ScientificPapers_SeriesB_Horticulture_Vol_LVII_2013

SCIENTIFIC PAPERS
SERIES B. HORTICULTURE
Volume LVII, 2013
University of Agronomic Sciences
and Veterinary Medicine of Bucharest
Faculty of Horticulture
SCIENTIFIC PAPERS
SERIES B. HORTICULTURE
Volume LVII
2013
BucharesT
SCIENTIFIC COMMITTEE
x Bekir Erol AK - University of Harran, Sanliurfa, Turkey
x Arina ANTOCE - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania
x Adrian ASĂNICĂ - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania
x Adrian BACIU - University of Craiova, Romania
x Liliana BĂDULESCU - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania
x Lance BUTTERS - University of Central Lancashire, Myerscough College, United Kingdom
x Mihail COMAN - Research Institute for Fruit Growing Pitesti - Maracineni
x Elena DELIAN - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania
x Alin DOBREI - Banat University of Agricultural Sciences and Veterinary Medicine Timisoara, Romania
x Elisabeta DOBRESCU - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania
x Károly HROTKÓ - Corvinus University of Budapest, Hungary
x Lucia DRAGHIA - University of Agronomic Sciences and Veterinary Medicine Iasi, Romania
x Monica DUMITRAùCU - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania
x Gheorghe GLĂMAN - President of the Romanian Horticultural Society, Romania
x Gică GRĂDINARIU - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania
x Dorel HOZA - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania
x Marian ION - Research and Development Institute for Viticulture and Enology Valea Calugareasca
x Karsten KLOPP - Obstbauversuchsanstalt Jork, Germany
x Viorel MITRE - University of Agronomic Sciences and Veterinary Medicine Cluj-Napoca, Romania
x Ion MITREA - University of Craiova, Romania
x Adrian PETICILĂ - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania
x Silviero SANSAVINI - University of Bologna, Italy
x Radu SESTRAù - University of Agronomic Sciences and Veterinary Medicine Cluj-Napoca, Romania
x Florin STĂNICĂ - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania
x Dorin SUMEDREA - Research Institute for Fruit Growing Pitesti - Maracineni
x Nicolae ùTEFAN - President of Horticulture Section - Academy of Agricultural and Forestry Sciences
”Gheorghe Ionescu-‫܇‬i‫܈‬e‫܈‬ti”, Romania
x Florin TOMA - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania
EDITORIAL BOARD
General Editor: Dorel HOZA
Executive Editor: Adrian ASANICĂ
Members: Bekir Erol AK, Valentina BOZHKOVA, Luca CORELLI GRAPPADELLI,
Elena DELIAN, Elisabeta DOBRESCU, Monica DUMITRA‫܇‬CU, Károly HROTKÓ,
Karsten KLOPP, Adrian PETICILĂ, Florin TOMA
PUBLISHERS:
University of Agronomic Sciences and Veterinary Medicine of Bucharest - Faculty of Horticulture
Address: 59 Marasti, District 1, 011464 Bucharest, Romania
Phone: + 40 213 183 636, Fax: +40 213 183 636, Webpage: www.horticultura-bucuresti.ro
CERES Publishing House

Address: 1 Pia‫܊‬a Presei Libere, District l, Zip code 013701, Bucharest, Romania
Phone: + 40 21 317 90 23, E-mail: [email protected], Webpage: www.editura-ceres.ro
Copyright 2013
To be cited: Scientific Papers. Series B. Horticulture, Vol. LVII, 2013
The publishers are not responsible for the content of the scientific papers and opinions published in the Volume.
They represent the authors’ point of view.
ISSN 2285-5653, ISSN-L 2285-5653

International Database Indexing: COPERNICUS, CABI (www.cabi.org) and CNCSIS B+.
SUMMARY
SUSTAINABLE PRODUCTS
AND TECHNOLOGIES IN HORTICULTURE
Behaviour of Delta Cultivar Nectarines During the Valorization Process
According to the Fertilization of the Culture - Constan‫܊‬a ALEXE, Marian
VINTILĂ, Simona POPESCU, Liana–Melania DUMITRU, Gheorghe
LĂMURANU, Lenu‫܊‬a CHIRA .................................................................................. 13
Research Regarding the Possibilities of Starting and Controlling of MLF in
Red Wines from Cernavoda Viti-Vinicol Centre Situated in Murfatlar
Vineyard - Georgeta BELENIUC, Constantin Baduca CÂMPEANU, Claudia
‫܇‬TEFAN, Jose PARDO .............................................................................................. 19
Influence of Biological Products Used in Foliar Fertilization on the Number
and Quantity of Fruit Reported to the Plant and Area of Culture - Gheorghe
CÂMPEANU, Florin Constantin IACOB, Nicolae ATANASIU, Elena CATANĂ,
Gabriela NEA‫܉‬Ă ........................................................................................................ 23
Organic Weed Control Measures Applied in Organic Tomatoes Culture -
Elena CATANĂ, Gheorghe CÂMPEANU, Nicolae ATANASIU, Gabriela
NEA‫܉‬Ă, Vasilica MANEA, Constantin-Florin IACOB ………………………….... 27
Researches on the Influence of Some Biological Stimulators to the Seed
Production of French Bean - Ana-Emilia CENU‫܇‬Ă, Victor POPESCU ................ 33
Researches Concerning the Resistance Frost of the Table Grape Varieties
Grown in Stefanesti-Arges Vineyard - Adriana COSTESCU, Liviu DEJEU,
Camelia POPA ............................................................................................................ 37
The Influence of Technological Factors on the Production and Quality of the
Pepper - Simona Elena DIMACHE (BOBOC), Nicolae ATANASIU, Gheorghe
CÂMPEANU, Gabriela NEA‫܉‬Ă, Claudiu BOBOC .................................................. 41
Research Concerning Effects of Perlite Substrate on Tomato in Soilless
Culture - Elena Maria DRĂGHICI, Maria PELE, Elena DOBRIN .......................... 45
Influence of the Pest Control Methods Over the Useful Entomofauna Within
the Viticultural Ecosystem - Ion ENOIU, Lidia FÎCIU, Sonia DROSU ................ 49
Effects of the Different Grape Rootstocks on Berry Skin B, Cu, Fe, Mn and
Zn Contents of ’Cserszegi FĦszeres’ Cultivar - István FEKETE 1 , Béla
KOVÁCS1, Dávid ANDRÁSI1, Éva BÓDI1, Nándor RAKONCZÁS ....................... 55
The Influence of Development Level of Vines on the Biometric Indices of
Cardinal Variety - Mariana GODOROJA, Cornelia LUNGU, Gheorghe
NICOLAESCU, Valeria PROCOPENCO ................................................................. 61
Research Regarding the Influence of the Hybrid and the Number of Stems on
the Field Production of Tomato Plants – Gheorghita HOZA ................................. 65
Type of Trellising and Foliar Fertilization Influence on Yield and Quality For
New Varieties of Gherkins (Cucumis Sativus L.) With Parthenocarpic Fruiting
- Florin Constantin IACOB, Gheorghe CÂMPEANU, Nicolae ATANASIU, Elena
CATANĂ, Gabriela NEA‫܉‬Ă ………………………………………………………. 69
Effect of Foliar Fertilization on the Chemical Composition of Five Gherkins
Fruit Hybrids (Cucumis Sativus L.) Gynoecious Type and Parthenocarpic 73
5
Fructification - Florin Constantin IACOB, Gheorghe CÂMPEANU, Nicolae
ATANASIU, Elena CATANĂ, Gabriela NEA‫܉‬Ă .....................................................
Effect of Foliar Fertilizer on Growth and Yield of Seven Potato Cultivars
(Solanum Tuberosom L.) - Ali Husain JASIM ......................................................... 77
Peach Crop Protection in Sustainable Agriculture Conditions in Small and
Medium Farms - Vasile JINGA, Carmen LUPU, Roxana DUDOIU, Andreea
PETCU, Gigel-Gabriel LUPU .................................................................................... 81
The Viticulture and Winemaking of Republic of Moldova - Past, Present and
Future - Gheorghe NICOLAESCU, Valeriu CEBOTARI, Ana NICOLAESCU,
Dumitru BRATCO, Mariana GODOROJA, Cornelia LUNGU, Valeria
PROCOPENCO ......................................................................................................... 87
The Influence of Fertilization Levels and Drip Irrigation Norms on the Apple
Harvest in South-Eastern Romanian Conditions - Nicoleta OLTENACU,
Catălin Viorel OLTENACU ...................................................................................... 93
The Influence of the Drip Irrigation on the Physical and Chemical Apple
Characteristics - Nicoleta OLTENACU, Cătălin Viorel OLTENACU .................. 99
Research on Factors Affecting Raspberry Plant Growth - Parascovia SAVA .... 105
Phenology Research on Blackberry Development in Republic of Moldova -
Parascovia SAVA, Cristina CATERENCIUC ........................................................... 109
Comparative Study Regarding the Influence of Biostimulators on the
Qualitative and Quantitative Potential of Cabernet Sauvignon - Marinela
STROE, Codrin BUDESCU ....................................................................................... 115
Technical Aspects Concerning the Quality Preservation in Fresh and
Dehydration of Apricots - Marian VINTILĂ .......................................................... 121
Kinematics and Operation Process of the Complex Aggregate Used to Prepare
the Germinative Bed in Vegetable Farming - Constantin VLAD, Gheorghe
BRĂTUCU ................................................................................................................. 127
Results Concerning the Effect of Foliar Fertilizers and Growth Promoters
Treatments on Production and Quality of Tomato Fruits - Jeni Gianina VOICU
(SIMION) ........................................................................................................................ 131
Results Concerning the Effect of Foliar Fertilizers and Growth Promoters
Treatments on Production and Quality of Lettuce Cultivated in Plastic
Tunnels - Jeni Gianina VOICU (SIMION) ………………………………………… 137
A Preliminary Survey of the Occurrence of Apple Proliferation in the North
of Romania - Lumini‫܊‬a Antonela ZAGRAI, Ioan ZAGRAI .................................... 143
HORTICULTURAL BIODIVERSITY AND GENETIC RESOURCES

Some Fruit Characteristics of Medlar (Mespilus Germanica L.) Genotypes
Grown in Ordu, Turkey - Ahmet AYGÜN, Ali Riza TASÇI .............................. 149
The Chorology of Artemisia Alba Turra, A. Lerchiana Weber and A.
Tschernieviana Besser (Asteraceae) in Romania - Monica BADEA, Ioana
PĂDURE, Sorin ‫܇‬TEFĂNU‫܉‬, Aurelia DOBRESCU, Liliana BĂDULESCU ........ 153
New Host Plant For Virus Vector Nematode XIPHINEMAITALIAE MEYL,
1953 (NEMATODA: LONGIDORIDAE) IN ROMANIA - Mariana BONTA
(GROZA), Ioan RO‫܇‬CA, Claudia COSTACHE ...................................................... 159
6
Study on the Free Amino Acid Profile of Leaves For Grapes Varieties of
Galbenă de Odobeúti Sortogroup - Marioara BOSOI, Constantin ğÂRDEA …… 163
Studies Upon the Phonology of Rosie de Aries Onion Plants From the First
Year of the Seeds Production Process and the Main Characteristics of the
Parent Plants From 2007 Until 2009 Year - Janina-Claudia CĂPU‫܇‬AN, Elena
‫܇‬TEFĂNESCU, Elena Liliana DUMITRA‫܇‬CU, Minerva HEITZ ........ 169
Biodiversity of Auchenorrhyncha Insects in a Pear Orchard From South-East
of Romania - Iuliu CEAN, Mirela CEAN ................................................................. 173
SSR Analysis Concerning the Resistance to PPV (Plum Pox Virus) in Several
Romanian Apricot Progenies - Fragu‫܊‬a CIOMAGA, Ligia ION, Cristina MOALE 177
Necessity of Cultivation and Classification of the Table Grapes Varieties For
Commercialization – Adriana COSTESCU ............................................................. 183
Identification of Ploidy Level on Varieties and Hybrids of Kiwifruit (Actinidia
Sp.) - Ramona COTRU‫܉‬, Florin STĂNICĂ, Giuseppe SCAPIGLIATI ................... 189
Evaluation Concerning the Variability of Some Characteristics at a Bulgarian
Tomatoes Collection Cultivated in Greenhouse - Mădălina DOLTU, Marian
BOGOESCU, Dorin SORA ........................................................................................ 193
Research Regarding the Breeding of Peach in Dobrogea Area - Liana Melania
DUMITRU, Corina GAVĂ‫܉‬, Dan-Victor DUMITRU, Georgeta CARE‫܉‬U, Adrian
ASĂNICĂ .................................................................................................................. 197
Present and Perspective of Almond in South-Eastern Romania - Corina
GAVĂ‫܉‬, Liana Melania DUMITRU, Georgeta CARE‫܉‬U ........................................ 201
The Influence of Fertilization Recipes Upon Seed Production of Madaraseni
Climbing Bean Variety- Alexander Kurt HEITZ, Elena ‫܇‬TEFĂNESCU, Elena
Liliana DUMITRA‫܇‬CU, Minerva HEITZ ................................................................. 205
Determination on Vitamin C in Several Old Romanian Apple Cultivars by
Hplc During Cold Storage - Dan Petri‫܈‬or MANAFU, Dorel HOZA, Ligia ION ... 209
Influence of Winter Frosts on Some Peach Cultivars Of Dobrogea - Cristina
MOALE ...................................................................................................................... 213
Influence of Fungicides and Antagonistic Yeast Product on Postharvest
Strawberries Quality - Cristina PETRI‫܇‬OR, Gheorghe CÂMPEANU, Elena
DELIAN ..................................................................................................................... 219
Behaviour of Some New Varieties of Table Grapes in the First Three Years
After Planting on Improved Sandy Soils From Southern Oltenia - Iulian
RĂ‫܉‬OI, Mihaela CROITORU, Emanuela Cristina VLADU ..................................... 223
Research Regarding the Behavior of Clonal Feteasca Neagra 10 Pt to Local
Climate Changes - Marinela STROE, Sofia ISPAS, Dragos MATEI, Damian
ION, Elena DUMITRU .............................................................................................. 229
Phylogenetic Analisys of Mangifera Base on Rbcl Sequences, Chloroplast DNA
- Suparman SUPARMAN, Adi PANCORO, Topik HIDAYAT ............................... 235
Variability of Some Apricot Varieties and Hybrids Productivity Traits Created
in Romania - Valerica TUDOR, Adrian ASĂNICĂ, Georgeta TEMOCICO ......... 241
New H1 Buzau F1 Hybrid of Eggplant Obtained at V.R.D.S. Buzau - Costel
VÎNĂTORU, Eliza TEODORESCU, Bianca ZAMFIR ............................................ 245
New Lines of Amaranthus Obtained at V.R.D.S. Buzau - Bianca ZAMFIR,
Costel VÎNĂTORU, Eliza TEODORESCU .............................................................. 249
7
PLANT PRODUCTION SYSTEMS
The Effect of Container Type and Soil Substrates on Growth and
Establishment of Selected Landscape Trees - Hani AL-ZALZALEH .................. 255
The Growth Characteristics of Six Pear Cultivars Under the “Trident”
Training System in South-East of Romania - Iuliu CEAN, Florin STĂNICĂ ..... 261
Researches on the Microsporegeneses and Pollen Tube Development of Some
Cherry Varieties in Experimental Conditions - Maria IORDACHE ……………. 267
Researches on Pollen Vitality in Some Apricot Hybrids - Maria IORDACHE,
Lenuta COROIANU …...........................................................................……….. 273
Some Morphological Properties of Direct Sowed Sweet Corn - Ferenc OROSZ 279
ORNAMENTAL PLANTS, DESIGN

AND LANDSCAPE ARCHITECTURE
Some Contributions on introduction of the Genus Abies Mill. Species in the
Republic of Moldova - Vasile BUCATEL ………..…………..…………………. 285
Researches Concerning the Postharvest Care of Lisianthus Russelianus Cut
Flowers - Erzsebet BUTA, Maria CANTOR, Mihai BUTA, Denisa HORT,
Orsolya VALKAI ....................................................................................................... 289
Use of Ornamental Plants on Different Soil Types From Transylvanian Plain -
Erzsebet BUTA, Mihai BUTA, Maria CANTOR, Denisa HORT, Anca HUSTI ...... 295
‘Candida Ali’ and ‘Excelsa’ - Romanian Gladiolus Cultivars Recent
Homologated - Maria CANTOR, Lenu‫܊‬a CHI‫܇‬, Erzsebet BUTA, Denisa HORT 299
Researches Concerning the Multiplication In Vivo of Lisianthus for
Promoting in Romanian Green Houses - Maria CANTOR, Rodica POP, Iudita
Elisabeta CSETE, Buta ERZSEBET, Anca HUSTI ................................................... 303
THE INFLUENCE OF FERTILIZERS APPLIED ON CONTAINERIZED
Culture of Thuja Occidentalis Columna - Georgeta CARE‫܉‬U, Liana Melania
DUMITRU, Corina GAVĂ‫ ܉‬.................................................................................... 309
Historical Analysis and Study of Current State of Bran Castle Domain,
Inorder to Restore the Historic Landscape Esemble – Former Royal
Residence - Elisabeta DOBRESCU, Anca STĂNESCU .......................................... 315
Objective Necessity of Study and Professional Approach to Restoration of
Historical Landscape Ensambles in Romania - Elisabeta DOBRESCU ............... 321
Spontaneous Species with Ornamental Potential: Aster Oleifolius (Lam.)
Wagenitz (I) - Morphology, Ecology, Chorology - Mihaela Ioana GEORGESCU,
Ioana Marcela PĂDURE, Florin TOMA, Monica BADEA, Sorina PETRA …...... 327
Study of Applying Different Treatments on Cut Alstroemeria and Their
Influence on the Shelf Life - Szidónia KOSZEGHI, Endre KENTELKY .............. 333
Study of Applying Different Treatments on Cut Hydrangea and Their
Influence on the Shelf Life - Szidónia KOSZEGHI ................................................. 339
Planning a Low Cost Landscaping Studio as a Career Start for Young
Professionals - Alexandru Paul LAZAR-BÂRA ....................................................... 345
Political Landscapes and Urban Identity. Bucharest’s Demolitions and
Worldwide Correspondences - Alexandru MEXI, Ioana TUDORA ....................... 351
Restauration of the Romanian Writer’s Rotunda – Cismigiu Garden -
Alexandru MEXI, Maria BRATU, Violeta RĂDUCAN ........................................... 363
8
Phenological Studies on Some Varieties of Roses from the Collection in the
"Dimitrie Brandza" Botanical Garden in Bucharest - Eduard Marius NEGULICI 371
Wintering Resistance of Ornamental Woody Plants in Containerized Culture
- Ion ROcCA .............................................................................................................. 377
Quality Parameters of Urban Green Spaces - Anca STĂNESCU ........................ 381
Dendrologic Species in Street Plantations with Sound-Insulating Role - Anca
STĂNESCU, Elisabeta DOBRESCU ......................................................................... 387
MISCELLANEOUS
The Influence of Climatic Conditions on the Grape Quality in the Wine
Center of Murfatlar in 2012 - Victoria ARTEM, Arina Oana ANTOCE .............. 393
Researches Regarding the Influence of Apple Fruit Sorting upon the
Economic Efficiency in the Commercialisation Process - Adrian CHIRA,
LenuĠa CHIRA, Elena STOIAN ................................................................................ 399
Studies Regarding the E.U. Strategy in the Field of Agro-Food Product’s
Quality - Lenu‫܊‬a CHIRA, Adrian CHIRA, Elena DELIAN, ConstanĠa ALEXE 403
A Practical Approach of Traceability in the Wine Industry - George A.
COJOCARU, Arina Oana ANTOCE ......................................................................... 409
Sampling Procedures Applicable for the Quality Assurance Systems in the
Starch Industry- Georgiana DECIU, Arina Oana ANTOCE .................................. 415
A Brief Overview of Ethylene Management to Extend the Shelf Life of
Tomatoes - Elena DELIAN, Adrian CHIRA, Liliana BĂDULESCU, LenuĠa CHIRA 423
Preliminary Study Related Highlighting the Inhibitory Effect of In Vitro Fungus
Growth Mycosphaerella Grossulariae (Auers.) Lind. by Saprophytic Fungi -
Eugenia PETRESCU, Tatiana-Eugenia ùESAN, Florica CONSTANTINESCU,
Maria OPREA, Traian MANOLE, Irina IONESCU-MĂLĂNCUù ......................... 429
The Quality Test of the Burnt Vetiver (Vetiveria Zizanioides) Waste
Utilization as an Eco-Friendly Material Pot – Meylinda Nur PUSPITA, Pristi
SUKMASETYA, Selma Siti LUTFIAH……………..………………………….. 437
Tuber Yield and Quality of Nine Genotypes Yam Bean (Pachyrhizus Spp.)
Due to Sink-Reproductive Pruning - Wieny H. RIZKY, Sofiya HASANI, Agung
KARUNIAWAN......................................................................................................... 445
9
SUSTAINABLE
PRODUCTS
AND TECHNOLOGIES
IN HORTICULTURE
Scientific Papers. Series B, Horticulture. Vol. LVII, 2013
Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653
BEHAVIOUR OF DELTA CULTIVAR NECTARINES DURING THE VALORIZATION

PROCESS ACCORDING TO THE FERTILIZATION OF THE CULTURE
ConstanƜa ALEXE1, Marian VINTIL 1, Simona POPESCU1, Liana-Melania DUMITRU2,

Gheorghe L MURANU2, LenuƜa CHIRA3
1
Research and Development Institute for Processing and Marketing of the Horticultural Products -
Bucharest, No. 1A, Intrarea Binelui Street, District 4, 042159, Bucharest, Romania
2
Research Station for Fruit Growing Constanta, 1 Pepinierei Street, 907300,
Commune Valu lui Traian, Romania
3
University of Agronomic Sciences and Veterinary Medicine of Bucharest,
59 Marasti Blvd., District 1, 011464, Bucharest, Romania
Corresponding author email: [email protected]
Abstract
The researchers performed at the Research and Development Institute for Processing and Marketing of the
Horticultural Product-Bucharest. They had as object the study of some qualitative indicators (firmness, organoleptic
appreciation, chemical composition, weight and qualitative losses) of Delta cultivar nectarines at harvest as well
as their evolution during the valorisation process. The nectarines – Delta cultivar (an extra-early cultivar, created by
the researchers from Research Station for Fruit Growing Constanta, in collaborate with Rutgers University, New
Jersey – S.U.A.), provided from experimental plots of R. S. F. G. Constanta. They were fertilized in different manners,
with organic or chemical fertilizers, applied on soil and/or foliar. The nectarines were stored in three variants: at the
ambient temperature (26-280C), in cold conditions (T = 2-4°C) and cold + modified atmosphere conditions, for 5, 25
and 30 days, respectively. It was found that the quality of the nectarines and their storage capacity varies according to
the fertilisation regime and the conditions in the storage environment, especially the temperature and the gaseous
composition of the air. Among the fertilisation variants, the V4 variant (soil + foliar chemical fertilisation) induces the
best quality and storage capacity. Foliar fertilisers ensure not only an input of macro-and micro elements but also other
organic substances which stimulate the metabolism of chlorophyll assimilation, the energetic delivery and finally, the
fruit quality. Of the three storage methods (ambient temperature, cold room and cold room + modified atmosphere), the
best results were obtained within the third method, which recorded the smallest losses during storage.
Key words: firmness, qualitative losses, storage capacity.
INTRODUCTION process, from the moment they are harvested

until they reach the consumer.
Due to a new and valuable sort which is ade-
The quality of the nectarines at harvest varies
quate to ecological conditions, both the peach
according to the technology which was applied
tree and the nectarine tree can ensure the
to the culture, the climatic conditions, the
consumption of fresh fruits for more than three
cultivar and the maturity phase, while the
month (Lamureanu et al., 2012). The studies
evolution of this quality during storage depends
show that the new nectarine cultivars obtain in
on an ensemble of factors, beginning with the
the south-eastern of Romania have a good
harvesting, the conditioning and the technolo-
quality of the fruits, high and constant
gical conditions in the storage environment
productivity of the trees and enriched the actual
(Gherghi et al., 1977) and especially on the
sortiment as for fresh consumption as for
temperature and the gaseous composition
canneries (jam, nectar, stewed fruit) too
(Alexe et al., 2012). If the storage of the fruit is
(Margineanu et al., 2011).
done while respecting adequate conditions
Nectarines are extremely perishable, which
(optimum storage temperatures or the specific
raises serious problems concerning the main-
modified atmosphere for a species or cultivar)
taining of their quality during the valorization
the biochemical processes are inhibited, thus
13
maintaining the quality of the products (Alexe The fruits, having a spherical-elongated shape,
et al., 2010). are of medium size (90-100 grams), which is
Nectarine cultivars display different particula- fairly good for an extra-early cultivar (the ma-
rities as far as their storage and valorisation for turity phase occurs in the third decade of the
a longer period of time (Jampa and Carabulea, month of June and the first decade of the month
2002). of July). The pulp is yellow, juicy, with a balan-
The chemical composition of nectarines, which ced, sour-sweet taste. The skin is smooth, the
determines the level of the biochemical proce- main colour being yellow, while the covering one
sses occurring during storage and thus the sto- is ruby-red on most of the surface (Figure 2).
rage capacity, is highly influenced by the ferti-
lisation regime. The doses in which the organic
or mineral fertilisers are applied influence the
chemical composition of the fruit, affecting the
storage capacity as well (Salunke, 1974; Ion,
2004). The presence of several nutrients enhan-
ces, in a synergic manner, the effect of each of
these nutrients, contributing to an adequate
growth and development of the fruit (Ionita,
2012).
The aim of this paper is to study the effects of
the fertilising regime on the physical and
chemical particularities of the nectarines of the
Delta cultivar as well as their evolution during
storage, which is a very important stage in the Figure 2. Nectarines of the Delta cultivar
valorisation process.
In the period 2007-2011 the threes were ferti-
MATERIALS AND METHODS lised according to three variants, which were
compared to the witness variant (V1), as follows:
The Delta cultivar was obtained at R.S.F.G. - V2-organic fertilisation (with fermented
Constanta following the collaboration with manure);
Rutgers University, New Jersey, U.S.A and - V3-chemical fertilisation of the soil (with
was patented in 1991. The tree is autofertile, of NPK complex fertilisers, the ratio being of
medium vigour (Figure 1), resistant to diseases 15:15:15);
and pests, precocious and productive (25-30 - V4-ground + foliar chemical fertilization
kg/tree), while the production, which is (ground with NPK complex fertilizers
constant every year, is destined to be consumed 15:15:15 and foliar feeding with Murtonik
as fresh (Braniste et al., 2007). 20:20:20 + micronutrients: Mn, Fe, Cu, Zn,
B, in the form of chelation).
Immediately after harvesting the fruit were
transported to the Research and Development
Institute for Processing and Marketing of the
Horticultural Product, where they were stored
in 3 variants:
- ambient temperature (T = 26-28 oC, RH =
65-70%) in 1 kg packages-keep warm;
- refrigeration room (T = 2-4°C, RH = 83-
87%), in packs of 1 kg covered with perfora-
ted polyethylene film-cold storage;
- refrigeration room (T = 2-4°C, RH = 92-96%),
in 1 kg hermetic packages, so that the com-
Figure 1. Nectarin of the the Delta cultivar position of the atmosphere inside has modi-
fied, by the reducing of the O2 content and
14
the increasing the CO2 content and also of ensure that the optimum conditions for main-
air relative humidity - storage in modified taining the quality were respected. In addition,
atmosphere - MA. the capacity of maintaining the fruit’s quality
The duration of the storage (days) varied was evaluated, including the apparition and
according to the technological variant, being of development of certain storage diseases.
5 days for the warm storage, 25 days for the
cold storage and 30 days for the AM storage. RESULTS AND DISCUSSIONS
Before entering the storage period and at its end
1. Firmness
the fruit were analysed in order to establish the
The results presented in Table 1 reveal the fact
firmness, the organoleptic characteristics and the
that at harvest the firmness of the nectarines
biochemical features of the main components
ranges from 68.79 PU at the V4 fertilising
(dry soluble substance, soluble carbohydrates,
variant (chemical fertilisers applied on soil +
titratable acidity). Moreover, the weight losses
foliar) to 93.57 PU at the V3 variant (chemical
(quantitative) and those cause by alteration
fertilisers applied on the soil), the average per
(qualitative) suffered by the fruit throughout
the storage period were established. cultivar being of 83.56 PU.
The firmness was determined by means of an
Table 1. The firmness of the nectarines of the Delta
OFD mass penetrometer which measures in cultivar upon harvesting and after storage
penetrometric units (1PU=0.1 mm) the depth that
Moment of Variant Average/
the conical needle (length=24 mm, base diameter
evaluation V1 V2 V3 V4 cultivar
= 4 mm) reaches within the pulp of the fruit. At harvest 91.28 80.59 93.57 68.79 83.56
The measurements were carried out on a num- After warm
ber of 25 fruit/variant, each fruit being penetra- 153.40150.11 175.62 144.11 155.81
storage
ted in 4 different points in the equatorial area. After cold storage 110.91129.35 126.35 127.95 123.64
The appreciation of the organoleptic quality After AM storage 99.35 119.78 123.66 125.53 117.08
was achieved by means of carrying out a
sensorial testing of the fruit and the method During warm storage for 5 days the firmness
was that of evaluating on a scale from 1 to 100. rapidly declines due to the alteration of the
Tasting sheet were used comprising three pectin substances and the cellular membranes,
appreciation criteria: aspect, texture, taste. Each reaching values ranging from 144.11 PU at the
of the three criteria holds a different weight V4 variant to 176.62 PU at the V3 variant, the
within the general scoring, according to their average per cultivar being of 155.81 PU.
importance. Thus, the “aspect” represents 15%, Cold storage slowed down the structural and
the “texture” 35% and the “taste” 50%. cellular alteration of nectarines, after 25 days
According to the scores there are five different the average firmness being of 155.81 PU,
quality classes as follows: meaning 110.91 PU at the V1 variant, 126.35
PU at the V3 variant, 127.95 PU at the V4
Grades (quality classes Points
variant and 129.35 PU at the V2 variant.
Very good 80 – 100
Good 60 – 79
The enriching of the atmosphere in carbon
Acceptable 40 – 59 dioxide allowed for the nectarines to be stored
Mediocre 20 – 39 for 30 days while maintaining the firmness at
Unsuitable 0 – 19 an average level of 117.08 PU, varying
between 99.35 PU at the V1 variant and 125.53
The methods for determining the biochemical PU at the V4 variant.
components were the following: refractometry,
using an ABBE refractometer to determine the 2. The organoleptic quality
soluble substance, the Bertrand titrimetric At harvest, following the organoleptic test, the
method for determination of the soluble nectarines obtained a high score (89.95) due to
carbohydrates, the titrimetric method for the their lovely aspect, their high degree of
determination of the titratable acidity. firmness and their pleasant and balanced taste,
During storage the thermo-hydric factors in the thus entering the “very good” fruit quality class
cold room were checked every day in order to (Table 2).
15
Table 2. The organoleptic appreciation of the nectarines 3. Biochemical composition
of the Delta cultivar The data presented in Table 3 show that the
Moment of evaluation fertilising variant with organic fertilisers (V2)
Organoleptic
After After as well as the variant with chemical fertilisers
appreciation- At After AM
warm cold applied on the soil + foliar (V4) have the lar-
score + grade harvest storage
storage storage
Total 89.95 83.75 70.07 56.16
gest input when it comes to enriching the fruit
Aspect 13.80 13.20 12.50 11.25 in dry soluble substance (11.10% and 11.24%,
Firmness 34.65 29.05 26.80 27.41 respectively) and soluble carbohydrates (8.57%
Taste 41.50 41.50 30.77 27.50 and 8.32%, respectively). From this point of
Very Very views, the V1 variant-witness occupies the last
Qualifying Good Acceptable
good good position, having, however, the highest content
of malic acid (0.93%).
After 5 days of warm storage the parameters of During storage the biochemical content of the
the organoleptic properties of the nectarines nectarines modifies but at a different intensity
remained fairly reasonable, the score being of according to the conditions in the storage place.
83.75 points and the grade “very good”. After The high temperature during storage favours
25 days of cold storage, the nectarines, though the undergoing of biochemical processes within
maintaining their pleasant aspect, lose their the fruit at a greater intensity, so that after 5
firmness and especially their taste, which days of warm storage the content of dry soluble
explains why the total score relatively drops to substance greatly increases (V1=12.39%,
70.07 and the adequate grade is now “good”. V2=12.73%, V3=11.53%, V4=12.19%,
During AM storage the nectarines of the Delta average=12.21%), while the soluble carbo-
cultivar lost their aspect, their firmness and hydrates (V1=5.70%, V2=6.56%, V3=7.09),
especially their taste, the latter becoming bland V4=6.81%, average =6.54%) and the malic
and floury. Because of the very low score acid (0.79%, 0.63%, 0.66% and 0.64%,
(56.16 points), the fruit received the grade respectively) decrease considerably in
“acceptable”. In some cases the nectarines comparison to the other storage methods.
stored in AM conditions displayed physiolo- The lower temperature during cold storage
gical disorders, manifested through shiny, grey leads to the slowing down of the rhythm of
spots or the cracking of the skin (a rather scarce these biochemical processes, so that the dry
phenomenon present at nectarines stored in soluble substance increases up to 11.50%
cold conditions as well). This demonstrates the within 25 days, while the content of soluble
fact that the period in which the fruit had the carbohydrates and titratable acidity decreases,
capacity to maintain their quality was reaching 7.76% and 0.71%, respectively –
surpassed, which means that the duration of the average value/cultivar.
storage in the atmosphere enriched in carbon
dioxide was too long.
Table 3. The main chemical components of the nectarines of the Delta cultivar
Variant
Biochemical indicator
V1 V2 V3 V4 Average/cultivar
At harvest:-soluble dry substance (0R) 9.77 11.10 10.74 11.24 10.71
-soluble carbohydrates-% 6.95 8.57 8.16 8.32 8.00
-acidity (malic acid/100g) 0.93 0.68 0.71 0.68 0.75
Warm:-soluble dry substance (0R) 12.39 12.73 11.53 12.19 12.21
-acidity (malic acid /100g) 0.79 0.63 0.66 0.64 0.68
Cold:-soluble dry substance (0R) 11.72 11.49 11.38 11.42 11.50
AM:-soluble dry substance (0R) 11.08 11.25 11.07 10.99 11.09
16
The effect of the low temperature, that of slo- Table 5. Losses recorded during cold storage of the
wing down the metabolism, adds up to that of nectarines
the carbon dioxide, which has a larger concen- Losses-%
Variant
tration in the case of storage in a modified at- total weight depreciation
mosphere. During this type of storage the con- V1 34.28 1.50 32.78
V2 10.17 1.30 8.87
tent of dry soluble substance does not increase
V3 22.06 1.43 20.63
very much as compared to the initial moment V4 5.67 1.33 4.34
(11.09%) and, at the same time, the content of Average per cultivar 18.04 1.39 16.65
soluble carbohydrates and titratable acidity
insignificantly drops (7.59% and 0.71%, It is obvious that, similar to warm storage, the
respectively). V4 variant records the smallest losses (5.67%),
followed by the V2 variant (10.17%).
4. Quantitative and qualitative losses Using the AM storage method led to a great
The losses recorded during warm storage decrease in both the weight and the depre-
(ambient temperature) for 5 days are presented ciation losses, the values of the total losses per
in Table 4. cultivar being of 6.46%, meaning 12.17% at the
V1 variant, 6.47% at the V2 variant, 6.99% at
Table 4. Losses recorded during warm storage of the the V3 variant and only 0.23% at the V4
nectarines
variant.
Losses-%
Variant
total weight depreciation Table 6. Losses recorded during AM storage of the
V1 45.71 14.97 30.74 nectarines
V2 36.89 13,32 23.57
V3 43.13 13.63 29.50 Losses-%
Variant
V4 31.79 14.36 17,43 total weight depreciation
Average per cultivar 39.38 14.07 25.31 V1 12.17 0.31 11.86
V2 6.47 0.33 6.14
V3 6.99 0.31 6.68
It was noticed that the total losses are signi- V4 0.23 0.23 -
ficant in all 4 variants of fertilisation and they Average per cultivar 6.46 0.29 6.17
are caused by weight losses and especially by
depreciation. The following total losses were There were no depreciation losses at the V4
recorded: 45.71% at the V1 variant, 36.89% at variant and the weight losses were very small
the V2 variant, 43.13% at the V3 variant and (0.23%) in comparison to the other storage
31.79% at the V4 variant. The average values of variants.
these indicators per cultivar are: 39.38% total
losses, 14.07% weight losses and 25.31% alte- CONCLUSIONS
ration losses. The V4 variant recorded the smal-
lest amount of losses, followed by the V2 variant. The different fertilization of the trees is
The causes which determine the high percen- reflected in the degree of firmness of the fruit at
tages of losses by alteration are the late infec- harvest, but not in their evolution during
tions caused by the Monilinia laxa and the M. storage. The greatest firmness at harvest is
fructigena fungi, which occur before harvesting recorded by the fruits which were chemically
and the attacks of the Rhizopus stolonifer and fertilized at soil + foliar (68.79 PU). The
Botrytis cinerea, which occur during harvesting evolution of the firmness during storage is
and manipulation. especially influenced by the storage conditions.
By using the cold storage method (Table 5) the Through warm storage the nectarines easily
developing of these fungi and moulds is slowed lose their firmness because of their rapid
down, so that the total losses were greatly ripening. In the case of cold storage the
reduced at all fertilisation variants. The values intensity of the ripening process is decreased so
were the following: 34.28% at the V1 variant, that the fruit maintain their structural and
10.17% at the V2 variant, 22.06% at the V3 textural firmness for a longer period of time (25
variant and 5.67% at the V4 variant, the average days). By enriching the atmosphere within the
per cultivar being of 18.04% total losses. storage space in carbon dioxide the metabolic
17
processes become even slower and the firmness and the developing of fungi and moulds are
of the fruit is maintained for a longer period of greatly slowed down, so that the losses were
time (30 days). significantly reduced at all variants of fertiliza-
The organoleptic quality of the Delta cultivar tion. The average reduction per cultivar was of
nectarines is better appreciated (89.95 points) 54.19% in the case of total losses, 90.12% in
at harvest, the fruit having a yellow, juicy pulp, the case of quantitative losses and 34.21% in
with a balanced, sour-sweet taste. During the case of depreciation losses. Using the AM
storage the quality decreases faster than it does storage method led to an important decrease in
at other studied cultivars (Cora), so that it is both weight losses (97.93%) as well as in
indicated that the valorization process be depreciation losses (75.62%).
carried out faster because the storage capacity
of this cultivar is lower. REFERENCES
The fertilization of the nectarine tree culture Alexe Constanta, M. Vintila, Veronica Tanasa, Liana-
Melania Dumitru, Gh. Lamureanu, 2010. Influence of
with the Murtonik foliar fertilizer (20:20:20 + fertilization system on the quality maintaining of
microelements: Mn, Fe, Cu, Zn, B-chelation) peach fruits in different storage conditions. Scientific
resulted in the enriching of the fruit in dry papers, UASVM Iasi – Horticulture Series, Vol.53, p.
soluble substance (11.24%) and soluble 305-311.
carbohydrates (8.32%). Moreover, the usage of Alexe Constanta, M. Vintila, Simona Popescu, Liana –
organic fertilisers led to the obtaining of Melania Dumitru, Gh. Lamuranu, Lenuta Chira,
2012. Researches on the influence of technological
nectarines with a high content of these production and valorization factors on the
biochemical compounds (11.10% and 8.57%, commercial quality of Cardinal peaches cultivar.
respectively). During storage the content of dry Scientific papers. Series B. Horticulture. UASVM
soluble substance increased, while that of Bucharst, Vol. LVI, p. 13-19.
soluble carbohydrates and malic acid Braniste N., S. Budan S., Butac Madalina, Militaru
Madalina, 2007. Tree, fruit growing shrubs and
decreased, the intensity varying according to strawberries cultivars created in Romania. Ed.
the temperature and the gaseous composition of Paralela 45, Pitesti p. 310.
the air in the storage place. The AM storage Dumitru Liana-Melania, Gavat Corina, Lamureanu Gh.,
recorded the best results regarding the slowing 2011.New Romanian nectarine and brugnone culti-
down of the rhythm of the metabolic processes. vars. Scientific papers. Series B. Horticulture.
UASVM Bucharest, Vol. LV, p. 374-375.
The quantitative and qualitative losses recorded Gherghi A., Millim K., Tasca Gh., 1977. Metods for
during the storage of the nectarines are greatly maintain quality and reduce losses during storage of
influenced by the fertilising regime applied to fruits and vegetables. Scientific papers ICVLF, vol
the culture. In the case of supplementing the VIII, Bucuresti, p. 27-31.
Ion V., 2004. Biological agriculture. Alma Mater
chemical fertilization of the soil with the Publishing House, Bucuresti, p. 76-89
Murtonik foliar fertiliser the weight losses and Ionita G., 2012. Bolile fiziologice se previn cu ingrasaminte
especially those caused by attacks from foliare. Gradina, via si livada. Horti, nr 3, p. 35.
diseases were substantially smaller as Jamba A., Carabulea B., 2002. Technology of preser-
compared to those recorded in the case of the vation and industrialization horticultural products,
Cartea Moldovei, Publishing House, Chisinau, p.
control. From this point of view, good results 308-317.
were also obtained in the case of fertilising the Lamurenu Gh., Caplan I., Moale Cristina, Oprita V.A.,
culture with organic fertilizers, which contain Alexe Constanta, 2012. The evolution of the growth
minerals which enhance the quality of the fruit and fructification stages of the clingstones in the
and their resistance to diseases during storage. conditions of south-eastern Romania, Journal of
Horticulture, Forestry and Biotechnology. Vol 16 (1),
The maintaining of the nectarines’ quality Banat University of Agricultural Sciences and
during valorization is also influenced by the Veterinary Medicine Timisoara, Ed. AGROPRINT
environmental conditions ensured during this Timisoara, p. 192-197.
Salunke D.K., 1974. Storage, processing and nutritional
process and especially by the temperature. Bu quality of fruits and vegetables. CR Press, Utah.
using the cold method the metabolic processes
18
RESEARCH REGARDING THE POSSIBILITIES OF STARTING
AND CONTROLLING OF MLF IN RED WINES FROM CERNAVODA
VITI-VINICOL CENTRE SITUATED IN MURFATLAR VINEYARD
Georgeta BELENIUC1, Constantin Baduca CÂMPEANU2, Claudia ‫܇‬TEFAN3, Jose PARDO4

1
Universitatea Ovidius Constanta, Mamaia street no. 124, Constanta, Romania
2
USAMV Craiova, Al. I. Cuza street, no. 13, Craiova, Romania
3
ASAS, 61 Mărăúti Blvd., District 1, Bucharest, Romania
4
Univ. La Mancha, Fac. Agraria, Camilo Jose Cela Avenue, s/nº. 13071, CIUDAD REAL, Spain
Abstract
The malolactic fermentation (MLF) is a biologically desacidification process of the wines especially red wines, made
by lactic bacteria that convert malic acid (more aggressive for the taste buds) into lactic acid (pleasant taste buds
impress) and CO2. Between 2009-2011, were made studies reffering to the possibilities of starting and controlling of
malolactic fermentation (MLF) in the red wines from Cernavoda Viti-Vinicol Centre, Murfatlar vineyard, as well as on
the conditions of this biochemical process. The degradation of malic acid has three effects upon the wines: reduced
acidity, microbial stabilisation and a some modification of the organoleptic properties. In the same time we noticed that
through malolactic fermentation, the red wines winning in quality. The starting of MLF can be easy initiated, if for this
are used wines in full MLF. For induce MLF is necessary an initial titre between 3x104 till 5,0 x104 cells/mm3. After
inoculation the bacteria cells passed through an adaptation period because their functions were limited by the alcohol
content and pH of the wine, and therefore in the medium remain a bacteria number of 1x104 cells/mm3. For MLF we
can recommend some strains of lactic bacteria, isolated from vineyard microflora.
Key words: malic acid; lactic acid; organoleptic properties, bacteria strain; inoculation.
INTRODUCTION acid and CO2, according to the reaction:

HOOC-CH2-CHOH+malolactic bacteria ->
In grapes, must and wine, malic acid there is in
CH3-CHOH-COOH + CO2. This proccess is
a big quantity like acid L (-)-malic. During
important for the wines quality, having in view
grapes transformation proccess, malic acid and
the effect upon the wines: reduced acidity,
its salts reach in must (Cotea D.V. et al., 2005,
microbial stabilisation and an organoleptic
2009). Many researchers have studied the
properties modification (Baduca-Câmpeanu et
evolution of malic acid during maturation of
al., 2008; Kontek A. et al., 1977). By this study
grapes, alcoholic fermentation, malolactic
are established the ways for starting and
fermentation and maturation of wines from
controlling of malolactic fermentation in the
vessel (Blouin J. et al., 2003). In the process of
red wines from Cernavoda viti-vinicol Centre
fermentation and wine storage period, the
situated in Murfatlar vineyard.
acidity decreases continuously through:
-the natural insolubilisation and precipitation of
MATERIALS AND METHODS
potassium hydrogen tartrate, under the
influence of alcohol and low winter The researches were made in SC VINEX
temperatures; MURFATLAR SRL, a private Viti-Vinicol
-through biological degradation of malic acid in Company, situated in Cernavoda Viti-Vinicol
must and wine by yeasts and malolactic Centre from Murfatlar vineyard, between 2009-
bacteria (Târdea C., 2007). In the most cases 2011, having in view:
malic acid from the wines is reduced by the - spontan starting of malolactic fermentation;
biological way through MLF. Malolactic - using wine in full malolactic fermentation;
bacteria completely metabolize malic acid from - using bacterial concentrate from spontaneous
the must and wine, with the formation of lactic microflora;
19
- usiing g selecteed baccterria frrom m Leu L uconosstoc ttion
n tiimee fo
or 1.44 g//l mal
m lic acid bein
b ng bettweeen n
oeenoss sp peccie,, foor mal
m lolaactiic ferm
f menntaation n star
s r- 7 8 daays.
7-8
tin ( ahl C. et al.,19
ng (Pra 995). I has
It h s beeenn foounnd tha
t t thhe staartinng of thee mme--
Th s ontaaneeouss sttartting
he spo g of malo
m olacticc feerm menn- t olisation
tab n of malm lic ac id coinccidees witw th tthee
w s foollooweed in thee vess
tattionn was v selss withw h 10000 momeent off accqu
mo uiring inn th he win ne maass off a
annd 10..000 lite l rs cappaccityy. For F too obtaain the b cterrial deensity off 4..2 x 10
bac 1 4cell
c ls/m
mmm3 and
a d att
w h a bbig maalollacttic baacteeriaa denssityy,
wiiness with t e ennd of
the o thee meta
m abollisaation of maalic accid thee
weere ussed wiinees pro p duccedd by y carb
c bon nic maacee- nsitty is 7.1xx104 ceells//mm
b cterrial den
bac m3 (Fiigurre 11).
rattionn prrocccesss.
Strrainns of maalollacttic baccterria useed in ressearrchhs
(100 stra
s ainss) forf r innocuulaation, weere seelecctedd inn
labborratooriees of
o SSC VINV NE EX MU URRFA ATL LAR R SRL
S L
byy sppeccialiizedd ppersson nnell, ffromm red
r wine w es withw h
loww pHp an w th the
nd wit t fin nishhed ponntan
d sp neouus maa-
lollacttic ferrmeentaatio
on. Forr laactiic bac b cteria’ss sttudyy
weere used thee teechn niqu
quess annd thee medi
m ium m, inndii-
cattedd by P nauud andd Dom
y Peyn D merrq (19 ( 59)), and a foor
theeir claassificaatioon was
w s ussedd Berg gey’’s Man
M nuaal oof
Deeterrmin nattivee Baacteerio
olog gy-N Nin
nth Ediitio on (220004)..
Thhe baccterriall coonccen ntrate waas pro p oduced d from
fr m
Merloot winw ne in i ffulll malo
m olaccticc feerm menttatiion, byy
thee taanggenttiall micro ofilltraatioon met
m thodd.
Th u e off baacteeriaal conccenntraate of spo
he use s ontaaneeouus Figgure 1. The
T e speeed of mal m lic acid
a d deg
graddatioon and
a
miicrooflo ora is reccom mm mend dedd foor the
t staartin ng andd baacterria’ss nuumbber evol
e lutio
on
coontrrolling MLF
g off M F inn red w winnes.
Thhe evo
e oluttionn off tootall nu umbberr off lacticc bactteria III. Thhe reeseaarch h fouundd th hat att tthe en nd off
waas mad
m de by b couunting g on n Thhom ma mooun nt, and
a d thhe a ohoolicc feerm
alc menttatiionn in red d wine
w es oobttain ned by y
nuumbber of prop opaggattion n ceells,, by
y fillterr meemb braane.. c rbonnic mac
car m ceraatioon prooceess w was onnly y hhalff
Th e oluttionn of laactiic bac
he evo b teriia in r wiines oof
i red malic acid
ma d met
m tabo olizzedd. Whhen n tthesse winee
Ceernaavo V -Viniccol Ceentrre was
odaa Viti- w s pu ut in
i evii- s ragge con
stor c ndittionns (teempperaaturre andd SO S 2) aree
deencee byb chrc rom mato ogrraph hy on n paapeer (the
( e KunK n- a equuatee th
ade hesee win
w nes com plettes its malo
mp m olaccticc
keee met
m tho od – 1196 68), an nd by th he evoe oluttionn oof f mentaatio
ferm on in
i 5 dayd ys. Blendding g tthesse win
w ness
umbberr off maalo
thee tootall nu olacctic baacteeriaa in wiine.. w th othherr win
wit w nes inn w whiich thhe malo
m olaccticc
f mentaatio
ferm on is desi
d iredd, i s a gooodd sooluttion n. T
Thee
RE
ESU
ULLTS A D DIS
S AND USSIO
D SCU NS
ON r earrch has sh
res howwn thhat if th he wiine--yeeastt
I. The
T spponntanneoouss star
s rting off m malolaactic q antiity is hiigh
qua her, thhe meetabbolisinng tim me off
ferrmeentatio on in thee SC C VIN
V NEX X MU
MURF FAATLLAR R malic accid deecreeasses. U
ma ng a proopo
Usin ortioon off
Ceernaavo odaa reed winees, is deepeendiing g of
o SO S O2 10%% wiine--yeeastts wa was ach hiveed inn thhe winee
quuanttity m thhe win
y frrom w nes andd of o th
he tan
t nk size
s e. Inn i ocullateed a tiitre off 5.00x1104 ceells//mm
ino m3 of laccticc
thee red w ness with
d win w h pH H-3,4 prrod duceed byy b cterria (Fiigurre 2).
bac 2
maaceerattionn inn biig tank
t k th he ddeg dation
grad n off mali
m c F om th
Fro he figgurre 2, it can seee thaat, affterr
acid is beeginnninng eaarly, w withhouut infl
i luen ncee oof i ocullatiion, malo
ino m olaccticc baacteriaa w wennt thhrooughh a
freee SO
S 2 do osees. p riodd of addju
per mennt wh
ustm henn the
t ir nu umbberr
In thhe red w es pro
r d wine oduucedd in
i sm
s all tan nk caa- d creaased tilll 3.8x
dec x1004 ccells/ m mm3 and a thhen
n
paacityy (100 8o tem
00 liteers)) att 18 mpeeratturee, the
t nee- i reaasedd reeachin
inc 8 x1004 cell
ng 8.0x c ls/m mmm3.
cessaary tim me forr malm lolaactic ferm
f menntattion n star
s r- I . T
III Thee usinng of co onceentratee bac
b terial froom m
tin
ng isi betw
b ween 10 0-50 0 days
d s, ini this
t s caasee beeingg s ontaaneeou
spo us micm croofloora is anottherr way w y forr
infflueencced off wiine SO O2 free
f e coonteentt. s rtinng mal
star m lolaactiic ferm
f menntattionn procccesss.
Thhe starrtinng of maalicc accid deegraadaatio on is p o-
i pro T is connceentrratee bac
Thi b cterrial wasw obbtaaineed by y
duuce wh n inn thhe win
hen w ne masm ss ther
t re is a bactteria t ngenntiaal miicro
tan ofliitraatioon meethhod fromf m an n
u sulpphitateed bu
uns ut mal
m lolaactic fermf mennted you y ung g
deensiity of 3x104 – 4.2 2x1104 cells//mmm3, deegraadaa-
20
wine of Merlot type, the characteristics of Table 2. The microbiological and phisico-chemical
which are shown in table 1. characteristics of the concentrate bacterial and the filtrate
obtained from Merlot wine
Number
of lactic PFT
Anthocianins mg/l
bacteria g/l
/mm3
Concentrate
2.1x 106 210.1 1850
bacterial
Filtrate 0 320.0 1990
IV. In our researchs, we selected 10 strains of

lactic bacteria from young red wines (Pinot
noir, Merlot, Cabernet sauvignon, Feteasca
neagra, Blawer). In the selection process were
had in view criteria that they must have,
namely: to possess the capability to increase at
low pH, to grow in the presence of alcohol, to
Figure 2. Lactic bacteria number evolution in the wines
inoculated with 10% wine-yeasts in full MLF
produce low amounts of volatile acids, do not
degrade certain compounds in wine, as pentoze,
glycerol, tartaric acid, etc. Of the 10 strains
Table 1. The phisico-chemical and microbiological isolated by us were tested morphologically,
characteristics of the malolactic fermented Merlot physiologically and oenological point of view,
Type
Wine characteristics
it noticed that strains registered with code 1, 2,
of wine 5, 7, belonging to the species Leuconostoc
Alcohol% vol 11.7 oenos, the codes 3 and 6 the species Leuco-
Sugars g/l 5.4
Tot. ac. g/l H2SO4 4.20
nostoc gracile, and the codes 4, 8 and 10, to
Volatile acidity g/l CH3COOH 0.38 Pediococcus cerevisiae species. For verification
Merlot in production conditions were chosen strains 1,
total 28.2
SO2
free 0.0 2 and 5 of the species Leuconostoc oenos. In
pH 3.30 our experiments, the starting of malolactic
Bacteria no./mm3 7.0x104 fermentation took place when the amount of
inoculum was 2.5x104 cells/mm3 on condition
From the table 1, we can show that at the end that at least 1.2×104 cells/mm can form
of metabolized period of malic acid, the bac- colonies. After inoculation of lactic bacteria in
terial density was 7,0x104 cells/mm3. In table 2, the wine, the bacteria passed through an
are shown the results of the microbiological adaptation period because their function was
tests, content of anthocyans and total poly- limited by the alcohol content and pH of the
phenols in the concentrate bacterial and in the wine. Three selected bacteria strains verified in
filtrate obtained. wines, has realised the malic acid degradation
The lactic bacteria number from the concen- in 5-7 days. Volatile acidity of the wines have
trate bacterial was 2,1x106 cells/mm3, while the had different growing-up, the smaller was in
filtrate was sterile. The content of anthocyans the sample inoculated with the strain code 2
and total polyphenols were greater values in the (0.08 g/l CH3COOH), and the biggest at the
filtrate than in the concentrate bacterial. sample inoculated with strain code 1 (0.16 g/l
CH3COOH) (Table 3).
Table 3. The changes in the wine composition, inoculated with different bacteria strains after malolactic fermentation
Free SO2 Acetaldehyde Totale acidity Vol acidity g/l Increase of vol.
The strain code pH
mg/l mg/l g/l H2SO4 CH3COOH acidity with:
Initial wine 12,2 16,1 4,00 3,60 0,34 -
Malolactic bacteria Code 1 10,5 12,6 3,42 3,67 0,50 0,16
21
To organoleptic analysis of the wines obtained, REFERENCES
shown there are differences between samples: Bĉduca-Câmpeanu et al., 2008. The malolactic fermen-
sample where MLF was carried out with bac- tation and the sensitive features of red wines obtained
teria strain under code 2, was balanced, harmo- in the vinezard of Oltenia county hills from Romania.
nious, soft and velvety, compared with samples Anale Univ. Craiova, Vol. XIII ( XLIX ) p. 319-324.
obtained with bacteria strains under code 1 and Blouin et al., 2003. Analyse et composition des vins.
Comprendre le vin. Dunod, Paris.
code 5 which were nice but not with the same Cotea V. et al, 2009. Tratat de Oenochimie, vol. I-II. Ed.
harmony. Therefore bacteria under code 2, has Academiei Romane, Bucuresti.
been recommended for use in the production Cotea V., 1985. Tratat de Oenologie, vol. I. Ed Ceres,
process in SC VINEX MURFATLAR SRL BucureƔti.
from Cernavoda Viti-Vinicol Centre. Kontek R.E. et al., 1977. Factori ai vinificaԑiei primare
care influenԑeazĉ aciditatea volatilĉ a vinului. Anale
ICVV., VI.
CONCLUSIONS Kunkee R.E., 1968. Control of malolactic fermentation.
In the red wines obtained by maceration pro- Am.J.Enol. and Vitic. 18, p. 71-77.
Peynaud et Domerq, 1959. Posibilite de provoquer la
cess in tanks of big capacity, the starting of ma-
fermentation malolactique en vinification a l’aide de
lolactic fermentation was spontaneous produ- bacteries cultivedes. C.R. Acad. Agric, France, no.
ced at the end of alcoholic fermentation. In the 45/335.
red wines produced in small tanks, the malo- Prahl C. et al., 1995. Malolactic fermentation by direct
lactic fermentation was later starting, due of inoculation with a culture of Leuconostoc oenos. 5-th
SO2 high-up level; Symp. Internat. Of Enology, Bordeaux.
Târdea C., 2007. Chimia si analiza vinului. Ed. “Ion
The quantity of inoculum used for initiation of
Ionescu de la Brad” Iaƕi.
MLF was 3x104 – 4,2x104 cells/mm3;
In production conditions the best results given
the Leuconostoc oenos strain 2, which was
recommended in production process.
22
INFLUENCE OF BIOLOGICAL PRODUCTS USED IN FOLIAR
FERTILIZATION ON THE NUMBER AND QUANTITY OF FRUIT
REPORTED TO THE PLANT AND AREA OF CULTURE
Gheorghe CÂMPEANU, Florin Constantin IACOB, Nicolae ATANASIU, Elena CATANĂ,

Gabriela NEA‫܉‬Ă
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Blvd.,

District 1, 011464, Bucharest, Romania
Abstract
Assortment of cucumbers has evolved rapidly and radically in recent years. The consequence of this development has
resulted in increasing the number of hybrids Cornichon type as well as quality. Recently created F1 hybrids are totally
gynoecious and presents type of parthenocarpic fruiting and also being very productive. It presents a high resistance to
some cucumber specific diseases being recommended for both culture in field and protected culture in solarium.
Biological products used in foliar fertilization, Cropmax, Bionat and Bioleafz are stimulating synthesis of
phytohormones that regulate the process of maturation facilitating norming of cucumber fruit load, that is responsible
for increasing the number of flowers and fruits. Fertilizations were made every 10 days, applying organic fertilizers
according to appropriate technological practices to five hybrid type cucumbers gherkins, Kybria, Karaoke, Compomist,
Trilogy and Promisa, pursuing the influence of products used in foliar fertilization on the number and amount of fruit
reported to the plant and surface.
Key words: Cucumis sativus L., fertilization, fruits, number, quantity.
INTRODUCTION tunnels, cultivated with five pickling cucum-

bers cultivars: Karaoke, Componist, Kybria,
The present research wants to demonstrate how
Trilogy and Promisa (Table 1).
pickling cucumber production may be
influenced by hybrids and culture techniques Table 1. Experimental variations in solar with pickling
(biofertilizer used for plant growing). cucumber type, Tartasesti 2010.
The vast majority of the pickling cucumber
Variant Cultivar Origin Comments
used in vegetable growing in south of Dam-
1 Trilogy Netherland Rijk Zwaan Hybrid
bovita County is grown for pickling and fresh
2 Promisa Netherland Rijk Zwaan Hybrid
alimentation use (size 3 to 6 cm and 6 to 9 cm).
3 Karaoke Netherland Rijk Zwaan Hybrid
To optimize yield and quality of commercial
4 Kybria Netherland Rijk Zwaan Hybrid
size fruits, most growers use biofertilizer
5 Componist Netherland Rijk Zwaan Hybrid
production growing.
Main objectives of this experience are as
The soil pH was 8.06, and soil analyzed N-
follow:
NH4: 29,58, N-NO3: 33,25, P-PO4: 60,20, K:
-Determining the production potential of some
145. The trials were monofactorial and set after
new hybrids have been used in the culture,
the randomized block method using five
using biofertilizer for plant growing.
cultivars, in tree variant and two replication
-Comparison of productivity of fruit obtained
(Ciulca, 2002, Saulescu, 1968).
in comparative culture conducted in 2010.
Specific elements of technology: culture was
established by planting seedling on 10/04/2010
with distance between rows of 70 cm and 30
Conditions of experiment cm between plants per row.
This field experiments were conducted at the Plant spacing and row spacing were selected on
family farm in 200 square meters solarium the basis of current practices. The specific
23
works were pickling the cucumbers in solarium
tunnels.
Experimental culture was harvested by hand,
gradually, with registration repeating the pro-
duction quality for each variant. Quantities har-
vested were pooled to establish production in
accordance with experimental scale (variations).
The experimental design was the latin square
blocks with three replications. Immediately
after planting, foliar fertilizers (Cropmax,
Bionat and Bioleaf) were applied and then soil
fertilizer at a rate of 1 kg/ha (1:2:1/N-P-K) in a
microirigation system.
Pickling cucumbers were harvested manually
on period of 12.05.2010 (32 days after planting
day) up to 12.08.2010 (3 months after day Figure 1. Total production type cornichon cucumber in
solarium, Tartasesti 2010, (the first month of harvest).
picking starting).
Fruits were harvested when about 30% of them Table 3. Total production type cornichon cucumber in
have about 9-12 cm in long and sorted solarium, Tartasesti 2010, (two month of harvest).
according to market standards.
Average Production Total Difference
Fruits Density
V. Cultivar weight per plant production from the
number/plant culture
(g) (kg) (kg/sq.m) control
1 Trilogy 17.04 97 1.65 4.76 7.85 -
RESULTS AND DISCUSSIONS 2 Promisa 13.46 92 1.24 4.76 5.90 -1.95
3 Karaoke 25.20 85 2.14 4.76 10.19 +2.34
The fruit number increased because of the good 4 Kybria 33.24 88 2.93 4.76 13.95 +6.1
conditions of growing. 5 Componist 24.62 95 2.34 4.76 11.14 +3.29
With increased density of fruits on terminal

part of plant the fruit weight per plant decrea-
sed and fruit weight per unit area increased.
This study results shows information that could
help the farmers in Dambovita county.
Plants had good performance as a result of
biofertilizer used.
Profitability of fresh pickling cucumbers its
directly linked to hibryd used, selling price and
period of selling. In this study we try to show
the optimum growing element required to
maximize the revenue.
Results of this study suggest that hibryd Kybria
have the highest production of 6.76 kg/sq.m
and 13.95 kg/sq.m for the first month of harvest
and second one.
Table 2. Total production type cornichon cucumber in

solarium, Tartasesti 2010, (the first month of harvest).
Figure 2. Total production type cornichon cucumber in
Average Production Total Difference solarium, Tartasesti 2010, (two month of harvest).
Fruits Density
V Cultivar weight per plant production from the
number/plant culture
(g) (kg) (kg/sqm) control
CONCLUSIONS
1 Trilogy 10.41 97 1.01 4.76 4.81 -
2 Promisa 9.78 92 0.90 4.76 4.28 -0.53 Regarding number of fruit per plant, hybrid
3 Karaoke 15.64 85 1.33 4.76 6.33 +1.52
Kybria are in top with average of 16.13 and
4 Kybria 16.13 88 1.42 4.76 6.76 +1.95
5 Componist 11.47 95 1.09 4.76 5.19 +0.38
33.24.
24
For average weigh of fruit, the heaviest one are
hybrid Trilogy with 97 g average and the
smallest Karaoke with 85 g.
Production per plant: Kybria 1.42 kg (+0.45)
and 2.93 kg (+1.28) for the first month of
harvest and second one.
Regarding the production per sq.m hybrid
Kybria had 6.76 kg/sq.m (+1.95) and 13.95
kg/sq.m (+6.10) for the first and second month
of harvest.
Regarding productivity factor the highest from
the four variants used was Kybria compare to
Trilogy control.
ACKNOWLEDGEMENTS
The researches were carried out within
doctoral thesis.
REFERENCES
Ciulca S., 2002, Tehnica experimentala, Ed. Mirton,
Timisoara
Saulescu N.A., Saulescu N.N., 1968, Câmpul de
experienta, Ed. Agro-Silvica, Bucuresti
25
ORGANIC WEED CONTROL MEASURES APPLIED IN ORGANIC

TOMATOES CULTURE
Elena CATANĂ1, Gheorghe CÂMPEANU1, Nicolae ATANASIU1, Gabriela NEA‫܉‬Ă1,

