; Udono 2012; Wu et al., 2017; Sornchuer et al.,
oxidase with agglutination abilities and hemolytic activity (Zhang 2018). It helps to refold the denatured protein into an appropriate
et al., 2006). When oxygen levels in the environment are low, conformation (Nakamoto et al., 2014).
crustaceans meet their oxygen needs by increasing the In this study, Hsp90 was significantly upregulated in hypoxic-
concentration of hemocyanin. A previous study revealed that HC sensitive L. vannamensis after 12 h of hypoxia stress, while there was
in L. vannamei was significantly increased (p < 0.05) under hypoxic no significant change in the expression of Hsp90 in hypoxic-tolerant
conditions (Wei L et al., 2016). Another shrimp species, oriental families. HSPs have been shown to be one of the main response
river prawn (Macrobrachium nipponense), had significantly proteins to hypoxic stress (Zhang, Zhang and Zhang 2016; Niu et al.,
increased (p < 0.05) expression levels of hemocyanin in response 2018). Although Ulaje et al. showed that Hsp70 and Hsp90 gene
to the hypoxic environment (Sun et al., 2016). In contrast, 10 h of expression in L. vannamei was down-regulated under hypoxia, in
hypoxic conditions negatively affected the HC rate in the southern both the short- and the long-term (Ulaje et al.,2020), most researches
king crab (Lithodes santolla) (Paschke et al., 2016). in crustaceans have indicated that the up-regulation in the
In this study, hypoxia treatment had no significant effect on expression of Hsps genes is a general response to cope with
the HC of L. vannamei in the two strains with hypoxia tolerance hypoxia (Sun et al., 2014, 2016; Jolly et al., 2018), which was
and sensitivity (p > 0.05), and there was no significant difference consistent with the results of this study.
in HC between the two strains at different periods of hypoxia (p > The hypoxic-sensitive strain L. vannamensis can regulate the
0.05). However, HC showed an overall upward trend compared protein level in a timely manner in response to the hypoxic-
to the control group, consistent with previous reports. In sensitive strain, while the protein expression in the hypoxic-
addition, HC increased gradually with prolonged hypoxia tolerant strain is at a normal level. In addition, after 12 h of
time, which was consistent with proteomic data. hypoxia, the expression of neuroendocrine differentiation factor
Under low DO circumstances, shrimp can adjust the use of in the hypoxic sensitive family was significantly upregulated,
energy substrates (carbohydrate, lipids, and proteins) to balance which may be related to its role in immune regulation (Sung et al.,
oxidative (Ulaje et al., 2019). In this experiment, immune-related 2016; Song et al., 2020; Junprung et al., 2017). The role of other
proteins, such as hemocyanin, chitinase, and heat shock protein 90, proteins identified in this study as a part of the response to
were found among the proteins expressed at significantly different hypoxia stress in L. vannamei remains to be further studied.
levels under hypoxic stress. Hemocyanin plays an important role in
the innate immunity of L. vannamei, such as antibacterial, antiviral,
hemolytic, anti-infective, and antitumor activities (Jiang et al., 2007; Conclusion
Zhang et al., 2009; Coates and Nairn 2014; Zheng et al., 2016).
Chitinases are widely exist in organisms as a group of hydrolytic Hypoxia stress has become a frequent occurrence in commercial
enzymes that hydrolyze chitin. The function of chitinases in L. vannamei farming, so it is important to explore the molecular
biological processes such as the growth of fungi, the molting of mechanisms of the hypoxic response and adjustment to changing
arthropods, and the invasion of bacteria or parasites into oxygen levels. This study demonstrated the changes in physiological
chitincontaining structures of the host has been intensely studied and biochemical levels in shrimp under conditions of low oxygen
(Arakane and Muthukrishnan, 2010; Chaudhuri et al., 2010; Pesch stress and investigated the expression of the hypoxic stress protein
et al., 2016). Chitinase is a key enzyme in the innate immunity of L. regulation mechanism and its function by comparing proteomics
vannamei and involved in numerous immunomodulatory responses data among two strains of L. vannamei with different tolerances to
(Zhang et al., 2016; Niu et al., 2018; Song et al., 2020), especially in hypoxia. The results from proteomic analysis were confirmed with
preventing bacterial infection (Duo-Chuan 2006; Gao et al., 2017). qRT–PCR to detect the gene expression level.
Chitinase expression in L. vannaensis infected with white spot Studies have indicated that low oxygen levels have an effect
syndrome virus is upregulated at the translation level (Jiang on THC and HC parameters. The hypoxia-sensitive strain
et al., 2007). A previous study demonstrated that chitinase plays showed a decreased number of hemocytes after 3 h under
a role in regulation of both humoral and cellular immune responses hypoxic conditions, while the hypoxia-tolerant strain response