Vasilica MANEA2, Constantin-Florin IACOB1
1
University of Agronomic Sciences and Veterinary Medicine of Bucharest, Blvd. Marasti 59,
Bucharest 011464, Bucharest, Romania
2
National Institute For Chemical - Pharmaceutical Research and Development – ICCF, Calea Vitan
112, Sector 3, Bucharest, Romania
Corresponding author email: [email protected]; [email protected]
Abstract
In vegetable cultures appears weeds which are perceived to be harmful to the culture. Weed infestation lowers its
production through competition for soil resources and light, which can lead to underdevelopment of plant and / or
inability to best use. Traditionally, removing weeds from crops is done by digging and hoeing. Usually, the crops still
found some weed, with a low density which does not affect the production. In order to increase vegetable productivity
different methods were used to eliminate weeds in crops. Among these biodynamic methods with sand or dry soil ash
1:9, the most effective methods are associations with chicken and tomatoes and heat weeding.
Key words: chicken tomato associations, weeds, biological control, thermal weeding, signed false.
INTRODUCTION cereals. Root systems of many weed species

have a high capacity to extract from the arable
In the opinion of many scientists weeds are
layer and subarable layer inaccessible com-
considered undesirable plant species
pounds for plant culture. Weeds contemporary
encountered worked and cultivated soils crops,
influences soil formation process, providing the
which causes some damage expressed by
soil with certain quantities of items biofile
reduction in production and its quality (Bucur,
(Bucur, 2011). The most important tillage to
2011). Most weeds have medicinal value:
help unweed are: plowing, seedbed preparation,
plantain (Plantago sp.), Capsella bursa-
hoeing and weeding. Through a deep plowing
pastoris. Beneficial weeds are dandelion
will kill perennial weeds by cutting and burying
(Taraxacum officinale), clover (Trifolium sp.)
them. Annual weed species and the perennial
and other legumes (Balascuta, 1993). The use
part will be destroyed by the most energetic
of herbicides is one of the most effective
mechanical work to destroy weeds-hoeing. To
measures for weed control, but does not
combat the perennial species are required 3-4
replace, nor exclude other maintenance of soil
mechanical hoeing (Bucur, 2011). Based on the
(Catana et al., 2009). Control of weeds, pests
number and weight green weed was considered
and diseases must be achieved through
a weed pest threshold degree of weed number
preventive means, biological and mechanical. If
and gravity. Weeding was determined in dy-
it increases the proportion of cultivation crop
namic, critical period of crop to weed, called
rotation will succeed in reducing the degree of
the herbocritic stage (Bucur, 2011). In orchards
weeding, as a result of the large numbers of
are planted nettles (Urtica dioica), which seve-
maintenance. In the same area, in addition to
ral times a year mowing and leave the ground
crop rotation is necessary rotation of herbicides
as mulch. They also planted grass and other
with a different spectrum of combat (Catana et
plant species that many consider weeds (wild
al., 2009). Weed species diversity positively
carrot (Daucus carota), wild spinach (Cheno-
contributes to more complete use of vital space.
podium album), yarrow (Achillea millefolium),
The weeds trash are much more diverse and is
dandelion (Taraxacum officinale)). Couch grass
embedded in the soil, are subject to successful
(Triticum repens) is a plant to be removed even
humification processes compared to stubble
27
grasping a biological garden. It is also grown in fertilization was used Cropmax at two weeks
rows in the orchard clover (Trifolium sp.) or after planting.Preventive phytosanitary treat-
clumps of alder (Alnus incana) for fixing ments were:-25 April 2009 product preventive
atmospheric nitrogen in the soil (Catana et al, treatment for hand Champion 0.3%-on May 5
2009). Weed density Shepherd's Purse (Cap- was used horsetail decoction dilution of 1/10
sella bursa-pastoris) and nettle (Urtica dioica) against Septoria,infusion of nettle dilution of
was lowerin the treatments with compost. In 1/10, from 10 to 10 days from 20 April 2009
vegetable crops can intentionally leave other until the abolition of culture to prevent diseases
plants than those of culture that will be health and pests throughout the growing season, nettle
role. Among these against nematodes can with role of fungicides and insecticides.
successfully call marigold (Calendula offici- Trellising was made from planting and
nalis) or marigold (Tagetes sp.) and snails are continued throughout the period until meat.
chased by the smell hyssop (Hyssopus offici- Mulching was done in the first 10 days after
nalis) or thyme (Thymus serpyllum). To protect planting for weed control sheet and maintains
plants growing between the lines is planted soil moisture. Child cut was performed at 10
garlic (Allium sativum), marigold (Calendula days after planting, to reduce foliar apparatus.
officinalis), Tagetes sp.. The cultivation of va- Defoliation was performed at 10 days after
luable medical plants as vetricea (Tanacetum planting, the plant ventilation, preventing
vulgare), wormwood (Artemisia absinthium), passage of soil manna plants. The cut of shoots
comfrey (Symphytum officinale), nettle (Urtica has been made to 7 inflorescences, in order to
dioica), garlic (Allium sativum), and horsera- speed up fructification and ripening existing
dish (Armoracia rusticana) will consider most fruit. Exploit stimulation was performed by
preparations composites good or as extracts, placing near a beehive solarium, complete with
infusions and concoctions. The aim of this artificial pollination induced by shaking the
work was to analyze and test various ecological main wire to support plant every 15 days
ways of preventing and combating weeds that throughout the flowering. First harvest first
can infest tomato crops in solar. collection was recorded June 10, 2009. Last
harvest and dissolution culture were made on
MATERIALS AND METHODS 15 September 2009, followed by dissolution
culture and plant remains were transported to a
Experimental field is located in southern Mun-
composting platform.
tenia, Teleorman county and has been used for
False semantics was made after the preparation
each variant 100m2 in solar. The land was
phase for sowing train, waiting 12 days, during
already converse in organic agriculture. Vege-
which weeds have sprouted and grown destro-
tables grown on land are tomato (Lycopersicum
yed then very rigid, as described by Fitiu, for
esculentum). Other materials: Cropmax, Cham-
the creation culture tomato in solar. Working
pion 0.3% (copper hydroxide with 50% copper
variants were V1: tomato crop planting, V2: 14
metal), decoction of Horsetail (Equisetum
days after planting, V3: 30 days after planting
arvense), infusion of nettle (Urtica dioica),
for field experience and witness field, where
cylinder stove, burning appliances, ash resul-
weeds were counted in sq. Thermal weeding
ting from home heating, put the minimum age
was performed in cultured tomato in solar, after
of 7 days, black and white film for mulch.
being established culture, the technology
Methods
presented. Instead weeding thermal manual
Tomato crop in solar technology used in the
weeding was made. Working variants were V1:
experiments: the terrain was prepared by green
tomato crop planting, V2: 14 days after plan-
manure fertilization founded in autumn,
ting, V3: 30 days after planting for field expe-
digging, leveling, remove weeds (10 days after
rience and witness field, where weeds were
seedbed preparation), planted seedling age was
counted in sq. Burning Flame was carried out
60 days, planting culture was performed on 5
to prepare the land for crop establishment.
April 2009 after planting scheme 70 x 40 cm
Experimental variants field work and the
with a density 36-40000 culture plants / ha,
witness are as follows: V1 burning day, V2: 10
flowering began April 20, 2009.Care works
days to remove weeds by burning V3 at 20
were drip irrigation and 2 hand- hoeing and for
28
days after removal of weeds by burning, Con- Table 1. Weed control by false seeding at tomato culture
trol, and will include weeds. Gas consumption Weeds density / sqm
Variant
for soil preparation flame burning weeds Experiment Control
tomato crop establishment are: V1 in con- V1 At tomato transplanting 18±2 26±3
sumption of 15 liters of gas/1000 sqm, V2 at a V2 At 14 days from transplanting 29±4 48±6
rate of 20 liters of gas/1000 sqm, Control V3 At 14 days from transplanting 34±3 69±12
without gas consumption, and will include
weeds raise counting. Type of existing weeds At 14 days after planting weeds in the field
on land that was unprepared with thermal were 29 at experiment and 48 at control in the
weeds. Working versions are V1: number area. At 30 days after planting were observed 34
monocotyledonous plants, V2: number dicoty- and 69 weeds experience in control field. After
ledonous plants, monocotyledonous and dico- 30 days of culture planting control, in the expe-
tyledonous plants Control number. Weed con- rimental field consisted of 16 weed emergence,
trol with ash: soil 1:9, it was made after he was while control cultures were counted 43 weeds.
setting the stage for crop cultivation without Thermal weed is used as a means of weed control
something on the land for at least 15 days. such Atriplex, on an area of 100 sqm. Weed
Were counted in a number of plant species 15 control by thermal weed in tomato culture.
days after soil preparation and management of
gray, with the following types of work: V1 Table 2. Weed control by thermal weed in tomato culture
couch grass crawler (Agnopyrom repens), V2 Variant
Weeds density / sqm
bindweed (Convolvus arvensis), V3 veronica Experiment Control
(Veronica sp.) to control. V1 At tomato transplanting 2±1 32±4
Association between tomato-chicken was done V2 At 14 days from transplanting 6±2 51±5
V3 At 30 days from transplanting 18±4 74±8
in a tomato crop as presented technology with
the changes that not have been made hand wee-
ding and was eliminated Cropmax fertilization At the control planting culture in the experi-
and in solar were introduced in the 10 days mental field there were 2 weeds, while zone of
after planting (15 April) 150 chickens aged 7 weed control were 32. At 14 days after planting
days, which were removed from culture at the is noted that the experimental culture have 6
beginning of ripening fruit (June 5). Weeds weeds and the weed control were 51. At 30
were counted at 20 days and at 40 days after days after planting, weeds were 18 in the
placing puppies in culture. It has also been experimental and the control 74. During the 30
determined average amount offruits per plant. days of experiment, the cultures appeared 16
weeds in the experimental field and the control
Mulching foil was made in tomato culture
42 weeds have emerged. Results flame burning
under given technology, in the first 10 days
weeds, depending on when counting weeds
after planting. There were taken in consi-
following table:
deration the following variants: V1 mulching
with black foil, white foil mulching V2, V3 Table 3. Removing weeds by burning with flame
control without mulching. Were counted Weeds density /
sprung weeds around plants that have been Variant sqm
grown to 10 days after mulching were removed Experiment Control
by weeding, and mulching at 20 days (actually At removing the weed by
V1 0 64±8
thermal process
10 days from weeding). All experiments were
V2 At 14 days from transplanting 16±3 83±13
performed in triplicate, and results presentation 32±7 105±16
V3 At 30 days from transplanting
is average. Each variant of the experiment was
conducted over an area of 100 sqm.
In V1, immediately after burning in field
experience was not any weed, while in the
RESULTS AND DISCUSSIONS
control group were 64 weeds.
Weed control in tomato crops by false The variant V2 there were a few weeds because
semantics, on 1000 sqm, with predominant it's been a short period of cleaning by burning,
weeds Veronica (Veronica sp.), Amaranthus the weed seeds germinate to light, so 16 plants
retroflexus, Portulaca Oleraceea. were found in lot of experience, while the
29
control was 83 weeds. Increased to a period Percentage of destruction was not 100%, due to
more weeds pop up on sqm. In variant V3 were the existence of perennial weeds in crop.
found 32 plants in the experimental group, Monocotyledonous weeds were destroyed in
while the number of weed control increased to the 2-3 leaf stage, because at that time are
105 plants. sensitive to heat.
Note that 20 days of treatment increased the Note that the efficiency was higher in Dicotyle-
number of weeds experience with 32 plants and donous than Monocotyledon destruction. Com-
the weed control number increased by 41 bustion was achieved at temperature of 70-
plants, the total number of weeds in group sqm 80oC, so protein coagulates and weeds die.
were 3.28 times higher than experience. Gas Results of weed biodynamic methods, the ratio
consumption flame burning weeds in tomato of 1:9 ash to dry soil are presented in the
crop, calculated at an area of 1000 square following table.
meters, according to Table. 4: The results show that the percentage of all
existing weed control cultures is reduced by
Table 4. Gas consumption flame burning weeds in
tomato culture.
22% for creeping couch grass, bindweed and
V1 V2 Control
28% to 16% for veronica. Reproduction is
Gas Gas Gas inhibited by the introduction of new weeds into
Variant the soil ash obtained by burning their seeds.
consumption consumption consumption
15 liter 20 liter 0 liter This is repeated for 3-4 consecutive.
The quantity
of weeds Table 6. Weed biodynamic methods, the ratio of 1:9 ash
burn on sqm, 91,7±3,1 83,2±2,4 100 soil dry for at least 15 days
% compare
with control Results of
Results,%
weeds
plants find
After flame burning of weeds was observed Variant
destroyed after
after treatment Control
that maximum efficiency was achieved at 15 treatment
compare with
compared with
liters gas consumption at 1000 mp. control
control
The control was untreated weeds are in culture. Couch
Flame burning weeds in tomato crops, area V1 grass 22±2,9 78±2,9 100
0.01 square meters at a density of 70 x 40 cm, crawler
depending on the type of weeds, weed corre- V2 Bindweed 28±4,3 72±4,3 100
lated with the type existing in culture. V3 Veronica 16±6,1 84±6,1 100
After thermal weeding there are determined the
type of existing weeds on land unprepared. Such Results weed control in tomato crop using
weeds were counted on a square before treatment, chicken tomato combination, are shown in the
and at 30 days after treatment plants were following table:
counted according to the type found in them.
Table 7. Chicken with tomato Association
The results are shown below:
Table 5. Flame burning weeds, weed correlated with the Weed density/ mp
Variant
type existing in culture Experiment Control
Variant V1 V2 Control At 20 days after chicken
V1 2±1 154±
puppies introduced in culture
Monocot
Mono Dicoty yledon and At 40 days after chicken
Type of weeds V2 3±2 316±
cotyledon ledonous Dicoty puppies introduced in culture
ledonous Medium crop, kg/wire 3,2±0,5 1,9±0,3
Initial quantity of
weeds, % compare 100 100 100 At 20 days after placing puppies in culture is
with control noted that the field experience are only 2 weeds
Weed quantity, %, while the crop weed control is 154. At 40 days
distroyed by the
78,2±5,8 86,9±3,7 0 after placing puppies in culture, experimental
treatament compared
with control culture has three weeds, which was 314
The weeds after the compared with control weeds. Experiment 20
treatment,% compare 21,8±5,8 13,1±3,7 100 days, compared to the previous determination,
with control
30
it appears that the culture has grown a weed test number of weeds was higher, the higher
compared to 1620 weeds in the control group. number of weeds around plants as existing in
Output gap was 1.3 kg wire tomato production foils rises but suffocate due to temperature. If it
increase for the experimental group. This can was black film, the number of weeds is lower.
be explained by the fact that chickens ate Since soil is well warmed by mulching with
weeds, then fertilized with a fertilizer culture plastic white culture plants grow more quickly,
rapidly mineralized (represented by their reaching maturity earlier.
manure) and mobilized soil around plants. Land
mulching helps remove weeds from the crop, as CONCLUSIONS
shown below:
The most efficient mode to combat weeds is the
Table 8. Mulching land and the number of weeds sprung
association of tomatoes plants with chichen and
with the use of thermal and mulching weeds.
No of weeds at mp
After 10 days After 20 days A low effciency was found to ash/soil bio-
No Var Specification dynamic methods.
after after
transplanting transplanting
1 V1 Black foil 15±2 7±3
3 V2 White foil 21±5 9±3 REFERENCES
4 V3 Control 83±18 129±26
Bălăscu‫܊‬ă N., 1993. “Protec‫܊‬ia plantelor de grădină cu
deosebire prin mijloace naturale”, Ed. Tipocart,
Were counted sprung weeds around plants that Bra‫܈‬ov.
have been grown to 10 days after mulching Bucur Gh., 2011. “Rolul culturii protectoare în controlul
were removed by weeding, and mulching at 20 biologic al buruienilor la culturile pră‫܈‬itoare”, ‫܇‬tiin‫܊‬a
days (actually 10 days from weeding). Number agricolă, nr. 2/2011. ISSN 1857-0003, p. 10-13.
of weeds at 20 days after planting is less than Catana E., G. Câmpeanu, N. Atanasiu, G. Nea‫܊‬ă, V.
Zaharachescu, «Preparate ecologice ob‫܊‬inute din
10 days from planting because of weed seed plante folosite la combaterea bolilor ‫܈‬i dăunătorilor în
near existing plants benefit from light to dawn. legumicultură la Familia Solanaceae”; Simpozionul
Moreover, foil prevent weed emergence, but ‫܈‬tiin‫܊‬ific “Tendin‫܊‬e ale horticulturii rurale, periurbane
heats the soil to a depth of 4-5 cm by 5-6oC ‫܈‬i urbane în mileniul trei”, 6 nov. 2009, Bucure‫܈‬ti.
compared to the control. If it was white film
31
RESEARCHES ON THE INFLUENCE OF SOME BIOLOGICAL

STIMULATORS TO THE SEED PRODUCTION OF FRENCH BEAN
Ana-Emilia CENU‫܇‬Ă, Victor POPESCU

59 Mărăúti Blvd., District 1, zip code 011464, Bucharest, Romania
Abstract
The paper presents the results concerning a study on the influence of some biologically stimulators in a comparative
crop in some dwarf French bean varieties used for seed production. The research works were carried out during the
year 2012. Biological material under trial was represented by two dwarf Romanian varieties having green pods
(Fantastica, Delicioasa de Pasarea) and one dwarf Romanian varieties having yellow pods (Margareta). Natural
bioactive substances used in the experiments were: Cropmax 0.1% (four treatments on every 10-15 days), Kendal 0.2%
(six treatments on every 7-10 days), Viva 0.4% (three treatments on every 15-20 days) and Benefit PZ 0.3% (on every
seven days after pod setting). The variants were grown in an experimental field according to the method of subdivided
plots with three replications. The observations performed concerning the phenology and morphological traits of the
plants (plant pod number, pod length and weight of one thousand seeds) allowed an accurate characterization of the
varieties under investigation as well an optimum recommendation for the growth regulators on the French bean crops.
The processing of the production data of the seed crop was made according to the variance analysis. The influence of
these treatments has been recorded both on the yield obtained and on the quality of the seed production. The results
obtained show that the treatment applied with Cropmax and Kendal solution in a concentration of 0.1% and 0.2%
increased the seed production by 35% and 30%. The paper presents data from the PhD thesis in the frame
POSDRU/107/1.5/S/76888.
Key words: biologically stimulators, dwarf french bean, seed production.
INTRODUCTION Among the most efficient measures to increase

and improve vegetable production one could
Having a high nutritional value, the pods of
enumerate the production and use of seeds of
dwarf French bean are highly appreciated by
high biological and agrotechnical value. The
the consumers and are consumed during the
achievements in the vegetable breeding and in
whole year, both fresh, at maturity of
the technology of production and conditioning
consumption and frozen or as tinned products
of the seeds assured a high role of the seeds in
(Ciofu et al., 2003; Popescu, 1996).
the vegetable production, they having a strong
According to some researches the green pods of
influence over the level of the yield from
the French bean have a higher value in
quantitative and qualitative point of view. The
nutritional substances than the yellow ones.
yield ability of a variety, respectively of a
Due to the fact that one could obtain varieties
vegetable seed is well defined by the agrotech-
having natural resistance against the main
nical conditions and its adaptation to the local
pathogens and on the other hand, research
environment. Vegetable seeds can be easily
recent results confirm that it is possible to get
subjected to the degeneration when they are
seeds following ecological methods for the
grown under less suitable environmental
commercial crops, dwarf French bean is a
factors, an inferior agrotechnics or when it is
species very suitable to be grown under
not used for multiplication a biological material
ecological agriculture (Falticeanu, 2004).
well selected. The true quality of the vegetable
That is why several varieties were created
seeds is determined by the following traits:
which are different by their vegetative period,
authenticity, germinative ability, absolute
pod kind, resistance to diseases and pests
weight (weight of 1,000 grains), purity and
(Tigaieru, 2009; Munteanu, 1994).
health status (Voinea et al., 1971).
33
Maintainance of the genetic structure and recommended by the literature of speciality
prevention of the degeneration of the dwarf (Voican et al., 2006).
French bean varieties is achieved by the Two varieties of dwarf French bean with green
process of conservative selection during the pods-Fantastica and Delicioasa de Pasarea and
seed production scheme. In the dwarf French one with yellow pods-Margareta were used.
bean the method of seed production is applied Among the biostimulators used in present for
by individual selection with a single obtion vegetable crops we chose four products having
(Draghici, 2006; Glaman et al., 2002; Szilagyi, an effect upon vigour and resistance of the
2002; Scurtu, 2001). plants against diseases and pests: Cropmax,
Among the modern methods of growing of seed Kendal, Viva and Benefit PZ. The experiment
vegetable crops aiming increase of seed had two factors: factor A-Biostimulators with
production both quantitative and qualitative five gradations (a1-untreated; a2-Cropmax
point of view one could count the use of phyto- 0,1%; a3-Kendal 0,2%; a4-Viva 0,4%; a5-
regulators for growing, biological stimulators Benefit PZ 0,3%), factor B-Varieties having
and bioactive substances recommended by three gradations (b1-Fantastica, b2-Delicioasa
many specialists (Darasteanu et al., 2005; de Pasarea, b3-Margareta). By multiplication of
Tofan, 2004). these factors 15 experimental variants resulted.
Mode of action of the biostimulators in the Check control was untreated with biostimu-
plant and their influence upon the growing and lators.
development process of the plants were inves- The experiment was set up in a comparative
tigated by many researchers. Flower abortion culture placed in plots subdivided in three
could be prevented by the treatment with a replications. The surface of a replication plot
mixture of citochinins and giberelins. Giberelin was of 9 sq.m.
has a strong influence upon the flowering For the location, field preparation and setting of
process and in general upon plant development. the trial, general standards for the dwarf French
Fruit setting is linked by the mode how bean seed crops were observed.
essential metabolites are distributed between The trial followed an onion crop and the soil
the vegetative and generative tissues (Ber- was prepared under the shape of furrow beds of
nardis, 2006; Burzo et al., 1999). 1.5 m width. The sowing scheme consisted in
On the world scale already exists a real industry three rows on the furrow at 35 cm apart and 5
of production of such chemical and biological cm between seeds on the row. The herbicide
stimulators due to efficiency of the synthetic Dual Gold 1 l/ha was applied preemergently
hormonal substance upon the vegetable plants and the herbicide Basagran 2 l/ha was applied
and on June 2011 The European Biostimulants postemergently. During the vegetative period
Industry Consortium (EBIC) was set up (New four manual hoeings were made and humidity
AG International, 2012). was assured by dripirrigation. To control
The main objective of these researches is a disease and pests the following treatments were
study of some vegetal biostimulators having an applied with Vondozeb 0.2% + Topsin 0.1%,
effect of increase upon quantity and quality of Funguran 0.4%, Ridomil Gold 0.3%,
the seeds in dwarf French bean under the soil Milbecknoch 0.075%, Confidor Energy 0.1%,
and weather conditions from the south of the Mospilan 0.022%. A distinct work for this seed
country. This paper presents the seed yields crop was biological purification which
obtained in an investigation in order to esta- consisted in removing of untypical plants
blish the most efficient ways of their increase. considering traits for specifity of each cultivar.
Purification works were made at the stage when
MATERIALS AND METHODS plants had two cotyledons, during the flower
stage and at the physiological maturity of the
The research works were carried out during the
first pods.
year 2012 at UASVM Bucharest. The
Treatments were carried out with a sprayer and
biological material investigated was studied
substances were weighted with a cylinder and
under the open field according to the
an electronic scale. Biostimulators were applied
technology for seed crop in dwarf French bean
in the morning as aqueous solutions using 200-
34
500 l water/ha according to the foliar surface of Table 1. Influence of the variety on seed production in
the plants such as: dwarf French bean, 2012
-Cropmax – four foliar treatments at every 10- Average
Relative Difference
15 days interval; Variety yield Significance
yield (%) (t/ha)
(t/ha)
- Kendal – six foliar treatments at every 7-10
Delicioasa
days interval; 2.9 126.1 +0.6 xxx
de Pasarea
- Viva – three foliar treatments at every 15-20 Fantastica 2.4 104.3 +0.1 -
days beginning with the stage of two-three Average of
2.3 100.0 -
leaves; varieties
Margareta 1.7 73.9 -0.6 000
- Benefit PZ – three foliar treatments at every 7
DL5%=0.25t/ha; DL1%=0.34t/ha; DL0.1%=0.46 t/ha
days beginning with a completely formation of
the first pods. Computing average yield of seed obtained by
Both in size of the plots and in registering of treatment with the four biostimulators,
the observations taken during the vegetative irrespective of variety, only Cropmax product
period and regarding the technique of data gave distinct significant gains of 2.7 t/ha by
processing were observed provisions imposed comparison with control untreated variant
by the experimental technique. (Table 2).
Phenological observations were taken registe-
ring important data regarding both growing and Table 2. Influence of the treatments with biostimulators
plant development during the period from on seed production in dwarf French bean, 2012
sowing to physiological maturity of the seeds. Average
During the vegetative period biometrical deter- Relative Difference
Biostimulator yield Significance
minations were made concerning plant height, yield (%) (t/ha)
(t/ha)
pod width, pod length and number of pods per Cropmax
2.7 135.0 +0.7 xx
plant. 0.1%
After pods harvest at the stage of seed phy- Kendal 0.2% 2.6 130.0 +0.6 x
Benefit PZ
siological maturity was computed the number 0.3%
2.2 110.0 +0.2 -
of seeds per plant as well seed weight per plant Viva 0.4% 2.1 105.0 +0.1 -
using an electronic balance. Production data Control
2.0 100.0 -
were processed statistically by the method of untreated
variance analysis for polifactorial trials with the DL5%=0.49 t/ha; DL1%=0.71 t/ha;DL0.1%=1.06 t/ha
two factors placed in subdivided plots. Test of
significance of the results was assured by the Average yield of seeds for the variety
aid of F test for a global evaluation and with Fantastica ranged between 2.0 t/ha (control V1)
DL for evaluation of significance of every and 3.0 t/ha (variant treated with Cropmax
difference individually (Saulescu et al., 1967). 0.1%, V4).
For the variety Delicioasa de Pasarea the
RESULTS AND DISCUSSIONS highest seed production was obtained also at
the variant treated with Cropmax 0.1%, V5 (3.2
The trait “number of seeds per plant” is t/ha) by comparison with control variant V2
important because it determines the (2.6 t/ha).
productivity of the variety. It is directly The variety Margareta gave a seed production
correlated with the character “number of pods of 1.9 t/ha for the variant treated with Cropmax
per plant”. 0.1%, V6 by comparison with control variant
By comparing the average seed yield of the V3 (1.5 t/ha) (Table 3).
three varieties taken as control yield, the
highest yield was obtained at the variety
Delicioasa de Pasarea (2.9 t/ha) and the
lowerest at the variety Margareta (1.7 t/ha) and
the yield difference were very significant
(Table 1).
35
Table 3. Interaction variety of dwarf French bean x biostimulators, 2012
Fantastica Delicioasa de Pasarea Margareta
Variety
Diffe- Signifi- Diffe- Signifi- Diffe- Signifi-
Biostimulator T/ha % T/ha % T/ha %
rence cance rence cance rence cance
Cropmax 0.1% 3.0 150.0 +1.0 xx 3.2 123.1 +0.6 - 1.9 126.7 +0.4 -
Kendal 0.2% 2.9 145.0 +0.9 x 3.1 119.2 +0.5 - 1.8 120.0 +0.3 -
Benefit PZ 0.3% 2.2 110.0 +0.2 - 2.8 107.7 +0.2 - 1.7 113.3 +0.2 -
Viva 0.4% 2.1 105.0 +0.1 - 2.7 103.8 +0.1 - 1.6 106.7 +0.1 -
Control untreated 2.0 100.0 - 2.6 100.0 - 1.5 100.0 -
DL5%=0.66 t/ha; DL1%=0.93 t/ha; DL0.1%=1.34 t/ha
CONCLUSIONS Darasteanu C.C., Paranici S., Nicolau C., Bagiu L., 2005.
Implementation of bioregulators as modern imputs in
Under the weather conditions of the year 2012 private farms for lucrative agricultural technologies.
in the southern part of the country, treatments New Publishing House E9-Bucharest, p. 202-211.
with biostimulators influenced seed yield in Draghici E. M., 2006. Seed and plant production in
vegetable species. Atlas Publishing House Press
dwarf French bean by increasing the seed SRL-Bucharest.
production in comparison with variants Falticeanu M., 2004. Contributions for improvement of
untreated. field growing technologies in some vegetable species.
Doctor’s degree thesis. University of Agriculture-
The best results were obtained by treatments
Iassy.
with Cropmax 0.1% (2.7 t/ha). Glaman Gh., Margine A., Tudor Z., 2002. The behavior
The highest seed yield was obtained at the of some garden bean varieties in Baragan field.
variant treated with Cropmax 0.1% for the Scientific papers, UASVM Bucharest, Horticulture,
p.81-86.
variety Delicioasa de Pasarea (3.2 t/ha), Munteanu N., 1994.A comparative study of resistance at
followed by the variant treated with Kendal main pathogens for some new sources of germoplasm
0.2% (3.1 t/ha) for the same variety. in bean. Doctor’s degree thesis. University of
Agriculture Iassy.
ACKNOWLEDGEMENTS The European Biostimulants Industry Consortium, New
AG International, 2012, p. 26-29.
The paper presents data from the PhD Thesis in Popescu V., 1996. Vegetable Growing-Volume1. Ceres
the frame POSDRU/107/1.5/S/76888, project Publishing House, Bucharest.
Saulescu N.A., Saulescu N.N., 1967. Experimental field.
financed from the European Social Fund Scurtu I., 2001. Economy and technology of agricultural
through the Sectoral Operational Programme crops. Economical Independence Publishing House,
for Human Resources Development 2007-2013. p. 35-38, 74-79.
Szilagyi L., 2002. Researches on heredity of some
REFERENCES quantitative traits in bean and their correlations.
Doctor’s degree thesis. UASVM Bucharest.
Bernardis C. M., 2006. Study on effects of some Tofan M., 2004. A study on the main technological links
bioactive substances on differentiation of the flower in seed cauliflower crop aiming its improvment.
buds in eggplant. Doctor’s degree thesis. University Doctor’s degree thesis. University of Agriculture
of Agriculture-Iassy. Iassy.
Burzo I., Toma S., Craciun C., Voican V., Dobrescu A., Tigaieru D., 2009. A study on variability in the frame of
Delian E., 1999. Physiology of the growing plants, some hybrid populations in French bean. Doctor’s
Volume 1. Physiological process in growing plants. degree thesis. University of Agriculture Iassy.
Publishing House Enterprise Editorial-Publishing- Voican V., Scurtu I., Costache M., Lacatus V., Stoian L.,
Science-Chishinew. Roman T., Dumitrescu M., 2006. Vegetable growing
Ciofu R., Stan N., Popescu V., Chilom P., Apahidean S., in open field. Phoenix Publishing House, p. 175-185.
Horgos A., Berar V., Lauer K. F., Atanasiu Voinea M., Andronicescu D., Poli V., Talpalaru E.,
N., 2003.Handbook of vegetable growing. Ceres 1971. Seed production in vegetable crops. Ceres
Publishing House-Bucharest, p. 572-602, 865-873. Publishing House, Bucharest, p. 13-46, 85-92.
36
RESEARCHES CONCERNING THE RESISTANCE FROST OF THE TABLE
GRAPE VARIETIES GROWN IN STEFANESTI-ARGES VINEYARD
Adriana COSTESCU1, Liviu DEJEU1, Camelia POPA2

1
59 Marasti, District 1, 011464, Bucharest, Romania
2
National Research & Development Institute for Biotechnology in Horticulture Stefanesti,
Sos. Bucuresti - Pitesti, no. 37, CP 117715 , Stefanesti, Romania
Abstract
In order to achieve this paper we have studied the freezing resistance and the effect of low temperatures over the
viability of the winter shoots at certain grapevine varieties for the tablegrapes cultivated in the vineyard Stefanesti-
Arges. The research concerned the varieties: Argessis, Golden of Stefanesti, Moldova, Augusta, Canner and clones:
Muscat Adda 22 St., Perlette 10 St., grafted on Kober 5BB rootstock. The research took place in the period 2010-2012.
As a result of the study, we have noticed the sensitivity of Perlette and Augusta varieties at the low temperatures of the
winter. We have presented data concerning the determining procedure of the percentage of viable shoots.
Key words: table grapes, fertility, productivity, resistance.
INTRODUCTION zone with Campia Romana. The viticultural

plantations are located at altitudes between 200
The experiment was conducted in 2010-2012,
and 415m, the maximal altitudes being the
in the collection of INCDBH Stefanesti
Izvorani Hill (415m) and the Pietroasa Hill
ampelographic - Arges. The study was made of
(325m).
grape varieties and clones obtained and
cultivated vineyard table Stefanesti. Vineyard
area is characterized by the following
ecoclimatic elements Stefanesti: length of the In the wine-growing practice on one hand and
growing season for grape-vines, on average the grapevine varieties amelioration operations
177-178 days; The annual average temperature on the other hand, it has been observed that, the
9.8-10.1ºC, global heat balance of vegetation heredity of the characters and features of new
period 3530ºC, 1350ºC useful heat balance; varieties obtained by sexual hybridization are
average temperatures of the warmest months more obvious, as the genitors are genetically
(July, August 34,7ºC and 34,9ºC) insolation further and have distant origins. In the
duration of vegetation period on average 1430 characters of the first variety prevails.
hours; real heliothermic index of 1.86 during Following the manifestation and the degree of
the growing season. Therefore fits well studied hereditary variability for one or more
varieties in demand environmental and showed characters, in the wine-growing practice, the
good behavior even at lower temperatures. research analyzes a series of characters
The soil is loamy collection is located, the including: the growing force, the number of
average supply of phosphorus, potassium and grapes on a grapevine, the production per
slightly carbonated, with a slightly acid pH (6.2 grapevine, the sugar quantity, the acidity of the
to 6.4). Rootstock used for grafting these grape must, various maturation age, the
varieties was Kober 5BB, planting distance resistance to diseases and pests, the resistance
between rows of 2.5 m and 1 m row between to drought and frost, etc.
plants, resulting in a total of 4,000 vines / ha. In the present paper there have been tested four
As regards the geographical location, the varieties of table grapes with different
Stefanesti vineyard is located between 44°42’ maturation ages under the aspect of their
and 44°55’ northern latitude, at the southern resistance to the low temperatures in the years
limit of the platform Candesti, in the contact 2010-2012.
37
Experimental scheme is situated in linear temperatures below resistance. Damage caused
blocks with three variants 3 repetitions, each by winter frosts can reduce production both
repetition with 12 stocks. Placing such quantitatively and qualitatively important
experiences two-way 4x3 (varieties) and 2x3 economic effects for both growers and
(clones) for each experimental year (2010- winemakers as, traders etc (Fennel A., 2004;
2012) was the same, taking into study two Grecu V., 2010).
factors, namely: Parallelism exists between the annual cycle of
Factor A - Variety, which temperature and annual biological cycle of the
includedgraduations: vine allowed for optimal thermal thresholds for
-a1 Argessis; main plant phenophases taken (Olteanu I.,
-a2 Auriu de Stefanesti; 2000).
-a3 Moldova; In order to diminish the impact of climate
-a4 Augusta; change it is necessary to adapt the cultural
-a5 Perlette 10 St. practices to the evolution of climate over time
-a6 Muscat Adda 22 St (Bucur M. et al, 2012).
-a7 Canner During winter quantities of starch accumulated
Factor B - loads of fruit with differentiated in strings begin to decrease and the
application of cutting bearing vineyards, concentration of sugars begin to rise. These
which included graduations: changes are associated with the development of
-b1 load of 15 eyes per vine fruit, cutting the frost grape-vine. Readiness of the vine vines
drill; for winter can be appreciated by determining
-b2 load of 20 eyes per vine fruit, cutting the carbohydrate accumulated in strings.
heart; Throughout the winter synthesize starch thus
- of 25 eyes per vine fruit, cutting the string; increasing the concentration of sugars in string,
which is used as a barrier against injury caused
RESULTS AND DISCUSSIONS by frost. Towards the end of winter there is a
reverse conversion of carbohydrates so that will
Grape-vine buds lose their viability when the have high concentrations of starch and sugars
temperature falls below -20 in winter... 22ºC decrease (Bennett J.S., 2002; Georgescu M et
for wine varieties and below -18...-20°C at the al., 1986; Matei P. et al., 2009).
table (Damian et al, 2004; Dumitriu I.C., 2008).
The meteorological data have been extracted Table 1. Report wood / marrow and starch concentration
from the database of the Stefanesti Institute, in the string, the varieties studied (average 2010-2012)
collected during the interval 1991–2010 (Figure Report Starch
Varieties Version
1). wood/marrow %
V1 0,27 4,3
Argessis V2 0,25 4,1
V3 0,24 4,0
V1 0,25 5,2
Auriu de Stefanesti V2 0,27 5,4
V3 0,23 5,8
V1 0,33 5,7
Moldova V2 0,30 6,1
V3 0,31 6,3
V1 0,37 5,2
Augusta (control) V2 0,38 5,4
V3 0,35 5,0
Dates on the ratio of the diameter of the

Figure 1. Average temperatures (ºC) 1991-2010 wood/marrow and shows a correlation between
the size of the report and frost resistance of the
varieties studied. Thus the variety Moldova the
Grape vines can grow in the most common report was on average 0.31, the variety Augusta
areas as one of the most affected by low of 0.37 while Argessis and Golden Stefanesti
38
varieties this ratio was 0.25, 0.27 respectively Table 3. The fertility varieties and clones studied at
(Table 1). Hence the improved frost resistance INCDBH ùtefăneúti-Argeú (average 2010-2012)
of varieties Argessis and Golden Stefanesti Variety TO OV TL LF NI CFA CFR
irrespective of the applied pruning. Argessis 21 14 14 6 9 1,50 0,64
Auriu de Stefanesti 25 17 17 13 19 1,46 1,11
Table 2. Report wood / marrow and starch concentration Augusta 16 15 15 9 11 1,22 0,30
in the string, the clones studied (average 2010-2012) Moldova 28 17 17 8 8 1,00 0,47
Perlette 10 St. 17 9 9 1 1 1,00 0,11
Report Starch Muscat Adda 22 St. 28 17 17 8 8 1,00 0,47
Clones Version
wood/marrow % Canner 22 13 13 4 4 1,00 0,31
V1 0,34 5,1 TO-total eye; OV-eye viable, TL-total shoots, LF-fertile
Perlette 10 St. V2 0,30 5,4 tillers, NI-number of inflorescences, CFA-coefficient of
V3 0,28 5,6 absolute fertility, CFR-coefficient of relative fertility
V1 0,35 5,1
Muscat Adda 22
V2 0,31 5,3
St.
V3 0,30 5,0
The highest value CFA was recorded in variety
V1 0,35 4,8 Argessis (1.5) and the lowest in all varieties
Canner (control) V2 0,37 4,5 had suffered from frosts of 2012 (Table 4). The
V3 0,30 4,6 highest value CFR was recorded in variety
Golden Stefanesti. (1.11) and lowest for clone
The clone Muscat Adda 22 St. this report was Perlette 10 St. (0.11).
from 0.31 to 0.35, the clone Perlette 10 St. from
0.28 to 0.34. At the same time the control Table 4. The losses of buds at varieties studied (2012)
(Canner apiren variety) this ratio was % losses of buds
Variety Version
approximate values of the two clones from 0.30 2012
to 0.37 (Table 2). This suggests that neither V1 35
witness had chosen better behavior frost, so the Argessis V2 32
V3 30
two clonesirrespective of the applied pruning
V1 30
showed almost the same values of the ratio Auriu de Stefanesti V2 28
wood/marrow. V3 25
To assess the degree of fertility of a variety of V1 59
fertility coefficient calculated absolute and Augusta V2 60
relative (CFA CFR), and productivity is to V3 55
acquire plant and fruit shape keep it on the hub V1 35
Moldova V2 32
until full maturity (Dumitriu I.C., 2008). V3 30
Making grape-vine through several V1 55
physiological phases represented by floral Perlette 10 St. V2 52
induction, differentiation and outside bud, V3 50
inside the bud, inflorescence growth, flowering, V1 30
pollination and fertilization, the first fruits and Muscat Adda 22 St. V2 35
V3 32
baking. All these steps must be carried out
V1 60
normally for a good production and quality Canner V2 62
depend on the percentage of shoots that appear V3 65
on the block (Iuoras R. and Pop N., 2000).
Fertility and productivity are qualities that Between the lower threshold of spring and
characterize biological and technological autumn leaf fall that occurs when normal
agrobiological value variety and the grape-vine. conditions, length of the growing season ranges
Fertility and productivity are correlated with which ranges from 153-225 days in Romania.
each other and directly affect grape production (Oltenu I., 2000). Losses buds were evident in
(Stoian I. and Namolosanu I., 2006). varieties Augusta (55-60%) and Canner (62-
65%), regardless of the type of cut applied
(Table 4).
39
improvement especially laboratory staff for
their support.
REFERENCES
Bennett J.S., 2002. Relationships between carbohydrate
supply and reserves and the reproductive growth of
grapevines. Thesis, Lincoln University.
Bucur Georgeta Mihaela, Dejeu L., Cazan G., Tanase
Ana, 2012. Research concerning the influences of
climate changes on grapevine. Scientific Papers
Figure 2. Value of the temperatures (ºC) 2012 Series B. Horticulture, Vol. LVI, USAMV Bucuresti,
p. 43-48.
Damian Doina, Calistru Gh., Stoica Carmen, Savin C.,
Destructive temperatures, low temperature 2004. Comportarea unor soiuri de struguri de masa,
limits, the alternation and the duration of this cu rezistenta genetica sporita, în conditiile podgoriei
low temperatures, produced important damages Iasi, Analele ICVV Valea Calugareasca, vol. XVII, p.
to grapevine in general and the table grape 87-93.
varieties in particular (Stroe M et all, 2009; Dumitriu I.C., 2008. Viticultura. Editura Ceres,
Bucuresti, p. 440.
Stroe M. and Bucur M., 2012). Fennell A., 2004. Freezing Tolerance and Injury in
The minimum temperatures in 2012 were Grapevines, Journal of Crop Improvement, Vol. 10
significantly smaller in average years 1991- (1-2), p. 201-235.
2010 (-20.90C in February) (Figure 2). Georgescu Magdalena, Indreas Adriana, Dejeu L.,1986.
Comportarea unor soiuri de struguri de masa si de vin
obtinute la noi în tara si a unor soiuri cu rezistente
CONCLUSIONS
biologice, în conditiile iernii 1984/1985. Lucrari
Dates on the ratio of the diameter of the stiintifice IANB, seria B, Horticultura, vol.XXIV.
wood/marrow and shows a correlation between Grecu V., 2010. Îndrumatorul viticultorului amator.
Soiurile rezistente de vita-de-vie si particularitatile
the size of the report and frost resistance of the lor de cultura. Editura MAST, p. 188.
varieties studied. Hence the improved frost Iuoras R., Pop Nastasia., 2000. Îndrumator pentru lucrari
resistance of varieties Argessis and Golden practice la viticultura. Editura AcademicPress.
Stefanesti irrespective of the applied pruning. Matei Petruta, Dejeu L., Mereanu Diana, 2009. Research
concerning the influence of climate change on
Argessis variety, showed the lowest resistance grapevine. Bulletin of USAMV Cluj-Napoca,
to frost it in hate -20.9ºC temperatures had a Horticulture, vol. 66 (1-2), p. 352-358.
viability of 70% and variety Canner of 40%. Olteanu I., 2000. Viticultura. Editura Universitaria,
Craiova, p. 599.
Most resistant variety of the studied work was Stoian V. si Namolosanu I., 2006. Prelucrarea strugurilor
Argessis with a viability of over 70%, so again si producerea vinurilor. Editura Ceres Bucuresti.
showed resistance to frost. Stroe Marinela Vicuta, Ispas Sofia, Damian I., Bucur
Georgeta Mihaela, 2009. Comparative study on the
Losses buds were evident in varieties Augusta behavior of clonal selection of the main varieties
(55-60%) and Canner (62-65%), regardless of grown in the vineyard Pietroasa, Lucrari stiintifice,
the type of cut applied seria Horticultura, vol. 52, U.S.A.M.V. Iasi, Editura
Ion Ionescu de la Brad, Iasi, p. 743-748.
ACKNOWLEDGEMENTS Stroe Marinela Vicuta, Bucur Mihaela, 2012. Study
regarding the influence of low winter temperatures
Thanks to National Research & Development between 2011-2012 on the viability of winter buds of
Institute for Biotechnology in Horticulture some table grape varieties in the conditions of the
didactic experiemental field in Bucharest. Scientific
Stefanesti-Arges for the material provided and papers Series B. Horticulture, vol. LVI, p. 181-185.
the possibility of conducting research
40
THE INFLUENCE OF TECHNOLOGICAL FACTORS

ON THE PRODUCTION AND QUALITY OF THE PEPPER
Simona Elena DIMACHE (BOBOC), Nicolae ATANASIU, Gheorghe CÂMPEANU,

Gabriela NEA‫܉‬Ă, Claudiu BOBOC

59 Marasti Blvd, District 1, 011464, Bucharest, Romania
Abstract
The pepper, highly nutritious vegetable species is sensitive to alterations of the vegetation factors that may influence
both commercial fruit quality and their content in carbohydrates, vitamin C and other biochemical components. Full
paper shows the modifications and / or production dynamics and its quality in some cultivars of pepper in field crops
from two dedicated areas: vegetable basin Silistraru (Braila) and Vidra (Berceni) Ilfov county, within some experiences
regarding the allocated space for plants, their nutrition regimes and harvesting time. The researches were carried out
within doctoral thesis in POSDRU/107/1.5/S/76888.
Key words: Commercial quality, cultivars, field peppers, food quality.
INTRODUCTION Pepper has twice as much vitamin C than

lemon and twice as much vitamin A (630 IU)
Pepper is cultivated for its fruits, which have
than butter (Dumitrescu et al., 1998).
many uses in human nutrition, such fresh, and
Undertaken research purpose: to establish how,
prepared or preserved (Stan et al., 2003).
fruit maturity evolution technique at phy-
Pepper fruits have a particular importance,
siological maturity influence the commercial
considering the fact that you can eat fresh, as
quality and food importance of pepper fruits
such, vitamins being fully utilized by the body
grown in the field.
(Ceausescu et al., 1984).
Pepper is considered a concentrate of vitamins
easily assimilated by the human body. Among
the vitamins, vitamin C comes first. From some To achieve this experience were studied
studies conclude that mature pepper contains 4- variants shown in Table 1.
6 times more vitamin C than lemon juice or
orange juice (Ceausescu et al., 1984).
Table 1. Experimental variants. Peppers for fresh consumption,

vegetable basins Silistraru Braila and Berceni Ilfov – 2012
Var.no. Area of culture (A) Var.no. Time of harvest (maturity) (C)
1(mt1) Technical maturity (c1)
Bianca F1 (b1)
2 Silistraru Physiological maturity (c2)
3 Braila Technical maturity (c1)
Atris F1 (b2)
4 Silistraru Physiological maturity (c2)
5 Braila Technical maturity (c1)
California Wonder F1 (b3)
6 Physiological maturity (c2)
7(mt2) Technical maturity (c1)
Bianca F1 (b1)
9 Berceni Technical maturity (c1)
Atris F1 (b2)
10 Ilfov Physiological maturity (c2)
11 Technical maturity (c1)
California Wonder F1 (b3)
41
Table 1 shows the type 2x3x2 trifactorial Works in autumn - abolishing pre-culture, basic
experience with 12 variants, with the following fertilization with superphosphate simple 3 kg
graduations. per 100 m2 (300 kg/ha) deep autumn plowing
Experimental factor A - Areal has two gradua- with incorporation of crop residues and
tions: a1 - Silistraru vegetable basin Braila a2 - superphosphate.
Ilfov Berceni vegetable basin Experimental factor Foundation work, care and harvesting of crops:
B - Cultivar, has three graduations: b1 - Bianca Experience planting on 15 May 2012, by
F1 b2 - Atris F1 b3 - California Wonder F1 planting seedlings rarely without transplanters,
Experimental factor C - Time of harvest has produced in solarium with nutrient mixture
two graduations: c1 - technical maturity of fruit layer placed on fresh manure aged 60 days to
c2 - physiological maturity of the fruit. 70 cm between rows and 20 cm between plants
The biological material used in experience is in the row, providing density 71 400 plants/ha
composed of three cultivars. (Neata G., 2002).
Bianca F1, a pepper grown successfully in Care of the most important works we mention
Romania, very early with good capacity integrated weed combat by herbicides com-
fructification, large fruits white-yellow color. bined with hoeing treatments to prevent/combat
Atris F1 early hybrid and highly productive, diseases and pests and crop specific area
ripening from green to red. Long fruit with (Cristea S. and Neata G., 2004).
thick pulp is suitable for growing in the field Fertilization was performed using soluble
and/or solarium. Good taste is juicy at technical complex fertilizers Universol type, with higher
maturity and also at its physiological. content in nitrogen (blue Universol) until the
California Wonder F1 hybrid with undeter- first fruits and higher potassium content
mined growth and long cycle of culture. Before (Universol purple) during fructification
maturity fruits have green color and at (Neamtu G. et al.).
physiological maturity red color, the pericarp
thick and juicy. RESULTS AND DISCUSSIONS
Specific technology applied to experience
Into experience were made observations and
included the following groups of works and
measurements, after which they were esta-
technical parameters (Atanasiu N., 2005).
blished the following results.
Table 2. The average weight of fruits (g). Silistraru Braila, Ilfov Berceni, 2012
Technical maturity
Cultivar
Grams of fruit Differences
Bianca F1 149,4 X +
Atris F1 153,7 + +
California Wonder F1 168,4 + +
Bianca F1 141,2 - X
Atris F1 136,2 - -
California Wonder F1 149,5 - -
The average fruit weight varied for analysis California Wonder F1 witness against Bianca
carried out from 153.7 g registered at the Atris F1 149.4 g.
F1 cultivars, up to the value of 168.4 g at The differences are small and without statistical
coverage.
Table 3. The dry matter content. Silistraru Braila, Berceni Ilfov, 2012
Technical maturity Physiological maturity
Cutivar
Silistraru Berceni Silistraru Berceni
Bianca F1 4.50% 4.35% 4.65% 4.47%
Atris F1 5.30% 5.15% 5.45% 5.32%
California Wonder F1 3.80% 3.65% 3.95% 3.77%
42
During the experiments and analyzes perfor- in experimental conditions Silistraru, Braila.
med noted Atris F1 hybrid with a dry matter The dry matter content increases from technical
content of 5.45% at its physiological maturity maturity to physiological.
Table 4. The pericarp thickness. Silistraru Braila, Berceni Ilfov, 2012

Cutivar
Silistraru Berceni Silistraru Berceni
Bianca F1 4.86 mm 4.64 mm 5.15 mm 4.95 mm
Atris F1 4.54 mm 4.41 mm 4.65 mm 4.48 mm
California Wonder F1 7.15 mm 6.94 mm 7.30 mm 7.15 mm
During this research, the pericarp thickness Silistraru) and 7.15 mm at cultivar California
ranged from 4.54 mm minimum value at Atris Wonder F1 (technical maturity, Silistraru) The
F1 (technical maturity, Silistraru) to 4.86 mm differences were smaller when cultivars in
in case of Atris F1 cultivar (technical maturity, Berceni, Ilfov because culture conditions.
Table 5. Vitamin C content. Silistraru Braila, Berceni Ilfov, 2012

Cutivar
Silistraru, Braila County Berceni, Ilfov County Silistrar, Braila County Berceni, Ilfov County
Bianca F1 131,90 mg/100 g s.p. 126,1 mg/100 g s.p. 139,12 mg/100 g s.p. 135,41 mg/100 g s.p.
Atris F1 152,44 mg/100 g s.p. 146,32 mg/100 g s.p. 156,28 mg/100 g s.p. 150,17 mg/100 g s.p.
California Wonder F1 118,40 mg/100 g s.p. 109,2 mg/100 g s.p. 125,60 mg/100 g s.p. 119,12 mg/100 g s.p.
Vitamin C content recorded the highest values In the experiments is remarkable growth indi-
in case of cultivar Atris F1 and lowest in case cators: solids content, vitamin C content and
of cultivar California Wonder F1. Values in- thickness of the pericarp cultivars when
creased from technical maturity to physio- compared with cultivars Silistraru Braila in
logical maturity and are higher in cultivars Berceni, Ilfov due to culture conditions and
from Silistraru Braila due to culture conditions technology used.
and superior technology. Pericarp thickness and chemical composition
ensures a balanced of fruit succulence and
CONCLUSIONS particularly flavor, it recommends the con-
sumption of fresh and preserved condition.
Based on the experimental results held the
following conclusions can be drawn:
ACKNOWLEDGEMENTS
Among the cultivars used in experience stands
in terms of average fruits weight with 168.4 g The researches were carried out within
the hybrid California Wonder, which exceeds doctoral thesis in POSDRU/107/1.5/S/76888.
the average weight of fruits witness Bianca F1
(149.4 g). REFERENCES
The pericarp thickness increases from technical Atanasiu N., 2005. Field crops for consumption of fresh
maturity to physiological all cases, and towards peppers, Atar Publishing House, Bucharest.
the witness Bianca F1 (5.15 mm, physiological Ceausescu I., Balasa M., Voican V., Savitchi P., Radu
Gr., Stan N., 1984. General and special vegetable,
maturity) in experimental conditions Silistraru, Didactics and Pedagogical Publishing House,
Braila County, the hybrid California Wonder Bucharest.
F1 is distinguished with 7.30 mm (to physiolo- Cristea Stelica, Neata Gabriela, 2004. Fertilization
gical maturity). materials and plant protection products, AMD
Vitamin C content increases from technical Veterinary Medicine Bucharest.
Dumitrescu M., Scurtu I., Stoian L., Glaman Gh.,
maturity to physiological maturity and the Costache M., Ditu D., Roman Tr., Lacatusu V., Vlad
highest values we meet at Atris F1 hybrid in C., Zagrean I, 1998. Production of vegetables,
experimental conditions in Silistraru, Braila. Artprint Publishing House, Bucharest.
43
Neamtu G., Gheorghe Campeanu, Carmen Socaciu, Stan N., Munteanu N., Stan T., 2003. Vegetable gro-
1995. Vegetable biochemistry, Didactic and Peda- wing, Vol. III, Ion Ionescu de la Brad Publishing
gogic Publishing House, Bucharest. House, Iasi.
Neata Gabriela, 2002. Agro-chemistry and soil biology.
Printech Publishing House, Bucharest.
44
RESEARCH CONCERNING EFFECTS OF PERLITE SUBSTRATE

ON TOMATO IN SOILLESS CULTURE
Elena Maria DRĂGHICI, Maria PELE, Elena DOBRIN

Abstract
In Romania, soilless culture method in perlite substrate for tomato crop is still in early stages. Few farmers practice
the culture on perlite substrate. Soilless cultures have many advantages such as increased yield, health and uniform
product, conservation of water and land, better protects an efficient control of environmental pollution and reduce of
workers for cultivation.The aim of this study was effects of perlite substrate on tomato yield and fruit quality in soilless
cultivation.This study has done in the Hortiviticultural Systems Bioengineering Department, University of Agricultural
Sciences and Veterinary Medicine-Bucharest. Tomato culture was founded on mattresses filled with perlite.
Experimental variants were the type of size particle of perlite from mattress. The mattresses had provided a volume of
10 l perlite / plant. We used three types of grain of perlite of 2 mm, 4 mm and 5 mm. The best results were obtained
when using perlite as substrate grain 4 mm.
Key words: perlite substrate, tomatoes, size grain.
INTRODUCTION In the global horticultural production, vegetable

crops 'without soil' had begun already gain a
Supply the market with fresh vegetables is a
leading position. These unconventional systems
priority with economic and social implication.
of culture are great interest both for researchers
Therefore, the researchers are permanently
and for those who practice in order to achieve
constrained to finding new modern growing
products for human consumption.
technology, perfumed that to assure a high
In Romania, expansion of these systems raises
production (Abrar, 2011).
serious technical and economic issues, so it is
The most frequently unconventional systems
necessary to establish culture technologies ap-
are the systems of vegetables growing on
plicable, using local materials and equipment
Grodan and NFT systems.
imported or to be accessible to a larger number
Extending these culture systems have some
of users (Atanasiu N., 2009).
drawbacks such as the rock wool culture sys-
Extending this systems create some problems
tem requires enormous quantities of this
referring to polluting because the Grodan is a
material, material subsequently back into
substrate that is difficult to recycled.
circulation very difficult and NFT system
Purpose of research in this study was to iden-
involves rearranging production facilities by
tify the best composition based on perlite
installing gutters, an operation that is very
substrate and recommend it to obtain early and
costly financially.
total yields, quality and price of low cost.
In view of the above, it is necessary to develop
Expanded perlite is a substrate of culture that
technologies that are not expensive, can be
completely replaces soil.
made with cheap materials and handy, but at
the same time ensuring high productivity both
quantitatively and qualitatively.
The culture of perlite substrate has two major The experiment was carried out in the vege-
advantages: it is very accessible from econo- table sector in Bucharest, Faculty of
mically within the global trend as organic Horticulture.
(Draghici et al., 2012). The biological material used was the hybrid
tomato Gaheris.
45
Experience consisted of the following experi- - determine the number of inflorescences and
ments presented in Table 1. flowers in blossom;
- percent of binding of fruit;
Table 1. Experimental variants - early production;
Variants Substrate types Growing - the quantity of fruit harvested per plant;
V1 Control Growing on soil - the average fruit per harvest;
V2 Perlite 2mm
Growing on - the total production;
mattresses Fruit production was determined by weighing.
50% Perlite of 2mm and Growing on
V3 For each determination was made statistical
50% peat mattresses
Growing on analysis
V4 Perlite 4mm
mattresses
Growing on RESULTS AND DISCUSSIONS
V5 Perlite 4mm+peat
mattresses
Growing on From the figure 1 we can see in dynamic the
V6 Perlite 5mm growing of plants on the experimental variants.
mattresses
Growing on
V7 Perlite 5mm+peat
mattresses
Culture was established in unheated solarium.

Of each variant we use four mattresses of 1 m
long for each where we had planted each three
plants. In total, 24 mattresses were installed.
The distance between the mattresses was 90 cm
and 35 cm between plants. Therefore, for each
plant we had assured 10 l perlite substrate. Mat-
tresses had contained 30 l of substrate. Plant
density was 31,746 plants per ha.
Hydroponics mattresses were made of biode-
gradable polyethylene, triple laminated, com- Figure 1. Dynamic growing in height of tomato plants
posed of two layers, colored black inside and
white outside. Mattresses have a length of 1 m
and a width of 20 cm. The experiments were Total number of the flowers and fruits formed
realized on some mattresses prototype created on inflorescences are presented in table 2.
by SC Procema SRL, Romania.
Table 2. Total number of the flowers and fruits formed
The fertilizing recipe was modified with on inflorescences
phenophase. In the first phenophase, immediate
period after planting, for each plant we gave Inflorescences
Variants
1st 2nd 3rd 4th 5th 6th
amount 50 ml of solution per fertigation-for 2
No. Flowers 9 9 7 7 9 9
weeks. V1
No. fruits 5 5 4 4 3 3
Daily we had administrated a number of six No. Flowers 9 9 9 9 11 14
watering. V2
No. fruits 5 06.05 04.05 02.05 2 7
I increased the amount of solution per plant as No. Flowers 9 9 9 08.05 7 9
the plants increased in height, so had adminis- V3
No. fruits 6 3 5 05.05 02.05 4
trated between 100 ml and 200 ml depending No. Flowers 8 9 9 7 7 7
V4
on temperature and light. No. fruits 8 4 6 3 7 5
Measurements and determinations made. No. Flowers 7 9 7 9 5 5
V5
During the growing season were conducted No. fruits 7 0 4 3 4 1
observations and determinations so: No. Flowers 11 7 5 6 6 5
V6
No. fruits 6 7 4 2 3 3
- increase in plant height;
No. Flowers 7 9 7 7 7 10
- number of leaves; V7
No. fruits 5 6 4 1 0 5
- number of leaves until the first inflorescence;
- number of leaves between inflorescences;
In the table no 3 is noted that the highest
- average distance between inflorescences;
percentage of binding occurs in variant no 4
46
with 70.21% as compared to Control, Variant Variant 2 we harvested 10 fruits with weight of
no 1, were the percentage of binding was 48%. fruit of 117 g and at the V5 we harvested only 3
A large percentage of fruit we had obtained at fruits per plant with an average of 127 g fruit.
the V6 about 62.5% and 50.49% at the V3.
The variants 2, 5 and 7 we had registered a Table 5. The number of fruit and average mass of fruit at
percentage below 50%. the first harvesting
Number of fruits Products on Average mass
Table 3. Total number of flower and fruits formatted on Variants obtained on plant plants of fruits
plant and percentage of binding no. g/plant g
V1 4 400.0 100.00
Total flowers Total fruits
Percentage of V2 10 1173.0 117.30
formatted on formatted on
Variants binding V3 6 762.5 127.08
plant plant
V4 4 470.0 117.50
no. no. %
V5 3 381.5 127.17
V1 Control 50.0 24.0 48
V6 6 665.5 110.92
V2 Perlit
61.0 27.mai 45.08 V7 7 857.0 122.43
2mm
V3 Perlit
51.5 26.0 50.49 In the table 6 are presented production, number
2mm+peat
V4 Perlit
47.0 33.0 70.21
of fruits and the average mass of fruit obtained
4mm on plant at the second and last harvested. We
V5 Perlit can remark that at the second harvest, the
42.0 19.0 45.24
4mm+peat
V6 Perlit
highest production had obtained at the V2
40.0 25.0 62.5 (1320.4 g/plant) and smallest production at the
5mm
V7 Perlit V6 (920.0 g/plant). In average the mass of fruit
47.0 21.0 44.68
5mm+peat had varied between 117.5 g/fruit at V4 and
Average 48.36 25.ian 51.85 125.0 g/fruit at the V3 (the second harvest). At
the last harvest were recorded 1322.40 g/plant
At the first harvesting, are not existing at the control (V1). In addition, we can observe
differences between variants except the V2 that at the last harvest the fruit mass was
where I remarked a positive significance between 101.5 g/fruit at the V2 and 120.0
statistic point and view (Table 4). g/fruit at the V7.
Table 4. Fruits mass at the first harvest Table 6. The production obtained at the second and the
Fruits mass Differences Significance last harvested
Variants
kg Kg % The second harvest Last harvest
V1 0.40 0.00 100.0 Mt Products Average Products Average
No No.
V2 ian.17 0.78 295.09 * Variants on mass on on mass on
fruits fruits
V3 0.76 0.37 191.82 N plants fruit plants fruit
V4 0.47 0.07 118.24 N g/plant No. g g/plant No. g
V5 0.38 -0.02 95.97 N V1 942.4 8 117.8 1322.4 12 110.2
V6 0.67 0.27 167.42 N V2 1320.0 11 120.0 659.75 06.mai 101.5
V7 0.86 0.46 215.60 N V3 1250.0 10 125.0 1150.0 10 115.0
V4 1645.0 14 117.5 1545.0 15 103.0
Average 0.67 0.27 169.16 N
V5 1089.9 9 121.1 821.10 7 117.3
DL5%=0.520 DL1%=0.780 DL01%=1.250
V6 920.0 8 115.0 1265.0 11 115.0
V7 964.0 8 120.5 720.00 6 120.0
At the first harvest, were collected from V1
four fruits with 100g in average fruit. The production obtained during a month was at
Production obtained from this variant had the 3.66 kg on the plant at V4 and 2.292 kg on the
lowest referring to average mass (Table 5). plant at V5 (Table 7).
Most fruits were harvested from V2. Were The highest percentage was recorded at V7 and
harvested an average of 10 fruits per plant, with the lowest at V3, compared to the control,
an average mass of 117 g on fruit. The largest table 7.
fruits were harvested at 3 and 5 variants with
127 g average fruit. Of all the variants at the
47
Table 7. Total production on plant ACKNOWLEDGEMENTS
Total on plant Percent to control This work was supported by a grant of the
Variants
g/plant %
V1 2662.80 100.00
Romanian National Authority for Scientific
V2 3152.75 118.40 Research, CNDI–UEFISCDI, financed from
V3 3162.50 118.77 project number PN-II-PT-PCCA-2011-3.2-
V4 3660.00 137.45 1351 - Contract No.68/2012. The perlite and
V5 2292.50 86.09 mattresses were obtained with help of manager
V6 2850.50 107.05 Somacescu Claudiu of SC PROCEMA
V7 2541.00 95.43
PERLIT SRL, Romania.
CONCLUSIONS REFERENCES
On the plant were six inflorescences formatted Abrar Hussain Shah, Shams Ul Munir, Noor-Ul-
in three months after planting on perlite Amin,Safdar Hussain Shah, 2011. Evaluation Of Two
substrate. Nutrient Solutions For Growing Tomatoes In A Non-
Circulating Hydroponics System, Sarhad J. Agric.
The number of fruit on inflorescences varied Vol.27, No.4.
between 3 at the fifth and sixth cluster and five Atanasiu N., 2009. Culturi horticole fara sol, ed. Ceres.
at the first and second clusters (V1 control). Draghici E.M., Pele M., 2012. Evaluation some new
hybridsfor cultivation in convetional system in
The best results were obtained when using
spring climatic conditions of Romania, International
perlite as substrate grain 4 mm of 3.66 kg on Journal of Agriculture Science, ISSN 095-
the plant. 3710&ISSN 0975-9107, volume 4, p. 299-305.
48
INFLUENCE O THEPEST CONTROL METHODS OVER THE USEFUL

ENTOMOFAUNA WITHIN THE VITICULTURAL ECOSYSTEM
Ioan ENOIU1, Lidia FÎCIU2, Sonia DROSU3

1
Naturevo Ltd, St. Ion Urdareanu, no 34, Sector 5, Bucharest, Romania
2
Research and Development Institute for Viticulture and Winemaking, St. Mantei,
Calugareasca Valley, Romania
3
Institute of Plant Protection Research and Development, Bd Ion Ionescu de la Brad, no. 8
Dictrict 1, 013813, Bucharest, Romania
Abstract
The paper presents the influence of the differential methods to control pests and diseases of vines, respectively chemical
control, biological and integrated, over the useful and harmful in a entomofauna vineyard ecosystem. Experimental
data obtained showed that the abundance entomofauna (useful and harmful) presented higher values for biological
control and integrated methods compared to chemical control method. Integrated control, especially chemical, caused
a reduction of 4% and 17% in the number of the useful insects compared to the biological control method. The ratio
between useful and harmful entomofauna recorded in May and June had an average of 1.1, with an upward trend in the
use of biological control method and decreasing for integrated control, especially the chemical. Useful entomofauna
recorded lower values than the harmful for all control methods used, which proves that useful pests are more sensitive
than the harmful ones after application.
Key words: methods of pest control, viticulture, useful entomofauna.
INTRODUCTION useful and harmful entomofauna existing in a

vineyard ecosystem.
A full management of viticultural ecosystem
can not be achieved without a reconsideration
of the whole system based on a design that
takes into account both ecological pest Research has been carried out within a vineyard
knowledge and their destructive potential and having planting distances: 2.0/1.0 m placed into
complex adoption of the most appropriate terraced slope conditions arranged in terraces
measures for the natural control of the harmful wide (width 17.2 m, 8 rows of vines). The
species (Coulon et Sentenac, 2001; Dejeu et al., biological material was represented by
2005; Fregona, 2005). Parasites and predators Merlot/SO4-4 variety.
of the existing natural background in each They were experienced 3 differentiated method
ecosystem wine is by far one of the most to control pests and diseases of the vines,
important natural biotic factors limiting the namely:
populations of the harmful pests (Perju et al., -Chemical control based on the use of contact
1988). Some technological sequences used in and systemic insecticides;
vineyards, especially treatments of diseases and -Biological control based on the use of of
pests of vines, can influence in an obvious copper, sulfur and bioinsecticides;
manner the diversity and numerical abundance -Integrated control based on the use of less
of natural predators populations, with direct harmful insecticides, accepted internationally
implications in maintaining the natural balance for the integrated pest management in
within the wines ecosystem. vineyards to which were added biotechnical
Based on these considerations the paper aims to means and bioinsecticides.
present the influence of differential methods To collect biological material that represents
of pests and diseases control in vines over the the useful and harmful entomofauna of the
49
vineyard, several methods were used Bruchidae, Curculionidae and Geometridae (for
depending on the targeted species, namely: Diptera, suborder Brachycera).
-Barber traps, which is the classical method for Beneficials were separated into predators and
collecting mobile arthropods on the ground; parasites. Predators were included in 7 order:
-Shaking technique that allows collecting Aranea, Dermaptera, Heteroptera, Neuroptera,
useful and harmful entomofauna by shaking Hymenoptera, Coleoptera, and Diptera in 6
vegetative organs above an entomological net; families. Parasites Hymenoptera belonge to two
-Method of leaf samples, allowing an estimate superfamilies, Chalcidoidea and
of the entomophagous populations from the Ichneumonoidea. Ants present in a large
leaves. numbers were included into Formicoideal
Measurements were made at an interval of two subfamily.
weeks between May and June. After The taxonomic classification of the fauna
harvesting the samples samples were brought collected specific to the vineyard ecosystem
to the laboratory and analyzed the binocular studied is presented in Table 1.
loupe and microscope to identify the present
species. Identified species were classified into Table 1. Taxonomic classification of the fauna collected
taxonomic groups: orders, families and genus. from the viticultural ecosystem studied
The relative abundance and the number of Harmful fauna Useful fauna
species that encounter the the useful and the 1. Ord. ORTHOPTERA
1. O. ARANEAE
harmful entomofauna specific for the vineyard Fam. Catantopidae
2. O. DERMAPTERA
Caliptamus italicus L.
ecosystem was studied, the subject to the type Fam. Gryllidae
Fam. Forficulidae
of the treatment. Forficula auricularia L
Grilus campestris L.
3. HETEROPTERA
Based on the data we have got calculated the Melanogryllus desertus
Fam. Anthocoridae
ratio between the two components of vine pests Pallas
Orius sp.
and predators respectively. 2Ord. THYSANOPTERA
4. NEUROPTERA
Fam. Thripidae
Fam. Chrysopidae
3. Ord. HETEROPTERA
RESULTS AND DISCUSSIONS Chrysoperla carnea Steph.
Fam. Miridae
5. O. HYMENOPTERA
Lygus sp.
Based on the role and the importance of Fam. Pentatomidae
Suprafam. Chalcidoidea
predators into two vineyard ecosystem, a Suprafam.
4. Ord. HOMOPTERA
Ichneumonoidea
mapping of the vine pest for the three methods Fam. Cicadellidae
Suprafam. Formicoidea
differentiated, on diseases and pest control in Fam. Aphididae
6. Ord. COLEOPTERA
vineyards was concluded. 5. Ord. COLEOPTERA
Fam. Coccinellidae
Fam. Elateridae
Arthropod fauna collected by means, during Fam. Halticidae
Coccinella 7-punctata L.
May-June in the experimental plots, Propylea 14-punctata L.
Fam. Bruchidae
Stethorus punctillum
amounted a total of 810 insects. out of these, Fam. Curculionidae
Weise
430 were harmful insects, representing 53.1% 6. Ord. LEPIDOPTERA
Fam. Staphilinidae
Fam. Geometridae
and 380 formed entomophagous population, 7. Ord. DIPTERA
7. Ord. Diptera
representing 46.9% of the total. The reletio Subord. Brachycera
Fam. Tachinidae
between the two populations was 1.13.
Function to the pest in the species vineyard, The structure and relative abundance and
arthropods were divided into two groups: (i) number of species that form the harmful fauna
harmful fauna (phytophagous pest that feed on population specific for the vineyard ecosystem
different parts of plants and (ii) useful fauna studied, function of the types of management
(parasitoids and predators, whose regime is regarding the control of the agents on the
carnivorous diet). entire collection period (May-June), is
Harmful species were included into 7 orders: presented in Table 2.
Orthoptera, Thysanoptera, Heteroptera, The experimental data obtained, indicate a
Homoptera, Coleoptera, Lepidoptera and difference in the number of species collected of
Diptera and 13 families: Catantopidae, functions of the three types of pest
Gryllidae, Thripidae, Miridae, Pentatomidae, management. Thus, it may be noted that the
Cicadellidae, Aphididae, Elateridae, Halticidae, version where we used the biological control of
50
pest agents, that have been used substances The remaining 6.73% counted Thisanoptera,
based on Cu and S + bioinsecticides was Heteroptera, Lepidoptera and Diptera.
collected the largest number of copies of Whole, pests collected from the chemically
harmful artopode (174 insects), followed by the treated, is below the threshold harmful to the
version where were used the integrated control vines. Noticeable is that Ciccadellidae family,
(less harmful chemicals + biotechnical means wich require careful follow-up for future, given
+ bioinsecticides) (152 insects) and variant that in Europe there are several species of
who underwent chemical control (104 insects). mycoplasmas carried by these vectors in
This is the result of the less toxic effect of the vineyards (eg Scaphoideus titanus, Metcalfa
products used for the biological control, and pruinosa). Fortunately,these micoplasmas have
effect of more toxic chemicals used for not been identified so far in our country.
chemical control. Integrated control place, the In the variant of biological control, there are
abundance of pests on an intermediate position. two groups close to each other: Homoptera and
In terms of the structure of pests, the situation Coleoptera occupy 44.3% and 30.5% in the
is different on the three pest control methods. structure of the pest, followed by Heteroptera
In the version with chemical control, the and Orthoptera 12.1% and 9.2%.
highest level was occupied by the insects of the In the version with integrated control, four
order Coleoptera (51.0%), followed by groups of insects occupy close structural levels,
Homoptera (30.8%) and Orthoptera (11.5%). as follows: Homoptera (38.8%), Coleoptera
(22.4%), Orthoptera (20.4%) and Heteroptera
(14.5%).
Table 2. Structure and relative and numeric abundance of the harmful insects subjects to the controlling method.
Chemical control Biological control Integrated control
Toxonomy classification
Nr ex. % Nr ex. % Nr ex. %
1. Ord. ORTHOPTERA 12 11.5 16 9.2 31 20.4
2. Ord. THYSANOPTERA 1 1.0 3 1.7 0 0.00
3. Ord. HETEROPTERA 0 0.0 21 12.1 22 14.5
4. Ord. HOMOPTERA 32 30.8 77 44.3 59 38.8
5. Ord. COLEOPTERA 53 51.0 53 30.4 34 22.3
6. Ord. LEPIDOPTERA 2 1.9 1 0.6 3 2.0
7. Ord. DIPTERA 4 3.8 3 1.7 3 2.0
TOTAL 104 100 174 100 152 100
To be noted that all versions include Orthoptera

group, represented by crickets and Table 3. Numerical distribution of the harmful
grasshoppers, whose presence is justified by the entomofauna differentiated by the methods applied for
pest control in vineyard
variety of spontaneous vegetation surrounding
the vineyard ecosystem (Table 3). Toxonomy Chemical Biological Integrated
Useful entomofauna specific for a vineyard classification control control control
Ord.
ecosystem, where three types of pest were ORTHOPTERA
4 7 12
applied is presented both as structure and as Ord.
1 1 0
number and relative abundance into the Table THYSANOPTERA
4. Ord.
0 10 9
Analyzing the useful entomofauna collected HETEROPTERA
Ord. HOMOPTERA 14 25 11
from the vineyard ecosystem under the three
Ord.
methods of pest control, as in the case of the 17 20 15
COLEOPTERA
harmful fauna, we found the same trend: the Ord.
0 0 2
largest number of beneficial being collected LEPIDOPTERA
from biological control version (214 insects), Ord. DIPTERA 0 2 0
followed by integrated control variant (102 TOTAL 36 65 49
insects), while fewer individuals were recorded
in chemical control version (64 insects).
51
Table 4. Structure and number and relative abundance of Table 5. Structure and abundance of the entomophagous
entomophagous population under different type of pest into the stationary , subject to different pest control
control methods in vineyard
Toxonomy Chemical Biological Integrated Toxonomy Chemical Biological Integrated
classification control control control classification control control control
No. % No. % No. % Ord. ARANEA 7 6 18
1. Ord. ARANEA 18 28.1 34 15.9 33 32.3 Ord.
6 8 2
2. Ord. DERMAPTERA
15 23.4 41 19.2 12 11.8
DERMAPTERA Ord.
1 19 3
3. Ord. COLEOPTERA
0 0.0 6 2.8 2 2.0
HETEROPTERA Ord. DIPTERA 0 1 0
4. Ord. Ord.
1 1.6 7 3.3 5 4.9 4 31 18
NEUROPTERA HYMENOPTERA
5. Ord. TOTAL 18 65 41
7 10.9 37 17.3 16 15.7
COLEOPTERA
6. Ord. DIPTERA 1 1.6 9 4.2 3 2.9 Table 6. The ratio between the useful and harmful
7. Ord. entomofauna (U / D) for the three methods of pest
22 34.4 80 37.4 31 30.4
HYMENOPTERA control in vineyard
TOTAL 64 100 214 100 102 100
Chemical Biological Integrated
Collection Date of
control control control
The beneficial insects were lower as number, (no) collection
(U/D)
but the number of species was higher. As a 1 25.05. 0.96 1.08 1.10
structure, the highest percentages were 2 5.06. 0.84 1.48 1.03
occupied by ants Hymenoptera group, 37.4% 3 19.06 0.46 1.55 0.95
4 29.06. 0.31 1.03 0.78
(biological control), 34.4% (chemical control)
and 30.4% (integrated control). Ants, although
they are not recognized as major predators in Based on the harmful and useful entomofauna
the agroecosystems, are big consumers of fresh collected from the wine ecosystems, a rotation
dejections secreted by some insects, mainly between useful and harmful fauna was
aphids, and insect remains under achieved for each collection date. The results
decomposition. are presented in the Table 6.
A group of predators of a great importance in From Table 6 we can see that the ratio between
limiting the multiplication of pests are beetles the two components harmful pests and
of the family Coccinellidae, Coccinella and beneficial, followed an upward trend under the
Stetorus genres. They have occupied the biological control and a decreasing if the
highest percentage in the alternative of variants of integrated and chemical particularly.
biological control structure (17.3%), followed As a general pole during spring and early
by integrated control option (15.7%) and summer this ratio has a value of 1.1, changes to
one or other of the components occurring after
then chemical variant (10.9%).
the intervention with the control treatments:
Noteworthy are the groups of Aranea (spiders
biological, chemical or integrated.
predators) and Dermaptera (earwig), which
achieved levels between 15.9-32.4% and 11.8-
CONCLUSIONS
23.4%. Both groups of predators feed on small
insects (aphids, mites) present on various Entomofauna abundance of the useful and
vegetable substrates vines, respectively harmful insects presented higher values for the
spontaneous vegetation. Earwig might produce biological and integrated control methods,
damages in grapes at harvest time, but without compared to the chemical control method.
the grapes ripened, they are regarded as Compared to the biological control, the most
predators of insects. protective for the useful entomofauna,
The structure and abundance of entomophagous integrated control and especially chemical,
in the experimental plots of the stationary were caused a reduction of 4% and 17% in the
three types of pest management were applied, number of useful insects.
are shown in Table 5. The ratio between useful and harmful
entomofauna recorded an average of 1.1, with
52
increasing trend for variants where was REFERENCES
practiced the biological control going Coulon T., Sentenac G., 2001. Un référentiel national
downward in the variant where chemical ‚Production intégrée des raisins” pour les vignobles
control was practiced. français. Bulletin de l’O.I.V., vol. 74, nr. 845-846, p.
Useful entomofauna was lower than the 445-462.
Dejeu et al., 1997. Hortiviticultura si protectia mediului.
harmful for all 3 methods of control, which Ed. Didactica si Pedagogica, Bucharest
proves that beneficial insects are more sensible Fregoni M., 2005. Viticoltura di qualita. Informatore
than the harmful insects, under phytosanitary Agrario Publishing House
treatments. Perju T. et all., 1988. Entomofagii si utilizarea lor în
protectia integrata a ecosistemelor viticole. Ceres
Publishing House, Bucharest
53
EFFECTS OF THE DIFFERENT GRAPE ROOTSTOCKS ON BERRY SKIN
B, CU, FE, MN AND ZN CONTENTS OF ’CSERSZEGI FĥSZERES’
CULTIVAR
István FEKETE1, Béla KOVÁCS1, Dávid ANDRÁSI1, Éva BÓDI1, Nándor RAKONCZÁS2
1
Institute of Food Science, Quality Assurance and Microbiology, Centre for Agricultural and
Applied Economic Sciences, University of Debrecen, Böszörményi Street 138., 4032,
Debrecen, Hungary
2
Institute of Horticulture, Centre for Agricultural and Applied Economic Sciences,
University of Debrecen, Böszörményi Street 138., 4032, Debrecen, Hungary
Abstract
The selection of the most appropriate grape rootstock regarding the production purposes has a positive effect on quality
of the grape, the must and the wine: it may produce higher vintage quantity and may increase the vintage quality. Field
experiment was set up at the model farm of University of Debrecen on sand soil. 12 different grape rootstocks were
compared (’Aramon x Riparia 143B M et de G’, ’Vitis Berlandieri’, ’Berlandieri x Riparia Szilágyi 157 Pécs’,
’Berlandieri x Riparia S.O.4’,’Berlandieri x Riparia T5C Eger’, ’Berlandieri x Riparia T.G. 5.A.5.’,’Berlandieri x
Riparia T.8.B.’,’Berlandieri x Riparia T.K. 5.BB’,’Berlandieri x Riparia K.125AA’,’Riparia Sauvage’, ’Riparia Selecta’,
’Riparia Tomentosa’). ‘Cserszegi fƾszeres’ scion was grafted into the above rootstocks. The aim of our research was to
determine how the B, Cu, Fe, Mn and Zn contents of the berry skins change in case of the different grape rootstocks. In
2011 we obtained valuable differences in the boron, copper, iron, manganese and zinc concentrations of skins of
‘Cserszegi fƾszeres’ grafted into different rootstocks. The concentrations of B, Cu, Fe, Mn and Zn changed between
18.0-32.0 mg kg-1, between 1.27-4.77 mg kg-1, between 11.5-45.0 mg kg-1, between 3.78-14.0 mg kg-1, and between 2.14-
8.53 mg kg-1, respectively. On the basis of our results the ‘Riparia Sauvage’ could be an advantageous rootstock, as the
largest boron, iron and manganese concentrations were found in its skin. Advantageous rootstocks could be the
’Berlandieri x Riparia Szilágyi 157 Pécs’ because of the largest measured copper content and the ‘Vitis Berlandieri’ due
to the largest measured zinc content. These results support that the selection of the rootstocks influence the B, Cu, Fe,
Mn and Zn contents of the grape berry.
Key words: grape rootstock, berry skin, micro element, ’Cserszegi fƾszeres’.
INTRODUCTION Berlandieri Plan.’ and ’Vitis vinifera L.’. The

first three varieties are of North-American
Grape rootstocks are present in the grape
production since the devastation of the origin. ’Vitis Riparia Scheel.’ comes from river
phylloxera. Because it is vital to be acquainted valleys of the east coast, ’Vitis Rupestris Mich.’
with characteristics of different rootstocks to origins from south-west part of the east coast,
choose the variety most appropriate to given while ’Vitis Berlandieri Plan.’ can be find on
circumstances, these characteristics were rocky territories of Texas state. Distinctive
broadly inspected by many researchers. characteristics of these species result from
Choosing the ideal rootstock-scion cultivar many thousand years’ evolution (Kocsis, 2010).
combination at establishment of the vineyard In ennobling of rootstock cultivars some other,
has a determining effect for its whole lifetime. mainly North-American grape species were
Crucial evaluative characteristics of rootstock also used (Galet, 1998). However, there are 19
cultivars are the following: soil requirement, listed rootstock varieties in the Hungarian
mineral nutrition, resistant to loam- and salt National Variety Registry Catalogue, only a
content, affinity and vegetative cycle (Angeli et few is propagated for commercial use (Lƅrincz
al., 1959). Most often utilised grape species in and Zanathy, 2009). In some other countries
ennobling of rootstock cultivars are ’Vitis possibilities of different rootstock-scion variety
Riparia Scheel.’, ’Vitis Rupestris Mich.’, ’Vitis combinations corresponding to specific
55
territorial circumstances is more elaborated, Effects of rootstocks do not confine for
spectrum of used rootstock varieties is broader. impinge on mineral take up but also on
The cultivated vine plant is called vine stock distribution of nutrients (Mannini et al. 1992).
(Balogh, 1991). Vine stocks are propagated on Withstanding that Kocsis (2010) could
vegetative way by cuttings or grafted cuttings experimentally prove that scion cultivars show
(Prohászka, 2003). Parts differentiating from different results when grafted on various
the cane in the soil form the rooting system, rootstocks concerning mineral take up, in field
parts forming above ground give the trunk and circumstances: effects of production site and
shoot system of the stock (Kozma, 1993a). In ecological factors, affect the modifying power
case of propagation by grafts, the root system is of rootstocks to a great extent, or even
formed by the rootstock cultivar (American minimizes it (Csikászné, 2008).
grape species), and the shoot system growth up Minerals taken up are predominantly located
from the scion (‘Vitis vinifera L.’) (Prohászka, into the solid parts of the bunch: in the skin,
1982). Mineral nutrients are taken up by the seed and cellulose-pectinic cell walls of the
root hairs from the soil. These nutrients get into flesh. The skin of the berry consists of the
the leaves and bunches through the root system, epiderma and some cell layers beneath
trunk, canes and shoots (Prohászka, 1982; (Ferenczi, 1966). Alkalinity of the of the berry
Kozma, 1993a). Certain nutrients can also be regularly increase 2-3 times by the ripening;
taken up through the leaves in smaller however only a more intensive relative increase
quantities (Kozma, 1993a). Through the is characteristic for the skin (Kállay, 1998).
lifetime of the graft, scion and rootstock parts The most important microelements of the
live together in mutual service. The rootstock berries are B, Cu, Fe, Mn and Zn (Kállay,
takes up mineral nutrients dissolved in water, 1998). Most important role of iron is formation
the scion fruits and feeds the rootstock with of chlorophyll (Prohászka, 1982). The least
photosynthates (Kocsis, 2010). iron can be find in the seeds regarding the
Rootstock has direct and indirect effects on the berries (Kozma, 1993a). Boron has crucial role
scion (Striegler and Howel, 1991; Csikászné, in evolution of floral fertility, in amount and
2008). Hegedƾs and I’só (1965) demonstrated, quality of the yield, but even a slight overdose
that different scion cultivars show their best of this element can have toxic effects (Bényei
performance on different rootstocks, which and Lƅrincz, 1999; Oláh, 1979). Ruckenbauer
differently affect nutrition of scions grafted on (1987) found, that boron uptake of the vine is
them (Lƅrincz and Bényei, 1999). Mineral the biggest in the berries in case of 10 tons/ha
nutrition pattern characteristic for own rooted yield. Experiments of Candolfi-Vasconcelos et
vine alter in case of grafts (Kozma, 1993b). al. (1997) state, that grafts are more effective in
Quantity and composition of nutrients going to boron uptake than own rooted vines.
the direction of the scion is predominantly Manganese is a mediator in the synthesis of
determined by the selection ability/ carbohydrates and proteins, since it activates
characteristics of the root system (Kozma, many enzymes (such as polyphenol-oxidase,
1993b). ascorbic acid-oxidase). Zinc plays its most
Different rootstocks can be characterized by critical role in catalysing synthesis of
different root formation. Magnitude, vertical tryptophan (Kozma, 1993a). Copper is one of
and horizontal extension of the root system is the most important growth factors of the vine
also an important factor of mineral take up plant. One of its important roles is supporting
(Vercesi, 1987). Certain rootstock cultivars of carbohydrate and protein synthesis (Kozma
form smaller (’Berlandieri x Riparia TK5BB’) 1993a; Kállay, 2010).
others form medium sized (’Aramon x Microelement content of the grape skin can
Rupestris G 1’) root system. ’Riparia Portalis’ also be interesting from the point of maceration
can be characterised by a deeper, while technology at processing white aromatic grape
’Berlandieri x Riparia S.O.4’ can be cultivars, since by this way a certain amount of
characterised by a shallow root system microelement of the skin dissolves into the
(Vanekova, 1995). must increasing its alkalinity (Kállay, 2010).
Microelement content of the must further on
56
gets serious role through the fermentation cm depth accordingly. To determine the
process, because enzymatic activity of the yeast fraction of soil B, Cu, Fe, Mn and Zn content,
requires adequate amount and ratio of which could be utilized by the plant, analysis
microelements (Erdƅss, 1973). Further on, in with NH4-acetate + EDTA elution, elaborated
the wine it is also significant from the point of by Lakanen and Erviö (1971) was used.
formation of “minerality”. This concept refers Analysis of mineral composition of the elution
to the mineral content of the wine, also called was checked by Thermo Scientific iCAP 6300
“salinity”. Both describe a special abundance in Dual type inductively coupled plasma optical
the taste complexity (Hajós, 2008). emission spectrometry (ICP- OES).
The aim of our research was to determine how
the B, Cu, Fe, Mn and Zn content of the berry Table 1. Soluble (Lakanen and Erviö, 1971) B, Cu, Fe,
Mn and Zn content of soil of Model Farm (mg kg-1)
skins changes in case of the different grape
rootstocks. Data on mineral composition Parameters Average (mg kg-1)
affected by different rootstocks are first year Sampling depth (cm) 0-30 30-60
B 0.63 0.60
results of a longer, and more complex work.
Cu 9.95 7.02
Fe 239 213
MATERIALS AND METHODS Mn 329 382
Zn 6.93 4.65
Grape variety collection of the University of
Debrecen, Centre of Agricultural and Applied
Table 2. General parameters of soil of Model Farm
Economic Sciences was established in 2003 on
immune sandy soil with 3m between row and Parameters Average
1m between vine spacing. 28 rootstock Sampling depth (cm) 0-30 30-60
pH (KCl) 5.93 5.91
cultivars of the collection were trained to bald
Soil texture Sand Sand
head system with one bended wire technology. All water soluble salt (m/m) 0.005 0.006
In 2010 grafting of ‘Cserszegi fƾszeres’ (also CaCO3 % (m/m) 0.5 0.5
called ‘Woodcutters’ white’) on 14 rootstocks Humic % (m/m) 1.12 1.08
out of the 28 was started with woody-green
grafting in May, following with green grafting In October of 2011 respectful amount of grape
up to 20th of June. On vines grafted in place the could be harvested of scions on 12 rootstock
scion was situated between 50-150 cm height. varieties. These are the following: ’Aramon x
Scion was trained to single curtain training Riparia 143B M. et de G.’, ’Vitis Berlandieri’,
system (Figure 1.). ’Berlandieri x Riparia Szilágyi 157 Pécs’,
’Berlandieri x Riparia S.O.4’, ’Berlandieri x
Riparia T5C Eger’, ’Berlandieri x Riparia T.G.
5.A.5.’, ’Berlandieri x Riparia T.8.B.’,
’Berlandieri x Riparia T.K. 5.BB’, ’Berlandieri
x Riparia K.125AA’, ’Riparia Sauvage’,
’Riparia Selecta’, ’Riparia Tomentosa’.
The scion cultivar ’Cserszegi fƾszeres’ was
ennobled by the crossing of ’Irsai Olivér’ and
’Traminer’ by Károly Bakonyi in
Cserszegtomaj (Hungary). This middle ripe,
white wine grape variety is commonly
respected for its good wine quality and
resistance to fungal diseases (Balogh, 1993;
Figure 1. View from a grape variety collection of the Bényei and Lƅrincz, 1999). The point in
University of Debrecen, Centre of Agricultural and selection of this cultivar for our study is to
Applied Economic Sciences focus on its sensitivity to dry periods, and
effects of rootstock cultivars on this feature.
1st and 2nd tables show soil parameters of the Sample preparation and analyses were
experimental field in Pallag of 0-30 and 30-60 performed in laboratory of University of
57
Debrecen, Centre for Agricultural and Applied Results show, that significant differences were
Economic Sciences, Institute of Food Sciences, detected between berry skin Cu contents of
Quality Assurance and Microbiology. ’Cserszegi fƾszeres’ grafted on different
By the analysis 5 elements were checked (B, rootstocks. The relative standard deviation
Cu, Fe, Mn and Zn) in three replications. The between Cu content measured in the berry skins
skin was separated and cleared in laboratory was 36.6%, with a mean value of 2.58 mg kg-1.
circumstances with laboratory tools (tweezers, The highest Cu-level was experienced at
flasks). Chemical maceration of the samples ’Berlandieri x Riparia Sz 157 Pécs’, while the
was carried out with the use of HNO3 (wet and lowest value was experienced at ’Berlandieri x
closed). Prepared samples were analysed by Riparia T5C Eger’.
Thermo Scientific iCAP 6300 Dual type 3. Results of iron concentration
inductively coupled plasma optical emission Significant differences were experienced in
spectrometry (ICP-OES). case of iron content of the berry skins of
Statistical evaluation of data was done by SPSS ’Cserszegi fƾszeres’ grafted on different
v. 14.0 (IBM Company). Correlation between rootstocks. The relative standard deviation of
parameters and factors was checked by One- iron content measured in berry skin is 33.3%.
Way ANOVA and Tukey-test. Probes were The calculated mean value was 26.8 mg kg-1.
deemed significant below 5% P-value. The highest iron concentration was measured at
Average, deviation and relative standard ’Cserszegi fƾszeres’ grafted on ’Riparia
deviation (RSD%) were also calculated. Sauvage’, while the lowest was measured at
’Berlandieri x Riparia T5C Eger’.
4. Results of manganese concentration
Our inspection aimed to answer, how change Significant differences were experienced in
different rootstocks affect B, Cu, Fe, Mn and case of manganese concentration of the berry
Zn content of berry skin of ‘Cserszegi fƾszeres’. skins in case of the different rootstocks. The
3rd table presents berry skin analytical results of relative standard deviation of different
‘Cserszegi fƾszeres’ grafted on different rootstocks was 35.1%, with a calculated
rootstocks expressed on dry matter basis. 9.54mg kg-1 mean value. The highest
Bolded values represent the highest, bolded and manganese concentration was measured at skin
dented values represent the lowest samples of ’Cserszegi fƾszeres’ standing on
concentration. ’Riparia Sauvage’, the lowest value was
1. Results of boron concentration measured at ’Berlandieri x Riparia Sz 157
Data clearly show, that the lowest difference Pécs’.
was experienced in regard to the different 5. Results of zinc concentration
rootstocks in case of boron. The relative Data show well, that the highest differences
standard deviation between the rootstocks was between rootstocks were experienced at zinc
22.3%, with a mean value of 22.7 mg kg-1. The concentration In respect to this element, the
highest level was experienced at berry skin relative standard deviation was 40.5%, and the
samples at ’Riparia Sauvage’, while the lowest calculated mean value was 4.42 mg kg-1. The
value was experienced at ’Berlandieri x Riparia highest value was measured in case of ’Vitis
S.O.4’. Berlandieri’, the lowest value was experienced
2. Results of copper concentration at ’Berlandieri x Riparia Sz 157 Pécs’.
58
Table 3. Element content of the berry skins of ‘Cserszegi fƾszeres’ grafted on different rootstocks (n=3) (2011, Pallag)
ROOTSTOCKS B (mg kg-1) Cu (mg kg-1) Fe (mg kg-1) Mn (mg kg-1) Zn (mg kg-1)
’AxR 143B M et de G’ 31.9 ±0.4
e
1.93 ±0.03
c
16.8 ±0.2
b
8.07d±0.09 3.66cd±0.14
’V. BERLANDIERI’ 20.2b±0.6 2.64e±0.05 30.7f±0.6 13.1g±0.1 8.53h±0.12
’BxR SZ 157 Pécs’ 18,4 ±0,2
a
4.77 ±0.15
h
23.2 ±0.7
d
3.78a±0.16 2.14a±0.04
’BxR S.O.4’ 18.0a±0.3 3.03f±0.06 21.3c±0.3 5.76b±0.14 3.49c±0.08
’BxR T5C Eger’ 19.0ab±0.6 1.27a±0.05 11.5a±0.1 7.47cd±0.16 2.25a±0.04
’BxR T.G. 5.A.5.’ 22.0c±1.1 2.16cd±0.08 27.5e±1.0 7.69cd±0.49 4.31de±0.29
’BxR T.8.B.’ 26.4d±1.0 3.09f±0.08 30.3f±0.3 12.0f±0.4 4.57f±0.10
’BxR T.K. 5.BB’ 18.1 ±0.1
a
2.59 ±0.05
e
31.8 ±0.3
f
10.2e±0.2 4.99f±0.13
’BxR K.125 AA’ 24.9d±0.1 3.55g±0.08 36.7g±0.3 12.5fg±0.4 4.63ef±0.17
’R. SAUVAGE’ 32.0e±0.2 2.30d±0.02 45.0h±0.9 14.0h±0.1 4.95f±0.08
’R. SELECTA’ 19.4ab±0.3 1.59b±0.02 24.3d±0.6 12.9g±0.5 6.51g±0.22
’R. TOMENTOSA’ 22.7 ±0,3
c
2.07 ±0.06
c
23.0 ±0.5
d
6.92c±0.22 3.01b±0.10
Different letters indicate significant differences between rootstocks regarding the element (P < 5%)
CONCLUSIONS TÁMOP-4.2.2/B-10/1-2010-0024 projects. The

projects were co-financed by the European
In this research work berry skin B-, Cu-, Fe-,
Union and the European Social Fund.
Mn-, and Zn- concentration data have been
processed.
Based on our examination it could be stated,
that there are significant differences in mineral
content of the berry skins of ‘Cserszegi
fƾszeres’ grafted on different rootstocks in
regard to the listed elements. The highest
relative standard deviation was experienced in REFERENCES
the case of zinc, while the lowest relative Angeli L., Horváth J., Hullai L., 1959. Szƅlƅtermesztés,
standard deviation was shown in the case on In: Rajman J. (ed.) Kertészeti Ismeretek.,
boron. Differences between experienced Mezƅgazdasági kiadó, Budapest, p. 322-323.
concentrations can either be due to the genetic Balogh I., 1991. Szƅlƅtermesztési és Borászati
factor, thus to the different rootstocks, or to Enciklopédia, Debreceni Agrártudományi Egyetem,
climatological factors of the vintage, that Debrecen, p. 11.
Balogh I., 1993. Fontosabb szƅlƅfajtáink jellemzése,
greatly affect mineral status of the vine (Szƅke Debreceni Agrártudományi Egyetem, Debrecen, p.
and Kiss, 1987; Csikászné, 2008). For 33.
evaluation of genetic and climatological Bényei F., Lƅrincz A. 1999. Szƅlƅfajtáink, In: Bényei F.,
(vintage) factors data of many years’ Lƅrincz A., Sz. Nagy L. Szƅlƅtermesztés.,
experiment is to be collected. Mezƅgazda kiadó, Budapest, p. 196-199.
Candolfi-Vasconcelos M.C., Castagnoli S., Baham J.
Based on our results, it could supposed, that 1997. Grape Rootstocks and Nutrient Uptake
’Riparia Sauvage’ could be an advantageous Efficiency. Annual Meeting of the Oregon
rootstock, since the highest values on B, Fe and Horticultural Society. http://berrygrape.org/grape-
rootstocks-and-nutrient uptake-efficiency/
Mn were measured in berry skin samples of Csikászné K. A., 2008. A termés mennyiség, a termés
’Cserszegi fƾszeres’ grafted on this rootstock minƅség és a levelek tápelem tartalmának
variety. From the point of the highest Cu összefüggése különféle alanyokra oltott Cabernet
concentration ’Berlandieri x Riparia Szilágyi sauvignon szƅlƅfajtán, Doktori Értekezés, Pannon
157 Pécs’, while in respect to the Zn Egyetem Georgikon Mezƅgazdaságtudományi Kar,
Keszthely, p. 9., p. 18-28.
concentration ’Vitis Berlandieri’ could be
Erdƅss T., 1973. A szƅlƅ és a must kémiai összetétele,
highlighted. In: Kádár Gy. (ed.) Borászat., Mezƅgazdasági kiadó,
Budapest, p. 178-179.
ACKNOWLEDGEMENTS Ferenczi S., 1966. A szƅlƅ, a must és a bor kémiája.
Mezƅgazdasági kiadó, Budapest, p. 32.
The research work was supported by the Galet P., 1998. Grape Varieties and Rootstock Varieties.
TÁMOP 4.2.1./B-09/1/KONV-2010-0007 and Oenoplurimedia, Chaintre, France
59
Hajós Gy., 2008. A bor kémiája, In. Hajós Gy. (ed.) compounds and acidity. Quad. Vitic. Univ. Torino
Élelmiszer-kémia, Akadémia kiadó, Budapest, p. 16, p. 27-32.
498-499. Oláh L., 1979. Szƅlészek Zsebkönyve, Mezƅgazdasági
Hegedüs Á., I’só, A., 1965. Az egri borvidékre kiadó, Budapest, p. 135.
legalkalmasabb alanyfajták. Kísérleti közlemények. Prohászka F., 1982. Szƅlƅ és bor., Mezƅgazdasági
3, p. 61-77. kiadó, Budapest, p. 9-19., p. 115-117.
Kállay M., 1998. Borászati kémia, In: Eperjesi I., Kállay Prohászka F., 2003. Szƅlƅ és bor., Mezƅgazda kiadó,
M., Magyar I. Borászat., Mezƅgazda kiadó, Budapest, p. 9.
Budapest, p. 258. Ruckenbauer W., 1987. Neue Aspekte der Düngung im
Kállay M., 2010. Borászati kémia, Mezƅgazda kiadó, Weinbau unter besonder Berücksichtigung de
Budapest, p. 28-31. Nahrstoffentzuges verschiedener Rebsorten. „A szƅlƅ
Kocsis L., 2010. Szƅlƅalanyok egyes fiziológiai tápanyagellátása” Nemzetközi Tanácskozás. Borsod-
jellemzƅinek és biotikus tényezƅinek értékelése, Heves megyei Szakszolgálati Állomás. Gyöngyös, p.
MTA doktori értekezés, Keszthely, p. 4-8., p. 28., p. 33-47.
94. Striegler R.K., Howell G.S., 1991. The influence of
Kozma P., 1993. A szƅlƅ és termesztése I., Akadémia rootstock on the cold hardiness of Seyval grapevines
kiadó, Budapest, p. 91., p. 164 -176. I. Primary and secondary effects on growth, canopy
Kozma P., 1993b. A szƅlƅ és termesztése II., Akadémia development, yield, fruit quality and cold hardiness.
kiadó, Budapest, p. 45-46. Vitis, 30, p. 1-10.
Lakanen E, Lƅrincz A., Zanathy G. 1999. Szƅlƅfajtáink, Szƅke L., Kiss E., 1987. A fajta, a terhelés és az évjárat
In: Lƅrincz A., Zanathy G. (eds.) Szƅlƅtermesztés., hatása a szƅlƅlevél tápanyagtartalmára. „A szƅlƅ
Budapesti Corvinus Egyetem, Budapest, p. 76-79. tápanyagellátása” Nemzetközi tanácskozás.
Lƅrincz A., Bényei F., 1999. Tápanyagellátás, In: Gyöngyös, 1987. október. 9.
BényeiLƅrincz A., Sz. Nagy L. Szƅlƅtermesztés., Vanekova Z., 1995. A szƅlƅ morfológiája és fejlƅdése,
Mezƅgazda kiadó, Budapest, p. 384-392. In: Szƅke L. (ed.) Szƅlƅfajták, Mezƅgazda kiadó,
Mannini F., Lanati D., Lisa A., 1992. Rootstock effect on Budapest, p. 22-25.
'Grignolino' vine nutrient level and must phenolic Vercesi A., 1987. Gli assorbimenti radicali della
vite:meccanismi e fattori influenti. Vignevini,
Bologna, 4, p. 47-55.
60
THE INFLUENCE OF DEVELOPMENT LEVEL OF VINES

ON THE BIOMETRIC INDICES OF CARDINAL VARIETY
Mariana GODOROJA, Cornelia LUNGU, Gheorghe NICOLAESCU,
Valeria PROCOPENCO
State Agrarian University of Moldova, 44 Mircesti Street, MD-2049,

Chisinau, Republic of Moldova
Abstract
The grape quality is determined by the development of vines. Homogeneity of plant development depends on the quality
of planting material and agrotechnics used. In our study on vineyards, the vines were classified in three groups - the
small, medium and large vines. The vines within each group were studied weak, medium and strong shoots, setting a
specific correlation.
Key words: biometric indices, Cardinal variety, influence.
INTRODUCTION MATERIALS AND METHODS

Viticulture is and will remain one of the basic The vineyards which we studied are located in
branches of economy of the Republic of Copceac village, Stefan Voda district, in a
Moldova. Today the scientists are working to South-East part of Republic of Moldova, in
select the varieties and clones resistant to 2011-2012 years.
various adverse factors, high productivity and The vines of vineyards were classified into
quality. Moldova has favorable conditions for three categories: small grow vigor, medium
growing grapes, but winters in recent years grow vigor and large grow vigor and the shoots
have lower minimum temperatures influencing were classified into the same three categories.
productivity and quality. Therefore, The observations and analyzes were performed
recommended to protect the vines of table according to current guidelines (Mĉnescu,
grapes' varieties and clones with soil even in Creola, Ɣ.a., 1989; Perstniov, N, Ɣ.a., 2000).
the South of Moldova, especially varieties with Results were processed by the method of
early bud break, for example, the table grape correlation and regression analysis:
variety Cardinal. - small grow vigor vines (y1, y2, y3, y4),
The grapes' resistance to frost and winter medium grow vigor vines (y9, y10, y11, y12),
conditions is a multilateral particularities of the large grow vigor vines (y17, y18, y19, y20),
vines, because gradually formed long before general data (y25, y26, y27, y28);
installing the low temperatures. This complex - small grow vigor shoots (y1, y9, y17, y25),
of characteristics and agronomic measures are medium grow vigor shoots (y2, y10, y18, y26),
determining the longevity of vineyard large grow vigor shoots (y3, y11, y19, y27),
plantation and the development level of vines. general data (y4, y12, y19, y28).
The vines of the Cardinal variety are
characterized with average growth vigor. Level RESULTS AND DISCUSSIONS
vine growth is determined mostly by the
Cardinal-is an early table grape variety. The
homogeneity and quality planting material.
grapes are large, cylindrical-conical shape. The
The vigor of varieties is given with in a length
berry density is different. The berries are very
and diameter of the shoots. In the experience,
large, spherical or oval, red-violet, covered
we studied both data diameter as well as length.
with obscure bloom. The peel is thick, but
edible. The berries begin to ripening in late I-II
decade of august. Productivity is high. The
grapes have a high transportability.
61
Figure 1. The diameter of internodes of shoots with small grow vigour
(a-small vigour shoots, b-medium vigour shoots, c-large vigour shoots)
Figure 2. The diameter of internodes of shoots with medium grow vigour

Figure 3. The diameter of internodes of shoots with large grow vigour

The data from figure 1 showed that the diame- The data from figure 4 showed that the length
ters of internodes of small grow vigor was of internodes of small grow vigor was between
between 0,35 to 0,65 cm for small shoots, from 1,60 (1st internodes) to 4,10 cm (8th internodes)
0,40 to 0,94 cm for medium shoots and from for small shoots, from 3,85 (1st internodes) to
0,79 to 1,05 cm. 7,25 cm (4th internodes) for medium shoots and
The data from figure 2 showed that the diame- from 2,63 (1st internodes) to 7,90 cm (5th inter-
ters of internodes of medium grow vigour was nodes).
between 0,46 to 0,83 cm for small shoots, from The data from figure 5 showed that the length
0,74 to 0,89 cm for medium shoots and from of internodes of medium grow vigor was bet-
1,09 to 1,22 cm. ween 2,30 (1st internodes) to 7,27 cm (5th inter-
The data from figure 3 showed that the diame- nodes) for small shoots, from 3,13 (1st inter-
ters of internodes of large grow vigor was nodes) to 9,80 cm (8th internodes) for medium
between 0,51 to 0,85 cm for small shoots, from shoots and from 3,84 (1st internodes) to 11,74
0,59 to 0,78 cm for medium shoots and from cm (5th internodes).
0,94 to 1,20cm.
62
Figure 4. The length of internodes of shoots with small grow vigour (a-small vigour shoots, b-medium vigour shoots, c-
large vigour shoots)
Figure 5. The length of internodes of shoots with medium grow vigour (a-small vigour shoots, b-medium vigour shoots,
c-large vigour shoots)
Figure 6. The length of internodes of shoots with large grow vigour (a-small vigour shoots, b-medium vigour shoots, c-
large vigour shoots)
The data from figure 6 showed that the length dyx=0,0784 (figure 7b). For large vines we
of internodes of large grow vigor was between obtained the next equation of regression
6,53 (1st internodes) to 10,50 cm (8th inter- y20=0,09795+1,1592x, correlation coefficient
nodes) for small shoots, from 4,10 (1st inter- r=-0,08, coefficient of determination
nodes) to 12,40 cm (9th internodes) for medium dyx=0,0064 (figure 7c). For all vines (the ge-
shoots and from 3,64 (1st internodes) to 14,00 neral data), we obtained the next equation of
cm (7th internodes). regression y28=0,05181+0,9067x, correlation
The data from figure 7 showed the correlation coefficient r=0,21, coefficient of determination
between the length and diameters of internodes dyx=0,0441 (figure 7d).
for each group of shoots and grow vigor of The general data of all vines for small vigor
vines. For small vines we obtained the next shoots showed the next equation of regression
equation of regression y4=0,02761+0,7134x, y25=0,05324+0,9454x, correlation coefficient
correlation coefficient r=0,46, coefficient of r=-0,07, coefficient of determination
determination dyx=0,2116 (figure 7a). For dyx=0,0049 (figure 7d). For medium vigor
medium vines we obtained the next equation of shoots showed the next equation of regression
regression y12=0,03575+0,8317x, correlation y26=0,04636+1,0117x, correlation coefficient
coefficient r=0,28, coefficient of determination r=-0,32, coefficient of determination
63
dyx=0,1024 (figure 7d). For high vigor shoots r=-0,37, coefficient of determination
showed the next equation of regression dyx=0,1369 (figure 7d).
y27=0,02148+0,8435x, correlation coefficient
Figure 7. Results of correlation and regression analysis between length and diameters of internodes of shoots
The correlation between the length and Mĉnescu Creola et all, 1989. Controlul biologic al
diameters of internodes for small, medium and producԑiei în Pomiculturĉ Ɣi Viticulturĉ. BucureƔti.
large grow vigor of vines showed the Mokrâk G.P., Perstnev N.D., Gaina B.S., 2006. Obno-
vlenie i uluēšenie stolovogo sortimenta vinograda
insignificant weak correlation between these rannih sortov sozrevaniâ v Moldove. In: Uvologie Ɣi
indicators. This is due to the biology of variety, oenologie. ChiƔinĉu, 15-76.
quality of planting material and climatic Nicolaescu G., Apruda P., TereƔcenco A., Perstniov N.,
conditions. 2008. Ghid pentru producĉtorii de struguri pentru
masĉ (ediԑia a II). ChiƔinĉu: Iunie-Prim.
Perstniov N. et al., 2000. Viticulturĉ. ChiƔinĉu.
http://vinograd.info/sorta/stolovye/kardinal.html
64
RESEARCH REGARDING THE INFLUENCE OF THE HYBRID
AND THE NUMBER OF STEMS
ON THE FIELD PRODUCTION OF TOMATO PLANTS
Gheorghi‫܊‬a HOZA

59 Marasti Bld., District 1, 011464, Bucharest, Romania
Abstract
The tomato crop started near Bucharest city, in a favourable area for vegetable growing, using 3 tomato crossbreeds,
pruned with one and two stems in order to study their behaviour from the vegetative and fruit forming point of view.
The biological material used for this particular experiment was 3 indeterminate, disease-resistant tomato hybrids, with
fruits of roughly 150g, round and regular. The plants were pruned with two stems, the first one being the main and the
second being formed from the first shoot located at the base of the plant. The crop was propped on trellis, with 5
clusters and mulched with agro textile material; the planting scheme was 100cm/40cm for variants pruned with two
stems and 80cm/40 for variants pruned with one stem. The results showed that all studied hybrids had a satisfactory
vegetative growth, proved by the height of the plants and their leaves, for both the main and the second stem. In what
regards the formation of fruits, the plants with two stems provided a larger quantity. Thus, the number of fruits per
plant was almost double for variants with two stems, the average fruit weight registered similar values for both
treatments, but a considerably higher fruits yield was noted for Veneԕia F1and Rhuen F1 hybrids.
Key words: tomato, hybrids, two stems, yield.
INTRODUCTION higher marketable and total yield; the 3

plants/m2 density issued in a considerably
Tomato cropping is possible in various systems
higher marketable crop in comparison with the
due to the satisfactory results obtained when
2,5 or 2 plants/m2 density and the results pro-
technological optimization is used. Tomato
ved that the tomato yield and the fruit quality
pruning with multiple stems is one of these
can be influenced by the number of stems and
improvements, which leads to cost reduction
the plant density, while fruit pruning proved
for the planting material, hence 20% less plants
little effect on the aforementioned features
per hectare in comparison with one stem crops
(Maboko et al., 2011). Moreover, pruning
(Hoza, 2011). This pruning system is widely
tomato plants with 2 stems proves to have a
used in a protected environment, in extended
significant positive influence on the crop
cycle as far as our country is concerned, but it
quality and plant health (Kanyomeka and
can also be practiced in farm field. Usually,
Shivute, 2005).
tomato plants are pruned with one stem,
however they can also be pruned with 2-3
stems for commercial crops and 4 stems for
decorative purposes, in which case plants are The research was conducted near Bucharest
propped variously. Research regarding the city, in very favourable climatic conditions for
tomato plants cropped at varied densities, tomato crops. The experiment was outlined in
namely 60cm/40cm and 60cm/50cm two straps, with two exponents (Table 1):
respectively, pruned with 1,2 or 3 stems proved -Exponent A, represented by hybrids, with 3
that a higher distance between plants on the graduations
row combined with 2 stems pruning, conducted -Exponent B, represented by the number of
to the highest total and marketable yield (Ara et stems, with 2 graduations
all., 2007). Other experiments show that plants The planting was made in simple rows at
pruned with 2 stems and 6 fruits per cluster or 2 80cm/40cm for variants pruned with one stem
stems and no fruit pruning gave a significantly and a leading density of 3.1 pl/m2 and
65
100cm/40cm for variants pruned with two two stems, the second stem was formed from
stems and a leading density of 2,5 pl/m2, with the first shoot located at the base of the plant
transplanted seedling. The crop was subjected which was V propped on band. During the
to specific maintenance work, the field was vegetation period, data was collected regarding
mulched with agrotextile material, with 5 the growth of the plants, flower formation, fruit
clusters and plants were propped by metallic binding, resulted yield and fruit size.
trellis on1,8 m height. At variants pruned with
Table 1. The scheme of the experiment

A Exponent B Exponent
Veneԑia F1 V 1 (Mt) - Veneԑia F1, one stem V 2 – Veneԑia F1, two stems
Fournaise F1 V3 – Rhuen F1, one stem V4 – Rhuen F1, two stems
Ruen F1 V 5 – Fournaise F1, one stem V 6 – Fournaise, F1 two stems
RESULTS AND DISCUSSIONS growth point of view, there were no significant

differences between the variant pruned with
Tomato pruning with two stems represents an
one stem and the other pruned with two stems,
alternative for growers in what regards the
as long as the appropriate and regular agro-
reduction of plants on the cropping field
technological procedures were conducted
without the fruits yield being affected. From
equally (Table 2 and 3).
research it is clear that from the vegetative
Table 2. The height of the main stem

V1 (Mt) Veneԑia F1 V2 Veneԑia F1 V3 Rhuen F1 V4 Rhuen F1 V5 Fournaise F1, V6 Fournaise F1
Variant
one stem two stems one stem two stems one stem two stems
H (cm) 102.5 100.3 95.7 82.8 101.6 81.3
Table 3. The height of the shoot stem

V2 V4 V6
Variant
Veneԑia F1 two stems Rhuen F1 two stems Fournaise F1 two stems
H (cm) 99.0 93.1 87.7
In what regards the distance between clusters, it The Veneԑia F1 hybrid registered the highest
was observed that differences of some regularity, the differences noted being under
centimeters between the variant pruned with 1,5 cm (Table 4 and 5).
one stems and the ones pruned with two stems
did not affect the fructification process.
Table 4. The synthesis of results regarding the average distance between clusters on main
Average distance between clusters
Variant
1-2 2-3 3-4 4-5
V1 (Mt) – Veneԑia F1 one stem 13.5 13.9 15.2 15.5
V2 – Veneԑia F2 two stems 14.1 13.3 15.1 13.9
V3 - Rhuen F1 one stem 7.4 9.4 10.4 10.1
V4 – Rhuen F1 two stems 11.1 13.6 15.1 17.4
V5 – Fournaise F1 one stem 12.8 12.5 16.6 15.4
V6 – Fournaise F1 two stems 8.4 11.0 14.2 8.6
Table 5. The synthesis of results regarding the average distance on the second stem
Average distance between clusters
Variant
1-2 2-3 3-4 4-5
V2 – Veneԑia F1 two stems 14.4 13.5 14.8 13.8
V4 – Rhuen F1 two stems 11.7 14.0 14.7 16.9
V6 – Fournaise F1 two stems 9.6 11.4 12.6 9.4
66
The process of fruit forming was developed in total number of fruits on the main stem was
optimal conditions, for both one stem and two contiguous for studied hybrids, but Veneԑia F1
stems plants. Thus, it was noted that Veneԑia and Rhuen F1 produced 2-3 more fruits when
F1 hybrid fructified on clusters similarly for they were pruned with two stems (Table 6).
both cases. However, on the second stem, on The second stem showed a high regularity of
clusters 1 and 2, the number of fruits was fruits formation on each cluster and the total
slightly higher probably due to the optimization number of fruits was conformable with the one
of environmental conditions. For other hybrids, on the main stem (Table 7).
the differences observed were smaller. The
Table 6. The synthesis of results regarding the average number of fruits formed on the main stem
Average number of fruits formed on cluster
Variant Total number of fruits
1 2 3 4 5
V1 (Mt) – Veneԑia F1 one stem 3.3 3.4 4.8 5.2 5.2 21.9
V2 - Veneԑia F1 two stems 5.3 5.4 4.8 4.8 4.9 25.2
V3 - Rhuen F1 one stem 4.2 3.6 4.9 4.6 4.5 21.8
V4 – Rhuen F1 two stems 4.2 3.7 4.7 5.3 5.6 23.5
V5 – Fournaise F1 one stem 4.7 4.4 4.7 5.1 5.1 24.0
V6 – Fournaise F1 two stems 4.5 5.0 4.1 5.2 5.0 23.8
Table 7. The synthesis of results regarding the average number of fruits formed on the second stem
Average number of fruits formed on cluster
1 2 3 4 5
V2 – Veneԑia F1 two stems 4.9 4.8 4.6 4.4 3.9 22.6
V4 – Rhuen F1 two stems 3.9 3.6 4.1 4.9 4.7 21.2
V6 – Fournaise F1 two stems 4.3 4.7 3.8 4.7 4.3 21.8
Integrating the number of fruits formed on than the main stem, but overall, the total
stems, it was ascertained that the second stem number of fruits obtained was almost double
produced lower figures, namely 2-3 less fruit for variants pruned with two stems.
Table 8. The synthesis of results regarding the average number of fruits formed on plant
Average number of fruits
Main stem Second stem
V1 (Mt) – Veneԑia F1 one stem 21.9 - 21.9
V2 – Veneԑia F1 two stems 25.2 22.6 47.8
V3 – Rhuen F1 one stem 21.8 - 21,.8
V4 – Rhuen F1 two stems 23.5 21.2 44.7
V5 – Fournaise F1 one stem 24.0 - 24.0
V6 - Fournaise F1 two stems 23.8 21.8 45.6
The number of fruits was compassed between Pruning plants with two stems brings a roughly
21,8 and 25,2 on main stem and 21,2 and 22,6 yield doubling on plant level (Table 10). This
on shoot stem. proves to be a great advantage because
In what regards the average weight of fruits, considering other features studied, such as the
there were no significant differences between number of fruits and their size, it is very
fruits obtained on the main stem and the ones contiguous for both stems. The highest tomato
from the second stem. However, it was yield was obtained on Veneԑia F1 hybrid
observed that fruits formed on the shoot stem pruned with two stems, 5,2 kg/pl, followed by
were slightly smaller than the ones from the Fournaise F1 with 4,9 kg/pl and Rhuen F1 with
main stem (Table 9). 4,7 kg/pl.
67
Table 9. The synthesis of results regarding the average weight of fruits
Average weight of fruits on Average weight of fruits on Average weight of fruits
Variant
main stem (g) second stem (g) on plant (g)
V1 (Mt) – Veneԑia F1 one stem 113.9 - 113.9
V2 –Veneԑia F1 two stems 109.1 108.4 108.8
V3 – Rhuen F1 one stem 120.5 - 120.5
V4 - Rhuen F1 two stems 106.2 103.9 105.0
V5 – Fournaise F1 one stem 112.4 - 112.4
V6 -Fournaise F1 two stems 107.7 105.3 106.5
Statistically analysing the fruit quantity on provided a higher yield per plant and per
plants pruned with one and two stems, it was farming area (Table 10).
ascertained that those pruned with two stems
Table 10. Statistic interpretation of results regarding the influence of the number of stems on tomato yield
Yield
Variant
kg/pl % Gap Meaning kg/m² % Gap Meaning
V1 (Mt) – Veneԑia F1 one stem 2.5 100 - Mt 7.8 100 - Mt
V2 –Veneԑia F1 two stems 5.2 208 2.7 xxx 13.0 166.6 5.2 xxx
V3 – Rhuen F1 one stem 2.6 104 - NS 8.0 102.6 - NS
V4 – Rhuen F1 two stems 4.7 188 2.1 xxx 11.8 151.3 3.8 xxx
V5 – Fournaise F1 one stem 2.7 108 - NS 8.3 106.4 - NS
V6 - Fournaise two stems 4.9 196 2.2 xxx 12.2 156.4 3.9 xxx
DL 5% = 0,3 kg/pl; DL 1% = 0,44 kg/pl; DL 0,1% = 0,63 kg/pl
DL 5% = 1,18 kg/sqm; DL 1% = 1,69 kg/sqm; DL 0,1% =2,44 kg/sqm
CONCLUSIONS Plants proved a highly satisfactory vegetative

growth, which lead to a similar fruit binding.
The research conducted on tomato plants
pruned with one and two stems can be followed
REFERENCES
by the next conclusions:
Ara N., Bashar M.K., Begum S, Kakon S.S. 2007. Effect
The number of seedlings used to start the crop of spacing and stem pruning on the growth and yield
was reduced with 20% by increasing the of tomato. Int. J. Sustain. Crop Prod. 2(3), p. 35-39
distance between rows up to 100 cm; Hoza Gheorghiԑa, Chiorean btefania, DrĉguƔin M.D.,
The quantity of fruits per plant significantly 2011. Research regarding management systems for
plants with two stems, cultivated in solar, Lucrĉri
grew on variants pruned with two stems, F1 Ɣtiinԑifice, Seria Horticulturĉ, vol 54, nr. 2, Ed. Ion
Veneԑia F1 hybrid even reaching roughly twice Ionescu de la Brad, IaƔi, ISSN 2069-847X, p.157-
as many fruits for that particular treatment; 160.
The yield per farming area increased due to Kanyomeka L., Shivute B., 2005. Influence of pruning
on tomato production under controlled environments,
higher yield per plant, even though the number Agricultura tropica et subtropica vol. 38(2), pp.79-83.
of plants was reduced by 20%; Maboko M.M., Du Plooy C.P., Chiloane S., 2011. Effect
The size of the obtained fruits was appropriate of plant population, fruit and stem pruning on yield
and quality of hydroponically grown tomato African
for the hybrids used; Journal of Agricultural Research Vol. 6(22), 12
The number of fruits and their size was slightly October, ISSN 1991-637X, Academic Journals, p.
smaller on the second stem for all studied 5144-5148.
hybrids;
68
TYPE OF TRELLISING AND FOLIAR FERTILIZATION INFLUENCE
ON YIELD AND QUALITY FOR NEW VARIETIES OF GHERKINS
(CUCUMIS SATIVUS L.) WITH PARTHENOCARPIC FRUITING
Florin Constantin IACOB, Gheorghe CÂMPEANU, Nicolae ATANASIU, Elena CATANĂ,


59 Mără‫܈‬ti Blvd., 011464, Bucharest, Romania
Abstract
This study was conducted during 2009-2010 in southern Dâmbovita County, in order to determine the impact of foliar
fertilization on the production and its quality on five hybrids of cucumber gherkins: Promisa, Trilogy, Karaoke, Kybria
and Componist and were obtained results with significant differences. Hybrids were planted in the same soil type and
bearing the same climatic conditions, differences occurred in the production were attributed to variants
studied. Immediately after establishment of experimental culture, fertilization were made every 10 days with
application of bio-fertilizer as appropriate technological practices, also were performed observations and
measurements on the production and quality of the varieties analyzed.
Key words: Cucumis sativus L., fertilization, production, quality, gherkins.
INTRODUCTION the plant with foliar fertilization regime, the

approach together of the two elements of
In traditional agriculture losses of elements
technology in a area where protected vegetable
used in fertilization are important, especially in
crops have a low share will lay the foundation
the N: P: K case, representing an important
for future investment in the area (Petrescu,
economic problem (Guerrero, 1998). Fractiona-
1992; Popescu V and Atanasiu N., 2001)
tion of fertilization and application in critical
Following research it was observed that the
phases is recommended by most researchers
driving of the plant and foliar fertilization led
(Cadahia, 2000; Guzmán, 2004; Pizarro, 1987).
to positive results on the production and quality
Foliar fertilization creates a positive impact on
of gherkins cucumbers, results that support the
production in most varieties and hybrids
necessity of introducing in the technology of
(Solorzano, 2001).
gherkins culture new elements that will come
Researches regarding the technology of cultiva-
as a completion of higher genetic potential of
tion gherkins cucumbers were conducted du-
new hybrids being subject of this study. The
ring 2009-2011 in the Tartasesti, Dâmbovita
main purpose of this research represents the
County, in the family-owned farm. Taking into
introduction of new elements of technology in
account the pedoclimatic conditions of the
parallel with the discovery of better hybrids
south area of the country and climate condi-
adapted to the climatic conditions of the area.
tions, the applied technology present a special
Therefore, research will highlight the following
importance for obtaining high productions and
aspect:
high quality. Foliar fertilization represents a
- obtaining high yields as a result of foliar
rare piece of technology applied in the Lun-
fertilization and of the plant leading type on
guletu-Brezoaele vegetable basin area (which
trellises;
includes Tartasesti), solar crops of vegetables
- correlation between growing phased and
being established in small areas, the most im-
total production under the influence of
portant are field crops of vegetable, maintained
technology elements;
on the traditional principles of agriculture.
- productivity of analyzed hybrids.
Have been attempted combining two elements
of technology, leading and trellising mode of
69
MATERIALS AND METHODS which has not have retained fruit having a
obvious influence.
For biological material selection were taken
into account first of all the necessity of using
high temperature resistant varieties (the South
area of the country and growing in protected
areas) and very productive. For this were
identified five RZhybrids (Kybria, Karaoke,
Compomist, Trilogy si Promisa). The
experience was polyfactorial one where
experimental factors have been the following:
- Factor A – Hybrid:
A1 – Kybria;
A2 – Karaoke;
A3 – Compomist;
A4 – Trilogy;
A2 –Promisa.
- Factor B – Leading mode:
B1 – The plants were led up to a maximum
height of 2.5 m. The first 30 cm were
maintained without fruit, next 50 cm one fruit
on each side sprig preserving all the fruits of
main stalk nodes, and from ˜ 80 cm has not
been intervened on the fructification.
B2 – The first 50 cm were maintained without Figure 1. Trellising schemes used in research
fruit, then for the next 50 cm were kept one
fruit on side sprig and all the fruit on the main Foliar nutrient solutions applied at the same
stem and from 100 cm height were kept stage of development of the plant, regardless of
absolutely all the fruit, as illustrated. hybrid, had a positive influence on the
- Factor C – Foliar fertilization: vegetative growth for variant B2 (50/100/250),
C1 – CROPMAX: biological product according plants having a strictly vegetative growth
E.U. period until they reached the 50 cm height
C2 – BIONAT PLUS: product approved by (compared with plants where it was applied
permit no. 391/16.03.2007. variant B1-30/80/250).
C2 – BIOLEAFZ: is a liquid plants stimulant. In 2009, concerning increase in height of
plants, it was found that the variant B2-
RESULTS AND DISCUSSIONS 50/100/250 had higher results compared to B1-
30/80/250.
During 2009-2011 the results of plants growth In 2010, the trends were similar, hybrid
concerning the stem growing height, number of reaching 234 cm led by the same scheme and
sprigs of orders I and II, number of leafs, foliar fertilized with the same solution.
number of female flowers and number of Maximum height reached in 2010 is detained
related fruits appeared, showed some also by Compomist hybrid, but led to the
differences, thus demonstrating the influence of scheme B1-30/80/250 and foliar fertilized with
experimental factors on production and its CROPMAX.
quality.
As a result, at some variants the hight of plants
was different and the number of fruits was
influenced by the leading mode of the stem and CONCLUSIONS
applied foliar fertilizer. The differences were
more pronounced at the beginning of Plants grown after B1-30/80/250 leading mode
vegetation, first floor of 30 cm and 50 cm high showed less vegetative growth than plants
grown after B2-50/100/250 leading mode.
70
Compomist F1 hybrid reaches value of 239 cm Guerrero R., Fertilizarea culturilor din clima rece,
in height in 2009, led by B2-50/100/250 scheme Volumul 3, Editura Monómero Colombo Venezo-
lano, Colombia, 1998
and fertilized with BIONAT. In 2010 the Guzmán M., Fertilizare, populatie, apa, sol si fertilizanti,
results were similar. Editura Almería, España, 2004
Promisa F1 with the scheme B1-30/80/250 Petrescu C., Legumicultura, Ed. Didactica si Pedagogica,
determined a total of 41 fruits representing the Bucuresti, 1992
Pizarro F., Riego Localizado de Alta Frecuencia,
maximum number and Trilogy F1 determined Mundiprensa, Madrid, España, 1987
19 number of fruits with the scheme B2- Popescu V., Atanasiu N., Legumicultura, Volumul 2, Ed.
50/100/250 in the year 2009. Ceres, Bucuresti, 2001
Solorzano P., Manual pentru fertilizarea culturilor in
REFERENCES Venezuela, Editura Agroisleña, Venezuela, 2001
Cadahia C., Fertirigarea culturilor horticole si orna-

mentale, Editura Mundiprensa, Venezuela, 2000
Table 1. Records of growing and developping of plants, Tartasesti, 2009