Frontiers in Physiology 10 frontiersin.org

Chang et al. 10.3389/fphys.2022.979472

with significant changes in hemocyte number was delayed to 6 h Acknowledgments

in a hypoxic environment. Since hemocytes are involved in
oxygen transportation together with the immune response, The authors would like to thank the editors and the reviewers
these results suggest the weakening of immune system for their constructive comments and suggestions for this paper.
capacity in response to low oxygen levels.
A total of 3417 proteins were detected in proteomics analysis.
The hypoxia-sensitive strain showed 273 differentially expressed Conflict of interest
proteins in response to 12 h hypoxia treatment, while in the
hypoxia-tolerant strain, this number was reduced to 35 proteins. The authors declare that the research was conducted in the
The cohort of proteins that were affected in the two strains absence of any commercial or financial relationships that could
included hemocyanin, Hsp90, GP, chitinase, PD, actin, ferritin, be construed as a potential conflict of interest.
and trypsin. These proteins were classified into immune-related
proteins, energy metabolism-related proteins, cytoskeleton-
related proteins, chaperones, and others. Publisher’s note
Five protein genes with significant changes at the proteomic
level in two strains of L. vannamei were chosen for qRT–PCR to All claims expressed in this article are solely those of the
confirm the gene expression patterns, namely, hemocyanin, authors and do not necessarily represent those of their affiliated
chitinase, HSP90, PD, and GP. This group of proteins is organizations, or those of the publisher, the editors and the
probably an important component of the L. vannamei reviewers. Any product that may be evaluated in this article, or
response to hypoxia stress and could be considered biomarkers. claim that may be made by its manufacturer, is not guaranteed or
endorsed by the publisher.

Data availability statement

Supplementary material
The raw data supporting the conclusion of this article will be
made available by the authors, without undue reservation. The Supplementary Material for this article can be found
online at: https://www.frontiersin.org/articles/10.3389/fphys.
2022.979472/full#supplementary-material
Author contributions SUPPLEMENTARY FIGURE S1
Sample correlation analysis heat map. The sign of correlation coefficient
FC, resources, writing—original draft NL, investigation, represents positive or negative correlation. The value represents the
strength of correlation: 0.8–1.0 represents a strong correlation,
validation XS, resources VO, writing—review and editing XW, 0.6–0.8 represents a strong correlation, 0.2–0.4 represents a weak
conceptualization, supervision XD, project administration HZ, correlation, 0.0–0.2 represents a very weak correlation or no correlation.
conceptualization, supervision, funding acquisition XT,
SUPPLEMENTARY FIGURE S2
supervision. Protein mass distribution. X-axis displays the protein mass interval
(Kilodalton), y-axis displays the corresponding protein number.

SUPPLEMENTARY FIGURE S3
Funding Differential protein volcano map. experiment II-vs. -Experiment I,
(B) control II-vs.-control I, (C) experiment II-vs.-control II. X-axis of
the volcanogram refers to the multiple protein fold change
The research was funded by the Natural Science Foundation difference (log2), and the Y-axis corresponds to -log10 (P value). The
of Hainan Province (2019RC077, 20164159). Scientific Research green circle indicates the proteins with significantly downregulated
patterns, the red circle indicates the proteins with significantly
General project of Hainan Provincial Department of Education
upregulated patterns, and the gray circle indicates the proteins with
(Hnky2022-10). no significant difference.