VARIANT Plant No. of tillers
No. of No. of No. of related
No. height Tipe. Tipe.
HYBRID LEADING FERTILIZATION leafs flowers fruits
(cm) I II
A1 - Kybria
1
A2 - Karaoke 228 17 24 64 31 25
2
A3 - B1 215 12 19 69 29 27
3
Compomist (30/80/250) 232 14 20 65 38 31
4
A4 - Trilogy 226 12 23 72 42 37
5
A5 - Promisa C1 224 11 29 73 46 40
A1 - Kybria CROPMAX 230 10 17 68 32 28
6
A2 - Karaoke 238 9 19 70 34 25
7
A3 - B2 232 12 22 61 31 24
8
Compomist (50/100/250) 225 10 14 74 42 38
9
A4 - Trilogy 229 8 19 77 40 34
10
A5 - Promisa
A1 - Kybria
11
A2 - Karaoke 228 12 22 61 39 32
12
A3 - B1 236 9 17 67 35 29
13
Compomist (30/80/250) 210 13 21 64 38 35
14
A4 - Trilogy 224 15 23 76 39 30
15
A5 - Promisa C2 257 12 19 68 38 36
A1 - Kybria BIONAT 224 9 24 69 33 27
16
A2 - Karaoke 236 11 19 66 31 29
17
A3 - B2 239 7 23 63 29 25
18
Compomist (50/100/250) 218 12 20 69 40 29
19
A4 - Trilogy 224 10 19 67 43 35
20
A5 - Promisa
A1 - Kybria
21
A2 - Karaoke 208 14 28 62 42 40
22
A3 - B1 222 10 30 69 29 24
23
Compomist (30/80/250) 235 16 25 70 36 32
24
A4 - Trilogy 238 12 20 74 31 29
25
A5 - Promisa C3 227 11 26 69 44 41
A1 - Kybria BIOLEAFZ 216 12 18 64 41 38
26
A2 - Karaoke 221 8 14 72 34 29
27
A3 - B2 219 11 21 71 28 21
28
Compomist (50/100/250) 233 11 22 68 36 19
29
A4 - Trilogy 230 9 19 66 33 28
30
A5 - Promisa
71
Table 2. Records of growing and developping of plants, Tartasesti, 2010.
VARIANT Plant No. of tillers
No. of No. of No. of related
Nr. height Tipe. Tipe.
HYBRID LEADING FERTILIZATION leafs flowers fruits
(cm) I II
A1 - Kybria
1
A2 - Karaoke 223 10 21 61 29 26
2
A3 - B1 219 13 22 64 30 26
3
Compomist (30/80/250) 238 15 18 67 36 28
4
A4 - Trilogy 237 12 21 74 46 41
5
A5 - Promisa C1 225 16 27 70 43 39
A1 - Kybria CROPMAX 236 11 19 66 34 27
6
A2 - Karaoke 223 9 18 68 33 28
7
A3 - B2 211 11 24 64 29 26
8
Compomist (50/100/250) 235 12 17 77 47 39
9
A4 - Trilogy 228 10 21 79 44 33
10
A5 - Promisa
A1 - Kybria
11
A2 - Karaoke 229 11 24 60 38 31
12
A3 - B1 234 16 21 66 36 32
13
Compomist (30/80/250) 218 12 17 67 33 25
14
A4 - Trilogy 220 10 22 72 40 38
15
A5 - Promisa C2 217 11 24 69 39 36
A1 - Kybria BIONAT 226 10 22 65 28 26
16
A2 - Karaoke 232 10 21 64 35 31
17
A3 - B2 234 8 24 60 31 24
18
Compomist (50/100/250) 221 11 18 58 41 30
19
A4 - Trilogy 209 9 21 65 38 33
20
A5 - Promisa
A1 - Kybria
21
A2 - Karaoke 223 12 31 68 40 27
22
A3 - B1 225 11 27 71 31 25
23
Compomist (30/80/250) 231 15 24 66 35 31
24
A4 - Trilogy 214 11 22 72 32 28
25
A5 - Promisa C3 229 16 25 68 42 36
A1 - Kybria BIOLEAFZ 227 9 20 62 40 33
26
A2 - Karaoke 224 12 17 63 32 32
27
A3 - B2 233 10 19 73 26 25
28
Compomist (50/100/250) 230 13 23 71 38 24
29
A4 - Trilogy 229 8 17 70 39 32
30
A5 - Promisa
72
EFFECT OF FOLIAR FERTILIZATION ON THE CHEMICAL

COMPOSITION OF FIVE GHERKINS FRUIT HYBRIDS
(CUCUMIS SATIVUS L.) GYNOECIOUS TYPE
AND PARTHENOCARPIC FRUCTIFICATION
Florin Constantin IACOB, Gheorghe CÂMPEANU, Nicolae ATANASIU, Elena CATANĂ,


59 Marasti Blvd., Bucharest, Romania
Abstract
Large number of gherkins type cucumbers varieties and hybrids emerging as a result of increasing demands from
pretentious consumers related to quality aspects such as shape, color, firmness, appearance and capacity of storage,
have led in time to change culture technology, foliar fertilization having a key role to achieve these goals, without
knowing in detail the long-term influence on the chemical composition of the fruits used or human consumption.
Therefore, this study comes to support clarification of these issues. As a result of data obtained concerning chemical
composition of the fruits of five cucumber gherkins hybrids: Promisa, Trilogy, Karaoke, Kybria and Componist and
interpreted in the USAMVB it was concluded that it differs depending on fruit size and age at which they were collected.
Soil pH, fertilizer pH which is applied to leaf and the degree of hydration of the fruits has a direct influence on the
chemical composition.
Key words: Cucumis sativus L., fertilization, fruits, number, quantity.
INTRODUCTION route from the moment of foliar fertilization

through fruit until using them in close
Chemical composition represents an important
correlation with their quantities in the soil.
factor with direct influence on fruits quality of
According to studies on the pollution of
gherkins cucumber. Information concerning the
horticultural products where there is a balanced
amount of different chemicals can be obtained
diet, approximately 75-80% of nitrate derived
from the analysis of dry matter and organic
from vegetables, nearly 15-20% from water and
acid titration. Concentrations of these organic
somewhere in the 5-7% from meat and milk.
compounds in fruits are different depending on
Their accumulation in different organs of the
the cultivar and strongly influenced by their
plant depends on the speciesWith 1349 samples
land reserve, which can be found in the form of
to Cucumis sativus L. and its varieties origi-
ions, being picked up by plants (Rivis, 2004).
nating in China, India and Turkey, The U.S.
In order to obtain conclusive results is very
National Plant germplasm is the largest in the
important to know the exact amounts of
world.
substances (N-NH4, N-NO3, P, K) in the soil
and their concentrations in the solutions used to
foliar fertilization.
In one plant exist at one point all common To accomplish this work were studied five
fructification elements: flowers, small, medium different variants (for five hybrids Promisa,
and large fruit, located to a distance less or Trilogy, Karaoke, Kybria and Componist) on
greater than the radicular system having a which foliar fertilization was performed with
significant influence on the chemical compo- Cropmax product. The pH of the culture
sition of gherkins cucumber fruits. Results substrate (soil in which was embedded well
follow in the first place nitrates and nitrites fermented manure) was 7.4 for Trilogy and
73
Componist variants, 7.5 for Kybria variant and
7.6 for Karaoke and Promisa variants.
Experimental field was conducted in a large
solar farm, the culture being founded in the
summer of 2010 from seedlings personally
obtained. After soil analysis were obtained
results which gives to the soil good fertility, N-
NH4 content range between 18,25-51,30 ppm,
N-NO3-136,7-356,2 ppm, P-28,4-42,1 and K-
178,2-223,5 ppm.
During the experiment of the summer of 2010
soil samples were taken for each variant and
fruit samples for each category according to
size (3-6 cm, 6-9 cm, 9-12 cm). Figure 1. Experimental results representation concerning
nitrogen content of gherkins fruit.
After analyzing the results we can distinguish
This study followed the route up to the fruits as follows: for hybrid Promised starting from a
level of nitrogen compounds based on concentration of 226.85 ppm nitrogen in the
monofactorial research conducted. Samples soil can be seen a sharp increase in its
collected were analyzed in the Laboratory of concentration to small fruit stage 3-6 cm with a
Biotechnologies of USAMVB and after obtai- value of 456.00 ppm, then decreased to a level
ning the results we could notice that in most of 105 ppm for large fruit stage 9-12 cm. This
cases they did not exceed permissible levels of threshold which has exceeded the permissible
quality standards. limit by 56 ppm not constituted a risk to human
health; the fruits of this size are only collected
Table 1. Experimental results concerning nitrogen
content of gherkins fruit.
for laboratory analysis. According to analyzes
of fruits, in the case of Phosphorus the values
N fruits N fruits N fruits ranged from 179.92 to 193.76 ppm for different
N soil,
Cultivar (3-6 cm), (6-9 cm), (9-12 cm),
ppm
ppm ppm ppm
fruit sizes of Componist hybrid, observing a
Trilogy F1 161.45 144.4 152 120 slight decrease in concentration as the fruit
Karaoke F1 266.60 285 76 95 increases in size.
Promisa F1 226.85 456 114 105
Componist Table 2. Experimental results concerning phosphorus
281.09 114 323 95
F1 content of gherkins fruit.
Kybria F1 386.78 76 95 114
P soil, P fruits (3-6 P fruits (6-9 P fruits (9-
Cultivar
ppm cm), ppm cm), ppm 12 cm), ppm
Nitrogen content ranged between ranged from
Trilogy F1 28.4 373.68 553.6 420.1
76.00 to 323.00 ppm values in fruits and only Karaoke F1 32.5 664.32 664.32 512.08
in one case it exceeded the permissible limit of Promisa F1 34.1 809.64 588.2 511.3
400.00 ppm (Promisa hybrid sample of small Componist
fruit 3-6 cm, where the value of was 456 ppm). 42.1 193.76 186.84 179.92
F1
By considering the following aspects: Kybria F1 40.2 276.52 560.52 449.8
vegetation period was equal for all studied
hybrids, irrigation was performed using a
uniform system of drip irrigation and foliar
fertilization was achieved with the same
product, we believe that small differences
between the results obtained cannot be made
only on account of hybrid, is being in close
correlation with fruit size. Maximum permitted
limit for nitrogen and its compounds in fruits
gherkins is 400 ppm.
74
Figure 2. Experimental results representation concerning
phosphorus content of gherkins fruit Figure 3. Experimental results regarding concerning
potassium content of gherkins fruits.
Table 3. Experimental results concerning potassium
content of gherkins fruits. CONCLUSIONS
K fruits (9- In most cases N content was within normal
K soil, K fruits (3- K fruits (6-
Cultivar 12 cm), limits. In the case of Promisa hybrid version
ppm 6 cm), ppm 9 cm), ppm
ppm
Trilogy F1 185.2 2840 2620 2560 (fruit 3-6 cm) was found a high value of N
Karaoke F1 223.5 3080 2740 2570 concentration that exceeding by 56 ppm the
Promisa F1 215.8 2840 2620 2490 normal concentration. Growing season,
Componist
178.2 2840 2980 2540
irrigation and the product used for foliar
F1 fertilization had no influence on the N amount
Kybria F1 180.2 3340 2620 2700 in the fruits level, variations are due to the
studied hybrid and are based on its ability to
For Karaoke and Promisa hybrids can be synthesize nitrogen compounds. Phosphorus
observed sudden decline of P values from concentration varies depending on the size of
664.32 and 809.64 ppm for 3-6 cm fruits to P the fruit and the hybrid used. Potassium
values of 512.08 or 511.3 ppm for 9-12 cm analysis showed significant differences.
fruits. Trilogy and Kybria presents one
maximum concentration peak for 6-9 cm fruits, REFERENCES
with values of 553.60 ppm and 560.52 ppm
respectively, after which it decreased to 420.1 Alexa E., Contaminanti în produsele horticole si
cerealiere, Ed. Solness, Timisoara, 2008
and 449.80 ppm for 9-12 cm fruits. Radulescu H., Goian M., Tehnica experimentala, Ed.
For potassium, as can be seen from the figure 3, Mirton, Timisoara, 1999
the differences are not significant, the Rivis A., Contaminanti agroalimentari, Ed. Eurostampa,
concentrations of all the studied variants being Timisoara, 2004
in the range of 2620 ppm to 3080 ppm, with a National Plant Germplasm System: Csativus [en linea]
slight peak concentration of 3340 ppm for
Kybria hybrid with 3-6 cm fruits.
75
EFFECT OF FOLIAR FERTILIZER ON GROWTH AND YIELD

OF SEVEN POTATO CULTIVARS (SOLANUM TUBEROSOM L.)
Ali Husain JASIM
University of Babylon, Babylon, Iraq
Abstract
An experiment was conducted out during 2009 to study the effect of spraying numbers (0, 2 and4 ) of Alaska foliar
fertilizer (N:12, P2O5:12, K2O:36, Fe:0.05%, Cu:0.005%, Mn:0.03% , Zn:0.01% , B: 0.02% , Mo:0.003% ) on growth
and yield of 7 potato cvs. (Draga, Aladin, Elpaso, Kurado, Diseree, Provento and Red Brown). Factorial experiment
included 21 treatments arranged in Random Complete Bloke Design (RCBD) with 4 replications. Results showed that
foliar fertilizer had a significant effect on plant height, tuber weight and total yield. Potato cvs. differ in all studied
parameters. High yields were obtained from Red Brown, Provento and Draga cvs. Interactions had a significant effect
on the most studied parameters.
Key words: foliar fertilize , potatoes cultivars.
INTRODUCTION increase total and/or marketable tuber yield

(Kara, 2002; Zebarth et al., 2004; Zelalem et
Potato (Solanum tuberosum L.) is the most
al., 2009). It is suggested that late application
important tuber crop, and it is the fourth world
of N in foliar sprays can be benefit to potato
crop after wheat, rice and maize. Moreover,
crop with a long growing season and reduce
potato is an important vegetable and a good
environmental losses of N.
source of antioxidants (Chen et al., 2007).
Phosphor application significantly increased
Although potato is quite adaptable to planting
plant height, marketable tuber yield and
conditions, it has, as every culture, certain
marketable tuber number (Zelalem et al.,
requirements for ecological conditions.
2009). One of the major problems in the use of
Stability of a varieties features and preserving
phosphate fertilizer is the fixation of applied
quality in different conditions has great
phosphate by the soil. Foliar P application
importance; total and graded yield and quality
resulted in higher tuber yield (Ekelof,
factors are affected by cultivars and location
2007). Application of K increases plant
(Tomasiewicz et al., 2003; Haase et al., 2005).
height and crop vigour. It increases both the
Both yield and quality of potato are affected by
rate and duration of tuber bulking. Its
cultivar, environmental conditions and cultural
application assists in the translocation of
practices. In trial with Burren, Arnova and
carbohydrates from leaves to tubers. Potassium
Aladin cv., Burren was a superior in yield, but
increases the size but not the total number of
Arnova was super in tuber mean weight
tubers (Trehan et al., 2001). Foliar application
(Kadum, 2011).
of K increased potato tuber yield. The
Fertilizer application has important effects on
increasing of foliar K fertilizer rates (2.5%)
the quality and yield of potato (Westermann,
was associated with the highest yield (Habib et
2005). Uptake of fertilizer nutrients (NPK) by
al., 2011). Foliar application of micronutrients
potato per unit area and time is high because of
has been one of the approaches to achieve an
the rapid rate of early growth and tuber
improvement the nutritional status, yield of
bulking. Foliar fertilization has potential for an
potato end to optimize use of chemical
important role in potato production.
fertilizers (Khalifa et al., 2003). Potato plants
Nitrogen supply plays an important role in the
foliar treated with Unigreen (containing macro
balance between vegetative and reproductive
and micronutrients) 2.5 g/l and Solu Potash
growth for potato (Alva, 2004). Many previous
(50% K2O) 3.0 g/l gave higher total yield and
studies have shown that N applications can
higher number of marketable tubers per plant
77
and total number of tubers per plant (Abdul of plant. These results are in good accordance
Rasool et al., 2010). with those obtained by (Khalifa et al., 2003;
The present investigation aimed to study the Abdul Rasool et al., 2010; Kadum, 2011).
response of 7 Potato cultivars to the number of The varieties had a significant effect in plant
foliar fertilizer sprays. height. It appeared that it was related to type of
various varieties, (Tafi et al., 2010). The
MATERIALS AND METHODS interaction had a significant effect also.
A field experiment was carried out on a farm Table 1. Effect of Varieties and Foliar High-K Fertilizer
15 km south of Hilla, during 2009 to study the Number on Plant Height (cm)
effect of spraying numbers (0, 2 and 4) of
Average 4 time 2 time
Alaska foliar fertilizer (N:12, P2O5: 12, K2O: control Var.
var. spray spray
36, Fe: 0.05%, Cu: 0.005%, Mn: 0.03%, Zn: 64.3 68 66 59 Draga
0.01%, B: 0.02%, Mo: 0.003%) on 7 potato 56.3 63 56 50 Aladin
varieties (Draga, Aladin, Elpaso, Kurado, 65.7 67 68 62 Elpaso
Diseree, Provento, and Red Brown) obtained 55.7 62 59 46 Kurado
62.7 69 68 51 Diseree
from Nahar Alawrad Company. Factorial
65.0 69 72 54 Provento
experiment included 21 treatments arrangement 56.3 61 59 49 Red Brown
in Random Complete Bloke Design (RCBD) Average of
with 4 replications. - 65.6 64 53
spray
Potato seed Tubers were sown on 6 Feb. at 25 L.S.D. 0.05 var. = 3.1 fertilizer = 2.03 interactions = 5.37
cm apart in the rows. Each plot consisted of 3
rows, each of five meters in length and 70 cm Results in (Table 2) showed that foliar fertilizer
wide. The plot area was 10.5 m. DAP fertilizer had no significant effect on stem numbers.
was added at the rate of 200 kg/ha dressing 10 Potato varieties had a significant effect on stem
cm bellow the tubers. The first foliar spray was numbers, and Elpaso had the largest than other
made after 40 days, in which plants were cultivars, it gave 4.6 stem which reached
blossoming and were at the early tuber set significant only with Aladin that gave 4.0
stage. The other foliar sprays were made at cm.In fact the stem numbers are formed after
weakly intervals. Plant length (cm), number of planting and before adding foliar fertilizer and
shoots was determined at 90 days after cannot affect by it. It can be mentioned that the
planting. At harvesting (21 May), fresh tuber stem number in different cultivars is as one of
yield were recorded in terms of number of the internal and compatible characteristics
tubers per plant and tuber weight as well as affected by the plant environmental condition
total yield. (Henricksen and Molgaard, 2005).
The obtained data were subjected to the
analysis of variance procedure and treatment Table 2. Effect of Varieties and Foliar High-K Fertilizer
means were compared to the L.S.D. test Number on Stem Numbers
according to Steel and Torrie, 1980. Average 4 time 2 time
control Var.
var. spray spray
RESULTS AND DISCUSSIONS 4.27 4.2 4.4 4.2 Draga
4.00 4.2 4.1 3.7 Aladin
Data presented in (Table 1) showed that, length 4.60 4.7 4.7 4.4 Elpaso
of potato plants were significantly increased as 4.27 4.3 4.1 4.4 Kurado
a result of plant spraying with Alaska fertilizer 4.17 4.4 4.2 3.9 Diseree
4.30 4.3 4.6 4.0 Provento
compared with the control treatment. In 4.17 4.2 3.9 4.1 Red Brown
addition, there were no significant differences Average of
between 2 or 4 foliar times of sprays. The - 4.3 4.3 4.1
spray
increases in plant height may be due to the role
of such macro and micro nutrients in the Foliar fertilizer caused an increase in tuber
physiological process and cell division and weight as compared with control (Table 3).
elongation which indirectly affect tissue Four times of foliar fertilizer had no significant
formation and consequently vegetative growth effect on this parameter as compared with two
78
times. It may be attributed to the increase in Table 4. Effect of Varieties and Foliar High-K Fertilizer
vegetative growth by fertilizer and in the role Number on Tuber Yield (ton/h)
of potassium in translocation of produced Average 4 time 2time
control Var.
photosynthetic assimilates and its accumulation var. spray spray
in storage organs (Habib et al., 2011). Haeder 27.999 29.553 30.045 21.398 Draga
21.873 23.693 25.094 16.894 Aladin
et al., (1973) indicated that with adequate K
20.602 21.737 22.022 18.049 Elpaso
nutrition two thirds of the labeled 23.403 26.265 24.640 19.304 Kurado
photosynthesis product passed within one day 23.829 25.975 27.297 18.357 Diseree
into the tubers when after flowering intensive 23.480 25.595 24.525 20.320 Provento
growth of tubers set in. With insufficient K 24.116 26.9654 27.666 17.718 Red Brown
supply only half of the photosynthesis product Average of
- 25.683 25.899 18.959
was translocated to the tubers during the same spray
L.S.D. 0.05 var. = 2.543 fertilizer = 1.665 interactions =
period Draga and Aladin varieties were 4.403
superior in this parameter as compared to other
varieties. It may be a variety characters. The CONCLUSIONS
interactions had a significant effect and Draga+
4 time sprayed was significant as compared Potato cultivars differ in growth and yield
with all interactions. because of the differences in inheritance and
the ecological conditions. Experiments could
Table 3. Effect of Varieties and Foliar High-K Fertilizer be made to select the best cultivar to the local
Number on Tuber Weight (gm) conditions. This study was done to evaluate
Average 4 time 2 time seven cultivars with foliar fertilizer at south
control Var.
var. spray spray region of Babylon. it could be concluded that
71.2 76.8 71.9 65.0 Draga potato plants foliar with fertilizer contain high
63.6 63.4 63.4 64.0 Aladin
potash, caused an improve in growth and tubers
59.0 59.0 60.6 57.5 Elpaso
57.0 58.2 56.0 56.6 Kurado yield per unit area, and it can also recommend
57.3 56.5 58.9 56.6 Diseree that planting Red Brown, Provento and Draga
57.8 56.8 57.2 59.6 Provento varieties in south region of Babylon
60.1 62.9 59.9 57.5 Red Brown Governorate.
Average of
- 62.0 61.1 59.6
spray REFERENCES
Foliar fertilizer caused a significant effect on Abdul Rasool I.J., Al-Jebory K.D.H., Al-Sahaf F.H.,
2010. Effect of foliar application of unigreen and solu
yield as compared with the control (Table 4). It potash on yield and quality of potato tuber. Jordan J.
could be concluded that increasing productivity Agric. Sci., 6 (1), p. 111-119.
of potato plants as a result of foliar fertilizer, Allison M.F., Fowler J.H., Allen E.J., 2001. Response of
may be due to increased in weight and numbers potato (Solanum tuberosum) to potassium fertilizers.
of tuber/plant which in turn increased the total J. Agric. Sci., Cambridge, 136, p. 407-426.
Alva A., 2004. Potato nitrogen management. J. Veg.
tubers yield (ton/h.). This effect might be due Crop Prod., 10, p. 97-130.
to that potassium plays an important role in the Chen Q., Su J., Nandy S., Kereliuk G., 2007. Screening
transport of assimilates and nutrients (Allison potato genotypes for antioxidant capacity and total
et al., 2001) as well as the enhanced effect of phenolics. Plant Canada Congress.
other materials contents of the fertilizer. These Ekelof J., 2007. Potato yield and tuber set as affected by
phosphorus fertilization. M.Sc. thesis, Swedish
findings were supported by previous University of Agricultural Sciences.
investigators such as (Habib et al., 2011; El- El-Sirafy Z.M., Abbady K.A., El-Ghamry A.M., El-
Sirafy et al., 2008). The interactions had a Dissoky R.A., 2008. Potato yield quality, quantity
significant effect and Draga+4 time sprayed and profitability as affected by soil and foliar
gave the highest, which differed significantly as potassium application. J. Agric. Biol. Sci., 4 (6), p.
912-922.
compared with Aladin and Elpaso interaction. Food and Agriculture Organization of the United
These results agreed with (Kadum, 2011). Nations. International Year of the Potato, 2008.
www.potato2008.org
Haase T., Krause T., Haase N. U., Bohm H., Loger R.,
He J., 2005. Effect of location and cultivar on yield
79
and quality of organic potatoes for processing to yield and nutritional status of winter potato var.
crisps. Abstracts of 16th Triennial conference of the Diamond. Ann. Agric. Sci., Ain Shams Univ., Cairo,
EAPR, Bilbao, pp: 699-703. 48 (2), p. 473-483.
Habib H.A.M., Shafeek M.R., Zaki M.F., El-Shal Z.S., Tafi M., Siyadat S.A., Radjabi R., Mojadam M., 2010.
2011. Response of potato plants to foliar application The effect of earthing up on the potato yield in
with different sources of potassium. Int. J. Acad. Dezful weather condition. Middle-east J. Sci. Res., 5
Res., 3 (3), Part 1. (5), p. 392-396.
Haeder H.E., Mengel K., Forster H., 1973. The effect of Tomasiewicz D., Harland M., Moons B., 2003. Irrigation
potassium on translocation of photosynthates and guide to commercial potato production on the
yield pattern of potato plants. J. Sci. Food Agric., 24 Canadian Prairies. Western Potato Council of
(12), p. 1479-1487. Canada, p. 55-60.
Henricksen, C.B., Molgaard J.P., 2005. The effect of Trehan S.P., Roy S.K., Sharma R.C., 2001. Potato
timing of ridging on soil nitrogen and potato tuber variety differences in nutrient deficiency symptoms
yield quality. Potato Res., 32, p. 81-89. and responses to NPK. Better Crops International.
Jenkins, P.D., Ali H., 2000. Phosphorus supply and Potash and Phosphate Institute of Canada (PPIC), 15,
progeny tuber numbers in potato crops. Ann. Appl. p. 18-21.
Biol., 136, p. 41-46. Westermann D.T., 2005. Nutritional requirements of
Kadum, E.A.H., 2011. Effect of spraying organic potatoes. Amer. J. Potato Res., 82, p. 301-307.
fertilizer (Humus) on growth and yield of three Zebarth B.J., Leclerc Y., Moreau G., Botha E., 2004.
potato cultivars. M.Sc. Thesis, Agric. Coll., Kufa Rate and timing fertilization of Russet Burbank
Univ. potato: yield and processing quality. Can. J. Plant
Kara K., 2002. The effects of nitrogen and phosphorus Sci., 84, p. 855-863.
applications in various planting time and at different Zelalem A., Tekalign T., Nigussie D., 2009. Response of
doses on quality. 3rd National Potato Congress, potato (Solanum tuberosum L.) to different rates of
Izmir, Turkey, pp: 347-363. nitrogen and phosphorus fertilization on vertisols at
Khalifa R., Kh M., Nofal O.A., Badran N.M., 2003. Debre Berhan, in the central highlands of Ethiopia.
Influence of foliar feeding with micronutrients on the Africa. J. Plant Sci., 3, p. 16-24.
80
PEACH CROP PROTECTION IN SUSTAINABLE AGRICULTURE
CONDITIONS IN SMALL AND MEDIUM FARMS
Vasile JINGA1, Carmen LUPU1, Roxana DUDOIU1, Andreea PETCU2, Gigel-Gabriel LUPU3
1
Research-Development Institute for Plant Protection Bucharest,
8 Ion Ionescu de la Brad Blvd., District 1, 71592, Bucharest, Romania
2
Research and Development Station for Fruit Tree Growing-Baneasa,
4 Ion Ionescu de la Brad Blvd, District 1, Bucharest, Romania
3
59 Marasti Blvd., Bucharest, Romania
Abstract
Scientific work aims to promote disease management systems of fruit trees stone group (peach), using chemical
treatment methods with low impact on the environment and human health, which contribute to increase crop quality
and quantity. Research has been conducted on peach species cultivated in Research and Development Station for Fruit
Tree Growing-Baneasa, Bucharest, in the climatic conditions of the year 2012. Stigmina carpophila was the pathogen
for which measures have been taken for its prevention and control. Treatments against pathogen were applied at
warning, depending on the biological reserve of the vegetation period and the climate evolution in that year. Among the
five fungicides used, the best results were obtained with the products Score 250 EC and Systhane C PU.
Key words: peach orchard, disease control, ARM software.
INTRODUCTION during several visits at the Research and

Development Station for Fruit Tree Growing-
Prunus persica L. culture has a high economic
Baneasa. There were taken biological samples
value on national as well as on international
(plants with pathogen attack symptoms) from
level. Production and fruits marketing is the
this orchard and there were isolated the main
goal of an intense modern trade. Annually, the
pathogen agents. The isolated pathogens were
trees suffer from attacks of various pathogens
used in laboratory experiments for testing these
causing crop diseases which develop dependent
new plant protection products proposed in the
to the climate conditions of the year and to the
technology. After the laboratory trials, there
cultivated variety (Ivascu, 2002; Delian, 2006).
were also performed field treatments, during
Long term use of pesticides in pomiculture and
the spring season, in the vegetation period, with
ignoring its side effects, have had negative
fungicides, followed by establishing the
consequences towards the environment (Hoza
efficacy of the tested products. In the Prunus
et al., 2000; Burzo et al., 2005). Nowdays, the
persica L. orchard there were carried out
more severe requirements regarding the
treatments in order to prevent and control the
environment protection and health orchards led
attack of the main fruit’s pathogens. The attack
to the development of ecological selective
rate was calculated with the formulas RA%=
methods (Toncea, 2001) specifically for the
F*I/100, F%-frequency of the attacked organs,
crops pest control (Jinga et al., 2008). The
treatments applied during the vegetation period I – intensity of the organ’ attack. The tested
determine the improvement of the yield’s peach variety was Victoria, which is a sensitive
one. During the laboratory trials was tested the
quality and quantity (Delian et al., 2012).
biological action of the following products:
Dithane M45, Bravo Folicur Solo 250EW,
Score 250 EC and Systhane C PU. It was used
The evaluation of several plant protection a method based on the inclusion of the tested
products efficacy against the main studied fungicide into the PDA medium, in 5 different
pathogens for the peach culture was developed concentrations. The medium was poured in
81
Petri dishes, the pathogenic fungi were placed spring season. There were used the following
on the medium, and it was observed the growth variants:
of the colonies compared to control fungi, V1 = untreated control
growth on medium without fungicide (Baicu et V2 = Dithane M45 0.2% concentration
al., 1996; Severin et al., 2001). For each V3 = Bravo 500 SC 0.15% concentration
fungicide concentration was calculated the V4 = Folicur Solo 250 EW 0.1% conc
inhibition percent of the mycelium growth V5 = Systhane C PU 0.1% concentration
(Alexandri, 1982; Geamanu, 2006). V6 = Score 250 EC 0.02% concentration
The field trials of the fungicides selected after Weather conditions during application:
the laboratory tests were made in the 2012
Table 1. 1st treatment 04-04-2012

Temperature of air 19.2°C
Relative humidity 54%
Wind speed 0.8
Wind direction N
Cloud cover (%) 0
Rainfall with 1 week before of spraying 0.4 mm
Rainfall with 2 weeks after spraying 0 mm
First rainfall after spraying and its amount 15-05-2012
Table 2. 2nd treatment 06-05-2012

Wind speed 0.5
Wind direction NE
Cloud cover (%) 0
Rainfall with 1 week before of spraying 0.4 mm
Rainfall with 2 weeks after spraying 3.4 mm
Table 3. 3rd treatment 09-06-2012

Wind speed 0.7
Wind direction N
Cloud cover (%) 0
Rainfall with 1 week before of spraying 0 mm
Rainfall with 2 weeks after spraying 0 mm
There were applied 3 treatments on the 4th years Prunus persica L. orchard, at Research
April, 6th May and 9th June, in accordance with and Development Station for Fruit Tree
the meteorological conditions, and the Growing-Baneasa, in order to establish the rate
observations took place 8 days after each of infectious load from this area.
treatment, taking into account the frequency It was used the classical testing method which
(PESING) and the intensity (PESSEV) of the consist in 6 variants in 4 replications with 5
attack. The observations targeted the Stigmina trees per each variant in random disposal.
carpophila pathogen which produces the shot
hole disease (Figure 1).
The treatments were carried out using the
SOLO atomizer pump (Figure 2).
Studies regarding the experimental models of
the proposed technology took place in an 8
82
Figure 1. Shot hole and fruit stain produced by Stigmina Figure 2. Treatments in vegetation period
carpophila
The biological action of some fungicides on the
development of Stigmina carpophila fungus
colonies on leaves and fruits is presented in
Table 4.
Table 4. Biological action of some fungicides on the development of fungus colonies Stigmina carpophila
Colony diameter (mm) at conc.% Inhibition percent at conc.%
Product
0,2 0,1 0,05 0,025 0,015 0,2 0,1 0,05 0,025 0,015
Dithane M 45 0 7 10 16 20 98,6 70,0 65,0 37,1 11,5
Bravo 500 SC 0 8 20 25 41 100 80,5 70,5 20,0 14,8
Folicur Solo 250 EW 0 0 8 10,5 15 100 91,4 88,6 75,0 50,1
Systhane CPU 0 0 8 19 31 100 100 78,5 58,6 42,5
Score 250 EC 0 0 0 0 0 100 100 100 87,1 51,5
Control 70 mm
Based on the data presented in Table 4 were 500 SC in 0.2% concentration, Dithane M 45 in
selected the products and their optimal con- 0.2% concentration.
centration which will further be used during the During the experiments there were taking into
field trials in order to control the fungus account the 100% fungi inhibition in accor-
Stigmina carpophila. dance with the various factors acting towards
The products with very good biological action plants.
were: Folicur Solo 250 EW in 0.1% concen- The results obtained in field during the vege-
tration, Systhane C PU in 0.05% concentration, tation period are presented in Tables 5 and 6.
Score 250 EC in 0.02% concentration, Bravo
Table 5. The frequency and intensity of the Stigmina carpophila attack

PESINC PESSEV PESINC PESSEV PESINC PESSEV
Treatment product name % % % % % %
04.04.2012 09.05.2012 12.06.2012
R1 27.0 12.0 39.0 12.0 52.0 16.0
R2 19.0 10.0 27.0 16.0 43.0 20.0
Variant 1 R3 28.0 9.0 34.0 14.0 48.0 23.0
R4 31.0 12.0 31.0 16.0 51.0 20.0
Average 26.3 10.8 32.8 14.5 48.5 19.8
R1 16.0 6.0 20.0 11.0 21.0 13.0
R2 12.0 4.0 18.0 12.0 31.0 21.0
Variant 2 R3 17.0 5.0 15.0 6.0 24.0 14.0
R4 14.0 4.0 21.0 10.0 28.0 12.0
Average 14.8 4.8 18.5 9.8 26.0 15.0
Variant 3 R1 17.0 5.0 17.0 15.0 20.0 9.0
83
R2 11.0 4.0 15.0 7.0 22.0 10.0
R3 16.0 4.0 16.0 5.0 17.0 8.0
R4 9.0 5.0 12.0 8.0 21.0 10.0
Average 13.3 4.5 15.0 8.8 20.0 9.3
R1 10.0 3.0 16.0 7.0 17.0 6.0
R2 12.0 5.0 10.0 4.0 19.0 7.0
Variant 4 R3 9.0 4.0 12.0 6.0 21.0 8.0
R4 11.0 6.0 14.0 3.0 14.0 7.0
Average 10.5 4.5 13.0 5.0 17.8 7.0
Treatment product name % % % % % %
04.04.2012 09.05.2012 12.06.2012
R1 14.0 7.0 11.0 4.0 11.0 7.0
R2 12.0 4.0 12.0 6.0 16.0 5.0
Variant 5 R3 16.0 4.0 14.0 5.0 14.0 8.0
R4 10.0 5.0 13.0 6.0 16.0 4.0
Average 13.0 5.0 12.5 5.3 14.3 6.0
R1 10.0 5.0 7.0 5.0 11.0 6.0
R2 12.0 4.0 10.0 4.0 12.0 5.0
Variant 6 R3 9.0 4.0 12.0 3.0 9.0 4.0
R4 8.0 3.0 11.0 3.0 10.0 3.0
Average 9.8 4.0 10.0 3.8 10.5 4.5
Table 6. Processing of data from the three treatments applied in the vegetation period
Treatment
Variant % % % % % %
Product Name
04.04.2012 09.05.2012 12.06.2012
1 Variant 1 26.3 a 10.8 b 32.8 a 14.5 a 48.5 a 19.8 a
2 Variant 2 14.8 b 4.8 b 18.5 b 9.8 b 26.0 b 15.0 b
3 Variant 3 13.3 b 4.5 b 15.0 bc 8.8 b 20.0 c 9.3 c
4 Variant 4 10.5 b 4.5 b 13.0 c 5.0 bc 17.8 c 7.0 cd
5 Variant 5 13.0 b 5.0 b 12.5 c 5.3 bc 14.3 cd 6.0 cd
6 Variant 6 9.8 b 4.0 b 10.0 c 3.8 c 10.5 d 4.5 d
LSD (P=.05) 4.56 1.59 4.32 3.57 4.85 3.41
Standard Deviation 3.02 1.05 2.87 2.37 3.22 2.27
CV 20.74 18.88 16.91 30.27 14.09 22.1
Bartlett's X2 6.773 3.184 5.618 8.991 4.713 10.298
P (Bartlett's X2) 0.238 0.672 0.345 0.109 0.452 0.067
Replicate F 1.270 2.050 1.114 1.166 0.462 1.136
Replicate Prob (F) 0.3204 0.1501 0.3746 0.3555 0.7131 0.3662
Treatment F 15.787 23.460 33.049 11.431 71.803 27.351
Treatment Prob (F) 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001
*Means followed by same letter do not significantly differ (P=0.05, Student-Newman-Keuls)
Mean comparisons performed only when AOV Treatment P (F) is significant at mean comparison OSL.
The data processed using ARM 8 software variants 3 and 5 up to very significant in variant
(ARM is a recognized and respected standard 6.
throughout the plant production, used by It results that the following contact fungicides
thousands of researchers around the world), Bravo 500 SC and Dithane M 45 (V2 and V3)
concludes, that after the first treatment (April have a good efficacy, and the systemic ones
4) all 5 fungicides showed significant effects (V3-V6) present a high efficacy. The best
(b) in fungus control. After the 2nd treatment results were obtained with V6, the fungicide
(May 9) the results are significant (b) in Score 250 EC.
variants 2 and 3 and significant distinct (bc) in
variants 4 and 5 and very significant in variant CONCLUSIONS
6. The results obtained after the 3rd treatment
During the laboratory trials there were selected
(June 12) are from distinct significant in
the products with the best biological activity
84
against the development of the studied fungi. Baicu T., Sesan T., 1996. Fitopatologie agricola. Ed.
The products with the highest biological acti- Ceres, Bucuresti.
Burzo I., Delian E., Hoza D., 2005. Fiziologia plantelor
vity against the development of fungus colonies de cultura. Vol. IV Fiziologia pomilor, arbustilor si
of Stigmina carpophila were: Folicur Solo 250 plantelor ierboase fructifere, Ed. Elisavaros.
EW in 0.1% concentration, Systhane C PU in Dejeu L., Petrescu C., Chira A., 1997. Horticultura si
0.05% concentration, Score 250 EC in 0.02% protectia mediului, Ed. Ceres, Bucuresti.
concentration, Bravo 500 SC in 0.2% concen- Delian E., Chira L., Dumitru L., Badulescu L., Chira A.,
Petcuci A., 2012-Mineral content of nectarines fruits
tration, Dithane M 45 in 0.2% concentration. in relation to some fertilization practices. Scientific
Laboratory results enable the selection of fun- Papers Series B. Horticulture Volume LVI, 201, p.
gicides showing high inhibition percentage in 73-81.
order to establish a treatment chart for the Delian E., 2006. Fiziologia stresului biotic la plante.
vegetation period, regarding the control of the Editura Cartea Universitara.
Geaman I., Berchez M., Baicu T., 2004. Fitiatrie, Ed.
major diseases specific to the peach. Cris Book Universal Bucuresti.
The phytosanitary treatments will be made at Geaman I., 2006. Microbiologie. Ed. Universitas,
warning, according to the evolution of environ- Bucuresti.
Gheorghies C., 1999. Bolile plantelor horticole,
mental conditions and pathogenic organisms, Bucuresti.
pursuant to the proposed technology. Gheorghies C., Cristea S., 2001. Fitopatologie, Ed.
It results that the following contact fungicides Ceres, Bucuresti.
Hoza D., Chira L., Paun C., 2000. Pomicultura –
Bravo 500 SC and Dithane M 45 (V2 and V3)
Îndrumator de lucrari practice, Bucuresti.
have a good efficacy, and the systemic ones Ivascu A., 2002. Rentabilizarea culturii piersicului în
(V3-V6) present a high efficacy. The best ferme mici si mijlocii. Edit. Cris Book Universal,
results were obtained with V6, the fungicide Bucuresti.
Score 250 EC. Jinga V., Neamtu M., Popescu M., Geaman I., Oprea M.,
Gradia M., Tudose M., Vlad F., 2008. Sisteme pentru
managementul protectiei integrate a speciilor
REFERENCES
sâmburoase din fermele mici si mijlocii în agricultura
Alexandri Al., 1982. Chemoterapia si combaterea bolilor durabila, Editura Ceres, Bucuresti.
la plante. Ed. Ceres, Bucuresti. Severin V., Constantinescu F., Frasin B.L. 2001.
Baicu T., Sesan T. E., 1996. Fitopatologie agricola, Ed. Fitopatologie, Editura Ceres, Bucuresti.
Ceres, Bucuresti. Toncea I., 2002. Ghid practic de Agricultura ecologica.
Editura AcademicPress
85
THE VITICULTURE AND WINEMAKING OF REPUBLIC OF MOLDOVA -

PAST, PRESENT AND FUTURE
Gheorghe NICOLAESCU1, Valeriu CEBOTARI2, Ana NICOLAESCU1,

Dumitru BRATCO2, Mariana GODOROJA1, Cornelia LUNGU1, Valeria PROCOPENCO1
1
State Agrarian University of Moldova, 44, Mircesti str., MD-2049, Chisinau, Republic of Moldova
2
Ministry of Agriculture and Food Industry, 162 Stefan cel Mare Blvd., MD-2004,
Chisinau, Republic of Moldova
Abstract
Viticulture and winemaking in Moldova has an important role in the national economy. These branches have an
important share in the GDP. At this stage of viticulture and winemaking activity is regulated by Law of Vine and Wine
(57/10.03.2006), government resolution on the approval of the restoration and development of viticulture and
winemaking for the period 2002-2020 (1313/07.10.2002) and other regulations. In the period until 2006 the branch has
a rapid growth, and stagnation occurred as a result of the embargo imposed by Russia. At present, the vineyard area is
about 100 000 ha.
Key words: Republic of Moldova, viticulture, winemaking industry.
INTRODUCTION Ministry of Agriculture and Food Industry of

Republic of Moldova. Also we used normative
Viticulture and winemaking in Moldova are the
and legislative acts of the parliament and
main sectors of agriculture. The favorable
government of Moldova, the specialized
climatic conditions of Moldova, provide an
literature.
opportunity to successfully cultivate grapes.
The main activity of the villagers is cultivation
of table grapes and grapes for processing. For
many years’ viticulture and winemaking was The state of viticulture and winemaking at this
subjected to many tests under the influence of stage is characterized by the following data.
various factors-political, economic, social, etc. The data from figure 1 showed that from 1991
At this stage of viticulture and winemaking to 2011, the total area of vineyards has
activity is regulated by Law of Vine and Wine decreased significantly from 176 thousand ha
(57/10.03.2006), government resolution on the to 102 thousand ha, and the area of productive
approval of the restoration and development of vineyards decreased from 148 thousand
viticulture and winemaking for the period hectares to 92 thousand hectares.
2002-2020 (1313/07.10.2002) and other In the period from 2002 to 2006 the area of
regulations. vineyards has been stable, about 108-110
The aim of our research was to study the thousand hectares. This is due to GD
dynamics of development and the state of 1313/2002 on the restoration of viticulture and
viticulture and winemaking at this stage and the winemaking for the period 2002-2020. After
level of their development in according to the 2006, the vineyard's area decreased, this
program. situation was associated with the embargo for
wine from Russia, the largest market for
MATERIALS AND METHODS products.
In our study, about the situation of viticulture
and winemaking, we used the data of the
National Statistical Department and the
87
decrease of the area of vineyards and the
nonhomogeneous weather conditions. The
weather conditions influenced the production
per hectares (next figures).
Figure 1. Dynamics of the total and productive area of

vineyards in the Republic of Moldova during 1991-2011
years, thousand ha (Nicolaescu et al., 2010; Corobca et
al., 2012)
Figure 3. Dynamics of the grape yield in the Republic of

Moldova during 2001-2011 years, kg/ha. (Nicolaescu et
al., 2010; Corobca et al., 2012)
The data from figure 4 showed that the yield

was nonhomogeneous. They was to influenced
by the nonhomogeneous weather conditions.
Figure 2. Dynamics of the total, processed and grapes

production in the Republic of Moldova during 1991-
Figure 4. Dynamics of the grapes export from the
2011 years, thousand t. (Nicolaescu et al., 2010; Corobca
Republic of Moldova during 1994-2011 years, thousand
et al., 2012)
USD. (Nicolaescu et al., 2010)
The data from figure 2 showed that from 2001 The source of information:
to 2011, the total area of table grapes vineyards http://comtrade.un.org
has been stable, about 15-16 thousand hectares. http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?
After that, from 2006 to 2009, the vineyard's uri=OJ:L:2011:282:0001:0912:RO:PDF
area decreased, this situation was associated
with the embargo for wine from Russia, the
largest market for products. In recent years, the
situation has improved.
The data from figure 3 showed that from 1991
to 2011, the production has decreased
significantly from about 600 thousand tones
(total production in 1991) to 350 thousand ha
(the same indices in 2011). The similar Figure 5. Dynamics of the grapes import in the Republic
situation observed for the quantity of processed of Moldova during 1994-2011 years, thousand USD.
(Nicolaescu et al., 2010)
grapes in this period, but the table grapes
production in the period from 2001 to 2011 The source of information:
years has between about 30 thousand tones (in http://comtrade.un.org
2006) and about 77 thousand tones (in 2004). http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?
The production decrease was due to the uri=OJ:L:2011:282:0001:0912:RO:PDF
88
Analyzing the dynamics of the total value of than the year 1994. However, the import value
export of fruits (code 08) and fresh and dried of fresh grapes in the total structure of the
grapes (code 0806), according to UN database, grapes (code 0806) was 80.62%, 18.38% for
we can say with certainty that until 1999 these raisins. Trade balance in terms of fresh grapes
indices were in a continuous decline and since in 2011 was positive by 12.6 million USD for
2000 there has been a considerable increase in export.
export value (fig. 5). Minimum export of total In the structure of exports of table grapes (code
fruits (code 08), was in 1999 and constituted 0806) in 2011, the share of 78.64% or
20.1 million USD and the maximum value of 25,941.62 tons refers to Russia, which is
exports was in 2011 and amounted to 187 followed by Belarus with 14.83% or 4891.03
million USD. Minimum export of fresh and tons and Romania with 6 16% or 2030.79 tons
dried grapes (code 0806), were in 1997 and (Figure 7).
constituted 0.7 million USD and the maximum
value of exports was in 1994 about 24 million
USD. Export value in 2011 was 17.6 million
USD, or 25.1 times more than the year 1997
and 1.4 times less than in 1994. Also in 2011,
the export value of grapes (code 0806), in
export value of fruit structure (code 08) was
9.39% (Figure 5).
The dynamics of import value (Figure 6)
compared to the exports in the period 1994-
1999 was relatively stable and in 2000 there is
also a considerable increase. In 2011, the
imports of fruit in general (code 08) was about
Figure 7. The structure of import of table grapes in the
68.4 million dollars, or 57 times more than the Republic of Moldova in 2011, tones,%. (Nicolaescu et
year 1994. The trade balance was positive- al., 2010)
118.6 million USD for export.
The source of information:
http://comtrade.un.org;
http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?
uri=OJ:L:2011:282:0001:0912:RO:PDF
In the structure of imports of table grapes (code

0806) in 2011, the share of 86.51% or 5655.93
tons is refers Turkey, which is followed by
Iran-by 5.38% or 351.63 tons, Uzbekistan-with
2.90% or 189.35, Greece-by 1.43% or 93.75
Figure 6. The structure of export of table grapes from the
Republic of Moldova in 2011, tones,%. (Nicolaescu et tonnes and Chile-0.64% or 41.89 tons (Figure
al., 2010) 8).

uri=OJ:L:2011:282:0001:0912:RO:PDF
The grapes import value (code 0806) in 2011

was 6.2 million USD or 155 times more than in
1994. In the structure of grape fruit import
value has returned 9.1%. The trade balance was
positive this 11.4 million USD for export.
Fresh grapes (code 080610) registered import
value of 5.0 million USD or 166.7 times more
89
Table 1. The dynamics of production of grapes and wine
production in Moldova in calculating the per capita
(Nicolaescu et al., 2010)
Indices 2006 2007 2008 2009
1. Grape production in the
130 167 178 192
calculation per capita, kg
-in% in comparison with last
x 128,46 106,59107,87
year
-in% in comparison with
scientific annual 288,89 371,11 395,56426,67
consumption
Figure 8. The structure of import of fresh table grapes in 2. The table grape
the Republic of Moldova in 2011, tones,%. (Nicolaescu production in the calculation 8,16 10,55 11,68 29,24
et al., 2010) per capita, kg
-in% in comparison with last
x 129,27 110,77250,37
year
-in% in comparison with
scientific annual 18,13 23,43 25,96 64,99
consumption
uri=OJ:L:2011:282:0001:0912:RO:PDF
3. Wine production in the
12,10 9,58 9,57 7,43
calculation per capita, l
In the structure of imports of fresh grapes (code -in% in comparison with last
080610), in 2011, the share of 95.13% or x 79,16 99,85 77,65
year
5655.93 tons is refers to Turkey, which is -in% in comparison with
followed by Greece-by 1.59% or 93.75 tonnes scientific annual 26,90 21,29 21,26 16,51
consumption
and Chile-0.47% or 27.89 tons (Figure 9).
Wine branch is a branch of Agro-Industrial
Complex that provides people with fresh and Analyzing coverage of consumer standard table
processed production: juices, jams and various grapes (Table 1.) We can say that Moldova is
types of wines. The food's importance, econo- unable to produce the required amount of
mic importance, it has the advantage that in grapes according to the norm of consumption.
comparison with others. According to scientific At present in force 'Program restoration and
research of medicine, annual consumption development of viticulture and winemaking in
calculation time a person is 40-50 kg grapes per the years 2002-2020', which was approved to
year and approx. 40-50 it coming. restore the complex in the branches of viti-
Grape production in calculating per capita in culture and winemaking by the Governmental
the period 2006-2009, varies between 130 kg Decision no. 1313 / 07.10.2002 (Monitorul
(2006) and 192 kg (2009) and of the mass: 8.16 oficial 142 / 17.10.2002, art. 1448).
kg (2006) and 29.24 kg (2009). Given the current state of the industry, pro-
Based on the data presented in Table 1, we find duction capacity and level of business develop-
that the production of table grapes in Moldova ment of enterprises at that time, were projected
in calculating per capita in 2006 is 18.13% of production following wines:
normal consumption, increasing to 64.99% in
2009 compared to the norm of consumption.
The results obtained show that local producers
can not cover domestic consumption of fresh
grapes. However, we find that the production of
wine in Moldova in computing per capita in
2006 is 26.90% of normal consumption, falling
by 16.51% in 2009 compared to the norm of
consumption.
90
Table 2. Indicative data on volumes of production of wine products and their value (in comparable prices of 2000) in
the 2002-2020 years
Years
2000 2010 2015 2020
Unit of
Type of wines Sum Quantity Sum Quantity Sum Quantity Sum
measure Price,
Quantity mil. mil. mil. mil. mil. mil. mil. mil.
MDL/unit
MDL Euro MDL Euro MDL Euro MDL Euro
Bottled wines 1000 hl 750 896 672 50,27 1000 896 67,02 1100 986 73,76 1500 1.344 100,53
Wines in bulk, sparkling
1000 hl 850 320 272 20,35 900 288 21,54 1000 320 23,94 1500 480 35,91
wine
Total: 16 944 70,61 19 1184 88,57 21 1.306 97,69 30 1824 136,44
1000 bottles 5,5 10 55 4,11 8,5 85 6,36 10 100 7,48 12 120 8,98
Sparkling wine
1000 hl 41,3 1333 55 4,11 63,8 85 6,36 75 100 7,48 90 120 8,98
Divin (cognac) 1000 hl 41,6 4000 166 12,42 40 160 11,97 50 200 14,96 60 240 17,95
Brendy 1000 hl 95,5 1660 153 11,44 100 160 11,97 120 192 14,36 140 224 16,76
Production value-total
1318 98,59 1589 118,86 1798 134,50 2408 180,12
(million MDL)
in% in comparison with
100 121 136 183
2000
The level of achievement of planned objectives Table 4. Indicative data on the development of viticulture
will be revealed in later chapters. To obtain that in the commodity producing grapes from 2002-2020
quantity of wine products necessary to process Annual average
Total area,
Necessary
thousand ha
quantity
the following quantities of grapes and wines. Total of
Total Producti
Years productio designed planting
area, ve area, Yield, planting material,
n, deforest
Table 3. Indicative data on volumes of grape processing thousan thousand kg/ha ation area million
thousand
and use directions of wine obtained in the 2002-2020 d ha ha pcs
tones
years 2002-
99,6 95,2 434,2 4.560 22,5 9,2 32,2
2005
Years includin
Unit of 2000 94,2 85,5 393,0 4.600 6,0 4,5 15,75
Indices 1990 (for g 2005*
measure (real 2010 2015 2020
reference) 2006-
data) 91,2 71,7 374,4 5.220 35,0 30,0 105,0
2010
Grape includin
1000 tones 770 360 360 430 600 89,2 64,2 379,0 5.900 8,0 7,0 24,5
processing g 2010*
Production of 2011-
1000 hl 5.200 2.400 2.400 2.800 3.900 92,2 64,4 419,6 6.520 30,0 35,0 122,5
raw wines 2015
including includin
----for wines 1000 hl 4.200 1.870 1.500 1.700 2.600 94,2 66,2 460,0 6.950 6,0 7,0 24,5
g 2015*
----for sparkling 1000 hl 500 470 500 500 500 2016-
----for divinuri 98,0 75,0 570,8 7.610 20,0 25,8 90,3
1000 hl 300 30 300 400 500 2020
(cognac) includin
----for grape 100,0 80,0 640,0 8.000 4,0 5,0 17,5
1000 hl 200 30 100 200 300 g 2020*
juice
Also it requires the existence of vineyards to

Considering the pedoclimatic potential of
produce wines with designation of origin, given
Moldova in terms of the culture of the vine, and
the unique climatic conditions favourable for
the objectives set for achieving certain amounts
vines. The area of these plantations should be
of wines, the area of vineyards of the
approx. 5000 hectares.
commodity producing grapes at the end of that
The level of program implementation can
period should be approx. 100 000 hectares, of
easily see from Figure 9, but the establishment
which the productive-approx. 80 000 hectares.
of vineyards in the years 2008-2009 was
The area of vineyards per wine regions should
performed at a lower level compared to planned
be distributed as follows: South wine region
programme. This, in our opinion, is due to
(Cahul)-48 000 hectares, the wine region of
stress growers as a result of the embargo
Centre-48 000 hectares and wine region North
imposed by the Russian Federation.
(Balti)-4 000 hectares.
91
this is the winter frosts, late spring frosts, hail
in the early stages of growth, prolonged
summer droughts, autumn rains and early
autumn frosts.
To improve the efficiency of viticulture and
wine-making is necessary to raise the level of
technology of vineyards, perform the intended
purpose of the program development, and to
develop new markets for grapes and wines.
REFERENCES
Figure 9. The dynamics of vineyard
Arpentin Gh. 2008. Moldovan Viticulture and
During the years, the global production of Winemaking Industry: Past – Future – Challenges –
grapes and quantity processed by the Opportunities. Moldo-American meetings North
Carolina. November 14. Power point presentation.
processing enterprises varies very widely. This Corobca V., Fosnea A., Jose Javie Ocon Berango, 2012.
is due largely to climatic conditions that are Viticultura si pepinieritul viticol în Republica
created in the geographical territory of the Moldova. USAID, CEED II, Chisinau.
Republic of Moldova. HG Nr. 152 / 26.02.2013 cu privire la aprobarea modului
The decisive and destructive climatic factors de repartizare a mijloacelor fondului de
subventionare a producatorilor agricoli pentru anul
which influencing the successful development 2013. În: Monitorul Oficial Nr. 41 / 184 din
of viticulture and their intensify in recent years 27.02.2013.
this is the winter frosts, late spring frosts, hail Legea Viei si Vinului nr. 57 / 10.03.2006. În: Monitorul
in the early stages of growth, prolonged Oficial Nr. 75-78 / 19.05.2006.
summer droughts (flowering and berry growth), Nicolaescu Gh., Apruda P., Perstniov N., Terescenco A.
autumn rains (berry maturation) and early Ghid pentru producatorii de struguri pentru masa
(editia II). Ch.: “Iunie Prim” SRL, 2008. 133 p. ISBN
autumn frosts. 978-9975-4004-1-1
Nicolaescu Gh., Cazac T., Vacarciuc L., Cebotari V.,
CONCLUSIONS Cumpanici A., Nicolaescu Ana, Hioara Veronica.
Filiera vitivinicola a Republicii Moldova-starea si
During the years, the total area of vineyards, perspectivele dezvoltarii. Inst. Italian de Comert
the global production of grapes and quantity Exterior, Univ. Agrara de Stat din Moldova; red. gen.
processed by the processing enterprises varies Gheorghe Nicolaescu; Ch.: S. n., 2010 (Tipogr.
very widely. This is due largely to climatic “Print-Caro” SRL). 133 p. ISBN 978-9975-4152-5-5.
Programul de restabilire si dezvoltare a viticulturii si
conditions that are created in the geographical
vinificatiei în anii 2002-2020 / HG nr. 1313 /
territory of the Republic of Moldova. 07.10.2002. În: Monitorul Oficial Nr.142 /
The decisive and destructive climatic factors 17.10.2002.
which influencing the successful development http://comtrade.un.org
http://faostat.fao.org/site/567/default.aspx#ancor
of viticulture and their intensify in recent years
92
THE INFLUENCE OF FERTILIZATION LEVELS AND DRIP IRRIGATION