References
Abe, H., Hirai, S., and Okada, S. (2007). Metabolic responses and arginine kinase Brouwer, M., Larkin, P., Brown-Peterson, N., King, C., Manning, S., and Denslow,
expression under hypoxic stress of the kuruma prawn Marsupenaeus japonicus. N. (2004). Effects of hypoxia on gene and protein expression in the blue crab,
Comp. Biochem. Physiol. A Mol. Integr. Physiol. 146, 40–46. doi:10.1016/j.cbpa.2006.08.027 callinectes sapidus. Mar. Environ. Res. 58, 787–792. doi:10.1016/j.marenvres.2004.
03.094
Arakane, Y., and Muthukrishnan, S. (2010). Insect chitinase and chitinase-like
proteins. Cell. Mol. Life Sci. 67, 201–216. doi:10.1007/s00018-009-0161-9 Buentello, J. A., Iii, D., and Neill, W. H. (2000). Effects of water temperature and
dissolved oxygen on daily feed consumption, feed utilization and growth of channel
Breitburg, D., Levin, L. A., Oschlies, A., Grégoire, M., Jing, Z., Conley, D. J., et al.
catfish ( ictalurus punctatus ). Aquaculture 182, 339–352. doi:10.1016/s0044-
(2018). Declining oxygen in the global ocean and coastal waters. Science 359,
8486(99)00274-4
eaam7240–12. doi:10.1126/science.aam7240