NORMS ON THE APPLE HARVEST IN SOUTH-EASTERN ROMANIAN
CONDITIONS
Nicoleta OLTENACU, Cătălin Viorel OLTENACU

Abstract
Making a modern fruit growing cannot be conceived without providing a corresponding hydric regime that fruit species
need. Even in areas with abundant precipitation should be taken into account that they are unevenly distributed
throughout the growing season and that there are critical moments in which trees need to consume water. Low humidity
and lack of water can harm large harvest this year or next year to the fruit formation. Taking into account this aspect,
in the present study, we wanted to put out the effects of application of modern methods of water located on the
behaviour of apple fruit valuable in terms of the south-eastern Romania, where are encountered optimal culture
conditions and find the best recommendations for production. The content of this paper is based on research,
observations, experiments, extensive research of issues prioritized and data processing including the whole range of
issues, starting from the foundation of the application irrigation necessity. As a result, the entire work is based almost
exclusively on research findings on the effect of irrigation and fertilization level on apple at Moara Domneasca farm
conditions.Factor A-variety: Generos and Florina. Factor B-irrigation norms: non irrigated witness; drop 2 litres /
hour; drop 4 litres / hour. FactorC-fertilization levels: 2,5 kilo Megasol or 5 kilo Megasol.The irrigation level resulted
in production increases and bonuses obtained as very significant statistically for the two levels of irrigation applied.
The highest yields were recorded in variants where rules were applied 4 l / h, with production increases of 40.1%, and
increases the harvest of 5.52 t / ha.
Key words: drip irrigation, fertilization, harvest, water norms, varieties.
INTRODUCTION growth exaggerated of the shoots and directing

the assimilated towards the fruits (Atkinson D.,
Making a modern fruit growing cannot be
1977).
conceived without providing a hydric system
Even in areas where there is 600-700 mm
that corresponds to the needs of the fruit
annual rainfall, water scarcity is need to be
species. Even in areas with heavy rainfall
cover from July through September, or
should be noted that these are distributed
sometime in the spring, in March-April, before
unevenly throughout the growing season and
and during flowering and autumn, in October
that there are critical moments in which trees
during intensive growth roots. Over time, water
need to consume water (Rzekanowski C.,
saving problem has become increasingly
Rolbiecki S., 2000). Low humidity and lack of
important higher with global climate change,
water can harm large crop of fruit in the current
rising among other issues also that of the
year or of the fruit formation in the next year
reduction and rationalization of water use for
(Cohen D., 1993).
irrigation (Popescu M., Godeanu I.,1989).
Currently, irrigation is necessary to be
Bearing this in mind, the present study, we
understood, according to the principles of
aimed to emphasize the effects of localized
integrated fruit crops as a highly effective tool
application of modern methods of water, over
for regulating the activity of vegetative and
the behavior of two valuable apple varieties, in
productive trees (Botu I., Botu M., 2003). It is
the south-eastern Romania conditions, where
known that a mild water stress has the effect of
are encountered optimal conditions of culture.
picking the fruit bud differentiation
The research objective is to observe what is the
phenomenon. Also, reducing excessive
impact of localized irrigation application on
watering result a decrease of the vegetative
fruitfulness and establishing recommendations
93
for production of localized irrigation on apple Table 1. The Influence of the variety on the production
application in the in the south-eastern Romania of apples, average of 2008-2011
conditions Variety
Prod.
% Dif. t/ha Signif.
t/ha
MATERIALS AND METHODS Generous 16,53 100,1 0,02 -
Florina 16,49 99,9 -0,02 -
The entire work is based on the results of Average 16,51 100 - Mt
personal research on the effect of apple Dl 5% = 0,244 t / ha Dl 1% = 0,563 t / ha Dl 0,1% =
irrigation in Moara Domneasca Farm 1,791 t / ha
conditions.
Researches to develop this work were To analyze the influence of the variety on
conducted in 2008-2011 period. Relief locality production, we have established as term of
is included in the Romanian Plain, Vlasiei Plain comparison-stander-by the average production
subdivision, in the transition from steppe to of the two analyzed varieties, 16,51 t/ha.
forest area. The general relief is flat with The Generous variety achieved a production of
numerous small bumps and depressions, called 16,53 t/ha, at a non-significant difference (0,02
dales, of different shapes and sizes. t/ha) compared to the stander-by.
Groundwater is at different depths from 6 m to Florina variety enrolled with a production of
10 m, depending on the terrain. In 2008, the 16,49 t/ha, at a non-significant difference
accumulated rainfall was 378 mm, in 2009 was compared to the stander-by, but negative.
559,4 mm, in 2010 was 494,8 mm and in 2011 We can say that the varieties have a similar
was 288 mm. All values are below the 50-year genetic potential production (Table 1)
annual average of 548.0 mm.
The soil type at the Moara Domneasca Farm is The influence of the drip irrigation levels on
reddish brown (preluvosoil), softness subtype. the production of apples
To achieve the objectives, it was imposed an
Table 2. The Influence of the drip irrigation levels on the
organization of some tri factorial type production of apples, average of 2008-2011
experiences with the following experimental
factors: Prod. Diff.
Irrigation norm % Signif.
t/ha t/ha
Factor A-variety: Generos and Florina.
Non-irrigated 13,75 100 - Mt
Factor B-irrigation norms: non irrigated 2 l/h 16,51 120,1 2,76 ***
witness; drop 2 litres / hour; drop 4 litres / 4 l/h 19,27 140,1 5,52 ***
hour. DL 5% = 0,140 t/ha DL 1% = 0,203 t/ha DL 0,1% =
Factor C-fertilization levels: 2,5 kilo Megasol 0,305 t/ha
or 5 kilo Megasol.
Drip irrigation was started from March 20, As shown in Table 2., the irrigation level
administering it daily, for 4 hours. In periods determined increases of the yields obtained and
where there were registered rainfalls, the increases statistically confirmed as highly
irrigation was discontinued. In general, the significant for the two levels of irrigation
number of watering recommended is 2-5. applied.
Fertilization consisted of Megasol product Compared to the control (irrigated) production
administration, which is a soluble fertilizer standards achieved at 2 l/h were 20,1% higher,
designed specifically for use in advanced which means an increase of 2,76 t/ha, very
irrigation systems, especially through the drip, significant.
and foliar and basic fertilization. On fruit trees An increase of 5,52 t/ha was recorded also at
were applied 5 splashes using the doses the irrigated variant with 4 l/h, which means an
mentioned above. additional crop of 40,1%.
RESULTS AND DISCUSSIONS The influence of the level of fertilization on

the production of apples
The influence of the variety on the
production of apples
94
Table 3. The Influence of the level of fertilization on the 14,82 t/ha. In comparison with this, the
production of apples, average of 2008-2011 recorded production on a dose of 2,5 kg/ha
Fertilizer Dose
Prod.
%
Diff.
Signif.
Megasol, 16,52 t/ha was higher by 1,70 t/ha,
t/ha t/ha which is a very significant production increase.
Unfertilized 14,82 100 - Mt The dose of 5 kg/ha resulted in a production of
2,5 kg /ha 16,52 111,5 1,70 ***
18,18 t/ha, with 22,7% over the stander-by
5,0 kg /ha 18,18 122,7 3,36 ***
DL 5% = 0,074 t/ha DL 1% = 0,101 t/ha DL 0,1% = production, meaning an increase of 3,36 t/ha, a
0,135 t/ha very significantly increase. In conclusion, the
fertilization causes very significant production
To make an analysis of the data presented in increases for all levels of fertilizer applied.
Table 3. was considered as a stander-by
production obtained on a unfertilized variant,
Table 4. The Influence of fertilization levels on production of apples for the same level of irrigation, average of 2008-
2011
Irrigated norm Non-irrigated 2 l/h 4 l/h
Fertilizer dose Prod. t/ha Dif. t/ha Signif. Prod. t/ha Dif. t/ha Signif. Prod. t/ha Dif. t/ha Signif.
Non-fertilizer 12,84 - Mt 14,89 - Mt 16,74 - Mt
2,5 kg/ha 13,81 0,97 *** 16,53 1,64 *** 19,23 2,49 ***
5,0 kg/ha 14,59 1,75 *** 18,12 3,23 *** 21,84 5,10 ***
The influence of fertilization levels on was 0,97 t/ha at a dose of 2,5 kg/ha and 1,75
production of apples for the same level of t/ha at a dose of 5 kg/ha Megasol. With the
irrigation water irrigation administration, benefits
As noted previously, fertilization brings very increased to 1,64 t/ha, respectively, 3,23 t/ha.
significant production increases at all Norms of 4 l/h caused increases of production
graduations used but irrigation application of 2,49 t/ha, the fertilized variant with 2,5 kg/ha
makes these increases higher than those and 5,10 t/ha, the fertilized variant with 5
obtained only after fertilization (Table 4). On kg/ha. All registered harvest ups were very
non-irrigated variant, the production increase significant.
Table 5. The Influence of irrigation levels on the production of apples for the same level of fertilization, average of
2008-2011
Fertilized Dose Non-fertilized 2,5 kg/ha Megasol 5,0 kg/ha Megasol
Irrigated norm Prod. t/ha Dif. t/ha Signif. Prod. t/ha Dif. t/ha Signif. Prod. t/ha Dif. t/ha Signif.
Non-irrigated 12,84 - Mt 13,81 - Mt 14,59 - Mt
2 l/h 14,89 2,05 *** 16,53 2,72 *** 18,12 3,53 ***
4 l/h 16,74 3,90 *** 19,23 5,42 *** 21,84 7,25 ***
The Influence of irrigation levels on the 5 kg/ha Megasol, 21,84 t/ha, an increase of
production of apples for the same level of 7,25 t/ha.
fertilization The Influence of the variety on the
The level of irrigation, on fertilization production of apples for the same level of
background brings very significant yield fertilization
increases (Table 5). The highest yields from The data presented in Table 6., shows that
unfertilized variants were obtained from Generous variety recorded high yields towards
irrigation norms of 4 l/ h, 16,74 t/ha with a Florina variety, but yield differences are
production increase of 3,90 t/ha. Production insignificant. The biggest difference of
increases amounted to 5,42 t/ha, where were production was obtained from unfertilized
applied 2,5 kg/ha Megasol and were irrigated variant, 0,28 t/ha. Florina variety gets higher
with and 4 l/h. The highest yields and hence the production but only at the variant fertilized
largest yield increases were obtained in with 5 kg/ha, where production exceeds the
irrigated variant with 4 l/h and fertilized with
95
Generous variety with 0,19 t/ha, increase that was statistically uninsured.
Table 6. The Influence of the variety on the production of apples for the same level of fertilization), average of 2008-
2011
Fertilizer dose Non-fertilized 2,5 kg /ha 5,0 kg/ha
Variety Prod. t/ha Dif. t/ha Signif. Prod. t/ha Dif. t/ha Signif. Prod. t/ha Dif. t/ha Signif.
Generous 14,96 - Mt 16,54 - Mt 18,08 - Mt
Florina 14,68 -0,28 0 16,51 -0,03 - 18,27 0,19 -
DL 5% = 0, 247 t/ha DL 1% = 0,523 t/ha DL 0,1% = 1,536 t/ha
The influence of the fertilization level on the production of apples for the same variety and
the same level of irrigation
Table 7. The Influence of the fertilization level on the production of apples for the same variety and the same level of
irrigation, average of 2008-2011
Variety Generous Florina
Non-irrigated 2 l/h 4 l/h Non-irrigated 2 l/h 4 l/h
Factor BxC
Prod. t/ha Dif. Prod. t/ha Dif. Prod. t/ha Dif. Prod t/ha Dif. Prod. t/ha Dif. Prod. t/ha Dif.
Non-fertilized 12,95 - 15,10 - 16,83 - 12,73 - 14,67 - 16,65 -
2,5 kg/ha 13,73 0,78*** 16,57 1,47*** 19,32 2,49*** 13,89 1,16*** 16,49 1,82*** 19,14 2,49***
5,0 kg/ha 14,37 1,42*** 18,11 3,01*** 21,77 4,94*** 14,80 2,07*** 18,12 3,45*** 21,90 5,25***
DL 5% = 0,182 t/ha DL 1% = 0,247 t/ha DL 0,1% = 0,331 t/ha
Analyzing the data in Table 7. and shows that concomitant irrigation and Megasol. To 2,5
the two varieties have similar production value kg/ha fertilizer, increases were 2,84 t/ha, the
but the biggest production increases were variety Generous and 2,60 t/ha, at Florina
achieved at Florina variety. On irrigated variety. At 5 kg/ha Megasol, increases were of
variants were made between 12,73 and 21,90 3,74 t/ha and 3,32 t/ha. Increasing the
productions t/ha. Production increases were water quantity, administered at 4 l/ha resulted
statistically confirmed and were in the range of in a significant increase of production increases
0,78 to 5,25 t/ha, all being very significant. obtained. Thus, at the dose of 2,5 kg/ha
Generous variety was enrolled with the lowest Megasol was recorded an increase of 5,59 t/ha,
production on non-irrigated, 12,95 t/ha and the at the Generous variety and 5,25
highest in irrigated variety with 4 l/h and t/ha at Florina variety. Dose of 5 kg/ha resulted
fertilized with 5 kg/ha Megasol, 21,77 t/ha, in increases of the production of 7,40
variant were the production growth achieved t/ha at the Generous variety and 7,10 t/ha, at
was 4,94 t/ha. Florina variety recorded the Florina variety.
highest harvest at the same variant 21,90 t/ha The Influence of variety on the production
and an increase of 5,25 t/ha. Irrigation of apples for the same level of irrigation and
combined with fertilization determines the fertilization
increase of the production increases compared Comparing the data in Table 9. it is noted that
to variants where he acted only one factor. between the varieties analyzed there are no
The influence of irrigation level on the differences of production statistically assured,
production of apples for the same variety which suggests a capacity approximately equal.
and the same level of fertilization The only variable that was a significant
Analyzing the data in Table 8. it observed that difference in the non-irrigated and fertilized
the application of irrigation causes very was with 5 kg/ha Megasol (0,43 t/ha). Overall
significant production increases at all variants the production of Florina variety was lower
studied. At a watering of 2 l/h, increases the than those of the Generous variety.
crop increases were recorded as receiving
96
Table 8. The Influence of irrigation level on the production of apples for the same variety and the same level of
fertilization, average of 2008-2011
Variety Generous Florina
Non-fertilized 2,5 kg/ha 5,0 kg /ha Non-fertilized 2,5 kg /ha 5,0 kg /ha
Factor CxB
Prod. t/ha Dif. Prod. t/ha Dif. Prod. t/ha Dif. Prod. t/ha Dif. Prod. t/ha Dif. Prod. t/ha Dif.
Non-irrigated 12,95 - 13,73 - 14,37 - 12,73 - 13,89 - 14,80 -
2 l/h 15,10 2,15*** 16,57 2,84*** 18,11 3,74*** 14,67 1,94*** 16,49 2,60*** 18,12 3,32***
4 l/h 16,83 3,88*** 19,32 5,59*** 21,77 7,40*** 16,65 3,92*** 19,14 5,25*** 21,90 7,10***
Table 9. The Influence of variety on the production of apples for the same level of irrigation and fertilization, average of
2008-2011
Dif.
Irrigation level Fertilization level Generous Florina Signif.
t/ha
Non-irrigated Unfertilized 12,95 12,73 -0,22 -
2,5 kg/ha 13,73 13,89 0,16 -
5,0 kg/ha 14,37 14,80 0,43 *
2 l/h Unfertilized 15,10 14,67 -0,43 0
2,5 kg/ha 16,57 16,49 -0,08 -
5,0 kg/ha 18,11 18,12 0,01 -
4 /h Unfertilized 16,83 16,65 -0,18 -
2,5 kg/ha 19,32 19,14 -0,18 -
5,0 kg/ha 21,77 21,90 0,13 -
The variants fertilized with 5 kg/ha, regardless doses of 5 kg/ha Megasol (18,18 t/ha), with
of irrigation level, Florina variety exceeded the increases of 22,7% (3,36 t/ha).
production Generous variety, showing a greater Influence of fertilization on the production
capacity for recovery of the fertilizer, but of apples to the same level of irrigation,
insignificant. average of the years 2008-2011.
CONCLUSIONS Fertilization brings very significant production
increases at all graduations used but irrigation
Influence on the production of apple variety, application makes these increases to be
average of the years 2008-2011. On average superior to those obtained only after
over the three years of experimentation, the fertilization. The highest yields were obtained
Generous variety showed a higher yield at fertilization with a dose of 5 kg/ha,
potential than Florina variety, but yield regardless of the norms of irrigation applied
differences between them are significant with a maximum increase irrigated with 4 l/h
Influence of drip irrigation level on apple (5,10 t/ha).
production, average of the years 2008-2011 Influence of irrigation level on the
Irrigation level resulted in increases of the production of apples for the same level of
production obtained and increases as highly fertilization, average of the years 2008-2011.
significant statistically assured for the two Irrigation resulted in very significant
levels of irrigation applied. The highest yields production increases regardless of fertilization,
were recorded in variants where were applied yields based on the value of 2,05 t/ha and
norms of 4 l/h, increases production of 40,1%, reaching at a value of 7,25 t/ha. The highest
and increases of crops of 5,52 t/ha. Influence yields and hence the largest yield increases
of fertilization level on the production of were obtained in irrigated variant with 4 l/h and
apple, average of the years 2008-2011. fertilized with 5 kg/ha Megasol, 21,84 t/ha, and
Level of fertilization causes very significant an increase of 7,25 t/ha.
production increases for all levels of fertilizer Influence of variety on the production of
applied. The highest yields were achieved at apples for the same level of fertilization,
average of the years 2008-2011.
97
The only difference between the two varieties 2 l/h compared to 1,94 t/ha obtained by Florina
production was recorded in the unfertilized variety, up to 7,40 t/ha, increase made at norm
variant, where the Generous exceeded the of 4,94 t/ha, increase achieved at a dose of 4
production of Florina variety by 0,28 t/ha, l/h, compared to 7,10 t/ha,obtained at Florina
which is a significant difference statistically variety. Generous variety exploited more
assured being insignificant. Fertilizer efficiently the effect of irrigation.
administration has reduced the distance All registered production increases at all
between productions, reaching at the dose of 5 graduations used were very significant.
kg/ha, Florina variety exceeds the production at Influence of variety on the production of
the Generous variety, but the differences are apples for the same level of irrigation and
insignificant. fertilization, average of the years 2008-2011.
Influence of fertilization level on the There are no differences of production
production of apples for the same variety statistically assured between the varieties
and level of irrigation, average of the years analyzed, which suggests a production capacity
2008-2011. approximately equal. Overall the yields of
Under the same conditions of fertilization and Florina variety were lower than the Generous
irrigation, the reaction was different varieties. variety. The largest differences in production
Thus, Generous variety obtained yield were of 0,43 t/ha and the lowest, of 0,01 t/ha.
increases in the range of 0,78 t/ha, at doses of
2,5 kg/ha to 1,16 t/ha obtained by Florina REFERENCES
variety, up to 4,94 t/ha, achieved growth in a Atkinson D. 1977. The effect of trickle irrigation on the
dose of 5 kg/ha towards 5,25 t/ha obtained by distribution of root growth and activity in fruit trees.
Florina variety. This variety has used more Seminaires sur l’irigation localisee, Bologne Italie 6/9
effectively the fertilization effect. All registered novembre
production increases at all graduations used, Botu I., Botu M. 2003. The modern and sustainable fruit
tree culture. Ed. Conphys, Râmnicu Vâlcea
were very significant.
Cohen D. 1993. Water deficit and plant growth. Hort.
Influence of irrigation level on the Science, vol.21, nr. 5
production of apples for the same variety Popescu M., Godeanu I.,1989.The drip irrigation, a
and level of fertilization, average of the years method for future for treeculture. Hort science nr. 11
Rzekanowski C., Rolbiecki S., 2000. The influence of
2008-2011. drip irrigationon yields of some cultivars of apple
Applying irrigation causes very significant trees in central Poland under different rainfall
production increases at all variants studied. conditions during the vegetation season, Acta
Horticulturae 537, Lisbon, Portugal
Thus, Generous variety obtained yield
increases in the range of 2,15 t/ha, the norms of
98
THE INFLUENCE OF THE DRIP IRRIGATION ON THE PHYSICAL

AND CHEMICAL APPLE CHARACTERISTICS
Nicoleta OLTENACU, Cătălin Viorel OLTENACU

59 MĉrĉƔti Blvd, District 1, 011464, Bucharest, Romania
Abstract
The premise of scientific and technical experiments was to evaluate the behaviour during the winter storage of the 2
cultivars of apples (Generos and Florina) introduced into experimental and comparison with other cultivars. The drip
irrigation was started from March 20, administering daily for 4 hours. Recommended watering periods, depending on
the weather of the year are:5-15 of March; 1-15 of May (after the fruit tying); 15-25 of July; 10-15 of September; 1-15
of November, the supply. The needed water norms are between 300 and 700 m3/ha.
Key words: chemical, irrigation, organoleptic, physical, storage.

Influence of drip irrigation on production To establish the ability to maintain quality fresh
quality is the effect on the nutritional and food apples were taken 5 homologated cultivars, of
value of fruits (Atkinson D., 1977; Gherghi et. which Generos and Florina disease-resistant
al., 1972). Nutritional and food value of the and Jonathan, Golden Delicious and Idared,
fruits represents the purpose for growing fruit with widespread in the current assortment in
trees, fruit bushes and strawberries as our country. Fruits were kept after harvesting a
supplements of vitamins, sugars, minerals, period of about 50-60 days, depending on
acids and energy (calories) needed for proper cultivar, in the storage spaces of the resort,
body growth and development (Botu, 2003). In from where they were then taken for
addition, the fruits also contain magnesium, experiments and refrigerated in storage
manganese, copper, zinc and iron, as well as conditions (t=0...+4°C, RH = 90-95%) over a
the important minerals in the diet (Gherghi A., period of 110 days in cold storage of
1983) Belciugatele Didactic Station, located inside
Apples in controlled storage conditions can the Moara Domneasca Farm.
prolong the storage period of 3-9 months After removal from storage were made
without losing its qualities. Storage and determinations regarding the following:
consumption during the same organoleptic - the quantitative and qualitative losses
characteristics depend on the terms offered and recorded by the fruit during storage;
the particular cultivar. It is known that during - modifying fruit firmness (penetrometer
storage, the apples suffer structural-textural determined) during storage;
changes that are produced slower or faster - evolution of the main chemical components
depending on the characteristics of cultivars of the apples during storage;
and storage conditions (Gherghi A et. all., - organoleptic assessment (appearance,
2001). When apples with great firmness at firmness, taste) of fruit after storage.
harvest are stored in controlled atmosphere The premise of the scientific and technical
storage, they can use the same value until the experiments was to assess behavior during
next harvest of early cultivars (Gherghi A., winter storage of the 2 cultivars of apples
1989). introduced in the experimentation and
comparison with other cultivars. Existence of
99
optimal flow experience across storage-keeping Specol spectrophotometer and expression in
with reference to standardized packaging units, mg/100g.
space conditioning, refrigeration thermostatic To assess organoleptic tasting were performed
cell, organoleptic testing laboratory, equipment using the tasting sheets that contain a number
and devices for measurements and analyzes of three assessment criteria (appearance,
provided made it possible to achieve this goal. texture, taste). Notation (appreciation) was
The experiments were conducted in 5 different performed using 100 points scale. Each of the
comparative variants based on the mentioned three assessment criteria has different weight in
cultivars, with 3 repetitions per general notation, depending on their
variant.During storage it has been made the importance. Thus 'the aspect' represents 15%,
daily examination of the thermal-hydric factors 'texture' 35% and taste 50%. Depending on the
in the refrigeration room, for ensuring that score achieved 5 quality classes, according to
optimal conditions to maintain quality Table 1.
(temperature 0 ... 40C and RH 90 .. 95%). Also
we proceeded to assess the ability to maintain Table 1. Classification of fruit after scoring
fruit quality by findings the appearance Rating (quality category) Score
changes occurred regarding dehydration, the very good 80-100
appearance and evolution of different storage good 60- 79
disease. Taking into account the high degree of acceptable 40-59
mediocre 20-39
maturity of the fruit during storage and quality
inappropriate 0-19
changes occurring during storage it was
estimated that during cold storage the limit is
110 days. After removing apples from the
storage space the determinations were Influence of drip irrigation on quantitative
performed on the table and impairment losses and qualitative losses
(spoilage) and fruit firmness, biochemical The results of the quantitative and qualitative
analysis of the main components and losses recorded by the fruit during storage at
organoleptic testing at this stage. Determination the experimental variants are presented in
of mass loss and spoilage during storage Table 2.
products was done by weighing samples of fruit
resulted, respectively the fruit impaired Table 2. Losses while preserving apples
(spoiled) during storage, compared with the Losses (%) Remarks on
Var Cultivar
initial amount deposited, the results being Total Weight Damage damaged fruits
3.54 % gray
expressed as a percentage. rottenness
Fruit firmness was made manual with a V1 Jonathan 19.28 7.41 11.87
8.33% internal
penetrometer piston type Effe-gi 1 mm, on a collapse
Golden
total of 25 fruits per variant, each fruit was V2
Delicious
24.20 8.62 15.58 gray rottenness
penetrated at 4 points in the equatorial zone V3 Idared 17.55 5.17 12.38 gray rottenness
after removing the epidermis in those points. 4.26 % gray
Tests for the main chemical components (dry V4 Florina 14.66 5.88 9.08 rottenness
4.82% heart rot
substance, total sugar, titratable acidity and V5 Generos 5.94 5.94 - -
ascorbic acid) were performed by standard AVERAGE 16.33 6.60 9.78
laboratory methods as follows:
- dry substance was determined by The data presented shows that total losses
refractometry method using ABB table during storage are between 5.94-24.20%
refractometer with results expressed in%: (depending on cultivar), with an average of
- total sugar by Berthrand method with results 16.33%. Weight loss varies between 5.17-
expressed in %; 8.62% with an average of 6.6% and by spoiling
- acidity by titrimetric method with results from 0-15.58% with an average 9.8%.
expressed in % of malic acid; The lowest total losses (5.94%) are recorded on
- vitamin C (ascorbic acid) by Generos cultivar (Figure 1).
spectrophotometer method, using UV-VIS
100
During cold storage the cultivars studied
showed a different degree of pulp consistency,
varying between 3.71 kgf/cm² (V4) and 4.82
kgf/cm² (V2).
Average value of the 5 variants was 4.13
kgf/cm², surpassed by the Golden Delicious
cultivar (4.82 kgf/cm²).
During storage, the fruit firmness decreased in
all variants in different ratios, ranging from
3.93 kgf/cm² on an average of 3.66 kgf/cm²,
value with 7.4% less than the original.
Fruits which remained firmed are related to: V3
(Idared), V1 (Jonathan) and V5 (Generos) on
Figure 1. The aspect of apples from Generos cultivar which firmness decreased from 3.68-5.85%.
after storage Firmness showed the largest decrease in variant
V2 (Golden Delicious) were registered
This variant shows reduced mass loss and drastically firmness decreased from 37.15%,
recorded spoiling due to disease attack. The respectively to 26.76%.
total losses are recorded by Golden Delicious Influence of drip irrigation on chemical and
cultivar (24.20%) that both weight loss and physical characteristics to apples
spoiling is the highest (Figure 2) Results on the evolution of the main chemical
components during storage are presented in
table 4.
Table 4. Principal chemical components of apples during

and after storage
Dry Soluble Titratable Total Ascorbic
Substance acidity (%) carbohydrates acid
Cultivar
(%) (malic acid) (%) (mg/100g)
initial final initial final initial final initial final
Jonathan 13.4 13.5 0.50 0.42 11.26 10.29 9.45 7.66
Golden 11.8 12.2 0.39 0.32 9.90 9.00 9.18 7.35
Idared 11.8 13.0 0.60 0.53 9.60 8.59 6.70 5.41
Florina 12.8 13.1 0.59 0.41 10.66 9.88 9.65 7.68
Generos 13.3 13.9 0.65 0.56 11.05 10.47 9.06 7.22
Average 12.62 13.14 0.55 0.45 10.50 9.65 8.81 7.06
Figure 2. The total losses recorded at studied varieties Differences
+5.20 -17.0 -8.70 -16.4
(%)
Influence of drip irrigation on fruit firmness

Results regarding the fruits firmness Initial dry substance content at the
(penetrometer determined) during storage are experimental variants was between 11.8 and
presented in Table 3 13.4%, with an average of 12.62%, Jonathan
cultivar and Generos cultivar with the highest
Table 3. Firmness of apples during storage and after values and the lowest at the Golden Delicious
storage and Idared cultivar. During cold storage the
Penetration value (kgf/cm²)
content of dry substance increased in all
Variant On After Reduction variants reaching on average of 13.14%. The
Cultivar average increase recorded was 5.20%. The
insertion keeping %
V1 Jonathan 3.93 3.73 5.09 initial acidity of the fruit (expressed in malic
V2 Golden 4.82 3.53 26.76 acid /100g) ranged from 0.39-0.65%, with an
V3 Idared 4.08 3.93 3.68 average of 0.55%. The lowest acidity was
V4 Florina 3.71 3.23 12.94 recorded by Golden Delicious cultivar and
V5 Generos 4.10 3.86 5.85
Average - 4.13 3.66 10.86
highest by Generos and Idared cultivars.
During cold storage fruit acidity decreased in
all variants on average with 17.0%.
101
Total carbohydrate content initially ranged Table 6. Organoleptic assessment of apples after storage
between 9.60% and 11.26% depending on the Rating cultivar taste - (points)
variant, with an average of 10.50%. The lowest The
Cultivar Firm- Grade Place
values were seen in Idared cultivar and the Aspect Taste average
ness
highest at Jonathan cultivar. During cold amounts
Very
storage, the carbohydrate content decreased by Jonathan 12.86 27.00 44.29 84.15
good
5
average of 8.7%. Initial content of ascorbic acid Very
(vitamin C) ranged from 6.70-9.65 mg/100g Generos 15.00 32.00 48.57 95.57 1
good
depending on the variant, with an average of Idared 13.71 34.00 44.29 92.00
Very
3
8.81 mg/100g. Fruits with high content of good
ascorbic acid belong to the Florina Very
Florina 13.71 34.00 45.71 93.42 2
good
and Jonathan cultivars. During cold storage, Golden Very
the ascorbic acid content decreased in all cases, 12.00 30.00 42.86 84.86 4
delicious good
with an average of 16.4%. The results of the Overall
13.46 31.4 45.14 90.00
measurements regarding the weight average, average
structural-texture firmness and the form index
of apples are shown in table 5. The highest score for taste assessing was
obtained by Generos. At the opposite side it
Table 5. Physical features of apples was Golden Delicious cultivar with the lowest
No. Average Firmness Form
score of assessment.
Variant Cultivar The total score in apples taste assessing was
crt. weight (g) (kgf/cm²) index
1 V1 Jonathan 171.05 3.47 0.84 84.15-95.57 points depending on variant and
2 V2 Generos 207.37 4.85 0.84 rated 'very good', with an overall average of
3 V3 Idared 209.20 4.48 0.83 90.00 points. On the first place it stands
4 V4 Florina 179.58 6.24 0.92 Generos. Latest seats were occupied in order by
Golden
5 V5
delicious
149.16 4.47 0.94 Golden Delicious and Jonathan.
Overall average 183.27 4.70 0.87
CONCLUSIONS
Influence of drip irrigation on organoleptic Conclusions on losses
Organoleptic test results from Apple
Among the cultivars tested best behaved was
(appearance, firmness, taste) after storage are
Generos, which ranked first a total loss of
presented in Table 6
5.94% without losses through spoilage. Golden
In terms of appearance it was found that the
Delicious presented the worst results, with
Generos cultivar has obtained the highest score
24.20% total losses of which 15.58% through
(15.0) of all experimental variants
spoilage.
while Golden Delicious had the lowest score
from experience. From the point of view of Conclusions on fruit firmness
apple appearance all variants showed a high Compared to the initial firmness of 3.71-4.82
score from 12.00–15.00 points depending on kgf / cm ² depending on the cultivar, apples
the variant, with an overall average of 13.46 after storage showed firmness values of 3.23-
points. 3.93 kgf / cm ² depending on the cultivar.
Regarding firmness, the apples obtained from The apples firmness dropped during cold
27.00-34.00 points depending on the variant, storage levels in average with 7-10%, with a
with an overall average of 31.40 points. Top- range between 3.68-26.76% depending on the
rated variants were Idared and Florina, the cultivar. Between cultivars were observed in
lowest being Jonathan cultivar. this order Idared, Jonathan and Generos with
Meanwhile Jonathan and Golden got the lowest fruit firmness reduction between 3.68-5.85%.
score (12.0). On the last place between cultivars was located
Regarding taste, the apples obtained from Golden Delicious whose firmness decreased by
42.86-48.57 points depending on the variant, 26.76%.
with an average of 45.14 points.
102
Conclusions on changes in chemical overall average of 13.46 points. Generos
constituents cultivar obtained the maximum possible score
The main chemical components (soluble dry of 15 points, while Golden Delicious
substance, titratable acidity, total sugars and cultivar had the lowest score. In terms of
ascorbic acid) during storage of apples undergo firmness, the apples obtained from 27.00 to
some changes regarding the increase or the 34.00 points with an overall average of 31.40
decrease of their recorded content during the points. Idared and Florina cultivars were best
storage in refrigerated space. In that period of rated and Jonathan cultivar received the fewest
110 days, the soluble solids substance content points. Regarding the taste, the apples obtained
increased by 5.20% and the titratable acidity, from 42.86-48.57 points, with an average of
total sugars and ascorbic acid were reduced by 45.14 points. The highest score on taste
17.0%, 8.70% and 16.40% assessing was obtained by the Generos cultivar.
On the opposite side was the Golden delicious
From the analysis resulted it is showed that
cultivar with the lowest score.
among all variants, a balanced content of these
components is found at the variants V1- The total score at the apples assessing taste was
Jonathan cultivar. 84.15-95.57 points and was rated 'very good',
with an overall average of 90.00 points. The
Conclusions on fruit size and shape index
first place was located by the Generos cultivar.
Apples of the late maturing apple cultivars The last place was taken in order by the Golden
studied, differs in fruit size, structural-textural Delicious and Jonathan cultivars.
firmness and form index. The average weight
of the fruit ranges from 149.16-209.20 g REFERENCES
(depending on variant), with an overall average
Atkinson D., 1977. The effect of trickle irrigation on the
of 183.27 g. The fruits over 200g/pcs presented distribution of root growth and activity in fruit trees.
the Generos and Idared cultivars. Seminaires sur l’irigation localisee, Bologne Italie 6/9
Firmness of apples varies between 3.47 and novembre, p. 51-60
Botu I., Botu M., 2003. The modern and sustainable fruit
6.24 kgf / cm ² (depending on variant) with an
tree culture. Ed. Conphys, Râmnicu Vâlcea
overall average of 4.70 kgf / cm ². The highest Cohen D. 1993. Water deficit and plant growth. Hort.
value was determined from Florina cultivar, Science, vol.21, nr. 5
and the lowest, from the Jonathan cultivar. The Gherghi A. et al., 2001. Biochemy and Fiziology of
form index of apples had an overall average of fruits. Romanian Academy Editure, Bucharest
Gherghi A., 1983. Fruits and their importance.Technic
0.87 with a range from 0.83-0.94, depending on Editure, Bucharest
the variant. Gherghi A. et al., 1989. Tutorial on technology for
Conclusions on some organoleptic keeping of horticultural products. ICPVILF,
Technical tutorial nr. 60
characteristics
Gherghi A., Mircea I. and Millim K., 1972. Valorificarea
In terms of apple’s appearance, all variants merelor si perelor, Indrumari tehnice ICVLF, nr. 7,
showed a high score of 12-15 points, with an Bucuresti
103
RESEARCH ON FACTORS AFFECTING RASPBERRY PLANT GROWTH
Parascovia SAVA
IP Scientific and Practical Institute of Horticulture and Food Technologies, 14, str. Costiujeni, MD-
2019, Chisinau, Republic of Moldova
Abstract
The paper presents the results and observations made in Moldova in the period 2002-2010 on the factors that influence
plant growth and development phenological phases of 29 introduced raspberry variety. It was established as the
beginning of flowering until early fruit maturation medium passes in 27-47 days. After assessing the extent of fruiting
plant varieties revealed the Pathfinder, Hybrid Bulgarian, Lloyd George, Rubin Bulgarian, The Latham. The average
weight of the raspberry fruits is a criterion for assessing their quality and which highlighted these varieties Hybrid
Bulgarian, Rubin, September, Delbard Magnific, Lazarevscaia. Study after winter hardiness of raspberry variety
introduced revealed the most resistant to Pathfinder, June, Cayuga, Solnisco, Lazarevscaia, Balsam. Varieties that
showed an increased resistance to drought are Stolicinaia, Malling Promise, Lloyd George. Among disease-resistant
varieties (Bean and Septoria) have revealed Kuthbert, Indian Summer, Hybrid Bulgarian, St. Walfried, The Latham
Key words: raspberry, phonological phases, weight of berries, plants resistance, Republic of Moldova.

Hydrological regime is one of the factors Studies on the impact of growing conditions
limiting raspberries crop. Raspberry shoots and plant development, deployment
during the growth and fruits ripening period, phenological development stages of raspberry
especially needs a large amount of moisture. varieties introduced and the influence of
Insufficient or excess of water during this climate on crop of fruits quality. The research
period not only adversely affects the fruits and was conducted in the experimental field of the
shoots at the moment, but also largely Institute of Horticulture as recognized and
determine their viability, harvest of next year approved methods for studying small fruits.
(Kazacov and Kicina, 1980). The plantation was established in 2000 on land
All varieties of raspberry strength are closely without irrigation after planting distance of
related to temperature regime during the 2.5x0.5 m
growing season determine the plant status The study included 29 introduced varieties of
during the resting state. So now, plant growth raspberry: Barnauliscaia, Rubin, Delbard
in the summer, in wet conditions and high Magnific, Stolicinaia, Kirjaci, Pathfinder,
temperatures leads to branching stems and President, Kuthbert, Indian Summer, Hybrid
prevents wood cooking at ramifications arising Bulgarian, June, Marfilk, Kobfuller, Cayga,
prematurely, which freezes in winter. Most Malling Promise, Solnishco, Lazarevscaia,
varieties not withstand temperatures below Balsam, Brigantine, Meteor, Red Wadenswil,
minus 25°C (Belîh et al,, 2004; ʶ̨ndratenc̨ Lloyd George, Bulgarian Rubin, Paul
and Ňdtocii, 2002). Camerzid, September, St. Taylor, Walfried,
Deep raspberry plantations thrive fungal Latham, Malling Jewel. Varieties were assessed
diseases, bacterial, viral, especially bean, by the degree of fructification with note 1 (low
Septoria, rust, bacterial cancer. Land too acidic fructification) up to grade 5 (high
and rich in nitrogen, bean grows more quickly, fructification), the degree of resistance to bean,
especially in dense bushes (Hoza, 2005; Septoria, frost and drought were rated at 0
Bogdanova, 2011). (unaffected) and Note 5 (strongly affected).
105
RESULTS AND DISCUSSIONS season aier, which reached only the value of
15.71°C, compared to the highest values of
Raspberry is a very demanding crop in soil
moisture due to shallow the root system. In the 18.69 º C, set in 2007.
absence of rainfall during critical periods of It also showed the lowest average annual
plant development (growth period of shoots temperature of only 9°C in 2003, compared
and fruit formation) and to avoid adverse with the highest temperature of 11.5°C,
effects on raspberry fruit crop requires recorded in 2007.
irrigation plantation. Still made on rainfall data Air temperature during 2007 for June, July and
from the period of observation during the years August with corresponding values of +23.6,
2002-2010 are included in Table 1. 25.8, 23.9°C, which was the highest for the
entire period of observations. Especially in
Table 1. Rainfall during the research period (mm) summer air temperature ranged between +17.9
Months 2002 2003 2004 2005 2006 2007 2008 2009 2010 and +27.7 values and C. Phases phenological
III 58.7 12.4 31.0 14.8 89.1 33.7 35.6 70.8 29.0 development of raspberry plants depends on the
IV 30.6 34.9 28.0 49.5 36.6 36.5 43.2 2.7 45.1
V 10.4 20.6 75.0 75.8 97.1 19.0 42.6 33.3 69.2 variety and other factors, but in particular on
VI 60.1 21.6 11.0 104.8 81.6 23,7 62.8 39.0 85.0 climatic conditions of the year, Table 3.
VII 133.4 17.4 10.0 17.6 53.0 3.6 50.2 67.2 67.2
VIII 80.6 27.4 25.6 150.9 67.7 33.8 30.8 32.6 53.0 According to phenological observations
IX 47.1 52.7 69.6 4.9 57.8 24.8 77.7 21.7 46.7 (Tables 1, 2, 3), and meteorological data
X 84.2 62.1 33.4 11.0 13.6 71.0 16.0 29.6 68.9
IV-IX 446.4 236.7 374.6 429.3 491.5 246.1 358.9 297.4 464.1 recorded in 2003 year, fell the least amount of
year 618.0 376.4 651.9 660.3 560 474.4 460.5 455.1 735.2
annual rainfall-376.4 mm was recorded and the
lowest average annual temperature +9°C, and
According to Table 1 analysis of data on in vegetation period + 15.71 º C, which led to
rainfall amount shows that the minimum annual the late burgeoning of raspberry plant at April
precipitation that has accumulated in 2003 year 21 during the researches.
was 376.4 mm, and the largest amount was Air average temperature higher than usual,
collected in 2005 year in the amount of 660.3 recorded in February by + 4.9 º C and +7.2 º C
mm, although rainfall during the year and the
in March of 2002 year contributed to the early
vegetation period were uniformly distributed,
budding of raspberry plant from March 20.
including during critical periods of growth and
Phenological phases carrying the raspberry
development of the raspberry plant. The highest
plants, during research
of monthly precipitation fell in August, 2005 in
the amount of 150.9 mm, in July 2002 year to Table 3. Phenological phases carrying the raspberry
133.4 mm, in June 2001 year to 129.5 mm. plants, during research
The smallest amount of monthly precipitation Phenological
2002 2003 2004 2005 2006 2007 2008 2009 2010 mean
fell in July 2007 to 3.6 mm, in September 2005 phases
beginning of
to 4.9 mm in August 2001 to 5.4 mm. Air vegetation
20.03 21.04 25.03 10.04 09.04 29.03 05.04 24.03 03.04
temperature and soil moisture are important on Duration
44 28 51 39 42 43 30 46 45 46
between phases
development and deployment of raspberry flowering 02.05 18.05 13.05 19.05 21.05. 10.05 04.05 08.05 18.05
phenological phases. Temperature during the Duration
43 31 34 27 30 36 47 35 35 33
between phases
observation period is presented in Table 2. Fruit maturation 14.06 19.06 15.06 14.06 19.06 15.06 20.06 12.06 22.06
Table 2. Air temperature during research, (0C)

Raspberry plants flowering usually begins in
Months 2002 2003 2004 2005 2006 2007 2008 2009 2010
III 7.2 1.0 5.4 2.3 2.6 7.1 7.2 3.2 3.4
early May, although some delays may occur up
IV 10.4 8.5 10.8 10.5 10.9 10.6 11.0 12.2 11.0 in the second half of May, depending on the
V 17.9 11.5 14.8 16.5 15.6 18.9 15.5 16.4 16.8
VI 20.1 1.2 19.3 18.6 19.7 23.6 20.9 21.1 21.0 amount of assets accumulated temperature
VII
VIII
24.3 21.6
21.3 22.6
21.7
21.1
27.7 22.1 25.8
21.8 22.2 23.9
22.3
23.8
23.9
23.0
23.1
24.9
needed to start the phenological phases. Length
IX 16.6 15.6 15.9 18.3 17.1 16.7 15.5 18.7 16.1 of time between phenological stages of budding
X 9.5 9.2 11.4 17.2 12.1 11.3 12.5 11.6 7.5
III-X 17.2 15.7 16.43 18.66 17.1 18.69 17.36 18.13 17.20
and flowering varies between 28-51 days. Since
year 11.0 9.0 10.29 11.43 10.2 11.5 11.4 11.3 10.62 the beginning of flowering until early fruit
maturation medium passes in a period of 27 to
The 2003 year was marked by the lowest 47 days.
average of temperatures during the growing
106
is different, and lack of rainfall can affect the
quantity and quality of the harvest, reduce fruit
weight, if necessary measures are not related to
irrigation. As a result of research conducted on
plant development, degree of fruiting, fruit
weight, degree of damage by disease, frost and
drought were assessed raspberry varieties on
irrigated land, and the data obtained are
presented in Table 4.
Appreciation fruiting varieties studied by the
ability to highlight varieties allowed Pathfinder,
hybrid Bulgarian, Lloyd George, Rubin
Figure 1. Flowering period of raspberry fruits
Bulgarian, Latham, who showed top marks in
Period, which lasts from the beginning of the grade 5 on level fruition.
vegetation, to fruit maturation, varies between The average weight of the fruits of raspberry is
59-87 days. Raspberry fruit ripening usually a criterion for assessing the quality varieties.
begins in the second-the third decade of June, The results obtained on fruit size allowed to
with some deviations depending on the highlight the following varieties of fruits
temperatures set in this period. largest: Hybrid Bulgarian-3.5 g, Rubin,
Raspberry reacts negatively to lack of moisture September-3.2 g, Delbard Magnific-2.9 g,
during fruit formation and growth, which can Lazarevscaia – 2.7 g. Small fruit varieties from
lead to fruit weight reduction, fruit quantity and 1.3 to 1.6 g were: June, Meteor, Pathfinder,
quality. Red Wadenswil, Indian Summer, Kuthbert, St.
Walfred.
Table 4. Development indices and the degree of
resistance raspberry plant, years 2002-2006
degree of Degree of Degree of Degree of
Degree of Average
Bean septoria frost drought
Variety fructification, fruit weight
damage, damage, damage, damage,
note grade,g
note, note note note
1.Barnauliscaia 2 2.0 2 1 2 3
2.Rubin 3 3.2 5 3 2 4
3.Delbard
3 2.9 3 3 1 5
Magnific
4.Stolichnaia 4 2.5 4 3 1 0
5.Chirjaci 4 2.0 4 3 1 4
6.Paphinder 5 1.6 2 3 0 2
7.President 1 2.5 2 2 1 -
8.Kuthbert 1 1.6 0 0 4 3
9.Indian
3 1.6 0 0 2 2
Summer
10.Hybrid
5 3.5 0 0 1 3
Bulgarian
11.June 1 1.3 1 1 0 4
12.Marfilk 1 2.0 2 2 2 -
13.Kobfuller 4 2.4 - - 1 2
14.Cayga 3 2.5 1 1 0 -
15.Malling
4 2.1 3 2 2 0
Promise Figure 2. Maturation period of raspberry fruits, variety
16.Solnishco 3 2.2 1 1 0 4
17.Lazarevscaia 4 2.7 4 4 0 1 Delbard Magnific
18.Balsam 3 2.3 1 2 0 1
19.Brigantine 3 1.9 2 2 1 2
20.Meteor
21.Red
1 1.6 2 2 1 4
Research on winter hardiness of raspberry
4 1.6 1 1 2 1
Wadenswil
22. Lloyd
variety introduced, included in the study and
5 2.7 2 3 1 0
George
23.Rubin
appreciation revealed the 0 score of the
5 2.5 3 2 2 4
Bulgarian
24.Paul
toughest as: Pathfinder, June, Cayuga,
2 2.4 - - 2 3
Camerzid Solnishco, Lazarevscaia, Balsam. Varieties
25.September 4 3.2 4 4 1 5
26.St. Walfried 4 1.7 0 0 2 1 showed an increased resistance to drought are
27.Taylor 1 2.0 2 2 3 1
28.The Latham 5 2.1 0 1 1 1 Stolicinaia, Malling Promise, Lloyd George.
29.Malling
Jewel
2 2.2 3 2 2 3 Among disease-resistant varieties (bean and
Variation limits 1-5 1.3-3.5 0-5 0-4 0-4 0-5
Septoria) were highlighted: Kuthbert, Indian
Summer, Hybrid Bulgarian, St. Walfried, The
Raspberry varieties capacity to adapt to the new Latham.
conditions of growth and development of plants
107
CONCLUSIONS Solnishco, Lazarevscaia, Balsam.
http://agricultureforlife.usamv.ro:9080/UserArt
As a result of scientific research conducted on
icle#
developing varieties introduced raspberry
established that: Varieties which showed a high resistance to
drought are Stolicinaia, Malling Promise, Lloyd
Budding is usually between 20.03-10.04,
George.
although there are some variations until 21.04.
The disease-resistant varieties (bean and
Early flowering begins average over 28-51
Septoria) have revealed Kuthbert, Indian
days. Early flowering usually occurs in early
Summer, Hybrid Bulgarian, St. Walfried, The
May at 02.05.
Latham.
Early fruit ripening occurs on average at 27-47
days after the beginning of flowering. REFERENCES
Maturation begins usually in the second-the Mladin Gh., Mladin Paulina, 1992. Cultura arbuƔtilor
third decade of June from 12 till 20.06. fructiferi pe spaԑii restrânse, BucureƔti, p.32-39.
depending on the year. ʶ̌ž̡̨v I., ʶiciň, V., 1980. ʺ̌liň. ʺ̨s̡v̌,
After assessing the extent of fruiting plant R̨ss̖lih̨zizdat, p. 5-21.
ʶ̨ndratenco P., Nadtocii I., 2002. Calina, malina, ojina
varieties revealed the Pathfinder, Hybrid ta oblepiha. Sorti razmnojenia, biroƔcivania ta
Bulgarian, Lloyd George, Rubin Bulgarian, vicoristania. ʶiiv, p.15-40.
The Latham. Belîh ʤ., Backlanova G., Beliaev ʤ., 2004. ʺ̌liň
The average weight of the fruits of raspberry is crasnaia v l̖s̨st̖pi Priobia. ˀʤˁˈʻ. Sib.̨td-ni̖.
a criterion for assessing their quality and which ʻʯʿ˔ʽˁ i̥. I. V. ʺiciriň. – N̨v̨sibirsc, p.47-56.
Hoza D., 2005. CĉpƔunul, zmeurul, coacĉzul, murul.
highlighted the following varieties as Hybrid
Tehnici de cultivare. BucureƔti, Editura Nemira, p.
Bulgarian-3.5 g, Rubin, September-3.2 g, 96-153.
Delbard Magnific-2.9 g, Lazarevscaia-2 7 g. B̨gďn̨v̌ I. i dr., 2011. S̨rť i ̌gr̨t̖hnič plodovîh,
Study regarding the raspberry varieties iagodnîh i decorativnîh culitur dlia Urala.
introduced after winter hardiness revealed the ʫčt̖rinburg, ʧ˄ʿ ˁʽ «ʤsbestovscaia tipografia, p.
36-41.
most resistant as: Pathfinder, June, Cayuga,
108
PHENOLOGY RESEARCH ON BLACKBERRY DEVELOPMENT

IN REPUBLIC OF MOLDOVA
Parascovia SAVA, Cristina CATERENCIUC
IP Scientific and Practical Institute of Horticulture and Food Technologies ChiƔinau, 14,
str. Costiujeni, MD-2019, ChiƔinau, Republic of Moldova
Abstract
The paper presents research results and observations made on the development of phenological stages and plant
development of blackberry varieties Darrow, Smoothstem, Thornfree studied during the years 2010-2012 in the
Republic of Moldova. It was established that during the period between budding and flowering was 31-46 days and
fruit ripening begins at 55 -64 days from the beginning of flowering. The varieties studied during fruit maturation until
early vegetation ranges from 88 to 114 days. The average length of blackberry shoots ranged from 1.18 to 3.29 m and
the average number on bush was 8-11. pcs. The average mass of blackberry fruit settled in the amount of 2.9 to 4.9 g.
Bush fruit number ranged from 224 pcs. to 483 pcs.
Key words: blackberry, varieties, phenophases, fruit mass.
INTRODUCTION which matures on bush are the largest (Cociu,

Oprea, 1989; Babuc, 2012).
Small fruits have and continued to have an
important role in the national economy and in
creating a cleaner environment and beneficial
as everyday living. Blackberry bush culture The research has been conducted on
have a great importance because of taste demonstration experimental field of Small
qualities, herbal capacities, being rich in fruits laboratory in the Technological-
content of tannins, flavones, organic acids, Experimental Station 'Codru' of IP ISPHTA. As
vitamin C, pectic substances etc. (Cociu, research objects was included 3 varieties of
Oprea, 1989; Chira, 2000).The Importance of blackberry: Darrow, Smoothstem, Thornfree.
blackberry bush is subject to a number of Blackberry plantation was established in 2007
advantages over other fruit crops. One of these year after planting distance of 3.0 x 1.5 m,
advantages is that blackberry bush easily and number of plants of each variety in the each
quickly multiply. He enters and gives early iteration was 20. Scientific study was
bearing crops rather large. The yields are performed according to field and laboratory
obtained from plants of blackberry in the 3-4 - methods under accepted and approved program
third year after planting. Because blackberry for small fruits (Cociu, Oprea, 1989;
bush blooms later, the flowers not affect by Miciurinsc, 1973).
spring frosts (Mladin, 1992). Blackberry bush,
early varieties, blooms during the last decade of RESULTS AND DISCUSSIONS
May and the first days of June to late varieties.
Swelling buds, that usually occurs in March,
Flowering duration is 5-8 days. While most
with some variation from year to year, the sum
varieties are autogamous, cross pollination
of active temperatures reach 60-80°C for
ensures maximum yields and high quality. Fruit
blackberry varieties (from a biological
maturation occurs gradually, and the during of
ripening is related to the particular variety, threshold +5°C). Blackberry varieties budding
which varies from 20 to 25 days for early begins when, the sum of active temperatures
varieties and from 50 to 80 days for late varies from 80 to 150°C (Balan, CimpoieƔ,
varieties. Usually, the first fruits of blackberry, BarbĉroƔie, 2002). In the first half of 2012 year
109
observations were made on phenological rainfall during the year and especially during
development phases of blackberry varieties. the growing season but besides all these, there
Evidence of harm caused by low winter are also unevenly distributed, especially during
temperatures was conducted in spring, during critical periods of plant development, and when
the accelerated growth of plants. The the air temperatures are too high. Data
impairment of blackberry plants by low winter accumulated rainfall amount and temperature
temperatures was established as a result of established during the vegetation period are
observations and appreciated as middle with included in Table 1.
the note 3.The climate conditions on Republic
of Moldova are quite complicated. Insufficient
Table 1. Climatic conditions during the vegetation period of research

2010 2011 2012 Year average
Month Rainfall Air temp Rainfall Air temp Rainfall Air temp Rainfall Air temp
(mm) (ºC) (mm) (ºC) (mm) (ºC) (mm) (ºC)
IV 45.1 11.0 57.6 9.9 16.4 13.2 39.7 11.4
V 69.2 16.8 56.4 16.4 65.3 19.2 63.6 17.5
VI 85.0 21.0 161.3 20.1 20,2 23.3 88.83 21.5
VII 67.2 23.1 15.5 23.0 36.03 26.0 57.03 24.03
VIII 53.0 24.9 16.1 21.1 27.4 22.4 32.2 22.8
IX 46.7 16.1 8.2 19.1 38.9 19.2 31.3 18.1
X 68.9 7.5 36.4 9.5 46.9 12.9 50.7 10.0
Sum (mm)
Average 435.1 17.2 351.5 17.01 303.5 19.46 363.4 17.9
(ºC)IV-X
The data included in Table 1 allow us to state first half of the year were aimed plant disease
that during the growing season of 2012 year resistance blackberry variety, the result of
was the lowest amount accumulated rainfall which has been established that all studied
amounting to 303 mm and the average varieties are resistant to mildew.
temperature of air was the highest of 19.46°C. As shown in Table 2, the earliest variety of
The highest amount of rainfall in the amount of blackberry that first begins vegetation Darrow,
435 mm accumulated during the growing then later start in vegetation Thornfree and
season of 2010 year, and the average Smoothstem varieties. According to
temperature comparatively low reached 17.2°C. observations made in the conditions of 2012
Research conducted according to methods field year blackberry plant growth and phenological
and laboratory work allowed registration data phases were conducted with 6-10 days earlier
covering the period of vegetation phenological than in 2011 year and 7 to 16 days earlier than
phases blackberry varieties that have been in 2010 year.
exposed in Table 2. The vegetation blackberry Blackberry plants budding took place in the
plant occurs in early spring, at the end of period from 08.04 until 12.04. The earliest
March and beginning of April when on blooming the variety Darrow, followed by
temperatures 2-4 º C begin the roots to rise and variety Smoothstem with 10-12 days later, and
adventitious buds activate the root of the neck the variety Thornfree blooms with 15 to 18
(Mladin Gh., Mladin P., 1992). days later than the variety Darrow. Duration of
From making observations on plant budding and flowering periods of blackberry
development in terms of new development and plant varies from 31 to 46 days.
conduct phenological phases of blackberry Blackberry varieties flowering takes place
varieties has been established as a satisfactory relatively late, when temperatures of aier are
general condition of the plants, the plants stable positive. The time difference between the
showed good development of the leaf and time of flowering of early varieties and late
phenological phases were conducted in normal varieties was 20 days (Mladin Gh., Mladin P.,
as characteristic peculiarities of varieties and 1992).
climatic conditions during the research. In the
110
According to observations made, besides the on varieties included in the study ranged from
characteristic features of blackberry varieties 30 to 46 days (Figure 2).
studied, flowering phenological phase depends As a result of measurements made at varieties
mainly on climatic conditions laid down in the of blackberry plants studied were obtained data
corresponding period phenological stage of on capacity development and fruiting
development. Blackberry varieties start blackberry plants that have been included in
flowering took place at 10.05. up to 01.06. and Table 3.
lasted from 28.05 until 21.06. The duration of The variety Darrow is from the group cumanica
flowering plants blackberry varieties included and is an early variety, very productive, with
in the study ranged from 16 to 23 days. the ability to suckers, has erect stems, but with
Blackberry fruit maturation takes place in the a drawback, are endowed with sharp thorns and
last days of June to the first decade of bend the tip, which creates inconvenience to
September. During fruit ripening at different harvest fruit.
blackberry varieties is almost three months, According to the data in Table 3 was
which is very important to provide fresh fruits established that the average length of strains on
(Hapova S., 2003). the blackberry variety Darrow reached values
The results obtained allowed to establish that ranging from 1.15 m in 2011 year until 1.21 m
blackberry fruit ripening took place over 55-64 on 2012 year.
days from the beginning of flowering (Figure The variety Smoothstem average length of the
1). The varieties studied during the early strains corresponding ranged between 1.58 m
vegetation until fruit maturation period ranged and 2.13 m. The variety Thornfree reached the
between 88 and 114 days. Early maturing highest values, the average length of the strains
varieties of blackberry took place at 21.06. up was corresponding 3.03 m and 3.55 m, data
to 28.07. and lasted from 29.07 until 09.09. from the emerge as the most vigorous variety.
During the period of ripening blackberry plant
Table 2. Phenological stages of plant development in blackberry varieties

Flowering Fruits maturation
The variety, Beginning Phenophases Phenophases
in Duration
years of budding period beginning end duration period beginning end duration
mass formation
Darrow
15.04 32 17.05 02.06 16 56 12.07 05.08 19.08 37 93
2010
10.04 34 19.05 06.06 17 59 17.07 30.07 16.08 30 89
2011
08.04 32 10.05 28.05 18 57 21.06 05.07 29.07 39 96
2012
Smoothstem
21.04 34 22.05 09.06 18 62 23.07 18.08 08.09 46 88
2010
20.04 33 23.05 08.06 16 59 21.07 15.08 05.09 45 114
2011
10.04 42 22.05 12.06 21 61 15.07 08.08 28.08 44 105
2012
Thornfree
28.04 31 29.05 21.06 23 60 28.07 19.08 09.09 43 103
2010
26.04 36 01.06 18.06 17 55 26.07 17.08 07.09 42 97
2011
12.04 46 28.05 19.06 22 64 21.07 17.08 02.09 42 104
2012
The average length of stems varied between values of fruits on the blackberry
1.18 and 3.29 m, and the limit of changes bushes ranged from 224 pcs. on the variety
deviated from 1.15 to 3.55 m. Smoothstem up to 483 pcs. on the variety
Average number of strains of the blackberry Thornfree. Limit of variation deviated between
bush varieties has varied on years from 8 195-540 fruits/bush.
shoots on the variety Smoothstem and up to 11
pcs. on the variety Darrow. The average mass
of blackberry fruit ranged from 2.9 g to 4.9 g
Darrow variety to variety Thornfree. Limit of
variation from the average mass of blackberry
fruit ranged from 2.7 to 5.1 g The average
111
Figure 1. Flowering period and blackberry fruit growth Figure 2. Maturation period of blackberry fruits, variety
Darrow
Table 3. Plants development and fructification capacity of blackberry varieties

Average length of Number of stems Average weight of Number of
The variety Presence of thorns
stems, m m/bush, pcs. a fruit (g) fruits/bush, piece.
Darrow
1.15 9 2.7 216
2011 thorns branches
1.21 11 3.1 355
2012
Mean 1.18 10 2.9 286
Smoothstem
branches without 1.58 8 3.9 195
2011
thorns 2.13 8 4.2 252
2012
Mean 1.86 8 4.1 224
Thornfree
branches without 3.03 9 4.7 426
2011
thorns 3.55 9 5.1 540
2012
Mean 3.29 9 4.9 483
Limit of
1.15-3.55 8-11 2.7-5.1 195-540
variation
The variety Smoothstem average length of the CONCLUSIONS

strains corresponding ranged between 1.58 m
As a result of research carried out at the
and 2.13 m. The variety Thornfree reached the
discretion Darrow blackberry varieties,
highest values, the average length of the strains
Smoothstem, Thornfree included in the study -
was corresponding 3.03 m and 3.55 m, data
found that:
from the emerge as the most vigorous variety.
The average length of stems varied between The period between budding and flowering
1.18 and 3.29 m, and the limit of changes varies between 31-46 days flowering period
deviated from 1.15 to 3.55 m. from 16 to 23 days.
Average number of strains of the blackberry Fruit maturation takes place between 55-64
bush varieties has varied on years from 8 days from the beginning of flowering.
shoots on the variety Smoothstem and up to 11 During the ripening of blackberry fruit is
pcs. on the variety Darrow.mass of blackberry between 88 to 114 days.
fruit ranged from 2.9 g on variety Darrow to
4.9 g on variety Thornfree. Limit of variation The average length of blackberry stems settled
from the average mass of blackberry fruit in variety Darrow 1.18 m, 1.86 m in variety and
ranged from 2.7 to 5.1 g. The average values of variety Smoothstem Thornfree 3.29 m
fruits on the blackberry bush ranged from 224 Average number of strains of the blackberry
pcs. the variety Smoothstem up to 483 pcs. the bush was 8 pcs. on the variety Smoothstem, 9
variety Thornfree limit of variation deviated pcs. on the variety Thornfree, and 10 pcs. on
between 195-540 fruits / bush. the variety Darrow.
The average weight of blackberry fruits, settled
in the amount of 2.9 g on variety Darrow, on
112
the variety Smoothstem 4.1 g, and 4.9 g on Lenuԑa Chira, 2000. “Cultura arbuƔtilor fructiferi”,
variety Thornfree. Editura M.A.S.T, BucureƔti, p. 102.
Spiridon I., 2008. Hobby. Afacere. Editura Alex – Alex.
Number of fruits on bush ranged from 224 pcs. BucureƔti, p. 5.
on the variety Smoothstem, 286 pcs. on the Programa i metodica sortoizucenia plodovîh, iagadnîh i
variety Darrow and 483 pcs. on the variety orehoplodnîh cultur.1973. Miciurinsc, 398 s.
Thornfree. Balan,V., CimpoieƔ, Gh., BarbĉroƔie, M., 2002.
Pomicultura, ChiƔinĉu, p. 184-188.
REFERENCES Hapova S., 2003. Vsio o iagodnîh culiturah: luciƔie sorta,
novîe rasteniea. Atlas-spravocinic sadovoda. Izd-vo
Mladin Gheorghe, Mladin Paulina, 1992. Cultura OOO Academiea razvitiea, Academiea holding,
arbuƔtilor fructiferi pe spaԑii restrînse. Editura Iaroslavli, 2003, s.12-15; ʤ̯̣̭̌-̸̨̡̛̭̪̬̦̌̏
CERES, BucureƔti, p. 88. ̨̨̭̌̔̏̔̌. ʰ̔̚-̨̏ ʽʽʽ ʤ̡̛̖̥̌̔́ ̛̛̬̯̌̏́̚,
Cociu V, Oprea bt., 1989. Metode de certare în ʤ̡̛̖̥̌̔́ ̵̨̛̣̦̔̐, ˔̨̬̭̣̣̌̏̽, ̭.5-12.
ameliorarea plantelor pomicole. Editura Dacia, Cluj-
Napoca.
113
COMPARATIVE STUDY REGARDING THE INFLUENCE OF

BIOSTIMULATORS ON THE QUALITATIVE AND QUANTITATIVE
POTENTIAL OF CABERNET SAUVIGNON
Marinela STROE, Codrin BUDESCU
University of Agronomic Sciences and Veterinary Medicine of Bucharest , 59 Marasti, 011464,

Bucharest, Romania
Abstract
The popularity, the qualitative parameters and the impressive variability proved by the Cabernet Sauvignon variety,
offers new ways of approach to the practice of winery and to scientific research. This paper presents a comparative
study regarding the influence of some biostimulators on the production and quality potential of the Cabernet Sauvignon
variety, in the ecological, pedological and climatic conditions recorded in Urlati wine center, from Dealu Mare
vineyard. The experiment proved the application of 3 treatments with these bio-stimulators (Tecnophyt PK, Tecamin
BRIX, Tecnokel amino CAB 2), during grape phonological growth, as follows: at the binding of the grapes (berry) 1-2
mm, when the grapes had a diameter of 4-6 mm and when the grapes had 6-8 mm. Observations and detailed
determinations regarding the agro-biological and technological behavior were performed in the same time, but the
production was especially evaluated in terms of physical-chemical parameters of the grapes, in order to obtain some
quality wines, with particular notes. All the obtained results in terms of production, quantity and quality are leading to
the idea that the used biostimulator substances had a positive influence, with the remark that for a 5.8% production
increase, the quality parameters (sugar, acidity, polyphenols) are situated in the same limits, even higher sometimes,
fully justifying their use.
Key words: biostimulators, ecological factors, phenological, vineyard, variety.
INTRODUCTION Starting from this consideration, in the present

paper has been analyzed the influence and the
Cabernet Sauvignon variety owns at present
effect of foliar application of some
time in our country, the largest cultivated
biofertilizers, in different stages regarding the
surface with varieties designed to obtain quality
growth of the grapes, on the enhancement of
red wines, and although they are more
the productive and technological potential
cultivated in many wine centers (74),
(Antonacci and Perniola, 2012) of this variety,
positioned in the hilly Carpathians of Muntenia
in the wine year 2011-2012.
and Oltenia, the South of Moldavia and
The interpretation of the results obtained after
Dobrogea as well as in some wine centers in
this experiment were analyzed under the aspect
the west of the country, found its second home
of production quality parameter definition
in Dealu Mare vineyard.
(production per vine, sugar, acidity),
Although adapted to the climate here, Cabernet
(Pârcalabu, 2010).
Sauvignon presents an impressing variability of
the phenolic characters in the plantations,
various biotypes being detected here,
differenced as follows: according to the type of The reasearch was made in the wine center
flowers, the length of the inflorescence, the Urlati, which is located in the Dealu Mare
degree of ramification of the inflorescence, the vineyard where Cabernet Sauvignon variety
binding percentage of the grapes, the shaking was conducted on a semi-high, mixed pruning
percentage of the already formed flower system, Guyot on a semi-stem pruning system,
(42,8%) as well as the undevelopment of the with a load of 30 buds/vine, at a planting
grapes, which in some years, leave a mark on distance of 1,0/2,5 m (Figure 1).
the production.
115
Figure 1. Cabernet Sauvignon variety in the experimental
field-wine center Urlati, 2012
Bio-stimulators used (Table 1) have a large

action specter including bio-stimulating effects,
growing and auxinic regulators, not being toxic
for humans, bees, fish, non-cumulative and
biodegradable.
Table 1. Phenological study of vine during biofertilizers treatment application

Principal growth stage 7: Development of fruits
(BBCH MODIFIED PHENOLOGICAL SCALE FOR COST ACTION FA1003)
Phenological stage Phenological stage Phenological stage
71: Fruit set: young fruits begin to swell, 73: Berries groat-sized, bunches begin 75: Berries pea-sized, bunches hang
remains of flower lost (1-2 mm) to hang (4 mm in diameter) (7 mm in diameter)
III treatment
I treatment II treatment Tecamin BRIX 2 l/ha & Tecnokel
Tecnophyt PK 3 l/ha Tecamin BRIX 2 l/ha amino CAB 2 l/ha
Small-berry grape only formats Grapes with berries 4-6 mm in diameter Grapes with berries 6-8 mm in
13.06.2012 30.06.2012 diameter
14.07.2012
Foliar treatments have been applied according (g/l), acidity (g/l of tartric acid), anthocyanins
to the experimental protocol, which prefigured mg/l, polyphenolic total index, and so on. In
applying them in different phenophases of order to provide information regarding the
grape growing, as follows: at binding 1-2 mm, quality of the production obtained, it was
when the grapes were 4-6 mm diameter and quantified the term of grape production quality
when the grapes were 6-8 mm diameter (Table (Pârcalabu, 2010) which was expressed
2). During growing period were taken throughout three components: production per
observations on the whole phonological vine in kg/vine; sugar concentration of the must
specter, and at the harvesting moment, on a g/l; must concentration in total acidity g/l.
medium sample of 10 grapevines, there were Dimensioning the grape production quality is
made the following determinations: fertility made for each variety eventhough in the same
coefficients (absolute and relative), wine area are cultivated white wine varieties as
productivity indexes (absolute and relative – well as red wine varieties.
g/sprout), grape number per vine, average A possibility to obtain quality characteristics
weight of a grape, average weight of 100 independent from the variety is to divide each
grapes, production in kilograms/vine, sugar quality component (P-production, Z-sugar
116
content, A-acidity content) to the optimal ecuation: ca = A/Aopt. Quality vector has in this
values of each variety Popt, Zopt, Aopt. Optimal case, the component c = ( cp, cz, ca ) . The best
values in Dealu Mare vineyard – Valea quality is considered when, on each component
Calugareasca are the multi-annual averages of quality coefficient exist and has the value close
these values (Pârcalabu, 2010), as follows: to 1. This being the ideal case, c = (1, 1, 1) or if
sugar – 210 g/l, acidity-4,4 g/l of tartric acid, they are expressed in percentages then this
production – 2,62 kg/vine. Therefore they are quality will become c = (100%, 100%100%).
defined: Production quality coefficient: cp In this case the values of quality coefficients
defined by the ecuation: cp = P/Popt; Quality are sub-unitary or supra-unitary, we can
coefficient in sugar must content: cz defined by conclude that, qualitatively speaking, the
the ecuation: cz = Z/Zopt; Quality coefficient in culture is not at optimal parameters.
must total acidity content ca defined by the
Table 2. Applied products features

Grapes with berries Grapes with berries 6-8 mm
Experimental Small-berry grape only formats
4-6 mm in diameter in diameter
values 13.06.2012
30.06.2012 14.07.2012
Tecamin BRIX 2 l/ha
Tecamin BRIX 2 l/ha &
Tecnophyt PK 3 l/ha
Potassium (K2O) 18% Tecnokel amino CAB 2 l/ha
(Potassium phosphate)
w/w, Calcium oxide (CaO) 10% w/w
Total Phosphorus P2O5 30% w/w,
Boron (B), 0,2% w/w Boron (B) 0,2% w/w
Total PotassiumK2O 20% w/w, pH 4;
Sea weed extract, rich L-Aminoacides 6% w/w
Cabarnet Activation of natural defending mechanisms of
in auxines and EDTA (Ethylenediamine
Sauvignon the plants, control and prevention of
giberelines 10% w/w tetracetic acid)
(fertilized) phytopatogenous mushrooms (Plasmospara
It enhances the color Increases fruit firmness and
viticola).
of the fruits and the post-harvesting quality
Inducind phytoalexines synthesis
sugar content Increases breaking resistance
Represents an asimilable and concentrated
Determines the growth Control over physiological
Potassium and Phosphorus source
of fruits dimension disfunctions associated with the
lack of Calcium
Cabarnet
Sauvignon - - -
(control)
Optimal values in Dealu Mare vineyard, Valea Cĉlugĉreascĉ are: sugar: 210 g/l, 4.4 g/l tartric acid and production 2,62
kg/vine
To evaluate more easily how quality coefficient in total acidity grape must content:
performant a variety acts inside an area or after ca defined by the ecuation: car = / Aopt = ca-1.
applying a technology, it can be introduced the Quality vector has, in this case the component
relative quality coefficient (relative to the cr= ( cpr, czr, car ) (Table 3). Appreciating the
optimal values), defined by the three quality potential of a variety in accordance to
components: Relative quality coefficient in the relative quality coefficient is made taking
production: cp defined by the ecuation cpr = into consideration the fact that the variety has a
/Popt = cp-1; Relative quality coefficient in greater adaptability area as the relative quality
grape must sugar content: : cz defined by the coefficient values recorded are closer to zero.
ecuation: czr = /Zopt = cz-1; Relative quality
Table 3. Quality components of grape production analysis