Frontiers in Physiology 11 frontiersin.org

Chang et al. 10.3389/fphys.2022.979472

Camacho-Jimenez, L., Peregrino-Uriarte, A. B., Martinez-Quintana, J. A., and Li, T., and Brouwer, M. (2013). Gene expression profile of hepatopancreas from
Yepiz-Plascencia, G. (2018). The glyceraldehyde-3-phosphate dehydrogenase of the grass shrimp Palaemonetes pugio exposed to cyclic hypoxia. Comp. Biochem.
shrimp litopenaeus vannamei : Molecular cloning, characterization and expression physiology. Part D, Genomics & proteomics 8, 1–10. doi:10.1016/j.cbd.2012.10.003
during hypoxia. Mar. Environ. Res. 138, 65–75. doi:10.1016/j.marenvres.2018.
Li, Y. H., Wei, L., Cao, J. R., Qiu, L. G., Jiang, X., Li, P., et al. (2016). Oxidative
04.003
stress, DNA damage and antioxidant enzyme activities in the Pacific white shrimp
Chabot, D., and Biology, J. 〥. D. J. J. o. F. (2005). Reduced growth of Atlantic cod (Litopenaeus vannarnei) when exposed to hypoxia and reoxygenation.
in non-lethal hypoxic conditions. J. Fish. Biol. 55, 472–491. doi:10.1111/j.1095- Chemosphere 144, 234–240. doi:10.1016/j.chemosphere.2015.08.051
8649.1999.tb00693.x
Liu, S., Zheng, S. C., Li, Y. L., Li, J., and Liu, H. P. (2020). Hemocyte-mediated
Chaudhuri, S., Bruno, J. C., Alonzo, F., Xayarath, B., Cianciotto, N. P., and Freitag, phagocytosis in Crustaceans. Front. Immunol. 11, 268. doi:10.3389/fimmu.2020.
N. E. (2010). Contribution of chitinases to listeria monocytogenes pathogenesis. 00268
Appl. Environ. Microbiol. 76, 7302–7305. doi:10.1128/AEM.01338-10
Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression
Chen, J., Mai, K., Ma, H., Wang, X., Deng, D., Liu, X., et al. (2007). Effects of data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.
dissolved oxygen on survival and immune responses of scallop (Chlamys farreri Methods (San Diego, Calif.) 25, 402–408. doi:10.1006/meth.2001.1262
Jones et Preston). Fish. Shellfish Immunol. 22, 272–281. doi:10.1016/j.fsi.2006.
Nakamoto, H., Fujita, K., Ohtaki, A., Watanabe, S., Narumi, S., Maruyama, T.,
06.003
et al. (2014). Physical interaction between bacterial heat shock protein (Hsp) 90 and
Cheng, W., and Chen, J. C. (2000). Effects of pH, temperature and salinity on Hsp70 chaperones mediates their cooperative action to refold denatured proteins.
immune parameters of the freshwater prawn Macrobrachium rosenbergii. Fish. J. Biol. Chem. 289, 6110–6119. doi:10.1074/jbc.M113.524801
Shellfish Immunol. 10, 387–391. doi:10.1006/fsim.2000.0264
Niu, S. W., Yang, L. W., Zuo, H. L., Zheng, H. L., Weng, J. F., Shao, P., et al. (2018).
Chongsatja, P.-O., Bourchookarn, A., Lo, C. F., Thongboonkerd, V., and A chitinase from Pacific white shrimp Litopenaeus vannamei involved in immune
Krittanai, C. (2007). Proteomic analysis of differentially expressed proteins in regulation. Dev. Comp. Immunol. 85, 161–169. doi:10.1016/j.dci.2018.04.013
Penaeus vannamei hemocytes upon Taura syndrome virus infection. Proteomics
Pesch, Y. Y., Riedel, D., Patil, K. R., Loch, G., and Behr, M. (2016). Chitinases and
7, 3592–3601. doi:10.1002/pmic.200700281
Imaginal disc growth factors organize the extracellular matrix formation at barrier
Coates, C. J., and Nairn, J. (2014). Diverse immune functions of hemocyanins. tissues in insects. Sci. Rep. 6, 18340. doi:10.1038/srep18340
Dev. Comp. Immunol. 45, 43–55. doi:10.1016/j.dci.2014.01.021
Qiu, R. J., Cheng, Y. X., Huang, X. X., Wu, X. G., Yang, X. Z., and Tong, R. (2011).
Cota-Ruiz, K., Peregrino-Uriarte, A. B., Felix-Portillo, M., Martinez-Quintana, Effect of hypoxia on immunological, physiological response, and hepatopancreatic
J. A., and Yepiz-Plascencia, G. (2015). Expression of fructose 1, 6-bisphosphatase metabolism of juvenile Chinese mitten crab Eriocheir sinensis. Aquac. Int. 19,
and phosphofructokinase is induced in hepatopancreas of the white shrimp 283–299. doi:10.1007/s10499-010-9390-z
Litopenaeus vannamei by hypoxia. Mar. Environ. Res. 106, 1–9. doi:10.1016/j.
Riffel, A. P., Saccol, E. M., Finamor, I. A., Ourique, G. M., Gressler, L. T., Parodi,
marenvres.2015.02.003
T. V., et al. (2014). Humic acid and moderate hypoxia alter oxidative and
Diaz, R. J., and Rosenberg, R. (1995). Marine benthic hypoxia: A review of its physiological parameters in different tissues of silver catfish (Rhamdia quelen).
ecological effects and the behavioural response of benthic macrofauna. Oceanogr. J. Comp. Physiol. B 184, 469–482. doi:10.1007/s00360-014-0808-1
Mar. Biol. 33, 245–303.
Rojas-Hernandez, N., Véliz, D., and Vega-Retter, C. (2019). Selection of suitable
Duo-Chuan, L. (2006). Review of fungal chitinases. Mycopathologia 161, reference genes for gene expression analysis in gills and liver of fish under field
345–360. doi:10.1007/s11046-006-0024-y pollution conditions. Sci. Rep. 9, 3459. doi:10.1038/s41598-019-40196-3
Filho, D. W., Torres, M. A., Zaniboni-Filho, E., and Pedrosa, R. C. (2005). Effect Song, L., Lv, J., Wang, L., Sun, D., Gao, B., and Liu, P. (2020). Characterization of a
of different oxygen tensions on weight gain, feed conversion, and antioxidant status chitinase-1 gene (PtCht-1) from a marine crab Portunus trituberculatus and its
in piapara, leporinus elongatus (valenciennes, 1847). Aquaculture 244, 349–357. response to immune stress. Gene, 2020, 144523. doi:10.1016/j.gene.2020.144523
doi:10.1016/j.aquaculture.2004.11.024
Sornchuer, P., Junprung, W., Yingsunthonwattana, W., and Tassanakajon, A.
Gao, C., Cai, X., Zhang, Y., Su, B., Song, H., Wenqi, W., et al. (2017). (2018). Heat shock factor 1 regulates heat shock proteins and immune-related genes
Characterization and expression analysis of chitinase genes (chit1, chit2 and in Penaeus monodon under thermal stress. Dev. Comp. Immunol. 88, 19–27. doi:10.
chit3) in turbot (scophthalmus maximus l.) following bacterial challenge. Fish. 1016/j.dci.2018.06.013
Shellfish Immunol. 64, 357–366. doi:10.1016/j.fsi.2017.03.019
Sun, S. M., Xuan, F. J., Fu, H. T., Ge, X. P., Zhu, J., Qiao, H., et al. (2016).
Gray, J., Wu, R., and Ying, Y. J. M. E. P. (2002). Effects of hypoxia and organic Comparative proteomic study of the response to hypoxia in the muscle of oriental
enrichment on the coastal marine environment. Mar. Ecol. Prog. Ser. 238, 249–279. river prawn (Macrobrachium nipponense). J. Proteomics 138, 115–123. doi:10.1016/
doi:10.3354/meps238249 j.jprot.2016.02.023
Guadagnoli, J. A., Tobita, K., and Reiber, C. L. (2011). Changes in cardiac Sun, S., Xuan, F., Ge, X., Fu, H., Zhu, J., and Zhang, S. (2014). Identification of
performance during hypoxic exposure in the grass shrimp Palaemonetes pugio. differentially expressed genes in hepatopancreas of oriental river prawn,
J. Exp. Biol. 214, 3906–3914. doi:10.1242/jeb.060442 Macrobrachium nipponense exposed to environmental hypoxia. Gene 534,
298–306. doi:10.1016/j.gene.2013.10.036
Huang, Y., and Ren, Q. (2019). Research progress in innate immunity of
freshwater crustaceans. Dev. Comp. Immunol. 104, 103569. doi:10.1016/j.dci. Tassanakajon, A., Rimphanitchayakit, V., Visetnan, S., Amparyup, P.,
2019.103569 Somboonwiwat, K., Charoensapsri, W., et al. (2018). Shrimp humoral responses
against pathogens: Antimicrobial peptides and melanization. Dev. Comp. Immunol.
Jiang, H., Li, F., Xie, Y., Huang, B., Zhang, J., Zhang, J., et al. (2009). Comparative
80, 81–93. doi:10.1016/j.dci.2017.05.009
proteomic profiles of the hepatopancreas in Fenneropenaeus chinensis response to
hypoxic stress. Proteomics 9, 3353–3367. doi:10.1002/pmic.200800518 Udono, H. (2012). Heat shock protein magic in antigen trafficking within
dendritic cells: Implications in antigen cross-presentation in immunity. Acta
Jiang, N., Tan, N. S., Ho, B., and Ding, J. L. (2007). Respiratory protein-generated
Med. Okayama 66, 1–6. doi:10.18926/AMO/48075
reactive oxygen species as an antimicrobial strategy. Nat. Immunol. 8, 1114–1122.
doi:10.1038/ni1501 Ulaje, S. A., Lluch-Cota, S. E., Sicard, M. T., Ascencio, F., Cruz-Hernández, P.,
Racotta, I. S., et al. (2020). Litopenaeus vannamei oxygen consumption and HSP
Jolly, E., Liang, S., Yu, X., and Wood, D. (2018). HSP70, HSP90A, and HSP90B
gene expression at cyclic conditions of hyperthermia and hypoxia. J. Therm. Biol.
are differentially regulated in response to thermal, osmotic and hypoxic stressors.
92, 102666. doi:10.1016/j.jtherbio.2020.102666
Osmotic Hypoxic Stressors 1, 1–9.
Ulaje, S. A., Rojo-Arreola, L., Lluch-Cota, S. E., Ascencio, F., Cruz-Hernandez, P.,
Keeling, R. F., Kortzinger, A., and Gruber, N. (2010). Ocean deoxygenation in a
and Sicard, M. T. (2019). Gene expression and energetic metabolism changes in the
warming world. Ann. Rev. Mar. Sci. 2, 199–229. doi:10.1146/annurev.marine.
whiteleg shrimp (Litopenaeus vannamei) in response to short-term hypoxia. Aquac.
010908.163855
Res. 50, are.13960–1004. doi:10.1111/are.13960
Kühl, N. M., and Rensing, L. (2000). Heat shock effects on cell cycle progression.
Wang, H.-C., Wang, H.-C., Leu, J.-H., Kou, G.-H., Wang, A. H. J., and Lo, C.-F.
Cell. Mol. Life Sci. 57, 450–463. doi:10.1007/PL00000707
(2007). Protein expression profiling of the shrimp cellular response to white spot
Lee, S. Y., Lee, B. L., and Soderhall, K. (2003). Processing of an antibacterial syndrome virus infection. Dev. Comp. Immunol. 31, 672–686. doi:10.1016/j.dci.
peptide from hemocyanin of the freshwater crayfish Pacifastacus leniusculus. J. Biol. 2006.11.001
Chem. 278, 7927–7933. doi:10.1074/jbc.M209239200
Wang, Y. J., Hu, M. H., Cheung, S. G., Shin, P. K. S., Lu, W. Q., and Li, J. L. (2012).
Levin, L. A., Ekau, W., Gooday, A. J., Jorissen, F., Middelburg, J. J., Naqvi, S. W. Immune parameter changes of hemocytes in green-lipped mussel Perna viridis
A., et al. (2009). Effects of natural and human-induced hypoxia on coastal benthos. exposure to hypoxia and hyposalinity. Aquaculture 356, 22–29. doi:10.1016/j.
Biogeosciences 6, 2063–2098. doi:10.5194/bg-6-2063-2009 aquaculture.2012.06.001