Vectors that define quality parameter
cp=P/Popt * cpr = /Popt= cp -1
cz =Z/Zopt* c = ( cp, cz, ca ) czr = /Zopt= cz -1 cr= (cpr, czr, car)
ca=A/Aopt* car = /Aopt = ca -1
117
RESULTS AND DISCUSSIONS after the three treatments obtains grapes with a
higher average weight (92 g), compared to the
Because of the fact that to both of the
control variant, difference that is observed in
experimental variants was applied the same
the average weight of 100 grapes. Regarding
agrotechnics (pruning type, pruning system,
the production that was obtained and its
load of buds per vine, planting distances, and
quality, higher accumulations of sugar are
so on), it is observed that there weren’t
showed at the fertilized variant (219 g/l),
significant differences regarding the elements
comparing to the control with values of only
that define the fertility of a variety (c.f.a, c.f.r,
202 g/l.
number of grapes per vine) values obtained for
Production per vine, also shows such
both of the variants being very close (Table 4).
differences, and a plus of 5,8% in case of bio-
Productivity level was appreciated with the
stimulators treatment was made, can be
help of the productivity indexes (absolute and
observed. Surprisingly, comparing the average
relative) that gives informations about the
values of the anthocyans accumulations and the
grape quantity on a fertile sprout, and from this
total polyphenol index, it is underlined the fact
point, it is observed that, the fertilized variant
that, at the control variant these values are
obtains higher values (173 g/sprout), in
superior, comparing to the fertilized variant.
comparation with the control variant (165
It can be concluded partially that, applying bio-
g/sprout) because the values of a grape’s
fertilizers to avoid massive flower shaking and
average weight know the same differences.
a good grape binding and growing, brings a
The differences more or less significant showed
plus of quality production through grape
as a result of applying the biofertilizers, in the
growth, enhances the sugar content and doesn’t
grape growing phenophase, practically insuring
enhance grape color (at least in the chosen
a better growth of the grapes, gradually in the
variants Tecnophyt PK 3 l/ha, Tecamin BRIX 2
three applying stages (13.06.2012, 30.06.2012,
l/ha, Tecnokel amino CaB 2 l/ha and for vine,
14.07.2012), as well as a higher grape weight.
especially).
At the harvesting moment, Cabernet Sauvignon
Table 4. Cuantification of the biofertilizers effects on the productive and technological potential of Cabernet Sauvignon
variety in the conditions of Urlati vineyard
Experimental variants Absolute fertility Relative fertility Absolute productivity Relative productivity
and specification coefficient coefficient index (g/sprout) index (g/sprout)
Cabernet Sauvignon
1,78 1,38 173,0 132,48
(fertilized)
Cabernet Sauvignon
1,89 1,36 165,0 118,4
(control)
Experimental variants No. of Average weight Weight of Production
and specification grapes/vine of a grape (g) 100 grapes (kg /vine)
Cabernet Sauvignon
25 92 96,5 2,210
(fertilized)
Cabernet Sauvignon
24 87 92,3 2,088
(control)
Experimental variants Sugar Acidity Anthocyans Total polyphenolic
and specification (g/l) (g/l tartric) (mg/l) index
Cabernet Sauvignon
219 4,46 1187,6
(fertilized)
Cabernet Sauvignon
202 4,98 1466,7 447,44
(control)
Evaluating the parameters that define values or productive potential of the variety are
production quality of Cabernet Sauvignon in considered average multi-annual values of the
accordance to the results obtained after the closest area, Valea Cĉlugĉreascĉ (Table 5).
experiment was realised through dividing each It is observed that, applying some biofertilizers
quality component (production, sugar, acidity) in different growing stages of the grapes, these
at optimal values of each variety, (optimal parameters record values close to 1 (1,042 – for
118
sugar accumulated in grapes and 1,01 for must values close to 1 (0,96 or 96,19%), underlining
acidity) which shows the fact that, the variety the fact that, the variety has reached at the full
reached at the moment of full maturation a maturity moment a technological potential very
technological potential close to the optimal close to optimal (variety potential). For the
(variety potential). For the production other two parameters, the production per vine
parameter, the value obtained of 0,84 or and the grape must acidity, the values recorded
84,35% shows that from this point of view, the are even too low (0,79), even too high (1,13),
variety was situated under the optimal showing the fact that, from this point of view
parameter. the variety situated under its potential. For
Appreciating the qualitative potential of the appreciating the qualitative variety potential
variety in conformity with the relative quality compared to the relative quality coefficient it is
coefficient values underline that, under underlined the same tendancy – under the sugar
accumulated sugar quantity and reached accumulation the control variant records values
acidity, the biostimulators variant records close to zero (0,04), hierarchically followed by
values close to zero, which shows a very good the values recorded by the acidity and the
adaptability of the variety and the chosen production/vine, with lower values, but not that
research variant, based on favorable low so that the differences could be statistically
ecopedoclimatic conditions in which the insured.
experiment took place. For the control variant,
it is observed that the sugar parameter records
Table 5. Cuantification of the effects of biofertilizers on quality parameters of Cabernet Sauvignon variety in the
conditions of Urlati vineyard
Experimental variants Vectors that define quality parameters
cp=P/Popt * cpr = /Popt= cp -1
0,84 0,16
c = ( cp, cz, ca )
Cabernet Sauvignon cz =Z/Zopt* czr = /Zopt= cz -1 cr= (cpr, czr, car)
0,84, 1,042, 1,01
(fertilized) 1,042 0,042 0,16,0,042, 0,013
84,35%, 104,2%, 101,1%
ca=A/Aopt* car = /Aopt = ca -1
1,01 0,013
cp=P/Popt cpr = /Popt= cp -1
0,79 0,20
c = ( cp, cz, ca )
Cabernet Sauvignon cz =Z/Zopt czr = /Zopt= cz -1 cr= (cpr, czr, car)
0,79, 96,19, 1,13
(control) 0,96 0,04 0,20,0,04, 0,13
79,69%, 96,19%, 113,18%
ca=A/Aopt car = /Aopt = ca -1
1,13 0,13
CONCLUSIONS the optimal one (variety potential). For the

control variant it is observed that the sugar
The results obtained under the aspect of
parameter records values close to 1 (0,96 or
quantity and quality lead to the idea that the
96,19%), and for production and acidity the
biostimulating substances used had a positive
values recorded are even too low (0,79 or
influence on Cabernet Sauvignon, observing
79,69%,) or even too high (1,13 or 113,18%),
that at a production rate of 5,8%, parameters
situating the variety under its optimal potential,
that define quality (sugar, acidity, polyphenols)
but not that far to have and influence on the
are situated at the same limits, sometimes even
quality of the wine.
higher, justifying their use. Regarding
production quality it is underlined the fertilized
REFERENCES
variant, the deviation from the optimal
production being minor – 84,35% and for the Antonacci D., Perniola R., 2012. Trattamento con
accumulated sugar and the grape must acidity biostimolanti per il miglioramento della qualità
dell’uva e della differenziazione a frutto delle gemme
the values obtained are closer to 1 showing the in varietà di uve da tavola senza semi. Organisation
fact that the variety reached at the moment of Internationale de la Vigne et du Vin, Paris, le 13 mars
full maturity a technological potential close to 2012.
119
Pârcalabu Liliana, 2010-Cercetari asupra delimitarii http://www.diprove.unimi.it/GRAPENET/index.php,
unitatilor “terroir” si a sistemului informatic de Cost action FA1003: East-West ollaboration for
gestionare cu privire special la central viticol Valea Grapevine Diversity Exploration and Mobilization of
Calugareasca. Teza de doctorat, U.S.A.M.V. Adaptive Traits for Breeding, PHENOTYPING
Bucuresti, p. 238-242. TRIAL 2012, First circular 12th March 2012.
Stroe Marinela, 2012-Ampelografie. Editura Ceres, ***-O.I.V. guidelines for studies on the effects of
Bucuresti, 2012. climate change in vitiviniculture and proposed
adaptations. Organisation Internationale de la Vigne
et du Vin, Paris, le 13 mars 2012.
120
TECHNICAL ASPECTS CONCERNING THE QUALITY PRESERVATION

IN FRESH AND DEHYDRATION OF APRICOTS
Marian VINTILĂ
Research and Development Institute for Processing and Marketing of the Horticultural Products -
Bucharest, No. 1A, Intrarea Binelui Street, District 4, 042159, Bucharest, Romania
Abstract
The researches carried on in ICDIMPH-Horting had in view to emphasize the influence of the variety and post-harvest
temperature on quality preservation in fresh and dehydration of apricots from internal production. In this way, three
varieties of apricots (Royal, Mari de Cenad, Cea mai buna de Ungaria), coming from the same orchard and being
simultaneously harvested, were kept in different conditions (environmental temperature, refrigeration and cold storage)
for testing the capacity of quality preservation of fresh fruits. At the same time,the apricots have been tested during
dehydration process, the researches being focused on conduct, quality and output of the product. Taking into
consideration losses level and the evolution of firmness and some chemical components, resulted that in environmental
conditions Royal variety gave better results, Cea mai buna de Ungaria emphasized its good behaviour in refrigerated
rooms and Mari de Cenad kept better quality than the others in cold conditions. Concerning dehydration, the results
stated that the variety and maturity stage influence the output and duration of the process. The variety Mari de Cenad
registered the highest drying ratio and the shortest time for dehydration process.
Key words: apricots, storage, dehydration, quality preservation.
INTRODUCTION technologies are based on cold chain used from

the producer to the consumer.
The apricots are very appreciated on local and
The storage optimum temperature
international markets. Growing conditions are
recommended by Cantwell M., 2002 and
also very good in our country, every yard from
Hardenburg and colab. 1986 is -0,5...0ºC and
the south part of the country having some trees
90-95% relative humidity. The authors do not
with savory sweet fruits. In Romania are many
recommend controlled atmosphere for fresh
local valuable varieties, but foreign varieties
apricots. Jamba A. and Carabulea B.,2002 are
are also grown with good results in specific
considering that the proper temperature for cold
conditions from different areas.
Differing from other countries that consider storage of apricots is 0…+0,5ºC and 7...+10ºC
apricots exports (fresh, dehydrated or for refrigeration purpose. They admit CA with
processed) a good income resource, our apricot 3% O2 si 5% CO2 for extension of cold storage
production is in present time only an internal life of apricots.
and seasonal resource. Romanian fresh apricots In order to find out the behavior of the apricots
can be found on the market only 1-2 months from internal production in different storage
during main harvesting period, the imported conditions (ambiental temperature, refrigerated
lots covering the market demand in the rest of and cold storage), specific comparative
the year. And the presentation on the market is researches have been done in ICDIMPH-
poor in comparison with the imported fruits. Horting institute using three varieties from the
This old deficiency is still present despite EC actual range of cultivars.
Regulation 851/2000 and Romanian Standard The dehydration of fruit and vegetables has
SR 3178/2003 containing precised rules many advantages, among which can be:
regarding the packaging and presentation for - all over the year consuming, especially
selling. during the fruits and vegetable absence,
In order to assure the preservation of the ensuring the human body needs with
quality and to prolong the trading time of vitamins, minerals and other components
horticultural products, actual postharvest
121
which sustain the immune system and its
balance;
- using, whatever the time of the year, of the
food recipes based on vegetables and fruits,
by the rehydration of industrial dried
products, both in restaurants and in
pizzerias, bakeries and candied fruits;
- the dried fruits and vegetables with a rich
content in vitamins and minerals, besides
their important role in the diet, helps to
prevent cardiovascular and digestive tract
diseases;
- the dried foods have high nutrient content
Figure 1. Apricot experiments during preparation
in low volume and weight, about 5-7 times
less compared to the fresh ones, presenting a
Apricots belonging to three varieties (Royal,
significant advantage in storage and
Mari de Cenad and Cea mai buna de Ungaria)
transport.
were stored in different thermal conditions
(environmental temperature, refrigeration and
cold conditions). The evolution of losses (by
The organization of experimental variants have weight and decay), structural firmness and
been done on the basis of variety and storage some chemical fruit compounds during storage
conditions and that is presented in table 1. have been determined.
The experiments was developed in 2012, on
Table 1. Organization of apricot experiments the dehydration plant existing in the pilot
Variant Variety Storage conditions station of ICDIMP-Horting Bucharest.
V1 Royal
Environmental (20- The dehydration plant used (fig. 2) is consist
22°) of vegetables and fruit dryer (70-300 kg / batch
V2 - idem - Refrigeration (10-12°) capacity), using hot air as drying agent. The
V3 - idem - Cold storage (3-5°)
installation program allows measurement and
Environmental (20-
V4 Mari de Cenad
22°)
automatic/manual programming (Figure 3)
V5 - idem - Refrigeration (10-12°) of working parameters: temperature, humidity,
V6 - idem - Cold storage (3-5°) air speed, driving valve and it is provided with
Cea mai buna de Environmental (20- an interface for connection to PC for data
V7
Ungaria 22°) acquisition.
V8 - idem - Refrigeration (10-12°) Drying temperature was 65-700C, held in this
V9 - idem - Cold storage (3-5°) area for 12 hours. During the dehydration
process was followed the evaluation of the
Preparation of apricot experiments is illustrated combined effects of various drying parameters,
in the figure 1. such as drying temperature, speed and direction
of the stream of air movement.
122
The results followed from the data presented in
the table 2 show that in ambiental conditions
the apricot can be kept maximum 5 days with
32,22% total average losses. The fruits from
Royal variety presented 26,27% total losses,
less than others. The highest level of losses was
registered at Mari de Cenad with 41,53% total
losses. Many of these fruits had wrinkled,
spotted and bruised appearance.
In refrigerated conditions the apricots have
been stores 15 days with 16,54-20,59% weight
losses (according to variety) and 4,44-37,77%
Figure 2. Dryer decay losses (according to variety). The total
losses ranged from 23,41 to 58,36 (according to
variety) with an average of 38,69%. The most
resistant in refrigerated storage was Cea mai
buna de Ungaria variety with minimum decay
and medium weight losses.
In cold storage conditions the apricots have
been stores 20 days with 10,64-17,67% weight
losses (according to variety) and without any
decay losses. For all that, the varieties
presented some differences. The Royal variety
fruits presented some discolorations (darker
zones of the skin) and maturation process. And
Cea mai buna de Ungaria variety presented also
a visible maturation process and slight wrinkled
Figure 3. Programmer skin of some fruits. But for Mari de Cenad
apricots the cold storage had a good effect on
RESULTS AND DISCUSSIONS the maintaining the quality. It reduced the
The level of weight and decay losses during postmaturation process and was favourable in
storage of apricots are presented in the table 2 keeping the fruit appearance and health.
and the fruit firmness evolution in the table 3.
Table 2. Losses during storage of apricots (%)

Environmental Refrigeration Cold storage
Variety losses (%) losses (%) losses (%)
weight decay total weight decay total weight decay total
Royal 18,12 8,15 26,27 16,54 17,78 34,32 10,64 0 10,64
Mari de Cenad 20,03 21,50 41,53 20,59 37,77 58,36 17,67 0 17,67
C.m.b.de Ungaria 18,62 10,25 28,87 18,97 4,44 23,41 11,51 0 11,51
Average 18,92 13,30 32,22 18,70 19,99 38,69 13,27 0 13,27
Storage period 5 days 15 days 20 days
Table 3. Evolution of apricot firmness during storage

Storage Storage
Pulp firmness Difference
Var. Variety temperature period
(PU) * (%)
no. (°C) (days)
Royal initial - 119,30 -
V1 -idem- 20-22° 5 148,90 +24,8
V2 -idem- 10-12° 15 145,95 +22,3
V3 -idem- 3-5° 20 149,35 +25,2
Mari de Cenad initial - 96,75 -
123
V4 -idem- 20-22° 5 169,15 +74,8
V5 -idem- 10-12° 15 162,65 +68,1
V6 -idem- 3-5° 20 98,05 +1,3
C.m.b. de Ungaria initial - 103,13 -
V7 -idem- 20-22° 5 150,55 +46,0
V8 -idem- 10-12° 15 125,25 +21,4
V9 -idem- 3-5° 20 143,85 +39,5
*penetrometric unit (PU) = 0,1mm
The data from table 3 show that initially Table 4. Initial level and evolution of some chemical
firmness of the apricots is 96,75-119,30 PU compounds of apricots during storage
(according to the variety), the maturity degree Storage Soluble Total
Var. Acidity
of different varieties being closed enough. In Variety temperature solids sugars
no. (%)
all experimental variants stored fruits presented (°C) (%) (%)
Royal initial 17,4 0,91 10,37
a decreasing of fruit pulp firmness with 1,3-
V1 - idem - 20 - 22° 17,3 1,00 11,02
74,8% from the initial value.
V2 - idem - 10 - 12° 17,4 1,20 11,84
In environmental conditions Royal apricots had V3 - idem - 3 - 5° 16,8 1,23 10,07
a constant evolution of fruit firmness that Mari de
decreased with 22,3-25,2% from the initial initial 17,2 0,87 9,88
Cenad
value (according to the storage conditions and V4 - idem - 20 - 22° 17,6 1,21 10,33
storage period). In such conditions the Royal V5 - idem - 10 - 12° 16,2 1,40 9,43
apricots kept better its quality in comparison V6 - idem - 3 - 5° 17,3 1,72 10,98
with the competitors Mari de Cenad and Cea C.M.B.U. initial 16,4 1,01 9,27
mai buna de Ungaria that registered a V7 - idem - 20 - 22° 16,6 1,15 9,89
V8 - idem - 10 - 12° 16,7 1,25 10,19
decreasing of 74,8% respectively 46% of the
V9 - idem - 3 - 5° 14,3 1,52 7,44
initial firmness.
The Mari de Cenad apricots presented extreme
The Royal fruis presented the highest soluble
firmness values according to the storage
solids and sugar content and Cea mai buna de
conditions having a great liability face to the
Ungaria the highest acidity.
temperature level. This variety was placed on
The evolution of these compounds differs from
the latest places concerning storage resistance
a variant to another. Soluble solids content
to environmental and refrigerated conditions
presented after storage figures very close
with 68,1-74,8% firmness decreasing, but
toinitial ones. Some lower values have been
occupied first place with only 1,3% decreasing
determined for Mari de Cenad stored in
in cool conditions.
refrigeration conditions and Royal and Cea mai
Cea mai buna de Ungaria variety had a
buna de Ungaria stored in cold rooms.
different firmness evolution, being adapted to
The postharvest fruit acidity presented
refrigeration. This variety registered during
generally a increasing tendency for all varieties
refrigerated storage the lowest pulp firmness
and in all storage conditions. The growth is
decreasing (21,4%). However at lower
reduced in case of ambiental storage condition,
temperature, specific to the cold storage, the
moderate in refrigerated conditions and higher
fruits of this variety are wasting 39,5% from
in cold storage conditions
the initial firmness, the apricot quality being
Total sugar content has an increasing tendency
thus affected in a way.
for all apricots stored in environmental
The initial content and evolution of some
conditions and for Royal and Cea mai buna de
chemical compounds during storage are
Ungaria varieties kept in refrigerated rooms. In
presented in the table 4. The data show that the
cold conditions the same Royal and Cea mai
initial content of fruits is as follows: 16,4-
buna de Ungaria varieties presented however a
17,4% soluble solids, 0,91-1,01% acidity and
decreasing of sugar content in the fruits,
9,27-10,37% total sugars (according to the
opposing to Mari de Cenad that registered
variety).
higher sugar content and a good storage result.
124
Appearance of the apricots after 5 storage days minutes after starting the process can be seen a
in environmental conditions is presented in the stabilization of the humidity values between
figure 4, after 15 days in refrigerated conditions 12-16% with a tendency to form a tray at the
in the figure 5 and after 20 days in cold value of 14%, which indicates a uniformity of
conditions in the figure 6. the air humidity inside the place for
dehydration.
The temperature variation-analyzing the graph
(Figure 8) can be seen that the start temperature
was 30-33°C, ambient temperature
respectively. The first hour of operation reveals
Figure 4. Appearance of apricots after 5 storage days in a faster growth temperature values of 50-60°C.
environmental conditions Over the next 120 minutes occurs a slow
increase of temperature, stabilizing its values
around 70-73°C, after 180 minutes from the
process starting.
Figure 5. Appearance of apricots after 15 storage days in

refrigerated rooms
Figure 6. Appearance of apricots after 20 storage days in

cold rooms Figure 8. The variation of temperature inside the place
for dehydration in the first 3 hours
The variation of air humidity inside the place
for dehydration-analyzing the graph (Figure 7), CONCLUSIONS
can be notice that at the beginning of the
Storage temperature is the main factor that
process the humidity was 76-80% in the four
determines the duration of apricot quality
measuring points of the place.
preservation. In this way the apricots have been
kept maximum 5 days in ambiental temperature
with 32,2% total average losses, 15 days in
refrigerated rooms with 38,7% total average
losses and 20 days in cold storage with 13,3%
total average losses. Optimum duration is
however 3 days in ambiental temperature, 10
days in refrigeration and 15 days in cold
conditions.
Apricot varieties had different behaviour in
similar storage conditions. If Royal apricots
Figure 7. The variation of humidity inside the place for had better results in ambiental temperature, Cea
dehydration in the first 3 hours mai buna de Ungaria gave better results in
refrigerated storage and Mari de Cenad kept
better quality than others in cold conditions.
During the first 30 minutes occurs a sudden Firmness is a good indicator of fruit quality and
decrease of humidity to a value of 35 – 40%. its evolution during storage allowed a good
Over the next two hours the humidity decrease evaluation of quality preservation in different
is achieved more slowly, reaching values of storage conditions. Fruit firmness decreased
20-30%. In the period between 120 and 180 with about 25% in all storage conditions. The
125
variety Mari de Cenad presented the largest In 80% proportion the dehydrated products
variation of fruit firmness that decreased with existing in the Romanian market come from
74,8% in ambiental conditions and only with imports. Due to current conditions and the
1,2% in cold conditions. absence of the performing technologies is
The evolution of some chemical compounds required the modernization and optimization of
(soluble solids, acidity and total sugar) can be the specific dehydration technologies, which
an important indicator of the capacity of quality can ensure the obtaining of competitive local
maintain in variable storage condition and of products (apricots, apples, plums etc.),
the maturity stage of apricots. The chemical competitive for both internal market and for
evolution differs from a variety to another. export.
Mari de Cenad presented an increase of soluble
solids and sugar content of the fruits in cold REFERENCES
store conditions and a decreasing tendency in Cantwell Marita, 2002. Postharvest Technology of
refrigerated rooms in opposition with other Horticultural Crops, Univ. of California, Div.of Agr.
varieties. At the same time fruit acidity of this and Nat. Res. Editia III-a, p. 517.
Chua, K. J., & Chou, S. K., 2003. Low-cost drying
variety stored in cold conditions increased with methods for developing countries. Trends in food
100% compared with only 35-54% registered science and technology; 2003 Dec; 14 (12) : 519 528,
by other varieties in similar conditions. 14 (12), p. 519-528.
Hardenburg. R.E., Watada A.E., Wang C.Y., 1990. The
Stating experiences results in dehydration allow
commercial storage of fruits, vegetables and florist
the following conclusions: and nursery stocks, USDA. Agric Handbook no.66,
- After 180 minutes inside the place for p. 35.
dehydration the temperature and humidity Jamba A., Carabulea B., 2002. Tehnologia pastrarii si
industrializarii produselor horticole. Ed.Cartea
were stabilized, in whole its volume; Moldovei, Chisinau, p. 305-307.
- For the same keeping period of 12 hours Mohsenin, N.N., 1986. Physical Properties of Plant and
under the same conditions of temperature, Animal Materials. Gordon and Breach Science
Publishers, New York. Vol. 1.
humidity and air drying speed, were Munde, A.V. 1982. Effect of time and temperature
obtained different values of the final during multistage dehydration on onion quality. M.E.
humidity of the fruits, which indicates that unpublished thesis, College of Tech. and Agric.
the texture, thickness and epidermis Engng., Sukhadia University, Udaipur.
influenced the dehydration process. Wilhelm, Luther R, Dwayne A. Suter, and Gerald H.
Brusewitz. 2004. Dryng and Dehydration. Chapter 10
in Food & Process Engineering Technology, St.
Joseph, Michigan, p. 259-284.
126
KINEMATICS AND OPERATION PROCESS OF THE COMPLEX

AGGREGATE USED TO PREPARE THE GERMINATIVE BED IN
VEGETABLE FARMING
Constantin VLAD1, Gheorghe BRĂTUCU2

1
Research and Development Station for Vegetables Growing, 23 Mesteacanului Street, 120024,
Buzau, Romania
2
Transilvania University, 29 Eroilor Avenue, 500036, Brasov, Romania
Abstract
Preparing the germination bed represents an essential work for growing and developing plants in vegetable farming.
The machinery used can have a positive or negative influence on improving or degrading the soil’s physio-mechanic
characteristics and on the quality of the work, therefore choosing them requires a lot of attention. These aspects are a
results of studying the kinematics and work process of the complex aggregate that is used during this stage.
Key words: soil, germinative bed preparation, complex aggregate, kinematics, work process.
INTRODUCTION lateral blade on the studied complex aggre-

gate’s blade-bearing bar.
Modeling the soil consists of a set of activities
The mechanism powering the blade-bearing bar
performed with the purpose of improve the
is presented in figure 1.a. This case presents a
soil’s physical, chemical and biological proper-
crank-rod mechanism featuring a crankshaft.
ties. During these activities the soil is overturned,
The running element is the AB crank, while the
aerated, mixed, crumbled, leveled, pressed and
led element is represented by the BC bar. The
modeled. Soil activities can be basic activities
blade-bearing bar executes the translational-
and germinative bed preparation activities.
oscillator movement (Caproiu St., 1982,
During the germinative bed preparation, the
Naghiu L., 2003, Pásztor J and Bratucu Gh.,
soil is aerated up to the seeding or planting
depth, in order for the soil to provide the 2008, Sztachó-Pekáry I. et al., 2007). The
required pedoclimatic conditions for the plants chosen frame of reference, xGz, is a mobile
to develop, during the seeding and sprouting system which moves at a constant speed
stages. reported to a stationary system, according to
The complex aggregates are machines that are figure 1.b.
used for preparing the germinative bed.
The working organs that are shaped like blades
with variable size are mounted on parallel bars
called blade-bearing bars. These bars are given
an oscillating motion from the tractor’s power
outlet. They move on a plane perpendicular to
the machinery’s movement direction. The
mechanism powering the bars transforms the
rotation movement into translational-oscillator
movement. Figure 1. 1. a - Kinematics of a point from the complex
aggregate blade-bearing bar, the running mechanism; b -
mobile and stationary reference
This piece of work will determine and study the The F(xF,yF,zF) point’s coordinates are
trajectory of the F(xF,yF,zF) point, the top of the determined using the coordinates of points A,
127
B, C, D and E (Pásztor J and Bratucu Gh.,
2008).
A(xA, yA, zA) point’s coordinates:
Where a1, b1, c1 are the computable coefficients

from the actual construction data:
B(xB, yB, zB) point’s coordinates:
where: H is the height difference between the

blade-bearing bar and the power outlet, in m; l
where: r is the length of the AB element, in m;
– length of the BC element, in m, according to
ɽ – the rotation angle of the AB element, in rad
figure 1.a. From the solutions obtained using
(fig,1.a.)
the system (6) the versions corresponding to
The ɽ angle is the variable parameter:
geometric restrictions are chosen.
The tgɲ expression is determined using the
C(xC, yC, zC) point’s coordinates, which is
necessary for describing the trajectory of points
where: ʘ is the power outlet’s angular speed, in E(xE, yE, zE) Ɣi F(xF, yF, zF):
rad/s; n – the power outlet’s speed, in rot/s.
Point C(xC, yC, zC) is located at the intersection
of two circles, one with the origin in point B,
having the BC radius, and the other with the
origin in point D, with the radius DC. By
resolving the system formed by the circles’
equation, the C point’s coordinates reported to
the mobile reference are obtained.
where: b is the length of the DE element, in m;

D(xD, yD, zD) point’s coordinates are considered
a - the blade’s length, in m, figure 1.a.
to be known are the following:
The xGz reference is considered mobile and
has a translational movement at a constant
speed, vm, reported to the xOz reference (fig, 1.
b).
The parametric equations reported to the xOy
Using the relations (5), the equation system (4) reference are obtained by resolving the
is modified as follows: following operations:
128
These trajectories are shown in figure 2, based
on the parametric equations of point F(xF, yF,
zF) (Vlad C. and all., 2012).
where: PF represent the coordinates of point F;
T – transformation matrix (Naghiu, L., 2003).
The transformed equations will be:
Figure 2. Blades’ tips oscillation on a horizontal plane
Where S is the distance covered by the complex By analyzing the aggregate’s operation, the
aggregate following the movement's direction.
blade-bearing bar’s oscillation on a plane
The distance covered by the complex aggregate
perpendicular to the movement direct can be
is time dependent and is calculated using the
observed. This can be verified by using the
relation:
parametric equations of point F(xF, yF, zF). The
fact that the blade-bearing bars follow an
oscillatory movement on plane xOz can be
observed in figure 3.
Parametric equations of the absolute movement Parametric equations xF=f(r, n, H, l, c, L, b,
of point F(xF, yF, zF) are obtained by making ʔn) and zF =f( r, n, H, l, c, L, b, ʔn) can also be
the corresponding replacements: used to represent the trajectories on the xOz
vertical plane, according to figure 3.
The trajectory of the blade’s top (Vlad C. and

all., 2012) is determined by using the F(xF, yF,
zF) point’s parametric equations. By drawing
the trajectory followed by the complex
Figure 3. The blade bar’s oscillatory movement.
aggregate’s working organ several aspects can
be determined: studying soil modelling at
During operation, the blades follow the bar’s
different speeds of the complex aggregate, the
movement, receiving the alternation
theoretical study of the aggregate’s behavior
translational movement perpendicular to the
and also the theoretical study of the blades’
forward movement in the xOz plane, according
working process.
to figure 4.
The equations for joined blades and blades
mounted on the other bars can be determined
by using the parametric equations of the
absolute movement (12). During calculations,
the following will be taken into consideration:
step between the blades, p;phase shift between
time crankpin, ʔn;the distance between the
blade-bearing bars, d.
129
CONCLUSIONS
Parametric equations xF=f(r, n, H, l, c, L, b,
ʔn) and zF =f( r, n, H, l, c, L, b, ʔn) describe
sinusoid trajectories of the complex aggregate’s
blades on vertical and horizontal plane.
By analyzing the work process of the operating
organs on the complex aggregate, it can be
observed that the agricultural machinery
provides the soil crumbling and a good mixture
of soil layers up to the set working depth, if
Figure 4. The operation process executed by the blade in fitted with two or three blade bars.
vertical plane
Parametric equations xF=f(r, n, H, l, c, L, b,
ʔn) and zF =f( r, n, H, l, c, L, b, ʔn) offer the
By analyzing the blades’ operation mode, it is
possibility to study the complex aggregate’s
observed that there are unprocessed sections in
optimization.
the soil caused by the vertical oscillation. A
second and a third blade bar are required to be The parametric equations represent
mounted on the complex aggregate in order to mathematical models for studying the complex
eliminate this inconvenience. aggregate’s dynamics and energetics.
The parametric equations are useful for
studying the joint operation process of the REFERENCES
blades on a vertical plane, perpendicular to the Brĉtucu Gh., Fodor A.N., 2002. Actual Conditions
forward movement, like pictured in figure 5. Demands from Romanian Agriculture over
Reliability-Maintenance Ration of Agricultural
Machines, in Magazine Mecanizarea Agriculturii,
nr.3/2002, p. 33-39.
Cĉproiu St., s.a., 1982. Agricultural Machines for Soil
Work, Seeding and Cultures Maintenance, Didactic
and Pedagogic Publishing, Bucharest.
Cojocaru I., Marin E., 2005. Researches Regarding the
Manufacturing of some Technical Equipments
Destined for Greenhouses Agricultural Works, in
Magazine INMATEH II, Bucharest, p. 21-31.
Naghiu, L., 2003. Researches Regarding Soil Working
Process with Rotary Working Organs, PhD Thesis,
Cluj-Napoca Technical University.
Pásztor J., Brĉtucu Gh., 2008. Researches About the
Kinetics and the Dynamics of the Machines for
Preparing the Seedbeds in Greenhouses, International
Figure 5. The blades’ operation process on vertical Conference on New Research in Food and Tourism,
Bioatlas, Brasov, Romania.
By analyzing the the trajectory of the complex Sztachó-Pekáry I., s.a., 2007. Engeneering Elements,
aggregate’s blades’ tips, it is observed that the Mezƅgazda Publishing, Budapest.
Vlad, C., Pásztor, J., Brĉtucu, Gh., Forgó, Z., 2012.
soil is being processed energetic and uniform Mathematical Modeling of the Vegetable Soil
up to the set working depth if three operating Preparation Process Using a Complex Equipment,
organs mounted on paralel blade bars and The 4th International Conference Advanced
working in phase shift are being used. Composite Materials Engineering COMAT 2012,
vol.III/2012, Brasov, Romania, p. 834-837.
130
RESULTS CONCERNING THE EFFECT OF FOLIAR FERTILIZERS

AND GROWTH PROMOTERS TREATMENTS ON PRODUCTION
AND QUALITY OF TOMATO FRUITS
Jeni Gianina VOICU (SIMION)

59 Marasti Avenue, postcode 011464, Bucharest, Romania
Abstract
The work presents results obtained in protected culture of tomatoes under different treatments with foliar fertilizers
(Folimax, Agriphyte) and ecological growth promoter P& R. It wastaken in experience hybrid Balkan F1 and variety
Ghittia. The foliar fertilizers and growth promoters treatments has good influence on production and quality of tomato
fruits. If the best at production was the hybrid Balkan F1, the variety Ghittia was the best at quality. The biggest
production was obtained by the hybrid Balkan F1 treated with Agriphyte (69.626 t/ha) and the smallest one it was the
variety Ghittia untreated – control (48.865 t/ha). The biggest content of vitamin C was registered at Ghittia variety in
the case of P& R treatment (21.52 mg/100g and the biggest content of lycopene was registered at hybrid Balkan F1 for
Agriphyte treatment (69.39 ppm). The content of soluble carbohydrates was almost constant and has slightly varied at
around 4.8%.
Key words: Agriphyte, Folimax, P&R, quality, production.
INTRODUCTION with pesticides and rapid correction of

nutritional deficiency (Voican and Lacatus,
Because of the big request for consumption,
2002).
tomatoes are the most cultivated vegetable
Between foliar fertilizers, the literature
species on protected crops from Romania.
mentions foliar fertilizers type F (231; 141;
The benefits of this culture system are:
411), the product Cropmax (Ciofu, et al.,
possibility to obtain of sorts of vegetables
2004), liquid foliar fertilizer Folimax (Lacatus,
according to the request of the market;
2006).
earliness; good prices; possibility to obtain
The growth promoters are used for the
tomatoes almost all year; big productions/ha
regulation of the processes of growth and
(Voican and Lacatus, 2002).
development of plants especially when the
For obtaining good productions with maximum
microclimate conditions are not favorable.
economic efficiency it needs to practice some
Many authors recommended that the treatments
technologies in which stimulating of growth
must be applied when the flowers are
and development of plants, fertilization and
completely opened with a solution of
pest control are the most important works.
Tomatoset, Tomafix, Duraset, or Tomato-stim.
In the production technologies can be used
The paper presents partial results regarding the
different fertilizers, growth promoters and
influence of the treatments with growth
foliar fertilizers.
promoters and foliar fertilizers on growth,
Researches on use of fertilizers in protected
development and production of tomatoes for
crops shows that use of foliar fertilizers has
protected crops.
very good effects in vegetable crops in all
growth and development phases (Davidescu
and Davidescu, 2000; Lacatus, et al., 2005).
Foliar fertilization is very used in vegetable The main objective of the research has been
protected crops and it has some advantages determining the optimal variant of stimulation
like: use of reduced concentration of mineral and foliar fertilization of tomatoes in protected
elements, easier application simultaneously crops in order to obtain early production of
131
good quality fruits. Experience has been carried strings, wire tapping for stimulation of
out in 2012 in Poiana, Ialomita county in high pollination, pest and diseases control. It has
tunnel of 1000 m2. been applied fertilization with different
The experiment has been carried out in random fertilizers (Folimax, Agriphyte) and growth
blocks in three repetitions and experimental promoter (P& R), depending on experimental
variants consist of three products: two foliar variants, at two weeks and one month from
fertilizers and one growth promoter, which planting.
were compared with the control (Table 1). Harvesting was done from the second decade of
the July, by variants.
Table 1. Experimental variants – variety Ghittia /hybrid During the experimentation period has been
Balkan-2012 carried out observations, measurements and
Variants/ determinations, which were used specific
Specification
treatments working methods namely:
V1 Control Phenological determinations: sowing date, date
-
(untreated)
of emerging, date of planting, date of flowering
V2 Foliar fertilizer with microelements; ensure
Folimax- steady growth, disease resistance, increase and date of harvest.
0.3% the number of fruits and production. Production potential was determined by
V3 Foliar fertilizer with 33% phosphorus, and recording the number of fruits/plant, average
Agriphyte-
28% potassium; secondary has systemic mass of fruits and by calculation of the average
0.3% fungicide properties. production/plant and ha, for each variant
Organic product with role of protection and
recovery of the plants from damage caused
studied. The fruits were harvested by quality
by extreme temperatures or diseases; help to classes according to the average weight of
V4 P& R- a better use of the nutrients in different types fruits as follows:
0.5% of soils; increase the assimilation of some -extra-greater than 80 g;
nutrients (Fe, Zn, Mn, B, Cu); may be used -I-60-80 g;
together with protective agents for plants
(herbicides, insecticides, fungicides).
-II-40-60 g;
-understas-less than 40 g.
Biological material has been represented by The results were interpreted statistically by
variety Ghittia and hybrid Balkan F1. analysis of variance-Student test (Ardelean, et
Ghittia: late tomatoes indefinite, the plants are al., 2007).
vigorous, fruits are round flattened with 4-6 Laboratory analysis at tomato fruits:
seeds lodge, uniform, of 250-300g weight and -biochemical analysis: vitamin C content
4-5 fruit in a cluster, fruits are resistant to (mg/100 fresh product), soluble carbohydrates
cracking, with good firmness. Recommended (%), acidity (%), lycopene (ppm). Were
for cultivation in plastic tunnels and field. harvested fruit samples for biochemical
Balkan: early tomatoes, semi-determined analysis of three different harvests and results
growth. The fruits are rounded, uniform, of are average of these samples.
100-120g weight, 6 fruit in a cluster.
Recommended for cultivation in plastic tunnels RESULTS AND DISCUSSIONS
and field. From the analysis of the results it can be
The technology used in the experiences was observed that, regardless of treatment, the
selected from the literature for tomatoes (Ciofu productions were superior to the untreated
et al., 2004). control (Table 2, Figure 1 and 2). Regardless of
Under climatic conditions of the year 2012, the the variety the greatest production was obtained
culture has been established by planting of when applying foliar fertilization with
seedling on 25 of the April. The seedling was Agriphyte (66.957 t/ha for Ghittia variety,
by 53 days old, 20-22 cm height, 4-5 mm respectively Balkan F1 hybrid 69.626 t/ha). The
thickness of stem, 5-6 leaves and it has first largest share of total production was at quality
inflorescence. The density used was 36.000 I. It can also notice a higher share of quality
plants/ha. Care work consisted in watering, extra in the case of Ghittia variety for
hoeing, weeding, removing of early shoots Agriphyte treatment (40%).
whenever is necessary, sustaining plants on
132
Table 2. The production obtained at tomato experiment and the distribution on qualities Poiana, Ialomita county, 2012
QUALITY
TOTAL
HYBRID / VARIETY VARIANT EXTRA I II TOTAL STAS UNDERSTAS
t/ha
t/ha % t/ha % t/ha % t/ha % t/ha %
Control 18.000 37 19.965 41 9.000 18 46.965 96 1.900 4 48.865
Folimax 23.900 37 27.900 43 9.850 15 61.650 96 2.560 4 64.210
GHITTIA
Agriphyte 26.900 40 27.400 41 10.500 16 64.800 97 2.157 3 66.957
P& R 22.350 38 23.920 41 10.100 17 56.370 95 2.650 5 59.020
Control 18.570 34 18.471 34 16.005 29 53.046 96 1.955 4 55.001
Folimax 21.924 33 25.932 39 15.920 24 63.776 96 2.600 4 66.376
BALKAN F1
Agriphyte 23.410 34 26.920 39 17.015 24 67.345 97 2.281 3 69.626
P& R 20.499 32 22.943 36 17.284 27 60.726 96 2.775 4 63.501
growth promoter P&R exceed untreated control

with very significant differences.
Table 4. The influence of treatment of tomatoes

production
Average Differences Signi-
Treatment %
production (t/ha) (t/ha) ficance
Figure 1. The production obtained at Ghittia variety and b1Control 51.933 100 -
the distribution of it on qualities b2 Folimax 65.293 126 13.360 ***
b3
68.292 131 16.359 ***
Agriphyte
b4 P& R 61.261 118 9.328 ***
DL 5% 1.884312
DL 1% 2.644951
DL 0.1% 3.734048
Regarding the influence of foliar fertilizer

Figure 2. The production obtained at hybrid Balkan F1 treatments and growth promoter on each
and the distribution of it on qualities variety (Table 5) it can be noted that the yield
differences obtained from untreated control are
Taking into account the influence of variety/ very significant.
hybrid on the production of tomato (Table 3) it
can be seen that the hybrid Balkan F1 has made Table 5. The influence of treatments on each variety
production
a significantly distinct difference production
(3.863 t/ ha) than Ghittia variety. Average
Variant Differences Signi-
production %
(treatment) (t/ha) ficance
Table 3. The influence of variety on tomatoes production (t/ha)
a1b1
Average 48.865 100 -
Variant Differences Signi- (Control)
production, % a1b2 64.210 131 15.345 ***
(variety/hybrid) (t/ha) ficance
(t/ha) a1b3 66.957 137 18.092 ***
A1 Ghittia 59.763 100 - a1b4 59.020 121 10.155 ***
A2 Balkan F1 63.626 106 3.863 ** a2b1
55.001 100 -
DL 5% 1.5423 (Control)
DL 1% 3.57957 a2b2 66.376 121 11.375 ***
DL 0.1% 11.33411 a2b3 69.626 127 14.625 ***
a2b4 63.501 115 8.500 ***
The influence of treatment on tomatoes DL 5% 2.6648189
DL 1% 3.7405256
production can be observed in table 4. As
DL 0.1% 5.280742
shown in this table all variants treated with
foliar fertilizers (Folimax, Agriphyte) and /or
133
If it is taking into account both factors (variety being superior to other types of treatment
and treatment) it can be noted that the variant (Table 6, Figure 3 and 4).The largest increases
treated with Agriphytehad the most consistent of production was realized by Balkan F1
behaviorregardless of the variety under study, hybrid treated with Agriphyte (69.626 t/ha).
Figure 3. Fruits of hybrid Balkan F1 Figure 4. Fruits of variety Ghittia
Table 6. The influence of variety and treatment on tomatoes production

Average Average
Variant Differences Signi- Variant Differences Signi-
production % production %
(treatment) (t/ha) ficance (treatment) (t/ha) ficance
(t/ha) (t/ha)
a1b3
a1b1 (Control) 48.865 100 - 66.957 100 -
(Control)
a2b1 55.001 113 6.136 ** a2b1 55.001 82 -11.956 000
a2b2 66.376 136 17.511 *** a2b2 66.376 99 -0.581
a2b3 69.626 142 20.761 *** a2b3 69.626 104 2.669 *
a2b4 63.501 130 14.636 *** a2b4 63.501 95 -3.456 0
a1b4
a1b2 (Control) 64.210 100 - 59.020 100 -
(Control)
a2b1 55.001 86 -9.209 000 a2b1 55.001 93 -4.019 0
a2b2 66.376 103 2.166 a2b2 66.376 112 7.356 **
a2b3 69.626 108 5.416 ** a2b3 69.626 118 10.606 ***
a2b4 63.501 99 -0.709 a2b4 63.501 108 4.481 **
DL 5% 2.6107467 DL 5% 2.6107467
DL 1% 4.1067505 DL 1% 4.1067505
DL 0.1% 7.7606017 DL 0.1% 7.7606017
134
As shown in figures 5 and 6 the vitamin C and
lycopene content of tomato fruits are bigger for
treated variants than control regardless of
variety.
Figure 8. Soluble carbohydrates and acidity content

hybrid Balkan F1
CONCLUSIONS
Figure 5. Vitamin C and lycopene content in variety Growth promoter and foliar fertilizer treatments
Ghittia had a positive influence on the level of
production and quality of tomato fruits grown
in high tunnel, Poiana county Ialomita 2012.
Highest yield was obtained at Agriphyte
treatment for both varieties Ghittia and Balkan
F1 (66.957 t/ha, respectively 69.626 t/ha).
Regarding the distribution of fruits on the
quality classes, Ghittia shows in variant treated
with Agriphyte, the biggest share of
extra fruit quality class (40% of total
production).
Figure 6. Vitamin C and lycopene content in hybrid Production results were interpreted statistically.
Balkan F1 The differences between Balkan F1 and Ghittia
is distinctly significant and between control and
Regarding the carbohydrates content it can be treated variants were very significant.
observed that it does not vary much by
Vitamin C and lycopene contents varied
treatment. The acidity of tomato fruits varies
positively according to the treatment.
quite widely depending on the treatment and
variety (Figure 7 and 8). The highest content of vitamin C was recorded
in variety Ghittia treated with growth promoter
P& R (21.52%) and the highest lycopene
content was at Balkan F1 hybrid treated with
Agriphyte (69.39 ppm).
ACKNOWLEDGEMENTS
The paper presents data from the Ph. degree
thesis in the frame POSDRU / 107/
1.5/S/76888, project financed from the
European Social Fund through the Sectoral
Operational Programme for Human Resources
Figure 7. Soluble carbohydrates and acidity content in Development 2007-2013.
variety Ghittia
135
REFERENCES Davidescu D., Davidescu Velicica, 2000. Horticultural
agrochemistry, Ceres Publishing House, Bucharest.
Ardelean M., Sestras R., Cordea Mirela, 2007. Lacatus V. et al., 2005. Vegetable crops in greenhouses
Horticultural experimental technique, Academic Pres and plastic tunnels, Ceres Publishing House,
Publishing House, Cluj-Napoca, p. 30-33. Bucharest.
Ciofu Ruxandra, Stan N., Popescu V., Chilom Pelaghia, Lacatus V., 2006. Fertilization of tomato plants
Apahidean S., Horgos A., Berar V., Lauer K.F., cultivated in protected system, Session of Scientific
Atanasiu N., 2004. Treaty of vegetable crops, Ceres Paper, Vidra.
Publishing House, Bucharest, p. 308-319, 431-442, Voican V., Lacatus, V., 2002. Protected culture of
603-646. vegetables in greenhouses and plastic tunnels, Ceres
Publishing House, Bucharest.
136
RESULTS CONCERNING THE EFFECT OF FOLIAR FERTILIZERS

AND GROWTH PROMOTERS TREATMENTS ON PRODUCTION
AND QUALITY OF LETTUCE CULTIVATED IN PLASTIC TUNNELS
Jeni Gianina VOICU (SIMION)
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Avenue,

postcode 011464, Bucharest, Romania
Abstract
The work presents results obtained in protected crops of lettuce under different treatments with growth promoter P& R
and foliar fertilizers Agriphyte and Folimax, which are cultivated in high tunnels in southern area of Romania. It were
taken in experience three varieties of lettuce: May King, Great Lakes 118 and Lollo Rossa. These treatments shows
positive influence on the production and quality of lettuce. Reffer to production the best variant was in the case of the
variety May King which was treated with foliar fertilizer Agriphyte (175 g/ head, 28 t/ha). At the other two varieties the
best results was obtained at variants treated with foliar fertilizer Folimax. The laboratory analyses shows that the
nitrate content of leaves was clearly under the maximum admissible level (2000-3000 ppm) and depends by variety and
variant. The content of vitamin C was positively influenced by the treatments, especially by the ecological growth
promoter P& R.
Key words: Agriphyte, Folimax, P&R, quality, production.
INTRODUCTION as following: 100 g of lettuce contains 43 mg

Ca, 32 mg P, 0.3 mg Fe, 350 mg K, 15 mg
The lettuce is cultivated regularly at early in
vitamin E, 4.2 mg vitamin A, 0.07 mg vitamin
spring and in autumn late like successive
B1, 0.08 mg vitamin B2, 0.5 mg vitamin PP. It
cultures. This system of culture assure the
contains also in this quantity of leaves 0.1%
needs of vegetables in these periods of the year,
sugar, 1.4% proteins, 0.5% cellulose. Lettuce is
creates the possibility to use more intensive the
a good vegetable for remineralization, cleanser
constructions and assure more benefits to
sedative, emollient. Its energetic value is of 16
producers. Short vegetation period and reduced
calories. Lettuce juice has very good properties
height of plants recommended lettuce like a
because of the high content in magnesium and
very good associated culture (Ciofu et al.,
iron. This species was cultivated long time ago.
2004).
Egiptians, Greeks and Romans cultivate lettuce
The advantages of this system of culture are the
on large surfaces and appreciated this culture
following: possibility of obtaining of very early
like a very valuable vegetable. In present,
and early productions, possibility of obtaining
lettuce is spread on all continents, on large
good harvest long time during the year, good
areas, especially in the countries from Western
quality of the products, obtaining of big
Europe, in USA and Japan. In the US, for
production/ha, avoiding of apparition of
example, this culture occupies over 100,000 ha
weather accidents.
and the consumption/inhabitant reached 10
Lettuce is cultivated for its heads, which are
kg/year. In our country, lettuce is grown both in
consumed mostly fresh like salads.
pure culture and in the system of associated and
In recent times because of orientation of the
successive culture, in all counties and
population to a nutrition regime more close to
especially around big cities and industrial
nature, lettuce has begun one of the mostly
centers, occupying 14,000-15,000 ha annually.
consumed vegetable (Ciofu et al., 2004, Indrea
Different authors recommended for
and Apahidean, 1997). It has nutritional
prolongation of preservation of lettuce a big
importance because of the high content of
number of products. Relatively recent was
vitamins, mineral salts and nutritive substances
discovered many regulators of growth and
137
fruiting with a large application in vegetables The experimental variants consist of three
crops. They are natural or synthetic hormonal products used: two foliar fertilizers and one
substances which influence the processes of natural stimulator, which are compared with a
growth and development of plants (Indrea et untreated control (Table 1).
al., 2007). The authors shows that is possible to The technology used in the experiences was
apply these products in combination with foliar selected from the literature for lettuce (Ciofu et
fertilizers. al., 2004).
These foliar fertilizers are used on large scale Under climatic conditions of the year 2012, the
in vegetable protected crops because of some culture has been established by planting of
advantages like: reduced concentration of seedling on 15th of October. The seedling was
mineral elements and quickly correction of by 28 days old and 5-6 leaves.
nutrition deficiencies (Voican and Lacatus,
2002).

The main objective of research was to
determine the optimal variant of stimulation
and foliar fertilization of the lettuce in
protected crops for obtaining early and high
quality production.
The experience was held in 2012 in village
Poiana, Ialomita county, in high tunnels on a
surface of 720 m2.
The installation of trial was done in subdivided
parcels, in three repetitions. Figure 1. View with variety Great Lakes 118
Table 1. Experimental variants – 2012

Biological material Treatments Specification
V1 Control
-
(untreated)
V2 Folimax- Foliar fertilizer with microelements; ensure steady growth, disease resistance, increase
0.3% the number of fruits and production.
May V3
Foliar fertilizer with 33% phosphorus and 28% potassium; secondary has systemic
King Great Lakes Agriphyte- fungicide properties.
0.3%
118 Lollo Rossa
Organic product with role of protection and recovery of the plants from damage
caused by extreme temperatures or diseases; help to a better use of the nutrients in
V4 P&R-
different types of soils; increase the assimilation of some nutrients (Fe, Zn, Mn, B,
0.5%
Cu); may be used together with protective agents for plants (herbicides, insecticides,
fungicides).
Biological material has been represented by Lollo Rossa, recommended for protected and
two varieties: May King, Great Lakes 118 and open field crops. (Table 2, Figure 1).
The density used was 160,000 plants/ha.
Table 2. Description of the lettuce varieties from trial

Biological
Characterization
material
Early variety, for protected and open field crops, for autumn and spring, with compact medium head,
May King
blade present corrugating; resistant to flowering.
Great Lakes Mid – early variety, for protected and open field crops; with head by round to oval shape, with curled
118 leaves, crisp and of iceberg type.
Forms a distinct compact rosette of blood violet fan -shaped leaves with a non-hearting pale green base.
Lollo Rossa
The leaves have a crisp, semi-succulent, hardy texture
138
At two weeks from planting it was applied RESULTS AND DISCUSSIONS
treatments with growth promoter (P&R) and
From the analysis results can be observed that
foliar fertilizers (Folimax and Agriphyte) in
the average weight of the head of the May King
accordance with experimental variants.
lettuce ranged from 158 g (untreated control) to
Harvesting was done from the first half of
175 g (Agriphyte). At variety Great Lakes 118
December, by variants.
the average weight of the head ranged between
During the experimentation period has been
152 g (untreated control) to 168 g (Folimax).
carried out observations, measurements and
At Lollo Rossa the average weight of the
determinations, which were used specific
rosette varied between 140 g (untreated
working methods namely:
control) to 157 g (Folimax) (Table 3, Figure 2).
Phenological determinations: sowing date, date
of emerging, date of planting and date of Table 3. The influence of growth promoter and foliar
harvest. fertilizers treatments on the production of lettuce-2012
Production potential was determined by
Average weight of the Production
registering of the mass of each head/ rosette Variety Variant
head/ rosette, kg/pl. t/ha
harvested by variants. Control 0.158 25.28
The results were interpreted statistically by Folimax 0.170 27.20
May King
analysis of variance - Student test (Ardelean et Agriphyte 0.175 28.00
al., 2007). P& R 0.163 26.08
Laboratory analysis at lettuce: Control 0.152 24.32
Folimax 0.168 26.88
- agrochemical analysis: N-NO3- and N-NO2- Great Lakes
Agriphyte 0.166 26.56
content, P-PO43- content, K+ content. P& R 0.160 25.60
- biochemical analysis: vitamin C content Control 0.140 22.40
(mg/100 fresh product), soluble carbohydrates Folimax 0.157 25.12
Lollo Rossa
(%), acidity (%), chlorophyll (mg/100 fresh Agriphyte 0.150 24.00
product). Were harvested lettuce samples for P& R 0.146 23.36
laboratory analysis of three different harvests
and results are average of these samples.
Figure 2. Production at lettuce experiences, 2012
Concerning the production of lettuce May King (25.120 t/ ha) compare to the control (22.400 t/
it was between 25.280 t/ha (control) and 28.000 ha). If we take into account the influence of
t/ha (Agriphyte). It can be observed that the variety on the lettuce production (Table 4), it
applied treatments favored average weight of can be observed that both varieties Great Lakes
the heads and the production. At Great Lakes 118 and May King have made a significantly
118 variety, on first place it was the variant distinct difference of production (2.120 t/ ha,
treated with foliar fertilizers Folimax (26.880 t/ respectively 2.920 t/ha) compare to Lollo
ha) compare to the control (24.320 t/ ha). At Rossa.
Lollo Rossa variety, on first place it was the
variant treated with foliar fertilizers Folimax
139
Table 4. The influence of the variety on the lettuce differences for Folimax treatment, variety May
production King give best results at Agriphyte treatment
Variety
Average
%
Differences Signi- (Table 6, Figure 3 and 4).
poduction (t/ha) t/ha fication
a1 Lollo
23.720 100 -
Rossa
a2Great
25.840 109 2.120 **
Lakes 118
a3 May King 26.640 112 2.920 **
DL 5% 0.50609
DL 1% 1.17459
DL 0.1% 3.71916
The influence of the treatment on the lettuce

production it can be seen in the table 5. As it
show in this table the variants treated with
foliar fertilizers (Folimax, Agriphyte) exceeded
the control with significantly distinct Figure 3. View with variety May King
difference.
Table 5. The influence of the treatment on the lettuce

production
Average Differences Signi-
Treatment %
production (t/ha) t/ha fication
b1Control 24.000 100 -
b2 Folimax 26.400 110 2.400 **
b3
26.187 109 2.187 **
Agriphyte
b4 P& R 25.013 104 1.013
If we take into account the influence of the

treatments on the production at the same Figure 4. View with variety Lollo rossa
variety, it can be noticed different behavior of
the three varities of lettuce.If varieties Lollo
Rossa and Great Lakes 118 made the biggest
Table 6. The influence of the treatment on the lettuce production from the same variety
Average production Differences Signi-
Treatment %
(t/ha) t/ha fication
a1b1 (Control) 22.400 100 -
a1b2 25.120 112 2.720 **
a1b3 24.000 107 1.600
a1b4 23.360 104 0.960
a2b1 (Control) 24.320 100 -
a2b2 26.880 111 2.560 **
a2b3 26.560 109 2.240 *
a2b4 25.600 105 1.280
a3b1 (Control) 25.280 100
a3b2 27.200 108 1.920 *
a3b3 28.000 111 2.720 **
a3b4 26.080 103 0.800
DL 5% 1,77129
DL 1% 2,48631
DL 0.1% 3,51008
140
If we take into account the both factors, variety consistently achieving highest differences to
and treatment, it can be seen that the variants any control when is associated with variety
treated with Agriphyte behaved May King (Table 7).
Table 7. The influence of variety and treatments on the lettuce production

Average Differences Signi- Average Differences Signi-
Variant % Variant %
production (t/ha) t/ha fication production (t/ha) t/ha fication
a1b1 22.400 100 - a1b3 24.000 100 -
a2b1 24.320 109 1.920 * a2b1 24.320 101 0.320
a2b2 26.880 120 4.480 *** a2b2 26.880 112 2.880 **
a2b3 26.560 119 4.160 *** a2b3 26.560 111 2.560 **
a2b4 25.600 114 3.200 ** a2b4 25.600 107 1.600 *
a1b2 25.120 100 - a1b4 23.360 100 -
a2b1 24.320 97 -0.800 a2b1 24.320 104 0.960
a2b2 26.880 107 1.760 * a2b2 26.880 115 3.520 **
a2b3 26.560 106 1.440 a2b3 26.560 114 3.200 **
a2b4 25.600 102 0.480 a2b4 25.600 110 2.240 *
a1b1 22.400 100 - a1b3 24.000 100 -
a3b1 25.280 113 2.880 ** a3b1 25.280 105 1.280
a3b2 27.200 121 4.800 *** a3b2 27.200 113 3.200 **
a3b3 28.000 125 5.600 *** a3b3 28.000 117 4.000 ***
a3b4 26.080 116 3.680 *** a3b4 26.080 109 2.080 *
a1b2 25.120 100 - a1b4 23.360 100 -
a3b1 25.280 101 0.160 a3b1 25.280 108 1.920 *
a3b2 27.200 108 2.080 * a3b2 27.200 116 3.840 ***
a3b3 28.000 111 2.880 ** a3b3 28.000 120 4.640 ***
a3b4 26.080 104 0.960 a3b4 26.080 112 2.720 **
DL 5% 1.58555 DL 5% 1.58555
DL1% 2.30163 DL1% 2.30163
DL0.1% 3.58707 DL 0.1% 3.58707
If we take a look on the results of laboratory variant treated with Agriphyte (345.45 ppm).
analysis we can see that none of the variants The highest content of phosphorus was found at
is poluted with nitrates/nitrites (Table 8). variant Great Lakes 118 treated with growth
The nitrates content is well below the promoter P& R (166.38 ppm). The highest
maximum level (2000-3000 ppm). The highest content of potassium was found at variant May
nitrate level was recorded at Great Lakes 118 at King treated with Folimax (4020 ppm).
Table 8. Results of laboratory analysis at lettuce

Content
Variety Treatment - Acidity Soluble Vitamin C, Chlorophyll
N-NO3 P-PO43- K+
% carbohydrates mg/100g mg/100g
Control 185.10 132.65 3000.00 0.19 2.09 4.28 60.51
Folimax 186.10 126.91 3046.67 0.21 2.11 4.28 63.88
Lollo Rossa
Agriphyte 279.14 139.47 3083.33 0.21 2.11 4.25 60.02
P& R 301.31 138.11 3060.00 0.21 2.27 4.27 59.27
Control 190.41 144.19 3800.00 0.10 2.23 2.63 73.56
Folimax 194.17 132.66 3903.33 0.13 2.18 2.60 76.27
Great Lakes 118
Agriphyte 345.45 124.97 3700.00 0.15 2.25 2.60 71.57
P& R 335.27 166.38 3628.67 0.15 2.25 2.65 72.75
Control 152.09 136.63 3593.33 0.15 2.13 2.98 66.89
Folimax 179.38 124.31 4020.00 0.18 2.14 3.19 69.20
May King
Agriphyte 188.52 120.43 3820.00 0.18 2.09 3.32 66.98
P& R 214.17 114.96 3466.67 0.19 2.12 3.30 65.68
141
The highest content of soluble carbohydrates accumulation of potassium in Great Lakes 118
was found at variant Lollo Rossa treated with and May King varieties.
P& R (2.27%). The biggest content of vitamin
C was recorded at variant Lollo Rossa treated ACKNOWLEDGEMENTS
with Folimax (4.28%). The highest content of The paper presents data from the Ph. degree
chlorophyll was found at variant Great Lakes thesis in the frame POSDRU/ 107 /1.5/ S/
118 treated with Folimax (73.56%). 76888, project financed from the European
Social Fund through the Sectorial Operational
CONCLUSIONS Programme for Human Resources Develop-
The highest average weight of the head/ rosette ment 2007-2013.
and the highest production was achieved by the
variant May King treated with Agriphyte REFERENCES
(175.0 g, 28.0 t/ha). Ardelean M., Sestras R., Cordea Mirela, 2007.
Foliar fertilizers Folimax and Agriphyte Horticultural experimental technique, AcademicPres
Publishing House, Cluj-Napoca, p. 30-33.
achieved the highest average productions on
Ciofu Ruxandra, Stan, N., Popescu, V., Chilom Pelaghia,
the experience of lettuce (26.400 t/ha Apahidean S., Horgos A., Berar V., Lauer K.F.,
respectively 26.187 t/ha). Atanasiu, N., 2004. Treaty of vegetable crops, Ceres
The experimental results were verified statisti- Publishing House, Bucharest, p. 308-319, 900-914.
Indrea D.. Apahidean, Al.S., 1997. Culture of early
cally and differences from control was at least vegetables, Ceres Publishing House, Bucharest;
significantly. Indrea D. et al., 2007. Culture of vegetables, Ceres
None of these treatments had pollution effect Publishing House, Bucharest, p. 76-77.
Voican V., Lacatus V., 2002, Protected culture of
with nitrates/ nitrites on the final product. vegetables in greenhouses and plastic tunnels, Ceres
Foliar fertilizer Folimax favored the accumula- Publishing House, Bucharest.
tion of chlorophyll in all varieties and the
142
A PRELIMINARY SURVEY OF THE OCCURRENCE OF APPLE

PROLIFERATION IN THE NORTH OF ROMANIA
Lumini‫܊‬a Antonela ZAGRAI, Ioan ZAGRAI
Fruit Research & Development Station Bistrita, 3 Drumul Dumitrei Nou Street, 420127,
Bistrita, Romania
Abstract
Apple proliferation (AP), caused by the ‘Candidatus Phytoplama mali’ (’Ca. P. Mali’), is considered one of the most
important disease affecting apple. While different reports showed its largely spread in some European countries, very
limited information about the occurrence of AP in Romanian apple orchards are available. To start to secure this
missing data, a preliminary survey was perform in two apple orchards located in Bistrita area from Romania. Watching
typical AP symptoms (witches’ brooms, foliar reddening, dwarf fruits), twenty samples from symptomatic trees,
belonging to three cultivars (Generos, Florina and Aura), were collected in autumn 2012. Serological DAS-ELISA
using Bioreba monoclonal antibody, and nested-PCR using primer sets to detect AP group, were performed. ELISA
results indicated that 17 out of 20 samples collected were positive, while nested-PCR revealed that all 20 samples were
infected. Because plenty of trees showed similar symptoms like those sampled, this preliminary survey suggests a high
incidence of AP in the two orchards. An extended study on surrounding areas of Bistrita, and then on regional and
national level is necessary to provide relevant data about the AP occurrence in Romanian apple orchards and,
subsequently, to recommend control measures, if will be needed.
Key words: apple proliferation, DAS-ELISA, nested-PCR, apple orchards, survey.
INTRODUCTION (Krczal, et al., 1988), and in Italy (Tedeschi

and Alma, 2006).
Apple proliferation (AP) is considered one of
The main symptoms of AP disease are foliar
the most important diseases that occur in
reddening, witches’ brooms, enlarged stipules
almost all European countries, where apple is
and small sized fruits with poor taste (Nemeth,
grown (Seemüller et al., 2011). Most of the
1986). At this time, there are a lot of possibility
apple cultivars are known to be susceptible to
for detection of AP, from indexing on woody
this disease. The causal agent of this disease is
indicators and using electron microscopy
’Candidatus Phytoplama mali’ (’Ca. P. Mali’),
(Seemüller, 1976), to serological methods
which belongs to the 16SrX phylogenetic group
(ELISA) using monoclonal antibodies (Loi et
(Seemüller and Schneider, 2004). The first
al, 2002), hybridization and molecular tests,
report of AP was made in Northern Italy (Rui et
using direct/nested-PCR and RFLP (Kison et
al., 1950). Apple proliferation can be
al., 1994), or real-time PCR (Baric and Dalla-
transmitted by grafting and infected plant
Via, 2004). Regarding the serological detection
materials, but is not seed transmissible (Seidl
of AP group, Ploaie (2006) has showed that
and Komarkova, 1974).
there is no serological difference between
Within the orchards, the most important natural
Apple proliferation, Pear decline and European
spread of ’Ca. P. Mali’ is made by insects stone fruit yellows.
vectors. Two Cacopsylla species, C. picta The existence of AP in different orchards from
(Jarausch et al., 2003; Malagnini et. al., 2010) Romania, based on symptomatology, was
and C. melanoneura (Tedeschi et al., 2002; observed since 1958 (Pop, 1962; Pop et al.,
Chireceanu and Fatu, 2012) were reported as 1965, 1967). Along 15 years, Gheorghiu (1985)
‘Ca. P. mali’ vectors. The pathogen is had studied the etiology, symptomatology,
transmitted by both species in a persistent epidemiology and transmission of AP on two
manner. Also, Fieberiella florii (Stal) was apple cvs., Jonathan and Red Delicious. During
reported as vector of ‘Ca. P. mali’ in Germany 1967-1973, Gheorghiu (1985) provided data on
143
AP monitoring performed in Romanian apple Immunosorbent Assay (DAS-ELISA) – (Clark
orchards, based on morphological and Adams, 1977), using a monoclonal
symptoms. In the last thirty years there is a antibody (Loi et. al., 2002) raised against AP
lack of information about AP incidence in phytoplasmas group, according to the
Romanian apple orchards. manufacturer’s instructions (Bioreba,
To date, there are no studies about the Switzerland). Absorbance values were
occurrence of AP in apple orchards from measured at 405 nm after 30 and 60 minutes,
Romania based on serological and/or molecular using a TECAN plate reader. Samples were
tests. To start to secure these missing data, a considered positive if their absorbance values
preliminary survey was carried out in 2012, in were more than twice those of negative
two apple orchards located in Bistrita area, control. Positive and negative controls were
Romania, using serological and molecular provided in AP kit (Bioreba), and used both in
assays. serological and molecular assay.
For molecular detection, total DNA was
MATERIALS AND METHODS purified by using DNeasy Plant Mini Kit and
‘Florina’ cv., known to be one of the highly the protocol recommended by manufacturer
(Qiagen, Germany). DNA was extracted from
susceptible to AP (Loi et al. 1995) and another
leaf veins and phloem, which were prior grind
two Romanian cultivars, named ‘Generos’ and
to a fine powder under liquid nitrogen. Aliquots
‘Aura’, were the subject of this study. Twenty
of DNA were then used in nested-PCR. A first
samples of symptomatic apple trees were
round of amplification was made by using an
collected in autumn 2012 from the three
universal primers pair P1/P7 (Deng and Hiruki
cultivars. Sampling was based on typical AP
1991).
symptoms: witches’ brooms, foliar reddening in
late summer, enlarged stipules and dwarf of RESULTS AND DISCUSSIONS
fruits (Figure 1).
Seventeen samples out of twenty reacted
positively by DAS-ELISA, using monoclonal
antibody provided by Bioreba, which
specifically recognize AP (Table 1).
Nested-PCR, performed in parallel with
serological detection, allowed us to detect
16SrX phytoplasmas group. All samples tested
by nested-PCR reacted positively, both in the
first and the second PCR round.
Consequently, “infected status” of all the 20
trees showing typical AP symptoms analyzed
in the present work was confirmed in nested-
PCR.However, three samples were found
negative in DAS-ELISA. There is possible that
the three isolates were not recognized by
monoclonal antibody.
Table 1. Results of serological and molecular tests