Frontiers in Physiology 12 frontiersin.org

Chang et al. 10.3389/fphys.2022.979472

Watanabe, T., Kono, M., Aida, K., and Nagasawa, H. (1998). Purification and molecular Zhang, Y. L., Yan, F., Hu, Z., Zhao, X. L., Min, S. Y., Du, Z. H., et al. (2009).
cloning of a chitinase expressed in the hepatopancreas of the penaeid prawn Penaeus Hemocyanin from shrimp Litopenaeus vannamei shows hemolytic activity. Fish.
japonicus. Biochim. Biophys. Acta 1382, 181–185. doi:10.1016/s0167-4838(97)00184-2 Shellfish Immunol. 27, 330–335. doi:10.1016/j.fsi.2009.05.017
Wei, L., Li, Y., Qiu, L., Zhou, H., Han, Q., and Diao, X. (2016). Comparative Zhang, Y., Wang, S., Xu, A., Chen, J., Lin, B., and Peng, X. (2006). Affinity
studies of hemolymph physiology response and HIF-1 expression in different proteomic approach for identification of an IgA-like protein in Litopenaeus
strains of Litopenaeus vannamei under acute hypoxia. Chemosphere 153, 198–204. vannamei and study on its agglutination characterization. J. Proteome Res. 5,
doi:10.1016/j.chemosphere.2016.03.064 815–821. doi:10.1021/pr0503984
Wei, Y., Wang, J., and Xia, X. (2016). Coevolution between stop codon usage and Zhang, Z., Zhang, P., and Zhang, Y. (2016). Advancement on the immune
release factors in bacterial species. Mol. Biol. Evol. 33, 2357–2367. doi:10.1093/ function, molecular basis underlying multifunctionality and application of
molbev/msw107 hemocyanin. Journal of Shantou University Natural Science Edition 31 (1), 46–54.
Wu, J., Liu, T., Rios, Z., Mei, Q., Lin, X., and Cao, S. (2017). Heat shock proteins Zheng, L. Y., Zhao, X. L., Zhang, P., Chen, C. D., Liu, S. J., Huang, R. Q., et al.
and cancer. Trends Pharmacol. Sci. 38 (3), 226–256. doi:10.1016/j.tips.2016.11.009 (2016). Hemocyanin from shrimp Litopenaeus vannamei has antiproliferative
effect against heLa cell in vitro. Plos One 11, e0151801. doi:10.1371/journal.pone.
Yadzir, Z. H. M., Misnan, R., Abdullah, N., Bakhtiar, F., Arip, M., and Murad, S. (2012).
0151801
Identification of the major allergen of Macrobrachium rosenbergii (giant freshwater
prawn). Asian pac. J. Trop. Biomed. 2, 50–54. doi:10.1016/S2221-1691(11)60189-5 Zhou, H. L., Li, Y. H., Wei, L., Zhang, Z. H., Huang, H., Diao, X. P., et al.
(2014). Sensitivity of larvae and adult and the immunologic characteristics of
Yang, L. B., and Pan, L. Q. (2013). Effects of phosphatidyl serine on immune
Litopenaeus vannamei under the acute hypoxia. J. Chem. 6, 1. doi:10.1155/
response in the shrimp Litopenaeus vannamei. Open Life Sci. 8, 1135–1144. doi:10.
2014/574534
2478/s11535-013-0197-y
Zininga, T., Ramatsui, L., and Shonhai, A. (2018). Heat shock proteins as
Ye, S., Huang, L. W., Cui, L., Wang, M. X., Huang, J. J., and Feng, J. (2011). Effects
immunomodulants. Mol. (Basel, Switz. 23, 2846. doi:10.3390/
of acute hypoxia stress at 20°C on carbohydrate metabolism and antioxidant defense
molecules23112846
system of red-eared turtles. J. Aquatic Biol. 35.

Frontiers in Physiology 13 frontiersin.org