Figure 1. Symptom of Apple proliferation disease: dwarf
sized fruits (down) compared with healthy fruits (top) – Cultivar Isolate code DAS-ELISA Nested-PCR Status
original. G1 + + infected
G2 + + infected
Photo 1. Symptom of Apple proliferation G3 + + infected
G4 + + infected
disease: dwarf sized fruits (down) compared Generos
G5 + + infected
with healthy fruits (top) – original. G6 + + infected
Serological diagnoses were performed by G7 + + infected
Double Antibody Sandwich-Enzyme Linked G8 + + infected
144
F1 - + infected assay (ELISA) for detection of plant viruses. J. Gen.
F2 - + infected Virology 34, p. 475-483.
F3 + + infected Deng S., Hiruki C., 1991. Genetic relatedness between
F4 + + infected two nonculturable mycoplasmalike organisms
Florina revealed by nucleic acid hybridization and
F5 + + infected
F6 + + infected polymerase chain reaction. Phytopathology 81, p.
F7 + + infected 1475-1479.
F8 + + infected Jarausch B., Schwind N., Jarausch W., Krczal G.,
A1 + + infected Dickler E., Seemüller E. 2003. First report of
A2 + + infected Cacopsylla picta as a vector of apple proliferation
Aura phytoplasma in Germany. Plant Dis. 87, p. 101.
A3 + + infected
Gheorghiu E., 1985. Boala proliferarii la mar in
A4 - + infected
Romania. Ed. Ceres.
AP positive control + +
Lee I.-M., Bertaccini A., Vibio M., Gundersen D.E.,
AP negative control - - 1995. Detection of multiple phytoplasmas in
perennial fruit trees with decline symptoms in Italy.
Because plenty of trees showed similar Phytopathology 85, p. 728–735.
symptoms like those sampled, this preliminary Loi N., Carraro L., Musetti R., Firrao G, Osler, R., 1995.
survey suggests a high incidence of AP in the Apple proliferation epidemics detected in scrab-
resistant apple trees. J. Phytopathol. 143, p. 581-584.
two orchards. An extended survey on Loi N., Ermacora P., Carraro L., Osler R., Chen T.A.,
surrounding areas of Bistrita, and then at 2002. Production of monoclonal antibodies against
regional and national level, focused not only on apple proliferation phytoplasma and their use in
symptomatic trees, but also on asymptomatic, serological detection. Eur. J., Plant Pathol. 108, p. 81-
is necessary to provide relevant data about the 86.
Kison H., Schneider B., Seemüller E., 1994. Restriction
AP occurrences in Romanian apple orchards. Fragment Length Polymorphisms Within Apple
Subsequently, overall data will allow to Proliferation Mycoplamalike Organism. J. of
establish control measures, knowing that this Phytopathology, 141, p. 395-401.
disease is included in the list of quarantine. Krczal G., Krczal H., Kunze L., 1988. Fiebeiella florii
This work can be considered a first step in (Stal), a vector of apple proliferation agent. Acta
Hort. 235, p. 99-106.
evaluation of incidence of AP in apple orchards Malagnini V., Pedrazzoli F., Gualandri V., Zasso R.,
from Romania, by using not only visual Bozza E., Fiamingo F., Pozzebon A., Mori N., Ioriatti
monitoring, but also serological and molecular C., 2010. Detection of ‘Cabdidatus Phytoplasma mali’
assays. in different populations of Cacopsylla melanoneura,
in Italy. Bulletin of Insectology, 63 (1), p. 59-63.
CONCLUSIONS Nemeth M., 1986. Virus, Mycoplasma and rickettsia
diseases of fruit trees. Akademiai Kiado, Budapest.
The finding of AP in all twenty apple trees Rui D., Cifferi R., Refatti E., 1950. La virosi gegli
tested corroborated with plenty of symptomatic “scopazzi del mielo” nel Veronese. Not. Mal. Piante
13, p. 7-11.
trees indicates a potential for a high prevalence Ploaie P., 2006. Isolation and serological detection of
of AP within and around the surveyed orchards. apple proliferation phytoplasma group in Romania.
These results request an additional and Annals of the ARS – Aniversary volume 1, p. 163-
168.
exhaustive study at regional and national level.
Pop I.V., 1962. Principalele viroze ale plantelor in R.P.R.
Subsequently, appropriate measures to reduce Prob. de Biol., p. 347-401.
the impact could be recommended, if will be Pop I.V., Radulescu E., Docea E., Coman T. 1965. Virus
needed. Diseases of Fruit Trees in Romania. Zastita bilja, 16,
p. 493-496.
Pop I.V., Coman T., Gheorghiu E., Motoi E., Apetri A.,
REFERENCES
1967. Contributii la studiul si combaterea virozelor
Baric S., Dalla-Via J. 2004. A new approach to apple pomilor fructiferi in Romania. Gradina, Via si
proliferation detection: a highly sensitive real-time Livada, 8, p. 56-59.
PCR assay. J. Microbiol. Methods 57, p. 135-145. Schneider B., Seemüller E., Smart C. D., Kirkpatrick B.
Chireceanu C., Fatu V., 2012. Data on the Howthorn C., 1995. Phylogenetic classification of plant
Psyllid Cacopsylla melanoneura (Forster) pathogenic mycoplasma-like organisms or
Populations in Southeast Romania. Ecologica phytoplasmas. In Molecular and Diagnostic
Balkanica, vol. 4 (2), p. 43-49. Procedures in Mycoplasmology, vol. 2, p. 369–380.
Clark M., Adams A.N., 1977. Characteristic of the Seemüller E., 1976. Investigations to demonstrate
microplate method of enzyme linked immunosorbent mycoplasma like organisms in diseased plants by
145
fluorescence microscopy, Acta Hort. (ISHS) 67, p. European stone fruits yellows, respectively.
109-112 Int.J.Syst.Evol. Microbiol.. 54, p. 1217-1226.
Seemüller E., Carraro L., Jarausch W., Schneider, B., Seidl V., Komarkova V., 1974. Studies on natural spread
2011. Apple proliferation phytoplasma. In: Virus and of proliferation disease on apple. Phytopathol. Z. 81,
Virus-Like Disease of Pome and Stone Fruits. Edited p. 301-313.
by Hadidi, A., Barba, M., Candresse, T. and Jelkman, Tedeschi R., Bosco A., Alma A., 2002. Population
W. p. 67-73. dynamics of Cacopsilla melanoneura (Homoptera:
Seemüller E., Schneider B., 2004. ‘Candidatus Psyllidae), a vector of apple proliferation
Phytoplasma mali’, ‘Candidatus Phytoplasma pyri’ phytoplasma in northwestern Italy. Journal of
and ‘Candidatus Phytoplasma prunorum’, the casul Economic Entomology, 95 (3), p. 544-551.
agents of apple proliferation, pear decline and Tedesci R., Alma A., 2006. Fiebiella florii as a vector of
‘Ca.P. mali’. Plant Dis. 90, p. 284-290.
146
HORTICULTURAL
BIODIVERSITY AND
GENETIC RESOURCES
SOME FRUIT CHARACTERISTICS OF MEDLAR
(MESPILUS GERMANICA L.) GENOTYPES GROWN IN ORDU, TURKEY
Ahmet AYGÜN, Ali Riza TASÇI
Ordu University, Faculty of Agriculture Department of Horticulture, 52200, Ordu, Turkey
Abstract
Medlar is grown mostly as scattered trees within or around hazelnut orchards in the Black Sea Region of Turkey. The
harvested fruits are used for family consumption or sold in local markets. This research was carried out to determine
certain morphological and chemical attributes of 39 medlar genotypes grown in Ordu region in 2012. There was large
variation among the genotypes that the average fruit weight, fruit length and fruit width were between 6.32 and 36.42 g,
21.8 and 40.1 mm and 20.6 and 42.7 mm while width and length of calyx basin ranged from 8.3 to 23.3 mm and from
3.8 to 11.8 mm, respectively. Soluble dry matter, titreable acid contents and pH varied between 2.3 and 11.9 g/l, 8 and
18%, and 3.62 and 4.90, respectively. Based on especially fruit size and weight, the clone #3 was selected as a
promising genotype.
Key words: Medlar, Mespilus germanica L., pomology, selection.
INTRODUCTION characteristics of genotypes grown in natural

habitat of Ordu province.
Medlar (Mespilus germanica L.) is a genus in
the Rosaceae family which has many fruit
species. Medlar is deciduous and grows
naturally as large shrubs or small trees in Plant material
Southwest Asia and also in Southeast Europe, The fruits of 39 different genotypes were taken
mostly in the coast of Black Sea in Turkey for into consideration among hundreds of
3000 years. The fruits of medlar have brown genotypes grown in the district of Ulubey,
and sometimes reddish colour and they are 1.5- Ordu. The fruits were harvested from the trees
3 cm in diameter, the small ones have a weight before softening and 15 fruits from each
of 10-80 g (Browicz, 1972; Bignami, 2000; genotype were left for softening at 22 ± 2 0C.
Ayaz et al., 2008). The medlar fruit is widely The measurements of fruit length, fruit
consumed in Turkey. In Northeast Anatolia diameter, width and length of calyx basin were
(Turkey) both wild and cultivated forms are determined with digital calipers; fruit and seed
grown, and their fruit is used in different ways. weight were determined with 0.01 g sensitive
In October, the hard fruit is harvested from the precision scales by taking the average of the 15
medlar trees and stored in cold, dark and fruits.
ventilated places. However, a substantial part In soft fruits, the rate of total soluble dry matter
of the crop at different stages of maturity is left was determined as percentage with hand
on the trees and harvested later after fruit refractometer. The rate of titreable acid content
softening has started. The fruit is often was determined as percentage considering the
consumed or sold in the local markets and amount of total base consumed as malic acid,
stores.Cultivars of Mespilus germanica that are after the titration with 1N NaOH. The pH of
grown for their fruit include; hollandia, fruit juice was also determined.
nottingham and russian, dutch (also known as The data obtained from the fruits of the 39
giant or monstrous), royal, breda giant and genotypes were tested using variance analysis
large russian (Bignami, 2000). There are very with the statistical packages of minitab
few kinds of fruit in other types.This study was (MINITAB Inc.). The differences were
conducted in order to determine the fruit compared with Duncan method with using 0.05
F value (P< 0.05).
149
RESULTS AND DISCUSSIONS Ozkan et al., (1997) and Bostan (2002)
determined the titreable acid contents as
Fruit characteristics of the 39 genotypes that
between 1.91 and 8.71 g/l. Our results are
were evaluated in the field observations are
linear with these findings except the genotype
given in Table 1. According to the results, the
of 39 (11.93 g/l).
genotype 3 has the highest value for fruit
The maximum value of genotypes in terms of
weight (36.42 g) and it is followed by genotype
seed weight was found in the genotype 2 (4.28
1 (31.28 g) and genotype 33 (30.31 g). The
g) and it was followed by genotype 4 (4.10 g).
lowest value for fruit weight was measured in
The lowest seed weight was found in the fruits
the genotype 29 (6.32 g).
of the genotype 29 (0.92 g).
Studies in the literature carried out in different
Number of seeds in fruits was found above four
parts of Turkey showed that the values of fruit
in all genotypes except the genotypes 20, 22
weight ranged from 9.46 to 40.80 g (Ozkan et
and 36. On the other hand, the number of seeds
al., 1997; Bostan, 2002; Bostan and Islam,
was five in the genotypes 3, 32 and 39. Studies
2007; Ercilsi et al., 2012).
in the literature showed that the number of
The highest values in terms of fruit lengths
seeds were generally between 4 and 5 (Ozkan
were found in the genotypes 14 (40.12 mm)
et al., 1997; Bostan, 2002; Bostan and Islam,
and 3 (39.74 mm). The lowest values were
2007).
determined in the genotype 31 (20.69 mm). In
previous studies, it was indicated that the fruit
CONCLUSIONS
lengths ranged from 26.53 to 48.73 mm in the
genotypes selected (Ozkan et al., 1997; Bostan, In this study, fruit characteristics of 39
2002; Bostan and Islam, 2007; Ercilsi et al., genotypes were investigated. Four genotypes
2012). Our results are within the range of the with fruit weight of 25 g or more, 6 genotypes
values reported in the literature. with fruit length of 35 mm or longer and 6
The fruit diameters of analyzed genotypes genotypes with fruit diameter of 35 mm or
ranged from 23.10 to 42.65 mm. The highest more were determined. These leading
value was determined in the genotype 3, as it genotypes have the potential of being used in
was true for fruit length. In the literature, it was developing new varieties.
stated that the fruit diameters of identified In the study, 5 genotypes producing 17%
genotypes varied from 23.67 to 42.51 mm soluble dry matter were regarded as
(Ozkan et al., 1997; Bostan, 2002; Bostan and outstanding genotypes because of their
Islam, 2007; Ercilsi et al., 2012). Our fruit chemical composition and they also had high
diameter results were almost similar to these rate of titreable acid contents. This study
values. carried out in the natural growing area of
The width and length of calyx basin increased medlar revealed that the genotype 3 was
with the coarsening of fruit. For the width of promising in terms of the characteristics
calyx basin, the maximum value was evaluated in variety development.
determined in the genotype 15 (23.33 mm) and
for the length of calyx basin, the maximum REFERENCES
value was determined in the genotype 3 (12.94
mm). Ayaz F.A., Demir O., Torun H., Kolcuoglu Y., Colak
A., 2008. Characterization of polyphenoloxidase
The soluble dry matter contents of genotypes (PPO) and total phenolic contents in medlar
varied between 8-18%. In the literature these (Mespilus germanica L.) fruit during ripening and
values ranged from 12.5 to 26% (Ozkan et al., over ripening. Food Chemistry Volume 106, Issue 1,
1997; Bostan, 2002; Bostan and Islam, 2007; p. 291–298.
Ercilsi et al., 2012). Baird J.R., Thieret J.W., 1989. The Medlar (Mespilus
The pH value of fruit juice was found between germanica, Rosaceae) from antiquity to
obscurity. Economic Botany. 43 (3), p. 328–372
3.62 and 4.76. These differences are not Bignami C., 2000. Il nespolo comune. L’Informace
significant statistically. Agrario, 25, p. 43–46
The values of titreable acid contents were Bostan S.Z., 2002. Interrelationships among pomological
found between 2.35 and 11.93 g/l. These traits and selection of medlar (Mespilus germanica
differences are not significant statistically too.
150
L.) types in Turkey. J. Amer. Pomolog Soc. 56, p. Ercilsi S., Sengul M., Yildiz H., Sener D., Duralija B.,
215-218. Voca S., Dujmovic P.D., 2012. Phytochemical and
Bostan S.Z., Islam A., 2007. A research on breeding by antioxidant characteristics of medlar fruits (Mespilus
selection of medlar (Mespilus germanica L.) types in germanica L.) Journal of Applied Botany and Food
Eastern Black sea region of Turkey. Proceedings of Quality 85, p. 86–90.
5th National Horticultural Congress, p. 330-337. Ozkan Y., Gercekcioglu R., Polat M., 1997. A study on
Browicz K., 1972. Mespilus L. in: P.H. Davis (Ed.), the determination of fruit properties of medlar types
Flora of Turkey and the East Aegean Islands, Vol. 4 (Mespilus germanica L.) from Tokat region.
Edinburgh University Press, Edinburgh, p. 128–129 Proceedings of National Pome Fruit Symposium, p.
123-129.
151
THE CHOROLOGY OF ARTEMISIA ALBA TURRA,
A. LERCHIANA WEBER AND A. TSCHERNIEVIANA BESSER
(ASTERACEAE) IN ROMANIA
Monica BADEA, Ioana PĂDURE, Sorin ‫܇‬TEFĂNU‫܉‬, Aurelia DOBRESCU,

Liliana BĂDULESCU

59 Mără‫܈‬ti Blvd., District 1, 011464, Bucharest, Romania
Abstract
The paper presents chorological data concerning Artemisia alba Turra, Artemisia lerchiana Weber, and Artemisia
tschernieviana Besser (Asteraceae) in Romania. These species of Artemisia are considered rare in Romania.
Chorological data regarding Artemisia alba, A. lerchiana and A. tscherneviana distributions are presented using
bibliographical information, data from different Herbaria of Romania and original data collected from fieldwork. An
original chorological map using GEOCOD coordinates is presented for the first time.
Key words: Asteraceae, Artemisia species, chorology, distribution map, GEOCOD coordinates, Romania.
INTRODUCTION marine species from the Black Sea, Constanta

to Mamaia from Tannery (Prodan, 1925).
Genus Artemisia L. is one of the largest and
The main objective of the present study is to
most widespread types of the nearly 100 genera
add new and original chorological points and to
that make up the family Asteraceae. It is
document the geographic distribution of the A.
considered that the genus includes about 500
alba, A. lerchiana, A. tshernieviana species in
species worldwide, of which 15 species are
Romania using GEOCOD system.
annual or biennial. Several members of the
genus can be found as endemic species,
introduced by man or, as is the case in South
America and South Africa, appear as invasive The chorological distribution of the species
species. Artemisia species are perennial, rarely using UTM coordinates is expressed in Figures
annual or biennial (Bremer, 1994; Vallès and 4, 5 and 6. Descriptions and details of
McArthur, 2001). distribution of Artemisia are based on
In 'Flora Europaea' Artemisia genus contains 57 collections from Herbaria: BUAG-Herbaria of
species, and the Illustrated Flora of Romania it U.S.A.M.V. Bucharest, BUC-Herbaria of
is mentioned the presence of 16 species University of Bucharest, BUCA-Herbaria of
(Ciocârlan, 2009), five of which are considered Institute of Biology Bucharest, CL-Herbaria of
rare. In Romania there are few studies on rare University “Babes-Bolyai”, Cluj-Napoca,
species of the genus Artemisia (Badea, 2011). CRA-Herbaria of University of Craiova, I-
Holobiuc and Blidu (2007) and Dihoru and Herbaria of University “Al. I. Cuza” Iasi
Negrean (2003) realised a distribution maps of (according codes with Index Herbariorum, N.
some rare species usingUniversal Transverse H. Holmgren). The chorological map of
Mercator (UTM) system. Artemisia alba, A. lerchiana, A. tschernieviana
Artemisia lerchiana species was cited by Borza is based on the cited sources above and new
(1947) as being present in Dobrogea and personal records obtained during research, or
Moldova. Concerning A. tschernieviana species different databases / scientific publications
(syn. A. arenaria) Borza (1947) cites the where this species was referred. The
presence in Moldova and Dobrogea (FRE chorological maps of Artemisia alba, A.
2294) also mentioned that the dunes rare lerchiana and A. tschernieviana included in this
work were made by taking in account the
153
principles of the GEOCOD System (Oltean and 23959); G. Negrean, 2.07.1978 (HGN);
Stefanut 2002), which ensures an exact Jurilovca, 27.06. 1983, G. Negrean (BUCM
localization of villages, communes and towns 77235);
where this species was found. Artemisia tschernieviana Besser [syn. A.
arenaria DC.; A. campestris subsp. inodora
RESULTS AND DISCUSSIONS Nyman.]
It is a rare, continental, heliophile,
Artemisia albaTurr [syn. A. saxatilis Waldst.
psamophyllous plant. The western limit for her
& Kit., A. biasolettiana Vis., A. lobelii All., A.
growth area is Romanian part of Dobrogea
incanescens Jord., A. camphorata Vill., A.
(Figure 3).
suavis Jord.]
County CONSTANTA: PJ 28 Agigea, leg. C.
It is a rare, submediteranean calcicole species
Burduja et det. I. Sârbu, 5.08.1967, (I 43001,
(Figure 1).
43002); Capul Midia, leg. Badea Monica, det.
County ALBA: FS 94 Coltesti, leg. Csuros et
Vasile Ciocârlan, 6.07.2011 (BUC 157623; I
Pàll, det. Gergely, 19.10.1957 (CL 659804); FS
137117); PJ 28/29 Constanta, leg. C. Petrescu
94 Coltesti, 'Piatra Cetatii', leg. et det. I.
et det. C. Dobrescu, 31.07.1915 (I. 24249,
Gergely, 22.09.1961 (I 89274, 45278, 33162);
1467); PJ 37/38 Eforie, leg. et det. C. Burduja,
Mountains Hasmas: Mt. Hasmasul Mic,
27.07.1948 (I. 61355; 61356); PJ 37/38 Eforie,
Trascaului pe “Piatra Cetatii”, “Piatra
leg. et det. I. Sârbu, 19.10.1971 (I. 36912;
Urdasului”, “Piatra Podmon”, Mt. Bedeleu, “
36193; 38340); PJ 37/38 Eforie, leg. C.
Piatra lui Paul cel Mare” (Oprea, 2005); Zahariadi, det. A. Popescu, 30.08.1960,
County CARAS-SEVERIN: EQ 58 Ciclova (BUCA 129286); PJ 39 Mamaia, leg. et det. C.
(Oprea 2005, Savulescu et all., 1964); Burduja, (I 61357, 61358, 1467); PJ 39
County CONSTANTA: PJ 05 Cotul Vaii, leg. Mamaia, leg. Grintescu, 11.08.1910, det.
et det. Gavril Negrean, 21.08.2002 (CL Beldie Alex.,1964, (BUCA 88643); PJ 39
656524); Mamaia, leg. M.Tiesen, 11.08.1926 (CL
Couny CLUJ: Rimetea, (Savulescu et all., 429167); PJ 39 Mamaia, leg. Al. Borza,
1964); FS 95 Buru, leg. Badea Monica, det. V. 5.08.1923 (CL 501119, 501146); PK 20
Ciocârlan, 11.10.2010 (BUAG 23955); Navodari, leg. Popescu, 18.05.1972 (BUCA
County HARGHITA: Mt. Haghimasu Mic 129079); PJ 27 Techirghiol,, leg. et det. G. P.
(Savulescu et all., 1964); Grintescu, 17.09.1925 (I 45271, 33158, BUCA
County SIBIU: KL 68/78 Ocna Sibiului, (FS, 18848, 30326, 41826, 30380, 30379, 30378,
Savulescu et all.,1964); 11278; CL 618230; CRA, 1467); Corbu,
County TULCEA: 6 Martie, leg. et det. (Fagaras, 2008);
G.Negrean, 1.06.1984 (BUCA 549790); County SUCEAVA: MN 37 Moara Carp,
Artemisia lerchiana Weber [syn. A. incana B. reserve Frumoasa, leg. M. Paun, M. Olaru, Gh.
Keller, non Druce; A. taurica auct. roman., non Popescu, (CRA);
Willd.] County TULCEA: NL 92 Grindul, leg.
It is a Xerophile, heliophile and calcicole plant Popescu, 24.07.1968 (BUCA 133359; BUCA
widely spread in the Pontic-Aralo-Caspian 133539), PL91 Letea (Buia, 1963), QL 00/10
area. The species can be found in Dobrogea Sulina (Buia, 1963) Sf. Gheorghe, Ciocârlan,
(“Capul Dolosman-Jurilovca”). It has a 1994;
preference for dry, rocky terrain with a gentle
to medium slope and chernozem or CONCLUSIONS
kastanozems (Figure 2).
County IASI: NN 34 Tiganasi (Chifu et all., This study contains data from different
1987); Herbaria from Romania (BUC, BUCA, BUAG,
County TULCEA: PK 35 Baia, 3.07.1978, G. CL, CRA, I) in which we made the revision of
Negrean (BUCA); PK 46 Jurilovca (Capul Artemisia L. (Asteraceae) genus and made
Dolosman), 31.10.1999, leg. et det. V. photos of the herbaria sheets with Artemisia
Ciocârlan (BUAG 23191); leg. Badea Monica, alba, A. lerchiana, A.tscherneviana.
det. Vasile Ciocârlan, 4.10.2009 (BUAG
154
The chorology maps of Artemisia alba, A. lerchiana in BUAG-Herbaria of USAMV
lerchiana, and A. tschernieviana species were Bucharest, Artemisia tschernieviana in BUC-
developed for the first time using GEOCOD Herbaria of University of Bucharest, I-Herbaria
coordinates. New and original localities were of University “Al.I.Cuza” Iasi).
added compared with bibliographical These chorological maps add new data in our
references or data sheets specimens from monographic study of Artemisia L.
Herbaria. (Asteraceae) genus in Romania.
Were placed in Herbaria specimens of rare
Artemisia species (Artemisia alba and A.
Figure 1. Morphological aspect of Artemisia alba Turra (orig. 1a)
Figure 2. Morphological aspect of Artemisia lerchiana Weber (orig.)
155
Figure 3. Morphological aspect of Artemisia tschernieviana Besser (orig.)
Figure 4. Chorology of Artemisia alba Turra in Romania (orig.)
156
Figure 5. Chorology of Artemisia lerchiana Weber in Romania (orig.)
Figure 6. Chorology of Artemisia tshernieviana Besser in Romania (orig.)
REFERENCES Bremer K., 1994. Asteraceae, Cladistics and

Classification, Timber Press: Portland. Carnegie
Badea M. L., 2011. Cercetari privind structura tesuturilor Institution of Washington: Washington, DC.
secretoare, compozitia uleiului volatil si corologia la Buia A., Paun M., Malos C., Olaru A., 1963. Materiale
unele specii de Artemisia din România, Teza de pentru flora Masivului Parâng, Lucr. Gr. Bot.
doctorat, Bucuresti. Bucuresti, 1961-1962, p.267-297.
Borza Al., 1947. Conspectus Florae Romaniae Chifu T., Mititelu D., Dascalescu D., 1987. Flora si
Regionumque affinum, Tipog. “Cartea Româneasca”, vegetatia judetului Neamt, Memor. Sect.St, Acad.
Cluj. Romana, Ser. IV, X, vol.1, p. 281-302.
157
Dihoru Gh., Negrean G., 2009. Cartea Rosie a Plantelor Prodan I., 1925. Flora nisipurilor din România sub
Vasculare din România, Ed. Academiei Române, raportul fixarii si ameliorarii. Conspectul sistematic
Bucuresti, p. 630. al speciilor. Inst. Arte Grafice, Bucuvina, p. 89.
Ciocârlan V., 1994. Flora Deltei Dunarii, Ed. Ceres, Savulescu T., Ghisa E., Grintescu I., Gusuleag M.,
Bucuresti, p. 40. Morariu I., Nyarady E.I., Prodan I., 1964. Flora
Ciocârlan V., 2009. Flora ilustrata a României, Ed.Ceres, R.P.R., Ed. Academiei Române, vol.IX, Bucuresti.
Bucuresti. Valles J. and McArthur E.D., 2001. Artemisia
Fagaras M., Skolka M., Anastasiu P., Cogalniceanu D., systematics and phylogeny: cytogenetic and
Negrean Banica G., Tudor M., Samoila C., 2008. molecular insights. In Shrubland ecosystem genetics
Biodiversitatea Zonei Costiere a Dobrogei dintre and biodiversity: proceedings, E. D. McArthur and D.
Capul Midia si Capul Kaliacra, Ed. EX PONTO, J. Fairbanks, eds; 2000 June 13-15; Provo, UT. Proc.
Constanta, p. 451. RMRS-P-21. Ogden, UT: U.S. Department of
Holobiuc I., Blindu R., 2006-2007. In vitro culture Agriculture, Forest Service, Rocky Mountain
introduction for exsitu conservation of some rare Research Station.
plant species, Rom. J. Biol. Plant Biol., Vol. 51-52, p. Artemisia L. (Asteraceae) genus in
13-23. http:/eunis.eea.europa.eu/references/1780/species
Oltean M., Stefanut S. 2002. Atlas Florae Romaniae, Index herbariorum, N. H. Holmgren,
Proceed. Inst. Biol. IV, p. 101-108. http://sciweb.nybg.org/science2/IndexHerbariorum.a
Oprea A., 2005. Lista critica a plantelor vasculare din sp.
România, Ed. Universitatii 'Alexandru Ioan Cuza'
Iasi, p. 374-375.
158
NEW HOST PLANT FOR VIRUS VECTOR
NEMATODE XIPHINEMAITALIAE MEYL, 1953
(NEMATODA: LONGIDORIDAE) IN ROMANIA
Mariana BONTA (GROZA)1, Ioan RO‫܇‬CA1, Claudia COSTACHE2

1
59 Marasti Blvd., 011464, Bucharest, Romania
2
Central Phytosanitary Laboratory, 11 Voluntari Blvd., 077190, Bucharest, Romania
Abstract
Except direct damage to root system, Xiphinema italiae Meyl, 1953 has been reported to be a vector of Grapevine
fanleaf virus (GFLV) (Cohn et al., 1958). Soil samples were collected at a depth of 20-40 cm from orchards and
vineyards. Xiphinema italiae was identified in rhisosphere of peach orchard. A polymerase chain reaction protocol and
the morphological and morphometrical characters has been used for the reliable identification of X. italiae.
Morphometrics and illustrations of females are provided. Prunus persica L.is a new host plant for Xiphinema italiae for
Romania.
Key words: Longidoridae, morphology, PCR Multiplex.
INTRODUCTION Nematodes were extracted from 200cm3 soil by

a sieving and decanting technique, Nematodes
Xiphinema italiae Meyl, 1953 is widespread
were heat killed at 60ºC for two minutes and
migratory plant parasitic nematode, species
fixed in a 4% formaldehyde solution. The
occurring in southern and central Europe:
specimens were processed to mounted on
Bulgaria (Peneva and Choleva, 1992,
permanent microscopic glass slides (Seinhorst,
Peneva,1997) France (Wang et al., 2003)
1959).
Greece (Avgelis & Tzortzakakis, 1997,
The morphological and morphometrical
Tzortzakakis et al. 2006) Hungary (Nagy,
observations were made using Leica DMLB
1999), Italy (Martelli et al.,1966), Moldavia
microscope fitted with Leica FDC 295 camera.
(Polinovskij, 1979), Serbia (Barsi & Lamberti,
Multiplex PCR. DNA isolation was carried out
2003), Slovakia (Liškova et al., 1993) and
by placing 4 nematodes in 10 μL of lysis buffer
Spain (Teliz et al., 2007) (Gutiérrez-Gutiérrez
(1X Platinum Taq DNA polymerase /Invitrogen
et al., 2011).. Outside Europe it was found in
and 60 μg of proteinase K/mL) between two
Cuba (Dias-Silveira & Herrera, 1995), Egypt
glass slides and crushed gently. The
(Lamberti et al., 1996), Libya (Siddiqui et al.,
homogenate was taken up carefully with a
1987), Nigeria (Khan et al., 1993) and South
pipette, transferred to 0,2 mL Eppendorf tubes
Africa (Knoetze et al., 2000). Xiphinema italiae
and frozen at-80°C for 15 min. After the tubes
has been reported to be a vector of GFLV
according to Cohn et al., 1970). In Romania, were incubated at 60°C for 1 h and 95°C for 15
RomaƔcu, 1971 found X. italiae in association min.
Amplification was carried out in a 25-μl
with grapevines from sandy soil in PlatoneƔti
reaction mixture containing the 2,5 μl lysis
and Saveni (Ialomiԑa county).
buffer (nematode lysate as PCR template), 1x
Platinum Taq DNA polymerase buffer
(Invitrogen), 1.5 mM MgCl2 (Invitrogen), 0.2
For this study, soil samples were collected from mM each of dATP, dCTP, dGTP, and dTTP
the rhizosphere of peach trees at a depth of 20- (Sigma 10mM), 0.8 pmol each primer, and
40 cm from Valul lui Traian (Constanԑa 0.5 units of Platinum Taq DNA polymerase
county).
159
(Invitrogen). The primers A-ITS 1, I27, D24, Table 1. Measurements of Xiphinema pachtaicum (all in
V18, ITA26 were used (Wang et al. 2003). micrometres)
Amplifications were performed in a thermal
cycler (Mastercycler Pro S – Eppendorf), with
the following cycling conditions: 95°C for 3
min followed by 39 cycles at 94°C for 1 min,
58°C for 1 min, and 72°C for 1 min 30 s, and
ending with 1 cycle at 72°C for 5 min and
storage at 4°C.
Amplification product (10 μl PCR product) was
separated on 1,5% agarose gel (Sigma) and
0,5X TBE at 100V. The gels were visualized
with photo documentation system GENi
(Syngene).

Xiphinema italiae Meyl, 1953 (Table 1, Figure
3).
Female: Body almost straight, tapering forward
and backward, tail end ventrally curved.
Cuticle 1,5-1,7μm thick in postlabial region,
2,2-2,7 μm at mid body, 3-4,3 μm. Head end
4,3-5μm convex, clearly separated from
adjacent body by a constriction, laterally
rounded. Basal bulb measuring 17-18x113-120
μm. Prerectum 451-607μm, rectum 23-31μm.
Tail conical, elongated, tapering ventrally and
or dorsally before end. Terminus rounded.
Juveniles: The scatter plot diagram based on
functional and replacement odontostyle and n=number of specimens; a=body
body length reveals the presence of three length/greatest body diameter; b=body
juveniles stages (the second, third, fourth) length/distance from anterior to end of
(Figure 1). esophageal bulb; c=body length; c´=tail
length/anal body diameter; V%=distance of
vulva from anterior end
Figure 1. Scatter plot of odontostyle and replacement

odontostyle agaist body length of Xiphinema italiae.
Figure 2. Electrophoresis of the amplification products

from DNA isolated from Xiphinema italiae: lane M-
100bp DNA ladder (Fermentas), lane A,B – X. italiae
160
Molecular differentiation showed a single REFERENCES
fragment of approximately 414bp was Avgelis A.D., Tzortzakanis E.A., 1997. Occurrence and
amplified (Figure 2), according to Wang et al., distribution of Xiphinema species and Grape
2003 which correspond to Xiphinema italiae. fanleaf nepovirus in vineyards of Greek island of
Samos. Nematologia Mediterranea, 25, p. 177-182.
Barsi L., Lamberti F., 2003. Morphometrics of adults and
juvenile stages of three longidorid nematodes
(Nematoda: Dorylaimida) from Vojvodina province,
Northern Serbia. Nematol. Medit., 31, p. 65-85.
Cohn E., Tanne E., Nitzany F.E., 1970.
Xiphinemaitaliae, a new vector of grapevine fanleafe
virus. Phytopatology, 60, p. 181-182.
Gutiérrez-Gutiérrez C., Castillo P., Cantalapiedra-
Navarrete C., Landa, B. B., Derycke, S., Palomares-
Rius J. E., 2011. Genetic structure of Xiphinema
pachtaicum and X. index populations based on
mitochondrial DNA variation. Phytopathology 101,
p. 1168-1175.
Lamberti F., Agostinelli A., Radicci V., 1996.
Longidorid nematodes from Northern Egypt.
Nematol. Medit., 24, p. 307-339.
Liškova M., Lamberti F., Sabova M., Valocka B.,
Agostinelli A., 1993. First record of some species
longidorid nematodes from Slovakia. Nematologia
Mediterranea, 21, p. 183-194.
Martelli G.P., Cohn E., Dalmaso A., 1966. A
redescription of Xiphinema italiae Meyl, 1953 and
its relationship to Xiphinema arenarium Luc et
Dalmaso, 1963 and Xiphinema conurum Siddiqi,
1964. Nematologica, 12, p. 183-194.
Nagy P., 1999. New faunistic record for Longidorus
attenuatus Hooper, 1961 and Xiphinema italiae
Meyl, 1953 (Nematoda: Longidoridae) in Hungary.
Figure 3. Xiphinema italiae Meyl, 1953: A, anterior Növényvédelem, 35, p. 15.
region of female with lips region, odontostyle, Peneva V., Choleva B., 1992. Nematodes of family
odontophore, guiding ring; B, oesophageal bulb; C, Longidoridae from forest nurseries in Bulgaria. II.
posterior genital branch; D, anterior genital branch; E, The genus Xiphinema Cobb. 1913. Helmintology 32,
head end; F, vaginal region; G, female tail; H, rectum. p. 47-66.
Scale bar: 20μm; 50μm. Romascu, 1971. Xiphinema americanum Cobb, 1913 si
Xiphinema italiae Meyl, 1953 (Nematoda:
CONCLUSIONS Dorylaimidae), noi daunatori ai vitei de vie, Analele
I.C.P.P., vol. VII, p. 203-209.
Xiphinema italiae was recorded on Prunus Seinhorst J.W., 1959. A rapid method for the transfer of
persica for the first time in Romania. nematodes from fixative to anhydrous glycerin.-
Nematologica4, p. 67-69.
The monitoring of virus vector nematodes Teliz D., Landra B., Rapaport H.E, Camacho F.P., Diaz
through soil samples, before set up the orchards J. R. M., Castillo P., 2007. Plant parasitic nematodes
and vineyards, can assure healthy crop. infecting grapevine in south Spain and susceptible
reaction to root-knot nematodes of rootstocks
Accurate identification of Xiphinema spp. is reported as moderately resistant. Plant. Disc., 91, p.
important in regard to their virus transmission 1147-1157.
capability. Tzortzakanis E., Pateras D., Charoulis A., 2006.
Occurrence of Xiphinema species in grapevine areas
For a reliable diagnosis is necessary to combine of Tyranvos with comments on the distribution of X.
identification using morphometric characters italiae in Greece. Helminthologia, 43, p. 186-187.
and molecular technics. Wang X., Bosselut N., Castagnone C., Voisin R., Abad
P., Esmenjaud D., 2003. Multiplex Polymerase Chain
Reaction Identification of Single Individuals of the
ACKNOWLEDGEMENTS Longidorid Nematodes Xiphinema index, X.
This research was carried out with the support diversicaudatum, X. vuittenezi and X. italiae Using
Specific Primers from Ribosomal Genes –
of POSDRU/107/1.5/S/76888 project. Nematology, Vol. 93, No. 2, p. 160-166.
161
STUDY ON THE FREE AMINO ACID PROFILE OF LEAVES FOR GRAPES
VARIETIES OF GALBEN DE ODOBEbTI SORTOGROUP
Marioara BOSOI1, Constantin ğÂRDEA2

1
Research and Development Station for Viticulture and Oenology OdobeƔti, Stefan cel Mare no. 61,
625300, OdobeƔti, Romania
2
University of Agricultural Sciences and Veterinary Medicine IaƔi, Mihail Sadoveanu Avenue no.3,
IaƔi, Romania
Abstract
Researches on amino acid profile carried out so far in the genus Vitis showed its great variability, suggesting
importance of the genetic involvement in this variability This paper presents preliminary results of investigating the
amino acid profile from leaves to the grape varieties of sortogroup Galbenĉ de OdobeƔti. The grape varieties taken in
the study were: Galbenĉ de OdobeƔti, Bĉtutĉ neagrĉ, Zghiharĉ de HuƔi, Negru moale and Negru vârtos. For extraction
of free amino acids from the leaves of the vine has been used the method Bieleski & Turner (1966) adjusted for
grapevine, and separation technique was performed by thin-layer chromatography (TLC). Identification and
quantitative estimation of free amino acids was performed using analysis and image processing software - ImageJ
ver.1.46. The amount of free amino acids ranged between 18.76 mg / mg fresh leaf at Galbenĉ de OdobeƔti variety and
14.33 mg / mg for Negru moale variety. In the varieties Galbenĉ de OdobeƔti, Bĉtutĉ neagrĉ and Zghiharĉ de HuƔi the
most abundant free amino acids were: aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), proline
(Pro) and glycine (Gly). The predominant amino acids for Negru moale variety were: aspartic acid (Asp), serine (Ser),
glycine (Gly), glutamic acid (Glu), threonine (Thr), proline (Pro) and arginine (Arg). Amino acids predominantly to
Negru vârtos variety are: aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), proline (Pro) and
arginine (Arg). Aspartic acid (Asp) is found in large quantities compared with other amino acids, representing 31.7%
of total amino acids identified for Negru vârtos variety, 31.5% at Zghiharĉ de HuƔi variety, 30.5% fpr Negru moale
variety, 27. 5% for Galbenĉ de OdobeƔti variety and 25.3% for the variety Bĉtutĉ neagrĉ. Statistical ratio Pro / Arg
and amino predominant ratio (Asp / Ser), genetically differentiate the Bĉtutĉ neagrĉ variety the other varieties
belonging to the sortogroup Galbenĉ de OdobeƔti, with a confidence interval of 95%. These preliminary data provide a
basis for further research that can demonstrate that amino acid profile of the leaves can be used as method in
discriminant analysis of grape varieties.
Key words: amino acid profile, Galbenĉ de OdobeƔti, sortogroup, thin-layer chromatography.
INTRODUCTION increases during aging reaching values between

200 and 6500 mg/l of each amino acid
The fund management in grape germplasm is
variations from one year to another, and from
one of the most important issues is the growing
one variety to another (Ԑârdea, 2007). Share
concern of researchers from all countries.
amino acids in grapes is high and is 20 -30% of
Classical identification methods based on
the total nitrogen compounds (Poux and
characteristics ampelographic / botanical not
Ournac, 1970). Total amino acid content
the most accurate, with certain restrictions due
especially predominant ratio of amino acids
to instability morphological characteristics
differ significantly from one variety to another,
influence environmental conditions.
so knowing the amino acid spectrum of
Research on amino acid profile made so far in
vegetative organs and grapes can be a means of
the genus Vitis showed its great variability,
differentiation of vine varieties in terms of
suggesting importance of the genetic
involvement in this variability (Kliewer et al., genetically (Hernández-Orte et al., 1990).
1966, Kliewer 1969; Klub et al., 1978; Marcy Studies on free amino acid profiles of grapes
et al. 1981; Notsuka et al., 1984, Huang and made so far reported variations in the genetic
Ough, 1991). On vines, the total amino acids material and suggests new biochemical
descriptors (Shiraishi, 1996).
163
The characterization of the grapevine varieties stationary phase 60 on aluminum foil 20 x 20
based on free amino acid profile shows a great (TLC Silicagel 60), manufactured by Merck
importance to complement the modern methods KGaA, Germany. TLC plates were made with
on investigation of the vine varieties size 10 x 7 cm and have been marked the areas
(isoenzymatic analysis and DNA analysis). of application for samples. Using standard
amino acids were produced by Merck KGaA,
MATERIALS AND METHODS Germany, in the solution of methanol:
chloroform: water (12:5:3 v / v / v). Samples (2
The biological material was represented by five
ʅl) were applied with an automatic
local varieties to Galbenĉ de OdobeƔti
micropipette with volume control, from left to
sortogroup (Galbenĉ de OdobeƔti, Zghiharĉ de
right at the bottom of the plate, in the areas
HuƔi, Bĉtutĉ neagrĉ, Negru moale and Negru marked for each cultivar. The chromatographic
vârtos), belonging ampelographic collection of separation or development of plates was done
Research and Development Station for in mono dimension, was used the development
Viticulture and Winemaking OdobeƔti. system based on n - butanol / glacial acetic acid
Samples for analyses were the young leaf / water (ratio 4:1:1 v/v/v). After
obtained by forcing cuttings - eye. The leaf chromatographic separation, the TLC plates are
samples (2 or 3 leaves, ~ 5 g ) were collected ready for viewing and identification of amino
from each variety in plastic bags, labeled, acids separated. To ensure reproducible results,
stored on ice and brought to laboratory for the tests were repeated three times for
analyses. predominant amino acids, to all five varieties.
For extraction of free amino acids from the View amino acids was performed using
leaves of the vine has been used the method specific reagents – ninhydrin (a solution in
Bieleski & Turner (1966) adjusted for concentration of 0,25%). Amino acids appear
grapevine. This method ensures the extraction, as separate spots colors. The TLC plates
separation and quantitative estimation of amino viewed ninhydrin solution, sensitive to light
acids from small samples of vegetal fresh were scanned or photographed for the
tissue, by thin layer chromatography technique. qualitative and quantitative evaluation of free
For extraction of free amino acids in biological amino acids separated from each sample. To
material and for the preparation of standard identify amino acids separated in samples was
solutions of amino acids was used a mixture calculated the retention factor (Rf) compared
solution with methanol, chloroform and water with each standard amino acid. Quantitative
in a ratio of 12:5:3 v/v/v. For each grape determination of free amino acids in the
variety was weighed a sample of 0.5 g samples was performed using image analysis
biological material. The fresh leaves were program - ImageJ ver 1.46 r, and the values
lyophilized and crushed in a mortar with liquid obtained were expressed in ʅg free amino acid
nitrogen until was obtained a fine powder. for 1 mg fresh leaf tissue.
0,200 g was transferred for each sample in a The data obtained were processed statistically
Eppendorf tube 1.5 ml. Over powder was added for analysis of variance (ANOVA test) and has
200 ml extraction solution (methanol: been determined significance of differences for
chloroform: water - M/C/W) in ratio of 12/5/3 the total free amino acids content and the ratio
(v/v/v), which allowed the removal of pigments between the predominant amino acids (Student
and lipids from plant material in chloroform test). Analysis of variance and Student test was
layer. Cell suspensions were treated with sonic performed using the Microsoft Excel menu
frequencies for 1 hour at 4 ° C, causing rupture Tools - Data Analysis.
cell membranes. After sonication the samples
were stored in a refrigerator at 4 º C for at least RESULTS AND DISCUSSIONS
1 h. To obtain the supernatant containing the
amino acids, the sample was centrifuged at 14 amino acids were identified. In Figure 1 and
13,500 rpm for 15 minutes at 4 ° C. 2 are presented TLC plates with amino acids
The chromatographic separation of amino acids separated and visualized with ninyidrin solution
was achieved on TLC plates with silica gel for the five cultivars studied. Standard amino
acids used: alanine (Ala) and histidine (His). In
164
Figure 3 is presented the amino acid profile in
leaves (chromatogram) to the cultivars of
Galbenĉ de OdobeƔti sortogroup, with standard
glutamic acid (Glu). The amino acid profile for
the variety Galbenĉ de OdobeƔti is presented in
figure 4.
Figure 1. TLC plate with amino acids separated and

visualized (St.– Ala)
Figure 2. TLC plate with amino acids separated and

visualized (St.– His) Figure 3. Amino acid profile of leaves for the varieties
analyzed (St. - Glu)
165
Figure 4. Amino acid profile of the leaves to cultivars Galbenĉ de OdobeƔti
The results with the free amino acids content in Bĉtutĉ neagrĉ (15.20 ʅg/ mg) and (cv) Negru
leaves to the cultivars of Galbenĉ de OdobeƔti vârtos (17.74 ʅg/ mg). Aspartic acid (Asp) is
sortogroup, expressed in ʅg/mg fresh leaf tissue found in much higher amounts than other
and percentage are summarized in Table 1. The amino acids identified, representing 31.7% of
total content of free amino acids in leaves of total amino acids identified to the cultivar
vine varieties of Galbenĉ de OdobeƔti Negru vârtos, 31.5% to the variety Zghiharĉ de
sortogroup varied between 18.76 ʅg/mg fresh HuƔi, 30.5% to (cv) Negru moale, 27.5% to
leaf tissue in the variety Galbenĉ de OdobeƔti (cv) Galbenĉ de OdobeƔti and 25.3% to the
and 14.33 ʅg/mg fresh leaf tissue to the cultivar variety Bĉtutĉ neagrĉ.
Negru moale, with intermediate values for the
cultivars Zghiharĉ de HuƔi (14.54 ʅg/mg), (cv)
Table 1. Free amino acid content in the leaves at vine varieties of Galbenĉ de OdobeƔti sorto group
The variety Galbenĉ de OdobeƔti Zghiharĉ de HuƔi Batutĉ neagrĉ Negru moale Negru vârtos
Amino acid ʅg/mg % ʅg/mg % ʅg/mg % ʅg/mg % ʅg/mg %
Aspartic acid (Asp) 5.15 27.5 4.58 31.5 3.84 25.3 4.37 30.5 5.62 31.7
Glutamic acid (Glu) 2.04 10.9 1.37 9.4 2.17 14.3 1.30 9.1 2.06 11.6
Serine (Ser) 2.21 11.8 1.73 11.9 1.82 12.0 1.65 11.5 2.06 11.6
Threonine (Thr) 2.04 10.9 1.75 12.0 1.59 10.5 1.13 7.9 1.83 10.3
Proline (Pro) 1.28 6.8 0.82 5.6 1.46 9.6 1.13 7.9 1.15 6.5
Arginine (Arg) 0.99 5.3 0.71 4.9 0.87 5.7 0.88 6.1 1.26 7.1
Glycine (Gly) 1.27 6.8 0.86 5.9 0.91 6.0 1.35 9.4 0.71 4.0
Lysine (Lys) 0.93 5.0 0.72 5.0 0.81 5.3 0.76 5.3 0.81 4.6
Alanine (Ala) 1.09 5.8 0.75 5.2 0.56 3.7 0.53 3.7 0.72 4.1
Leucine (Leu) 0.81 4.3 0.69 4.7 0.49 3.2 0.45 3.1 0.50 2.8
Histidine (His) 0.65 3.5 0.37 2.5 0.47 3.1 0.54 3.8 0.54 3.0
Phenylalanine (Phe) 0.11 0.6 0.05 0.3 0.04 0.3 0.06 0.4 0.15 0.8
Valine (Val) 0.13 0.7 0.07 0.5 0.09 0.6 0.11 0.8 0.20 1.1
Methionine (Met) 0.06 0.3 0.07 0.5 0.08 0.5 0.07 0.5 0.13 0.7
Amino acid content 18.76 100.0 14.54 100.0 15.20 100.0 14.33 100.0 17.74 100.0
166
The most abundant of the free amino acids in Statistical interpretation of data obtained on
leaves were: total amino acid content in leaves of vine
- to the variety Galbenĉ de OdobeƔti: aspartic varieties belonging to Galbenĉ de OdobeƔti
acid (Asp), serine (Ser), threonine (Thr), sortogroup by analysis of variance/ANOVA
glutamic acid (Glu), proline (Pro) and test shows that there is no statistical
glycine (Gly), representing 74.7% of total significance between the five varieties, because
amino acids identified; the value of P is 0.938854, greater than the
- to the variety Zghiharĉ de HuƔi: aspartic critical value of P, 0.05.
acid (Asp), threonine (Thr), serine (Ser) and The ratio proline/arginine and the ratio of
glutamic acid (Glu), representing 64.8% of predominant amino acids (aspartic acid/serine)
total amino acids content; are considered parameters what remain
- to the variety Bĉtutĉ neagrĉ: aspartic acid constant from year to year and differ
(Asp), glutamic acid (Glu), serine (Ser), significantly from one variety/cultivar to
threonine (Thr), and proline (Pro), another and can be called descriptive
representing 71.7% of the amino acids biochemical parameters. The ratio Pro/Arg has
identified; values between 0.91 to the cultivar Negru
- to the variety Negru moale: aspartic acid vârtos and 1.68 for the cultivar Bĉtutĉ neagrĉ
(Asp), glycine (Gly), serine (Ser), glutamic and the ratio Asp / Ser ranges from 2.11 to the
acid (Glu), threonine (Thr), and proline variety Bĉtutĉ neagrĉ and 2.73 to the variety
(Pro), representing 76.3% of total amino Negru vârtos (Table 2).
acids content; Statistical interpretation of experimental data
- to the variety Negru vârtos: aspartic acid obtained for the ratio Pro/Arg by analysis of
(Asp), glutamic acid (Glu), serine (Ser), variance/ANOVA test shows the existence of a
threonine (Thr), arginine (Arg) and proline statistical significance between the five
(Pro), represents 78.8% of total amino acids cultivars because P value is less than the
content; critical value of P, that is 0.05 (Table 3).
Table 2. The values of biochemical descriptors for grapevine varieties to Galbenĉ de OdobeƔti sortogroup
The variety/
Galbenĉ de OdobeƔti Zghiharĉ de HuƔi Bĉtutĉ neagrĉ Negru moale Negru vârtos
Biochemical descriptors
Pro/Arg ratio 1,29 1,15 1,68 1,28 0,91
Asp/Ser ratio 2,33 2,65 2,11 2,65 2,73
Table 3. The significance of differences to the ratio proline / arginine in the leaves of vine varieties to Galbenĉ de
OdobeƔti sortogroup
The vine variety Galbenĉ de OdobeƔti Zghiharĉ de HuƔi Bĉtutĉ neagrĉ Negru moale Negru vârtos
Galbenĉ de OdobeƔti 0
Zghiharĉ de HuƔi 0.06542 0
Bĉtutĉ neagrĉ 0.00051 0.00064 0
Negru moale 0.94536 0.06777 0.00093 0
Negru vĉrtos 0.01346 0.06722 0.00096 0.01368 0
Statistical the ratio proline/arginine genetically analisys/ANOVA test for the ratio predominant
differentiates the variety Bĉtutĉ neagrĉ the amino acids (aspartic acid/serine), statistically
other varieties of Galbenĉ de OdobeƔti differentiates the variety Bĉtutĉ neagrĉ by the
sortogroup, with a confidence interval of 95%. other varieties except the variety Galbenĉ de
A significant difference exists between the OdobeƔti with a confidence interval of 95%,
variety Negru vârtos and the varieties Galbenĉ while this difference is not significant for the
de OdobeƔti and Negru moale. Variance variety Galbenĉ de OdobeƔti (Table 4).
167
Table 4. The significance of differences in the ratio aspartic acid / serine of leaf vine varieties of Galbenĉ de OdobeƔti
sortogroup
The vine variety Galbenĉ de OdobeƔti Zghiharĉ de HuƔi Bĉtutĉ neagrĉ Negru moale Negru vârtos
Galbenĉ de OdobeƔti 0
Zghiharĉ de HuƔi 0.11292 0
Bĉtutĉ neagrĉ 0.23710 0.00732 0
Negru moale 0.08869 0.93531 0.00357 0
Negru vârtos 0.06510 0.44839 0.00510 0.39683 0
CONCLUSIONS The amino acid profile of leaves can be used as

discriminant analysis method of vine varieties
The total free amino acids content in leaves
to Galbenĉ de OdobeƔti sortogroup. with the
varies between 18.76 ʅg/mg fresh leaf tissue to
other modern methods of investigation
the variety Galbenĉ de OdobeƔti and 14.33
(isoenzyme analysis and DNA analysis).
ʅg/mg to the variety Negru moale, with
intermediate values for the variety Negru
ACKNOWLEDGEMENTS
vârtos (17.74 ʅg/mg), (cv) Bĉtutĉ neagrĉ
(15.20 ʅg/mg) and (cv) Zghiharĉ de HuƔi The authors are grateful Mr. Ass. Prof.
(14.54 ʅg/mg). Gheorge Stoian, Ph.D., in the Department of
Biochemistry and Molecular Biology,
The most abundant of the free amino acids in
University of Bucharest, Faculty of Biology,
leaves of native varieties to Galbenĉ de
for their help in working with TLC.
OdobeƔti sortogroup are: Asp. Ser. Thr. Glu.
Pro. Arg and Gly. Aspartic acid is found in REFERENCES
large amounts compared with other amino
acids predominant. Bieleski R.L.. Turner N.A., 1966. Separation and
estimation of amino acids in crude plant extracts by
The ratio proline/arginine has differentiated thin-layer electrophoresis and
statistically the variety Bĉtutĉ neagrĉ by the chromatography. Anal. Biochem., p. 278–293.
other varieties of Galbenĉ de OdobeƔti Hernández-Orte P., Guitart Ana, Cacho J., 1999.
Changes in the Concentration of Amino Acids
sortogroup with a confidence interval of 95%. During the Ripening of Vitis vinifera Tempranillo
Significant difference exists between the Variety from the Denomination d'Origine Somontano
varieties Galbenĉ de OdobeƔti and Negru (Spain). Am. J. Enol. Vitic. 50:2, p. 144-154.
Huang Z., Ough C. S., 1991. Amino Acid Profiles of
vârtos and between the varieties Negru moale Commercial Grape Juices and Wines. Am. J. Enol.
and Negru vârtos. Vitic. 42:3, p. 261-267.
Kliewer W.M., 1967. Annual cyclic changes in the
The ratio between predominant amino acids
concentration of free aminoacids in grapevine. Am. J.
(aspartic acid/serine) has differentiated Enol. Vitic. 18., p. 126–137.
genetically the variety Bĉtutĉ neagrĉ by the Shiraischi Mikio, 1996. Proposed Biochemical
other varieties (except the variety Galbenĉ de Descriptors for Amino Acids to Evaluate Grape
OdobeƔti) with a confidence interval of 95%. Germoplasm, J. Japan. Soc. Hort. Sci. 65(2), p. 283-
289.
There is significant difference between the Ԑârdea C., 2007. Chimia si analiza vinului, Ed. “Ion
varieties Galbenĉ de OdobeƔti and Negru Ionescu de la Brad, p. 754-770.
vârtos and between the varieties Negru moale
and Negru vârtos.
168
STUDIES UPON THE PHONOLOGY OF ROSIE DE ARIES ONION PLANTS
FROM THE FIRST YEAR OF THE SEEDS PRODUCTION PROCESS AND
THE MAIN CHARACTERISTICS OF THE PARENT PLANTS FROM 2007
UNTIL 2009 YEAR
Janina-Claudia CĂPU‫܇‬AN, Elena ‫܇‬TEFĂNESCU, Elena Liliana DUMITRA‫܇‬CU,

Minerva HEITZ
Vegetable Research and Development Station Iernut, Str. Energeticianului 1A,

Iernut, jud. Mures, Romania
Abstract
The research was carried out in the period of 2007-2009 year, in the environmental conditions of SCDL Iernut. This
spanned the duration of vegetation phases of plans from the experimental variants, since Ist year-parent plant phase, in
three eras of sowing. The vegetation period of the parent plants (emergence- bulb maturity) was, as average on this
three years of study, of: 125 days in the Ist age (1751oC), 110 days in the IInd age (1821 oC) and 106 days in the IIIrd
age (2130 oC). The studied characteristics were: weight of the bulb, the longitudinal diameter, the transversal diameter,
the shape index and the height of the plant.
Key words: phenological dates, important characteristics of the bulb.
INTRODUCTION duration of phenophases in correlation with the

amount of accumulated temperature on
The area of origin and the spread of Allium
phenophases and the influence of some
genus on globe and also the phenotypic
important characteristics of the biological
variability of characteristics for adaptability to
material (bulbs – parent plants).
the bulb to different environmental conditions.
During the periods of experience for producing
Through the process of improvement and
the bulbs-parent plant (Ist year) have been
selection, experts have created valuable
carried out specific maintenance work. Have
varieties and hybrids of onion.
been carried out observations and biometric
Knowledge of the specific requirements of
measurements for the selection of biological
growth and development of each cultivar
material, where were made also the biological
determines the development of specific
purification as special works in production of
production technologies.
the biological material for the multiplication of
This paper represents a sequence of study plant
a cultivar.
requirements of Rosie de Iernut red onion for
In the laboratory, after harvesting the bulbs
the phases of growth and development in the
have made observations and biometrical
environmental conditions of SCDL Iernut.
measurements for choice, selection of
biological material typical for the variety. The
biometric calculations were established
The investigations were carried out on three selection parameters using confidence intervals
biological cycles “from seed to seed”. of the varietal characteristics of the variety,
The experiences were organized into four thus eliminating ± the variants.
rehearsals and three epochs (ages).
The biological material used for the obtaining RESULTS AND DISCUSSIONS
of the parent plants bulbs was made from the
The important stages of the experiences of
seed of the author, the Rosie de Iernut variety.
producing bulbs were: sowing, emergence,
Have been studied the vegetation phases and
commencement of the bulb (figure 1), the
phenophases, having as main objective the
deeply bulb formation and bulb harvesting.
169
The studied phenophases (table 1), as duration Table 2. The length of phenophases and the amount of
(table 2, figure 2) and the sum of the degrees of accumulated temperature degrees/phenophase, on sowing
ages
temperature on phenophases (table 2, figure 3),
accounted the periods between phases and the Ist age IInd age IIIrd age
length of the growing season was represented Phenophase Period o Period o Period o
C C C
by the period between plant emergence and (Days) (Days) (Days)
plant harvesting. Sowing-emergence 25 141 15 112 10 171
Emergence-bulb
47 527 37 543 32 585
formation
Bulb formation-
62 880 58 982 60 1262
maturity consumer
Maturity consumer-
16 344 15 296 14 283
harvesting
Sowing-harvesting 150 1892 125 1933 116 2301
Figure 1. Rosie de Aries variety
Table 1. The vegetation phenophases of the mother

plants of Rosie de Aries onion variety, on sowing ages–
the average on 3 years
Figure 2. The length of phenophases/ages of sowing to
Period the Rosie de Aries onion variety, the average on 3 years-
Phenophase
Ist age IInd age IIIrd age SCDL Iernut
26.03- 15.04- 01.05-
Sowing-emergence
20.04 29.04 10.05
Emergence-bulb 20.04- 29.04- 10.05-
formation 10.06 05.06 11.06
Bulb formation-maturity 10.06- 05.06- 11.06-
consumer 10.08 02.08 10.08
Maturity consumer- 10.08- 02.08- 10.08-
harvesting 23.08 17.08 24.08
26.03- 15.04- 01.05-
Vegetation period
23.08 17.08 24.08 Figure 3. The amount of temperature degrees on
phenophases and ages of sowing, the average on 3 years-
The plant emergence had after: 25 days SCDL Iernut
(141°C) during the Ist age, 15 days (112°C)
during the IInd age and after 10 days (171°C) The harvesting of the bulbs was carried out
during the IIIrd age. after an average of 16 days (344°C) during the
The commencement of the bulb formation had Ist age, 15 days (296°C) during the IInd age and
been manifested from the emergence as after 14 days (283°C) in the third age, from the
follows: 47 days (527°C) during the Ist age, 37 bulbs maturation.
days (543oC) during IInd age and after 32 days During the growing season, the three-year
(585°C) in the IIIrd age. average, it took 125 days (1751oC) in the Ist
The maturity consumer, the average on three age, 110 days (1821oC) during the IInd age and
years, was recorded in approximately 62 days after 106 days (2130oC) in the IIIrd age.
(880°C) in the Ist age, 58 days (982°C) during The average of accumulated temperature’
IInd age and after 60 days (1262oC) in the IIIrd degrees (°C) /day regarding the phenophases
age, from the commencement of the bulb. growth and the mother plants development of
Rosie de Aries variety on seeding ages was
manifested by increasing from the first age
170
until the second one and the greatest values (ages), each of these characteristics were the
were recorded during the IIIrd age (table 3, same variability in all eras: the weight of the
figure 3). bulb has great variability in all eras, shape
index recorded medium variability in all ages
Table 3. The average of accumulated temperature and the height of the plant has small variability
degrees (°C) /day to the phenophases growth and the in all ages (table 4).
mother plant development of Rosie de Aries, the average
on 3 years – SCDL Iernut
Table 4. Variability indexes of the onion parent plant, the
Ist IInd IIIrd average (2007-2009), SCDL Iernut
Phenophase Mean
age age age
Variability indexes Varia
Sowing-Emergence 5,64 7,46 17,1 10,06 Characteristic
xmed s2 s s% k bility
Emergence-Bulb formation 11,21 14,67 18,28 14,72
Ist age
Bulb formation-Mature
14,19 16,93 21,03 17,38 The weight of the 54-
consumer 64,2 104,04 10,2 25 High
bulb (g) 74,4
Mature consumer-
21,5 19,73 20,21 20,48 0,76-
Harvesting Form indexes 0,88 0,014 0,12 18,5 Medium
1,00
Vegetation period 11,68 15,46 19,83 15,66
Height of parent 54-
56,8 7,84 2,8 8,4 Small
plant (cm) 59,6
IInd age
The weight of the 33,8-
52,46345,96 18,6 30,08 High
bulb (g) 71
0,6-
Form indexes 0,78 0,02 0,14 10,0 Medium
0,9
Height of parent 52,7-
56,12 11,62 3,41 12,65 Small
plant (cm) 59,5
IIIrd age
The weight of the 30,6-
46 237,16 15,4 30,6 High
bulb (g) 61,4
0,50-
Form indexes 0,62 0,01 0,12 17,4 Medium
Figure 4. The°C average daily accumulated/phenophases 0,74
and ages to Rosie de Aries variety, the average on 3 Height of parent 44,6-
48,2 12,96 3,6 9,2 Small
years – SCDL Iernut plant (cm) 51,8
The quantitative characteristics of onion bulbs CONCLUSIONS

were influenced by the temperature conditions During the phenophases - “sowing-emergence”
during the growing season. There have been
and “emergence-bulb formation”-decreased the
value differences between ages, in particular
number of days since the Ist epoch to the IIIrd
concerning the weight of bulb, bulb size
age.
(longitudinal diameter – ØL, transversal
diameter – ØTr), and form index-IF. The phenophases - 'the beginning of the bulb
In the Ist age (table 4), the bulbs of the parent formation-the maturity consumption' and 'the
plant have been characterized through: the maturity consumption-harvesting' have almost
average weight of the bulb of 64.2 g, the index the same period of days for all three ages.
form (IF) - 0.88 and the plant height-56.8 cm. The longest vegetative period was recorded in
In the IInd age (table 4), the bulbs of the parent the Ist age and the shortest in the IIIrd age.
plant have been characterized through: the The average weight of the bulb decreases from
average weight of 52,46 g, index form (IF) – the Ist age to the IIIrd age, but records high
0.78 and the height of the plant – 56,12 cm. variability in all ages.
In the IIIrd age (table 4), the bulbs of the parent
The shape index tends to be almost unitary to
plant have been characterized through: the
the Ist age dropping to the IIIrd age, recording
average weight of the bulb-46 g, the index form
middle variability to all ages.
(IF) - 0.62, the height of the plant – 48.2 cm.
Although the features: average weight of the The leaves’ rosette of the plants recorded the
bulb, the bulb-shaped index and the height of largest height to the Ist age and dropping down
the plant have different values in different eras until the IIIrd age.
171
REFERENCES producԑiei cantitative Ɣi calitative la cultura de ceapĉ
semincerĉ RoƔie de ArieƔ, USAMV-Cluj Napoca, bc.
Capusan Janina, 2013. Rezultate parԑiale privind doctoralĉ, Facultatea de Horticulturĉ (referat).
influenԑa unor factori agrotehnologici asupra
172
BIODIVERSITY OF AUCHENORRHYNCHA INSECTS IN A PEAR
ORCHARD FROM SOUTH-EAST OF ROMANIA
Iuliu CEAN1, Mirela CEAN2

1
59 Mărăúti Blvd., 011464, Bucharest, Romania
2
Central Phytosanitary Laboratory, 11 Blvd. Voluntari, Ilfov, 077190, Bucharest, Romania
Abstract
The aim of the study was detection and identification of existing planthopper, leafhopper and cixiid fauna in the pear
orchard of University of Agronomic Sciences and Veterinary Medicine of Bucharest. Studied biological material consist
of adult stage has been obtained from yellow and white sticky traps which were placed in host plant canopy. The
identification of the collected material has been carried in the Entomology Laboratory of Central Phytosanitary
Laboratory. Based on morphological characters were identified following species: Metcalfa pruinosa (Say, 1830)
(Flatidae), Reptalus panzeri (Low, 1883) (Cixiidae), Fieberiella florii (Stal1864), Psammotettix notatus (Melichar
1896), Zyginidia pullula (Boheman 1845), Neoaliturus fenestratus Herrich-Schäfer 1834 (Cicadellidae). Photos with
male genitalia details are provided.
Key words: Flatidae, Cixiidae, Cicadellidae, morphological identification.
INTRODUCTION genitalia. Identification of the males to species

requires removing the abdomen then placing in
Planthopper, leafhopper and other related
a 10% KOH solution for 12-24 h at room
species are pests of cultivated plants and can be
temperature. To examine genitalia remove the
also vectors of different plant diseases.
abdomen from KOH place it in a Petri dish
The aim of the study was focused on the
filled with water for few minutes, then place it
biodiversity of Auchenorrhyncha
in a drop of glycerin to study. For microscopic
species (planthopper and leafhopper)
observation a drop of glycerin was put on a
assemblages of pear orchard in 2012 to identify
slide on which dissection of the aedeagus was
possible vectors of specific disease on host.
performed.
Identification were made to the genus and
species level according to (Ribauld 1952),
Survey was carried in a modern eight year old (Delia Giustina 1989), (Holzinger, 2003), (Le
pear orchard planted with the cultivars Abbé Quesne 1960).
Fétel, Red Williams, Conference, Beurre Bosc,
Alexander Lucas, Clapp’s Favorite. Planting RESULTS AND DISCUSSIONS
distance was 2 m within the row and 4 m As a result of our investigation altogether 265
between the rows. One sampling method was individuals have been found in pear orchard
applied using sticky traps placed in tree’s belonging to 3 Auchenorryncha families,
canopy using one trap/15-20 tree. The sticky namely Flatidae, Cixiidae and Cicadellidae
traps (yellow and white), sticky on one side (figure 1).
were 25X20 cm size. Traps were hanged into During the sampling period extending from
the middle part of the canopy during the May to October presence of 6 species was
vegetation period. Regular checks and established. Metcalfa pruinosa (Say, 1830)
replacements of the traps were done for from Flatidae family, Reptalus panzeri (Low,
faunistical survey. 1883) from Cixiidae family, Fieberiella florii
Accurate species identification requires (Stal 1864) , Psammotettix notatus (Melichar
examination of the structures of the male 1896), Zyginidia pullula (Boheman 1845),
173
Neoaliturus fenestratus Herrich-Schäfer 1834 spots. It is an invasive species quite new for
from Cicadellidae family. Europe, (introduced in Italy in 1970) and also
for our fauna. Has been recorded in Romania in
Constanta region in 2009 for first time (Preda
et al., 2009), then in western part of the country
in 2010 (Gogan et al., 2010) and also in
Bucharest area in 2011 (Chireceanu et al.,
2011).
Genitalia: Male pygofer and subgenital plates
not differentiated from ringlike segment IX;
anal tube short, with elongate tongue like
process (grooved on midline) above lower
angle; styles held vertically, in ventral aspect
slender, slightly divergent near tips, in lateral
aspect broadening towards tips, bearing
Figure 1. The structure of Auchenorrhyncha family in recurved hook beyond tip of aedeagus, setose,
2012 articulated against undifferentiated sternite IX;
connective linear; aedeagus curved dorsal,
The most common species collected in this parallel-margined to truncate tip bearing two
area, was Neoaliturus fenestratus 41 pairs of processes directed forward (CABI,
individuals, representing 15% of total record 2013) (Annex I, figures 1A, 1B).
species, followed by Fieberiella florii and Reptalus panzeri, polyphagous, has
Zyginidia pullula species which were also one generation per year and larva overwinter.
present in large number in samples, 11% in first Adults polyphagouus and lives in the shrubs
case and 12% in second (table 1) of total record and herb layer. Imagoes are active from mid
species. The other recorded species were June till beginning of August. This insect can
present with less frequency. Also, some species be vector diseases. It is believed that nymphs,
have remained unidentified. like those of other Cixiids, are root feeders
Adult has vertex much broader than long. Eyes
Table 1. Identified Cicadellidae species and their density
usually grayish, sometimes marginated reddish.
No
Cicadellidae species No of Abundance Overall length: 4.6-5.2 (male) and 5.7-6.8 mm
identified indiv. (%) (female) (Le Quesne, 1960). First segment of
1. Fieberiella 30 11 hind tarsus apically without platellae
2. Neoaliturus 41 15
3. Zyginidia 32 12
(Holzinger et al., 2003).
4. Psammotettix 8 3 Genitalia: Styles symmetrical (Holzinger et al.,
Total 111 2003), male anal tube produced laterally into
sharp angles posteriorly; projection of
We present below some information on parameres long; sclerotized projections at lower
identified Auchenorrhyncha in the monitored margin of genital segment pointed apically (Le
area about their biology and few morphological Quesne, 1960) (Annex I, figures 2A, 2B).
characters useful for their identification. Neoaliturus fenestratus Body small, slender,
Metcalfa pruinosa is an insect with one general coloration of the body deep brow
generation per year and is very polyphagous. almost black with red tinge; total length of the
Adults are present between July and October. male and female 3.9 to 4.5 mm; Forewings
This species overwinters in eggs stage, the eggs deep brown, apical third with irregularly
are inserted into the bark of host plants. They shaped and sized whitish patches.
are 5.5 to 8 mm in length have broadly Genitalia: aedeagus oval narrowing at both
triangular front wings that are held close to the ends, with tips biforked, the connective at the
body in a vertical position. The color of adults base of aedegus biforked posteriorly; genital
is brown to gray, due to the presence or plate triangular; its outer lateral margin with a
absence of a bluish white waxy powder. row of identical spines (Al-Asady et al., 2003)
Forewings in the basal half have a pair of dark (Annex I, figures 3A., 3B.).
174
Fieberiella florii is a polyphagous species Because some of the identified genera like
living on woody plants. Has one generation a Fieberiella, Psammotettix and Neoaliturus have
year and on woody plants and overwinter in been reported to transmit phytoplasmas to fruit
stage of egg. Imagoes emerge from the trees (Fos et al., 1986), (Jensen, 1957),
beginning of June till end of October. (Narayanasamy, 2011) it is important to
Length 6.5-7mm male and 7-7.5 mm female. monitor their presence in orchard in order to
Round vertex, wings and body covered with establish their role in propagation of the
dark punctuation. disease.
Genitalia: Pygofer in lateral aspect about 1% All planthopper, leafhopper and cixiid species
times as long as wide; aedeagus in lateral identified in the orchard were recorded
aspect broad medially, shaft curved laterally, previous
tube like and narrow, shaft with numerous
in the country (Boguleanu, 1994), (Chireceanu
minute spines; style short in dorsal aspect
et al., 2011), (Gogan et al., 2010), (Preda et al.,
simple, with distal half curved laterally;
2009) but we must underline the presence of
connective large (Ribaut, 1952) (Annex II,
the exotic pest Metcalfa pruinosa in the
figures 4A., 4B.)
monitored area. It is not very clear if this
Ziginidia pullula small species overall length
species can be a vector disease but its presence
2.2-2.6 mm male and 2,6-3.0 mm female. The on host plants and ability to establish in new
general color is dark grey-yellowish. It is a areas must be take in account. Following
multivoltine species, able to produce up to four species haven’t been recorded in Bucharest area
generations a year in some area of the Europe. by Boguleanu (1994) : Reptalus panzeri,
Genitalia: the anal tube has a pair of appendix Fieberiella florii, Psammotettix notatus and
developed and sinuous; sides of male genital Zyginidia pullula, so we can record here these
segment with Y-shaped lobe internally; species as result as our work.
aedeagus with two appendages long and thin
which are very difficult to observe in lateral ACKNOWLEDGEMENTS
position (Delia Giustina, 1989) (Annex II.
figures 6A., 6B.) This work was carried out with the support of
Psammotettix notatus: Central Phytosanitary Laboratory and financed
Small, linear species. Length overall over 3 mm by POSDRU/CPP 107/DMI 1.5/S/76888
for male and female. Head much larger than Project. I would like to thank Mrs. Ping-ping
pronotum. The general color of pronotum and Chen, specialist at Plant Protection Service,
fore wings very pigmented. Fore wings Netherlands, for confirmation of the pests and
developed, rounded symmetrical covers the also for identification of Psammotettix notatus
body entirely. (Melichar 1896) species.
Genitalia: Genital sternit in trapezoidal form;
basal part of the aedegus simple, without REFERENCES
annexes; aedeagus in lateral aspect round or Al-Asady H. S., Al-Gailany H. B. D., 2003. External
less sharp; shaft tubelike and those two arms of morhological study of the leafhopper Neoalituris
shaft like U or V; style in dorsal aspect shorter fenestratus Herrich-Schaeffer 1964 (Homoptera:
than connective and apex curved laterally; Cicadellidae) from Iraq. Bull. Iraq nat. Hist. Mus. 10
(1), p. 1-5.
connective very long, free; gonopore on Boguleanu Gh. Gh., 1994. Fauna daunatoare culturilor
ventral surface, near apex, bifid apically in agricole si forestiere din Romania.Vol II. Ed. Tehnica
ventral aspect (Ribaut, 1952) (Annex II. figures Agricola.
5A., 5B.) CABI. 2013. Invasive species compendium. Wallingford,
UK: CAB International. www.cabi.org/isc.
Chireceanu C., Gutue C., 2011. Metcalfa pruinosa (Say)
CONCLUSIONS (Hemiptera: Flatidae) identified in a new south
The Fulgoromorpha and Cicadomorpha eastern area of Romania (Bucharest area).
Delia Giustina W., 1989. Homoptères Cicadellidae III.
constitute an important part of the trophic Compléments aux ouvrages d' Henri Ribaut. Faune
network of land ecosystem. deFrance 73. Paris: INRA.
Gogan A., Grozea I., Virteiu A. M., 2010. Metcalfa
pruinosa Say (Insecta:Homoptera: Flatidae)-first
175
occurrence in western part of Romania. Research
Journal of Agricultural Science. 42 (4), p. 63-67.
Fos A., Bové J. M., Lallemand J., Saillard C., Vignault J.
C., Ali Y., Brun P., Vogel R., 1986. La cicadelle
Neoaliturus haematoceps (Mulsant et Rey) et vecteur
de Spiroplasma citri en Mediterranée. Annales de
l’Institut Pasteur Microbiologie. 137A, p. 97–107.
Jensen D.D., 1957. Transmission of peach leaf roll virus
by Fieberiella florii (Stal) and a new vector,
Osbornellus borealis Delong & Mohr. Journal of
Economic Entomology. 50, p. 668–672.
Holzinger W. E., Kammerlander I., Nickel H., 2003. The
Auchenorrhyncha of Central Europe. Die Zikaden
Mittleleuropas. Vol.1. Fulgoromorpha.
Cicadomorpha excl. Cicadellidae. Brill.
Narayanasamy P., 2011. Microbial Plant pathogens-
detection and disease diagnosis. Bacterial and
Phytoplasmal Pathogens. Vol.2. Springer.
Le Quesne W. J., 1960. Handbooks for the Identification
of British Insects. Hemiptera Fulgoromorpha. Royal
Society of London. Vol. II Part 3.
Preda C., Skolka M., 2009. First record of a new alien
invasive species in Constanta-Metcalfa pruinosa
(Homoptera: Fulgoroidea). In: Paltineanu C. (Ed.)
Lucrarile Simpozionului Mediul si Agricultura in
regiunile aride: prima editie. Estfalia, p.141-146.
Ribaut H., 1952. Homoptères Auchenorrhynques II Figure 2. Annex I: figure 1A. Metcalfa pruinosa
(Jassidae). Faune de France. P. Lechevalier et fls. (genitalia), 1B. (aedeagus); figure 2A. Reptalus panzeri
(genitalia complex), 2B. (aedeagus); figure 3A.
Neoaliturus fenestratus (aedeagus with connective), 3B.
(aedeagus in dorsal view).
Figure 3. Annex II: figure 4A Fieberiella florii

(genitalia), 4 B (connective); figure 5A Psammotettix
notatus (aedeagus), 5 B (connective); Figure 6A
Zyginidia pullula (genitalia complex in lateral view), 6B
(aedeagus in lateral position).
176
SSR ANALYSIS CONCERNING THE RESISTANCE TO PPV
(Plum pox virus) IN SEVERAL ROMANIAN APRICOT PROGENIES
Frăgu‫܊‬a CIOMAGA1, Ligia ION1, Cristina MOALE2

1
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59, Marasti Blvd,
011464, Bucharest, Romania
2
Research Station for Fruit Growing Constanta, Constanta, Romania
Abstract
Plum pox virus (PPV) is a devastating stone fruit disease of major importance, and better understanding of the genetic
control of resistance to this trait would be useful for more efficient development of resistant cultivars. Previous studies
have reported a locus major effect from PPV resistance on linkage group 1. The hybrids were grafted simultaneously
and subsequently inoculated with the PPV-M and D strains. The symptom scoring on leaves was performed three times
over two vegetative cycles. The PPV resistant loci were mapped using composite interval mapping (CIM).This paper
presents data from PhD thesis part of the project POSDRU/107/1.5/S/76888, funded by European Social Fund through
the Sectorial Operational Programme Human Resources Development 2007-2013.
Key words: disease, markers, Prunus armeniaca, PPV, SSR, Sharka.
INTRODUCTION Several studies suggest that the resistance is

conferred by a limited number (1–3) of genes
Plum pox virus (PPV) infection causes the
(Dicenta et all., 2000; Dosba et all., 1992;
Sharka disease of Prunus, has spread from the
Krska B et all., 2002; Karayiannis et all., 2007).
Balkan countries throughout most of the
Development of molecular marker maps for
European subcontinent and around the
segregating crosses is a significant
Mediterranean basin.
accomplishment toward understanding the
Considerable economic loss and significant
genetics of PPV resistance and developing
reduction in productive areas stimulated
markers that could potentially be useful in
breeding programs aimed at enhancing
breeding programs. Four molecular genetic
resistance to the pathogen in such countries as
maps based on intraspecific crosses introducing
Greece (Karayiannis et all., 2002), France
PPV resistance from North American cultivars
(Audergon et all., 1994), Italy (Bassi et all.,
‘Stark Early Orange’ and ‘Goldrich’ have been
1995), Spain (Egea et all., 1999) and the Czech
established to map a PPV resistance in
Republic (Polak, 1994).
As a result of the intensive search for a source apricot (Lambert et all., 2007; Sicard et all.,
of resistance within available apricot 2007). On these maps, a major genomic region
germplasm, some North American cultivars associated with PPV resistance was located on
‘Stark Early Orange’ (SEO), ‘Goldrich’, the Prunus G1 at a distance of 20–40 cm. In
‘Harlayne’, ‘NJA 45’, and others were found to total, five SSR markers linked to the targeted
resistance locus were identified in this region.
have natural resistance to PPV (Martinez-
Three of them have been already successfully
Gomez eta ll., 2000). These cultivars were used
tested for marker assisted selection (MAS) in a
as donors for a resistance trait in conventional
set of susceptible/resistant cultivars.
breeding programs based on crosses between
resistant and the best local cultivars susceptible
to virus.
Recently, resistant selections have been Plant material
released for regional trials (Badenes and Llacer, We are worked with 5 apricot population:
2006; Dosba et all., 1992; Karayiannis et all,
1999; Polak et all., 1997)
177
Pop 3 = Population 3 obtained by crosses all., 2002). SSR primer combinations revealing
between (‘Mari de Cenad, x,NJA 21’) x ‘Kesth polymorphism were screened all apricot
Pshor’ populations. The mix PCR consit in 10X
Pop 2 = Population 2 obtained by crosses buffer-2ul, MgCl2 (25 mM)-1.2 ul, dNTP 10
‘Sirena’ x ‘NJA 42’ mM – 0.16 ul, PGS 1.21-F – 0.6ul, PGS 1.21-R
Pop 4 = Population 4 obtained by crosses – 0.6 ul, PGS 1.24-F – 0.4 ul, PGS1.24-R – 0.4
‘Cristal’ x ‚NJA 21’ ul, ppb22-195-F-0.28 ul,ppb22-195-R – 0.28ul
Pop 1 = Population 1 obtained by crosses ‘Mari and Taq 0.1 ul. A 2-μl aliquot of the PCR
de Cenad’ x ‚SEO’ reaction was separated by electrophoresis on an
Pop 5 = population 5 obtained by crosses agarose gel 2% in order to confirm the
between (‘Viceroy’, x,NJA 2’) x ‘NJA17’ amplification of fragments of the expected size
The apricot selection R9 P 53 (‘NJA 2’ and DNA concentration. (Figure 1.).
×‘Viceroy’) was crossed as a female parent to The PCR-products were diluted (45 ul H2O and
‘NJA 17’ a PPV resistant apricot cultivar.The 5 ul DNA) and used to prepare the plate for
selection R13 VT 8/57 resistant to PPV (issued sequencing.
from ‘Mari de Cenad x NJA 21) was crossed as
a female parent to ‘Kesth Pshor’ (susceptible to
PPV) in the frame of the Faculty of All four SSR primer combinations amplified
Horticulture of University of Agronomic expected size fragments in germoplasm under
Sciences and Veterinary Medicine of Bucharest study. SSR scores for genotypes are included in
Romania in 2008. Crosses were performed by supporting documentation, Table 1. For all SSR
hand pollination with isolation of flowers after loci, we recorded genotypes in order of their
the petals and anthers removal from the flower electrophoretic mobility from fastest to slowest
buds. The F1 seeds were stratified at 5oC for 3 band.
months and subsequent seedlings were grown The infection process was different for various
in an insect-proof greenhouse. plant individuals; in some plants the presence
The young apricot populations sticks were of PPV was detected after the first dormancy
grafted onto inoculated GF305 (used like period, in some in the three vegetative cycles,
susceptible rootstock) ready for testing to PPV while some plants were not infected at all.
resistance. Selections ‘Kesth Pshor’ × ’R13 VT 8/57’ and
DNA extraction ’R9 P 53’ were screened with 3 SSR primer
Genomic DNA was extracted using the combinations. The products of PCR were
modified CTAB procedure [23]. DNA separated by electrophoresis on an agarose gel
concentrations were measured and working 2% in order to confirm the amplification of
solutions of genomic DNA at 10 ng/μl and at fragments of the expected size and DNA
100 ng/μl in 0.1× TE (0.01M Tris pH 8.0, 0,001 concentration. (Figure 1)
M EDTA) buffer was prepared for the targeted
SSR and AFLP analyses, respectively.
SSR analysis
‘Stark Early Orange’, ‘R13 VT 8/57’ NJA and
R9 P 53 were screened with 3 SSR primer
combinations from [2], associated with
PPVresistance.PGS 1.21, PGS 1-24 and ppb22-
195-F:CTCTTCTCGCCTCCCAATTT and
R:GCTTAGCCCTGGGTACAAG and
F:ATCTGCTCTTTCCCTCACCT with Figure 1. Electrophoresis for PCR with SSR markers in
R:GATTATCCCTCAACCCATCC. apricot progenies
PCR reactions, electrophoresis, and detection
of PCR products for the ‘Kesth Pshor’ × R13 These SSRs were polymorphic. This presence
VT 8/57’ population were carried out according of polymorphism is slightly higher than that
to conditions specified in (Zhebentyayeva et previously reported by Hurtado et al. (2002)
178
and Vilanova et al. (2003a; 46% and 42%, Pop2-106 107.01 111.91 102.81 106.46
respectively) in apricot. Additionally, the SSRs, Pop2-14 107.03 11.87 98.74 100.78
(PGS1_24)-F:CTCTTCTCGCCTCCCAATTT Pop2-17 11.92 102.85
Pop2-43 11.93 100.89 102.89
with R:GCTTAGCCCTGGGTACAAG and
Pop2-47 107.06 111.99 100.87 106.51
F:ATCTGCTCTTTCCCTCACCT with Pop2-66 111.91 101.81 102.78
R:GATTATCCCTCAACCCATCC were Pop2-63 111.97 100.85 102.83
significant for the first screening in a lager Pop2-69 107 106.37
population and may be useful for starting a Pop2-70 111.92 100.81 102.74
MAS in breeding for PPV resistance. Further Pop2-82 111.84 100.75
evaluation of these loci will be necessary to Pop4-104 111.92 102.9 129.28
characterize the genetic control of the PPV Pop4-19 107.03 111.95 98.88 129.3
resistance trait. Due to the co-dominant nature Pop4-45 107.07 111.92 98.83 129.22
Pop4-46 107.12 111.98 98.94 129.32
of SSRs along with their high genetic
Pop4-48 107.91 98.75
transportability, the development of SSRs Pop4-54 106.97 111.91 98.74 129.11
associated with PPV resistance in apricot could pop4-59 106.94 111.87 98.74 129.13
facilitate the use of MAS in breeding strategies pop5.51 112.3 100.97
aimed at breeding for natural resistance. Pop5-52 112.4 100.95
pop5-53 107.1 112.01 98.86 100.94
Table 1. Results concerning the implement of markers Pop 1 = Population 1 obtained by crosses ‘Mari de Cenad
PGS 1,24 and Ppb0022-195 in Romanian progenies. x SEO’
Pop 2 = Population 2 obtained by crosses ‘Sirena x NJA
Ppb
0022- PGS124 PGS124 42’
Ppb0022-195 Map Pop 3 = Population 3 obtained by crosses between (‘Mari
195 Map Map
Génotype distance de Cenad, x,NJA 17’) x ‘Kesth Pshor’
Map dist. dist.
cM Pop 4 = Population 4 obtained by crosses ‘Cristal x NJA
dist.. cM cM
cM 21’
KesthPhor 112.01 129.53 Pop 5 = population 5 obtained by crosses between
Viceroy 111.96 100.93 (‘Viceroy’, x,NJA 2’) x ‘NJA17’
H2+ 107 116.4 98.93 102.9
MariCenad 111.98 100.92 For the marker ‘Ppb0022-195’ the region with
NJA 17 107.01 112.01 98.9 100.91 resistance is situate between 107 / 112 (Tab. 1)
Cristal 111.84 100.78 102.73 The success of markers detection of PPV was
Sirena 111.81 100.78 127.76 confirmed to depend on the quality and
Tabriz 112.01 100.88
quantity of isolated DNA during the
SEO 107.11 111.97 98.9 100.91
Pop3-37 111.9 100.79 experiments and (Guilford et all., 1997) applied
Pop3-38 111.83 129.42 a similar method of isolation in CTAB buffer.
Pop3-42 111.9 102.73 129.43
Pop3-49 111.93 129.42 CONCLUSIONS
Pop3-64 107.05 111.98 98.89 100.92
Pop3-65 112 129.62
Targeted SSR analysis is a very direct way to
Pop3-68 107.13 98.88 102.93 link the molecular markers to a trait of interest.
Pop3-71 SSR markers developed for specific genome
Pop3-73 107.08 98.94 regions have been used to identify genes of
Pop3-74 107.12 112.03 98.96 127.93 agronomic importance for evidence of selection
Pop3-76 107.1 112.04 98.94 129.24 during domestication in maize (Vigouroux et
Pop3-77 106.97 98.76 all., 2002) and to verify wheat–barley
Pop3-78 111.91 100.81 introgression (Hernandez et all, 2002). They
Pop3-79 106.94 111.91 98.81 102.76
are the most likely candidates for MAS in crops
Pop3-80 106.97 111.92 98.78 100.83
Pop3-81 111.9 100.77 of economical importance and appear to be
Pop1-20 107.08 112 98.94 100.96 suitable for apricot as well (Ribaut and
Pop1-21 111.88 102.75 129.09 Hoisington, 1998; Badenes and Llacer, 2006).
Pop1-22 111.89 129.18 The identifying of a natural source of resistance
Pop1-55 106.96 111.86 98.8 127.76 to PPV, using this resistant source into new
Pop1-72 106.98 11.87 9875 137.97
crosses with Romanian commercial cultivars
179
well adapted in our country, and the implement Hernández P., Dorado G., Cabrera A., Laurie D.A.,
of marker-assisted selection (MAS), based on Snape J.W., Martín A., 2002. Rapid verification of
wheat-Hordeum introgression by direct staining of
markers tightly associated with resistance, as a
SCARS, STS, and SSR amplicons. Genome 45, p.
measure to substantially streamline the 198–203.
breeding process, may be a promising strategy Hurtado M.A., Romero C., Vilanova S., Abbott A.G.,
to obtain apricot varieties with natural genetic Llacer G., Badenes M.L., 2002. Genetic linkage map
resistance to PPV. of two apricot cultivars (Prunus armeniaca L.) and
mapping of PPV (sharka) resistance. Theor Appl
First couple of markers PGS 1.21 (Reverse and Genet 105, p. 182–192.
Forward) could be enough for the screening of Karayiannis I., Mainou A., Tsaftaris A., 1999. Apricot
a larger population of apricot and then start to breeding in Greece for fruit quality and resistance to
develop the others SSRs associated with PPV plum pox virus. Acta Horticulturae 488, p. 111–117.
resistance to facilitate the use of MAS in Karayiannis I., Thomidis T., Tsaftaris A., 2007.
Inheritance of resistance to Plum pox virus in apricot
Romanian apricot breeding program (Prunus armeniaca L.). Tree Genetics & Genomes
DOI 10.1007/s11295-007-0095-z.
ACKNOWLEDGEMENTS Krška B., Salava J., Polák J., Komínek P., 2002.
Inheritance of resistance to plum pox virus in apricot.
This paper presents data from PhD thesis part Plant Protection Sci 38, p. 180–182.
of the project POSDRU/107/1.5/S/76888, Krška B., Vachun Z., Necas T., 2005. The apricot
funded by European Social Fund through the breeding program at the Horticulture faculty in
Sectorial Operational Programme Human Lednice. Acta Horticulturae 717, p. 145– 148.
Resources Development 2007-2013. Lambert P., Dicenta F., Rubio M., Audergon J.M., 2007.
QTL analysis of resistance to sharka disease in the
apricot (Prunus armeniaca L.) ‘Polonais’ x ‘Stark
REFERENCES Early Orange’ F1 progeny. Tree Genetics & Genomes
Audergon J-M., Dosba F., Karayiannis I., Dicenta F., 3, p. 299–309.
1994. Amélioration de l’abricotier pour la résistance Martinez-Gomez P., Dicente F., Audergon J-M., 2000.
á la sharka. EPPO Bul 24, p. 741–748. Behavior of apricot (Prunus armeniaca L.) cultivars
Aranzana M., Pineda A., Cosson P., Dirlewanger E., in the presence of sharka (plum pox potyvirus) : A
Ascasibar J., Cipriani G., Ryder C., Testolin R., review. Agronomie-Paris 20, p. 407–422.
Abbott A., King G., Iezzoni A., Arús P., 2003. A set Polák J., 1994. Breeding to resistance to plum pox
of simple-sequence repeat (SSR) markers covering potyvirus in the Czech Republic. EPPO Bul 24, p.
the Prunus genome. Theor Appl Genet 106, p. 819– 781–782.
825. Polák J., Oukropec I., Komínek P., Krška B., Bittóova
Badenes M.L., Llácer G., 2006. Breeding for resistance: M., 1997. Detection and evaluation of resistance of
breeding for Plum pox virus resistant apricots apricots and peaches to plum pox virus. J Plant Dis
(Prunus armeniaca L.) in Spain. Bulletin Protection 104, p. 466–473.
OEPP/EPPO Bulletin 36, p. 323–326. Ribaut J.M., Hoisington D., 1998. Marker-assisted
Bassi D., Bellini E., Guerriero R., Monastra F., Pennone selection: new tools and strategies. Trends Plant Sci
F., 1995. Apricot breeding in Italy. Acta 3, p. 236–239
Horticulturae 384, p. 47–54. Sicard O., Marandel G., Soriano J.M., Lalli D.A.,
Dicenta F., Martinez-Gómez P., Burgos L., Egea J., Lambert P., Salava J., Badenes M., Abbott A.,
2000. Inheritance of resistance to plum potyvirus Decroocq V., 2007. Flanking the major Plum pox
(PPV) in apricot, Prunus armeniaca. Plant Breeding virus resistance locus in apricot with co-dominant
119, p. 161–164. markers (SSRs) derived from candidate resistance
Dosba F., Orliac S., Dutrannoy F., Maison P., Massonie genes. Tree Genetics & Genomes DOI
G., Audergon J-M., 1992. Evaluation of resistance to 10.1007/s11295-007-0114-0.
plum pox virus in apricot trees. Acta Horticulturae Vigouroux Y., McMullen M., Hittinger C.T., Houchins
309, p. 211–220 K., Schulz L., Kresovich S., Matsuoka Y., Doebley
J., 2002. Identifying genes of agronomic importance
Egea J., Burgos L., Martínez-Gómez P., Dicenta F.,
in maize by screening microsatellites for 416 Tree
1999. Apricot breeding for sharka resistance at the
Genetics & Genomes (2008) 4, p. 403–417 evidence
CEBAS-CSIC, Murcia (Spain). Acta Horticulturae
of selection during domestication. Proc Natl Acad Sci
488, p. 153–157.
USA 99:9650–965.
Guilford P., Prakash S., Zhu J.M., Rikkerink E., Gardiner
Yang Z-N., Ye X-R., Molina J., Roose M.L., Mirkov
S., Bassett H., Forster R., 1997. Microsatellites in
T.E., 2003. Sequence analysis of a 282-kilobase
Malus×domestica (apple): abundance, polymorphism
region surrounding the Citrus Tristeza Virus
and cultivar identification. Theor. Appl. Genet., 94,
resistance gene (Ctv) locus in Poncircus trifoliate L.
p. 249–254.
Raf. Plant Physiol 131, p. 482–492.
180
Zhebentyayeva T.N., Reighard G.L., Krška B., Gorina Construction and application of a bacterial artificial
V.M., Abbott A.G., 2002. Origin of resistance to chromosome (BAC) library of Prunus armeniaca L.
plum pox virus in apricot: microsatellite (SSR) data for the identification of clones linked to the self
analysis. Plant Protection Sci 38, p. 117– 121. incompatibility locus. Mol Genet Genomics
Vilanova S., Romero C., Abernathy D., Abbott A.G., 269:685–691.
Burgos L., Llácer G., Badenes M.L., 2003b.
181
NECESSITY OF CULTIVATION AND CLASSIFICATION

OF THE TABLE GRAPES VARIETIES FOR COMMERCIALIZATION
Adriana COSTESCU

59 Marasti, District 1, 011464, Bucharest, Romania
Abstract
Research in this paper were conducted during 2010-2012 to INCDBH Stefanesti Arges refer to native table grapes
varieties. Table grapes should be a pleasant and attractive. This condition is crucial because consumers consider
primarily 'eye' size, shape and color of the grapes. In grape production, in addition to climatic conditions and variety
cultivated a decisive influence has applied agrotechnics plantation. Obtaining high yields of high quality and at a low
cost price agrotechnical requires the application of a differentiated varieties. In 2009, vineyards supplying grapes for
table had 9.384 ha, representing 5.08% of the total area for growing plantations and nurseries. Table grape exports
was insignificant in recent years, however imports soared.
Key words: table grapes, export, productivity, commercialization.
INTRODUCTION continuously, reaching in 2008 to 10 732 ha

and 62 ha come bearing live young (Dejeu L.,
Grape production is the indicator reflecting
2010) (table 1). Table grape exports was
perhaps most visible as the hub biological
insignificant in recent years, however imports
potential and professionalism and ability to
soared. In the future it is necessary to relaunch
manage properly grower's holding in each year
the production lines, given the increased
since the beginning of phenophases first to last,
requirements for table grapes to consumers.
so a correctly applied technologies lead to
obtaining an appropriate grape harvest both Table 1. Cultural situation vine vines for table grapes in
quantitatively and qualitatively. Romania (after Dejeu L., 2010)
Quality table grapes from the combination of
Year
all the physical, chemical and organoleptic Specification
2005 2006 2007 2008
requirements satisfy and stimulate consumer Total vines on fruit
interest. It is estimated differently depending on 12 813 12 578 11 523 10 732
for table grapes (ha)
the subject (consumer, retailer, manufacturer) Young vines (ha) 48 91 73 62
and product. The consumer is interested, Total production of
39 338 67 053 81 046 87 164
primarily organoleptic quality, based on taste table grapes (t)
Table grape exports
characteristics (flavor, sugar content, acidity), (t)
200 100 909 306
olfactory (aroma), tactile (consistency pulp), Importation of table
visual (color, size, freshness, etc.). 2 044 9 000 18 959 21 500
grapes (t)
Grain trader appreciates homogeneity, Average
integrity, appearance (absence of defects in consumption of table
4,39 3,11 4,62 5,00
grapes (kg / resident
shape, parasites, flesh alterations, improper / year)
color), capacity retention and transport features
which allow product to reach the consumer in Quality of the items, the size of grapes
the best conditions. (bunches) determined according to weight and
elsewhere, is a character presentation
MATERIALS AND METHODS importance in terms of trade in table grapes
After 1989, due to the difficulties of the appearance (Sestras R., 2004).
transition and globalization expansion area Table grape varieties, as well as those for wine,
covered with vineyards for grapes decreased sugar content (with acid) is one of the most
183
important elements of quality grape-vine. Of given by a balance between sugar content and
carbohydrates, monosaccharides are the most acidity must.
important because it represents over 95% of the Groups of varieties are found higher
total sugars accumulate in the grapes and the accumulation of sugars in varieties with
monosaccharides glucose and fructose are the medium production potential. Late maturing
most representative (Tardea C., 2000). Table varieties, those with high production potential
grape varieties relationship between the two and high growth force accumulates lower
main sugars (glucose and fructose) should be in amounts of sugars. In 2012, a year rich in
favor of glucose (Ardelean M., 1986). resources heliothermal varieties studied have
New marketing standards for table grapes came accumulated large quantities of sugars from the
into force in the EU in 2008, as a result of the grapes recorded. Between 2010 and 2011,
European Commission Regulation no. normal in terms of climate, accumulation of
1221/2008. Table grapes can be divided into sugars were low, and because the higher
three categories: production of grapes obtained (Table 2).
- Extra. The grapes in this class must be of
superior quality to shape, development and Table 2. Sugars values in table grape varieties cultivated
coloring typical of the variety, allowing the at INCDBH Stefanesti-Arges
production area and have no defects. Berries SUGARS g/l
VARIETY
must be firm, firmly attached to the pedicel, 2010 2011 2012
evenly covered the cob and bloom; Argessis 140,3 138,5 155,2
Auriu de Stefanesti 140,2 140,9 146,3
- Category I. Grapes must be of good quality,
Augusta 137,8 139,4 143,2
take shape, typical of the variety, Muscat Adda 130,4 127,9 137,8
corresponding to the production area. Berries Perlette 10St 145,2 156,1 164,0
must be firm, firmly attached to the pedicel and Muscat Adda 22St 140,5 145,2 198,0
covered with bloom. Grains may have some Canner 140,8 150,1 169,0
slight defects that do not impair normal
appearance, quality, keeping quality and For all varieties studied, the highest amounts of
presentation in the package of the product: sugars accumulated in 2012 and lowest in 2010
slight defects of shape, color and burns caused (Table 1). This variation in sugar content of
by the sun, but affects only the skin. wine is determined mainly by the production of
- Category II includes grapes that can not be grapes, leaf area on each block. Such sugars
classified in the higher classes, grapes may that have accumulated grapes during the three
show slight defects in shape, development and year study ranged from 130.4 to 140.8 in 2010,
coloring, provided these do not impair the 127.9 to 140.9 in 2011 and 137.8 to 198, 0 in
essential characteristics of the variety, allowing 2012.
for the production. Berries must be firm and Titrable acidity of the must expressed in g / l
sufficiently attached to pedicel and, if possible, H2SO4 was determined at full maturity of the
covered with bloom. Assigned to clusters may grapes. Although the specific climatic
be less uniform than in other categories. Grains conditions vineyard Stefanesti-Arges, acidity
may have the following defects, provided they grape varieties of wine grape vines usually
retain their essential characteristics as regards remains sharp, high temperatures in recent
the quality, keeping quality and presentation: years indicate qualitatively affect this
defects of form, color, light skin burns in the considerably. Thus, in 2012, due to high
sun, slight bruising, slight skin defects. temperatures, acidity showed lower values,
especially in the early and mid-maturing
RESULTS AND DISCUSSIONS varieties such as Augusta and golden Argessis
Stefanesti and in 2010 and 2011, when
Table grape varieties are generally growing
temperature and insolation values were close
varieties with high force, high production
the annual average, titrable acidity was the
potential and a lower capacity to accumulate
characteristic varieties tested (Costescu A.,
sugars in the beans. This indicator of the
2012) (table 3).
quality of significance in that, in the case of
grapes for fresh consumption, taste qualities are
184
Variations in acidity of the varieties studied, Taking into account the varieties studied, it is
there were different due to the volume of foliar found that the highest values for this indicator
developed the hub, shading generated by it and were obtained from clone Adda 22 Del.
equally grape production levels. Muscat Adda, Muscat. in 2012 (6.82) and lowest in Muscat
extending the grain growth and delay their Adda (2.50) also in 2012. Table grape
maturation achieved a higher level of titrable producers constantly seek that level of quality
acidity of the must. Thus, this variety was to meet customer needs: large grapes, rare in
average titrable acidity of 5.29 g / l H2SO4. grain, uniform in size, firmly attached pedicel,
thin skin, evenly colored, crunchy flesh,
Table 3. Acidity values in table grape varieties grown in pleasant, neutral or aromatic see Quality table
INCDBH Stefanesti-Arges grapes from the combination of all the physical,
VARIETY
ACIDITY g/l H2so4 chemical and organoleptic requirements satisfy
2010 2011 2012 and stimulate consumer interest. It is estimated
Argessis 5,14 5,11 5,01 differently depending on the subject (consumer,
retailer, manufacturer) and product.
Augusta 3,50 3,56 3,50
Muscat Adda 5,15 5,21 5,51 The consumer is interested, primarily
Perlette 10St 3,80 4,15 3,30 organoleptic quality, based on taste
Muscat Adda 22St 3,81 3,60 2,90 characteristics (flavor, sugar content, acidity),
Canner 3,90 4,18 4,30 olfactory (aroma), tactile (consistency pulp),
visual (color, size, freshness, etc.) ds few,
Varieties studied showed acidity values small, or no seeds. Resistance is important for
between 3.50 to 5.15 in 2010, from 3.56 to 5.15 storage grain separation.
in 2011 and from 2.90 to 5.20 in 2012. Grain trader appreciates homogeneity,
Acidity values of varieties with less dense integrity, appearance (absence of defects in
foliage device were located within specific shape, parasites, flesh alterations, improper
table grape varieties (3.50 to 5.51) (Costescu A. color), capacity retention and transport features
and colab., 2010, Popa C. et all, 2007). which allow product to reach the consumer in
Glucoacidimetric index used to determine when the best conditions.
consumer maturity, so to set the date harvest. The manufacturer aims to maximize besides
Value of this index for table grapes is usually grapes and satisfying the consumer and the
between 2.5 to 4.5 range, given that table trader. New marketing standards for table
grapes contain 135-200 g / l sugar and 3.5 to grapes came into force in the EU in 2008, as a
6.0 g / l H2SO4 acidity (Martin, T., 1974). result of the European Commission Regulation
Following glucoacidimetric index values no. 1221/2008.
(Table 4) shows large differences from one Quality standards refer to minimum
variety to another, between experimentation. requirements and rules that should be respected
Varieties studied showed balanced values of producers and exporters of fruits and
the ratio of accumulated sugars and titrable vegetables and aim for food and fresh grapes,
acidity of must: Argessis (2.72 to 2.84), golden from varieties belonging to Vitis vinifera
Stefanesti (2.63 to 2.71), Muscat Adda (2.25 to Grain trader appreciates homogeneity,
2, 57), Augusta (3.75 to 4.04). integrity, appearance (absence of defects in
shape, parasites, flesh alterations, improper
Table 4. Glucoacidimetric index values in the studied color), capacity retention and transport features
period (average 2010-2012) which allow product to reach the consumer in
VARIETY
GLUCOACIDIMETRIC INDEX the best conditions.
2010 2011 2012 Rules define the quality characteristics that
Argessis 2,73 2,71 3,09 must have table grapes after preparation and
packaging. Given the specific provisions laid
Augusta 3,93 3,91 4,09
Muscat Adda 2,53 2,45 2,50 down for each class and the tolerances allowed,
Perlette 10St 3,82 3,76 4,97 grapes and berries must be:
Muscat Adda 22St 3,79 4,03 6,82 -sound, produce affected by mold or
Canner 3,61 3,59 3,93 deterioration such as to make them unfit for
185
consumption;-clean, practically free of any CONCLUSIONS
visible foreign substances and attacks by pests
Table grapes must be harvested carefully and
and diseases; abnormal external moisture-free,
degree of maturation to the transport, related
odorless and / or taste.
operations and to arrive in satisfactory
Also, the beans should be whole, well formed,
condition at the place of destination.
normally developed. Grapes must be harvested
carefully and degree of maturation to the Grapes and berries must be: healthy, produce
transport, related operations and to arrive in affected by mold or deterioration such as to
satisfactory condition at the place of make them unfit for consumption, clean,
destination. practically free of any visible foreign
Must must have a refractometric index of at substances and attacks by pests and diseases;
least: without abnormal external moisture, odorless
-12 º Brix for the Alphonse Lavalle varieties, and / or taste.
Cardinal and Victoria; Grapes for sale to be complete, well-formed,
-13 º Brix for other varieties of seeds; normally developed.
-14 º Brix for all seedless varieties.Alpha Quality table grapes from the combination of
In addition, all varieties must report sugar / all the physical, chemical and organoleptic
acidity satisfactory. The standards of the requirements satisfy and stimulate consumer
International Organization of Vine and Wine interest. It is estimated differently depending on
on minimum maturity requirements for table the subject (consumer, retailer, manufacturer)
grapes (VITI Resolution 1/2008) states that and product.
grapes that have a refractive index (° Brix)
equal to or greater than 16 are considered ACKNOWLEDGEMENTS
mature. In contrast, white varieties (and pink)
table grape with a refractive index less than 16, Thanks POSDRU, Contract cod:
you must have a minimum ratio 'sugar (g / l) / POSDRU/CPP107/DM11.5/S/76888 for
acidity (g / l expressed as tartaric acid) '20 / 1 financial support, to the University of
to be considered mature. If black varieties of Agricultural Science and Veterinary Medicine
table grape with a refractive index of between Bucharest who made this project and National
12.5 and 16 must have a report 'sugar / acidity' Research& Development Institute for
of at least 20/1, to be considered mature. Biotechnology in Horticulture Stefanesti-Arges
Grapes that have those values less than 12 are for the material provided and the possibility of
not considered mature. Minimum requirements conducting research.
determined by the weight calibration table
grape varieties large and small grains grown in REFERENCES
the field (or in greenhouses) are presented in Ardelean M., 1986. Ameliorarea plantelor horticole,
Table 5. Tipo Agronomia, Cluj-Napoca.
Costescu Adriana, Liviu Dejeu, Camelia Popa, 2012.
Table 5. Minimal weight of grapes (g) for different Evaluating the quality of the tablegrape varieties
qualitative categories (Reglement CE nr. 1221/2008) obtained and cultivated in the vineyard Stefanesti –
Arges, in Scientific Papers Series B Horticulture,
In the University of Agronomic Sciences and Veterinary
On the fild
greenhouse Medicine of Bucharest, Faculty of Horticulture, vol.
Category
grapes with grapes with LVI, ISSN 2285-5653, ISSN-L 2285-5653, p. 69-72
Table grape
large berries small berries Costescu Adriana, Popa Camelia, Visoiu Emilia, Necula
Extra 300 200 150 Cezarina, Iordache Stefania, 2010. The amelioration
I 250 150 100 of the Muscat d'Adda variety through clone selection,
II 150 100 75 Annals Foods and Techology, University of
Targoviste, p. 74-78.
Dejeu L., 2010. Viticultura, Editura Ceres, Bucuresti,
Each category are allowed tolerances in respect
480 p.
of quality and size of 5-10%. Each package Martin T., 1974. Cultura soiurilor pentru struguri de
must be uniform and contain content than masa, Editura Agro-Silvica, Bucuresti
grapes of the same origin, variety, quality and Popa Camelia, Radulescu Ion, Matei Viorica, 2007.
degree of maturation. Golden Stefanesti - a new vine variety for table
186
grape. Analele Universitatii din Craiova, Seria sectorul fructelor si legumelor privind standardele de
Biologie, Horticultura, Tehnologia Prelucrarii comercializare. Jurnalul Oficial L 336, 13.12.2008,
Produselor Agricole, Ingineria Mediului, vol XII p.1-80;
(XLVIII), p. 41-44. Sestras R., 2004. Ameliorarea speciilor horticole, Editura
Regulamentul (CE) nr. 1221/2008 al Comisiei din 5 Academic Pres, p. 9-66.
decembrie 2008 de modificare a Regulamentului Târdea C-tin si colab., 2000 Sestras R., 2004-
(CE) nr. 1580/2007 de stabilire a normelor de Ameliorarea speciilor horticole, Editura Academic
aplicare a Regulamentelor (CE) nr. 2200/96, (CE) nr. Pres, p. 9-66.
2201/96 si (CE) nr. 1182/2007 ale Consiliului în
187
IDENTIFICATION OF PLOIDY LEVEL ON VARIETIES
AND HYBRIDS OF KIWIFRUIT (ACTINIDIA SP.)
Ramona COTRU‫܉‬1, Florin STĂNICĂ1, Giuseppe SCAPIGLIATI2

1
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Blvd,
2
Department for Innovation in Biological systems, Food, Agriculture and Forestry (DIBAF),
University of Tuscia, Via S. Camillo de Lellis snc, 01100, Viterbo, Italia
Abstract
The genus Actinidia includes over 66 species and over 118 taxon, that range in ploidy level from diploid to octoploid.
Although there is basic information on ploidy levels of various species, sampling has been limited and little information
on specific cultivars and hybrids is available. The objective of this research was to determine ploidy levels among a
diverse collection of species, hybrids, and cultivars using flow cytometry. Nuclei were extracted, stained with propidium
iodide (PI), and analyzed using a flow cytometer. Among the selections tested we found Actinidia arguta as diploid (2n
= 2x) and tetraploid (2n = 4x), Actinidia deliciosa 'Hayward' as hexaploid (2n = 6x), Actinidia chinensis
'Soreli' tetraploid (2n = 4x) and the interspecific hybrid A. arguta x A. deliciosa as diploid (2n = 2x). This information
provides further insight into reproductive biology, substantiation of numerous hybrids and induced polyploids that will
help facilitate the development of improved hybrids in the future.
Key words: chromosomes, flow cytometry, interspecific hybrid, polyploidy, plant breeding.
INTRODUCTION variation in ploidy make hybridization between

Actinidia species difficult. Better knowledge
Commercial kiwifruit production is based on
and understanding of polyploidy of cultivars
two Actinidia species, A. deliciosa C.F. Ling et
and hybrids could facilitate kiwifruit
A.R. Ferguson and A. chinensis Planch.
improvement.
Nevertheless, at present, A. arguta is
Polyploidy has been an important process in the
commercially cultivated in Oregon in US, Chile
evolution of plants and is an important factor in
and New Zealand, and small-scale production
plant breeding because it can influence
for local consumption is conducted in many
reproductive compatibility, fertility, and
regions under a relatively cool climate
phenotypic traits (Chen and Ni, 2006; Jones
(Ferguson and Huang, 2001). The genus
and Ranney, 2009; Ranney, 2006; Soltis et al.,
Actinidia Lindl. comprises 66 species and about
2004). Hence, accurate and specific knowledge
118 taxa with remarkably wide natural range
of ploidy levels of species and cultivars is
extending from the tropics (latitude 0º) to cold important information for kiwi breeders.
temperate regions (50º N). Since the first seed The base chromosome number for Actinidia is
introduction of A. deliciosa was made from 1n = 1x = 29. However, different subgenera
China to New Zeeland in 1904, the economic contain species with a variety of ploidy levels
potential of kiwifruit has been extensively ranging from 2n = 2x = 58 to 2n = 6x =174;
exploited (Ferguson and Bollard 1990). respectively 2n = 8x =232. The range in ploidy
There is considerable genetic diversity amongst levels within this genus also provides an
the species within the genus Actinidia, opportunity to indirectly substantiate hybridity
particularly in fruit skin type, skin colour, flesh when parents differ in ploidy levels.
colour and flavour (Ferguson and Huang, Because many Actinidia species are polyploids
2007). with high chromosome numbers, traditional
This diversity provides many opportunities for cytology based on light microscopic
developing new types of kiwifruit. Dioecy, examination is a difficult and time-consuming
long generation cycles, high heterozygosity and process.
189
Flow cytometry has proved to be an efficient RESULTS AND DISCUSSIONS
means of estimating genome size and
We have evaluate for ploidy level six seletions
associated ploidy level (Dolezˇel et al., 2007;
of Actinidia arguta, two of A. deliciosa
Jones et al., 2007). Therefore, the objective of
‘Hayward’, one of A. chinensis ‘Soreli’ and one
this study is to identify the ploidy levels of a
interspecific hybrid, A. arguta x A. deliciosa,
diverse collection of species, hybrids, and
using flow cytometry (Table 1).
cultivars of Actinidia developing a database for
use by kiwi breeders. Table 1. Selection of species, hybrids of kiwi (Actinidia
sp.)
Species Genotype No. plants
The plant material was constituted by a Actinidia arguta R8P23 10
collection of plants from Actinidia arguta, Actinidia arguta R10P10 10
Actinidia arguta R9P18 10
Actinidia deliciosa, Actinidia chinensis and one
Actinidia arguta R8P1 10
interspecific crosses of Actinidia, total of Actinidia arguta R9P16 10
130 plants were kept in a green house. Actinidia arguta x deliciosa P1 10
Flow cytometric analysis was performed for Actinidia deliciosa’Hayward’ Hk 10
each of the Actinidia accessions by collecting Actinidia deliciosa’Hayward’ H8 30
leaf samples (3-5 per each), young fully Actinidia chinensis’Soreli’ S 30
expanded leaf collected from the shoot tips; to Total 130
maintain an adequate moister and ensure a
correct conservation tissues, the leaves were The ploidy levels of Actinidia plants were
placed in plastic bags in a refrigerator at 4ºC. clearly distinguished by flow cytometry.
Using the method of Galbraith et al. (1983), 50 Among Actinidiasp. tested, we found: Actinidia
mg Actinidia leaf tissue without midribs was arguta (2n=2x) R9P18, R8P23 as diploid
placed in plastic Petri dishes chopped with a plants, R10P10, R8P1, R9P16 as
razor blade adding 0.5 ml of ice-cooled tetraploid Actinidia arguta (2n=4x), plants; for
homogenization (Otto I buffer) to homogenize Actinidia deliciosa ‘Hayward’ (2n=6x) HK, H8
the tissues and release the nuclei, and kept on as hexaploid; for Actinidia chinensis ‘Soreli’
ice for 5 min. (2n=4x) tetraploid; for interspecific crosses A.
After filtration through 42-μm nylon mesh the arguta x A. deliciosa (2n=2x) P1 as diploid
nuclear suspension were treated with 2.5 ml of (Table 2).
a staining solution containing 10 ml Tris, 50
mM sodium citrate, 2 mM MgCl2, 1% (w/v) Table 2. Estimation of ploidy level of kiwi genotypes
PVP 30, 0.1% (v/v) Triton X-100 and 1 mg/ml (Actinidia sp.)
propidium iodide (PI), pH 7.5, letting the Species Genotype
Ploidy No.
samples stand 5 min prior to flow cytometric level chromosomes
analysis. Actinidia arguta R8P23 2x 58
Actinidia arguta R10P10 4x 116
Samples were run on a Coulter Epics XL-MCL Actinidia arguta R9P18 2x 58
flow cytometer EXPO 32 ADC; for each Actinidia arguta R8P1 4x 116
accession was gated between 5000-10000 Actinidia arguta R9P16 4x 116
events of a sample. Relative fluorescence Actinidia arguta x
P1 2x 58
intensity was assessed using FL2, green light deliciosa
source detector (excitation 488 nm). Actinidia
Hk 6x 174
deliciosa’Hayward’
Data were interpreted using WinMDI 2.9
Actinidia
software. As an internal standard was used deliciosa’Hayward’
H8 6x 174
Pisum sativum cv. Ctirad. The measurements Actinidia
were tripricated by using three leaf samples S 4x 116
chinensis’Soreli’
collected from each plant.
The results of an analysis are described as a
mono-parametric (fluorescence intensity/
object) histograms peaks, each of them
190
representing the fluorescence intensity of a of the histogram) is proportional to the amount
population of nuclei. Their intensity (position of nuclear DNA (Figure 1).
Figure 1. Frequency distribution histograms of fluorescence intensity stained with propidium iodide (PI) (A, A. arguta
R8P23; B, A. chinensis ‘Soreli’; C, A. arguta 108P10, D, A. deliciosa var. deliciosa cv. Hayward K; Log values of
fluorescence intensity% CV for nuclei are given on each histogram).
The comparison between the position of the This comparison can be made either between
sample’s peak and the internal standard’s peak two analyses performed under identical
give a ratio of relatives intensities. The ploidy conditions, or, in our case, through mixing the
levels are calculated by comparing two samples for simultaneous measurement.
experimental values with the value obtained Counting chromosomes in Actinidia species
from Pisum sativum sample having a known and their hybrids is technically difficult due to
ploidy level. the high numbers of chromosomes involved
As a result, ploidy analysis in which the DNA and their small size. Chromosome numbers
contents of Arguta sp. collection, nuclei were have been reported for only a few species but
compared to those from a specie having known the data support a polyploid sequence 2n = 2x,
ploidy (Pisum sativum 2n=2x). 2n = 4x, 2n = 6x with x= 29. To determine
ploidy, the number of basic chromosome sets in
191
cell nuclei, using chromosome counting in collections of plant materials, and to Sectoral
dividing cells is an unambiguous way and is Operational Programme Human Resources
time consuming, that is way a high-throughput Development 2007-2013 ''Doctoral and post-
solution is to use flow cytometry, making doctoral research support
possible a rapid and reliable ploidy estimation. 'POSDRU/107/1.5/S/76888.
Flow cytometry (FCM) was originally Chen Z.J., Z. Ni., 2006. Mechanisms of genomic
developed as a rapid technique to analyse blood rearrangements and gene expression changes in plant
polyploids. Bioessays 28, p. 240–252.
samples for medical diagnosis and is nowadays De Laat A.M.M., Gohde W., Vogelzang M.J.D.C., 1987.
used for countless medical applications by the Determination of ploidy of single plants and plant
analyses of individual cells at high speed. In populations by flow cytometry. Plant Breed 99, p.
plant sciences, and breeding in particular, flow 303-307.
cytometry is mainly known as a tool for ploidy Dolezel J., Greilhuber J., Suda J., 2007. Flow Cytometry
with Plant Cells Analysis of Genes, Chromosomes
analysis. The first ploidy applications focused
and Genomes. Online ISBN:9783527610921
on crop plants (De Laat et al. 1987) and plant Ferguson A.R., 1999. Kiwifruit cultivars: breeding and
breeding still dominates this field. selection. Acta Hort. 498, p. 43–51.
The method is fast, accurate and simple and Ferguson A.R., Bollard E.G., 1990. Domestication of the
kiwifruit. Kiwi fruit science and management.
replaced microscopic chromosome counts since
R.Richard Publ. N.Z., p.165-246
Galbraith et al. (1983) introduced chopping Ferguson A. R.,Huang H., 2007, Genetic Resources of
with a razor-blade as an easy standard protocol Kiwifruit: Domestication and Breeding, Horticultural
for plant analysis. Reviews, Volume 33.
Galbraith D.W., Harkins K.R., Maddox J.M., Ayres
At different stages in plant breeding flow N.M., Sharma D.P., Firoozabady E., 1983. Rapid
cytometry generates valuable information. As flow cytometric analysis of the cell cycle in intact
well for the selection of parent plants for plant tissues. Science 220, p. 1049–1051.
hybridisation as for the evaluation of hybrids, Hopping M. E., 1994. Flow cytometric analysis of
ploidy determination or genome size analyses Actinidia species, New Zealand Journal of Botany,
are useful. Flow cytometry is an indispensable 32:1, p. 85-93
Huang , H., A.R. Ferguson., 2001. Kiwi fruit in China.
tool in polyploidisation to screen plants treated N.Z. J. Crop Hort.29, p. 1-14.
with mitotic inhibitors. Huang H., Wong J., 2000. Genetic diversity in the genus
Such conclusions clearly highlight the Actinidia. Chinese Biodiversity 8, p. 1-12.
Jones, J.R., Ranney T.G., Lynch N.P., Krebs S.L., 2007.
indispensability of cytotype determination Ploidy levels and genome sizes of diverse species,
(most effectively realized by FCM) in any hybrids, and cultivars of Rhododendron L. J. Amer.
experimental study that may involve Rhododendron Soc. 61, p. 220–227.
heteroploid plant samples. Kataoka I., Mizugami T., Kim J.G., Beppu K., Fukuda
T., Sugahara S., Tanaka K., Satoh H., Tozawa K.,
2010. Ploidy variation of hardy kiwifruit (Actinidia
ACKNOWLEDGEMENTS arguta) resources and geographic distribution in
Part of this work was supported Department for Japan. Journal Scientia Horticulturae 124, p. 409–414
Ranney, T.G., 2006. Polyploidy: From evolution to new
Innovation in Biological systems, Food,
plant development. Proc. Intl. Plant Prop. Soc. 56, p.
Agriculture and Forestry (DIBAF), University 137–142.
of Tuscia. We greatly thank Dr. Giuseppe Soltis, D.E., P.S. Soltis, and J.A. Tate. 2004. Advances
Scapigliati, Phds. C. Marozzi, Mr. Giusseppe in the study of polyploidy since plant speciation. New
Zuccherelli for their assistance and the Phytol.161, p. 173–191.
192
EVALUATION CONCERNING THE VARIABILITY
OF SOME CHARACTERISTICS AT A BULGARIAN TOMATOES
COLLECTION CULTIVATED IN GREENHOUSE
Mădălina DOLTU, Marian BOGOESCU, Dorin SORA
Research and Development Institute for Processing and Marketing of the Horticultural Products, 1A
Intrarea Binelui, District 4, 75614, Bucharest, Romania
Abstract
The experience was conducted in a tomatoes collection consisting from 3 F1 hybrids, Bulgarian origin - Prekos, Kom
and Geo - with large percentage in the vegetable area near Bucharest. The observations and the biometric
measurements from fruits were made during the growing season, in 2012 year. The researches was conducted in the
Laboratory for Protected Cultures of the ICDIMPH-Horting Bucharest and were aimed the evaluation of some
determinants characteristics to the production and marketing of this vegetable on internal market of Romania. The
results show that the studied hybrids have genetic variability of the characteristics, favorable traits and are an
important source of germplasm for improvement works of the species.
Key words: Bulgarian seeds, Romanian tomatoes.
INTRODUCTION Bucharest because the fruits have size, color,

shape, taste by „Romanian tomato”.
Currently, are appreciated the tomatoes with
In the researches of the specialists, Prekos F1
taste by „Romanian tomato”.
was marked by superior organoleptic qualities
This aspect is determinant in the marketing of
of the fruits (Maria et al., 2009).
this vegetable on the internal market of
Romania; the consumers of our country have
classical, traditional and less diversified
options. The biological material used in the research
In our country, increasing interest for to was formed from Bulgarian tomatoes - 3
preferentially use early tomatoes F1 hybrids in hybrids F1 - Prekos, Kom and Geo.
protected spaces and field led to the The description of the hybrids is shown in table
predominant use of the foreign origin seeds, (Table 1).
specifically adapted and intended for
cultivation in warm greenhouses, with Table 1. The description of the Bulgarian tomatoes
pretensions for advanced technologies HybridType of growth Precocity Resistances
(Vânĉtoru, 2006). very VMT, Fusarium spp.,
Prekos semideterminate
Although the price of hybrid seeds is very high, early Verticillum spp.
their use is recommended because have the VMT, Fusarium spp.,
Kom indeterminate early Verticillum spp.,
favorable qualities - precocity, resistance to nematozi
diseases and pests, quality, high production, VMT, Fusarium spp.,
Geo indeterminate early
etc. (Voican and LĉcĉtuƔ, 1998). Verticillum spp.
So, vegetable growers obtain Romanian
tomatoes from import seeds. The tomatoes seedlings were produced in
The variety and production technology greenhouse specializes in producing seedlings.
influences the quality characteristics of the The plants were obtained in alveolar trays, in
tomatoes. nutritive substrate – peat, medium fertilized
The Bulgarian tomatoes hybrids (Prekos, Kom (Figures 1, 2, 3).
and Geo) have large share in the
cultivationarea of the vegetables near
193
Figure 1. Prekos F1 Figure 4. Prekos – 45 days
Figure 2. Geo F
Figure 5. Kom – 45 days
Figure 3. Kom F1
The culture was established on 21.03.2012, Figure 6. Geo – 45 days

with seedlings aged 45 days old (Figures 4, 5,
6). The conventional technology was used in the
tomatoes crop (maintenance works, directing of
the growth factors etc.) and the fertilization
program presented (Table 2).
194
Table 2. Fertilization program of the tomatoes culture in The number of the seminal lodges ranged from
the greenhouses - kg/ha (Voican and LĉcĉtuƔ 1998) a hybrid to another: 3-4 seminal lodges
Potassi (Prekos), 5 seminal lodges (Kom), 3 seminal
Concentrate Magnesi
Ammoni Compl um lodges (Geo) - Figures 8, 9, 10.
d um
Mome um ex sulphat
superphosp sulphate
nt nitrate 16:48: e
hate (16%Mg
(34% N) 0 (45%
(40% P2O5) O)
K2O)
A 200-
B 100-200 0-300 - 100-200
400
10–20 * 100 - - -
-
300 - 100 -
21–50* -
200 - - 50
51–80* 200
100 - - 50
81–110* 200
The experience included 3 plots (100 m2/plot)

cultivated with tomatoes, 270 plants/plot (ʌ = Figure 7. Exterior color of immature fruit
27000 plants/ha).
The first harvesting was realised at 2012/05/07
(Prekos) and 2012/05/14 (Geo and Kom).
The observations and the biometric
measurements at tomatoes were made in the
Laboratory for Protected Cultures of the
ICDIMPH-Horting Bucharest.

The results concerning the morphological
characters of the fruits are presented in the
table3. Figure 8. Prekos - 3; 4 seminal lodges
Table 3. The main characteristics of the tomatoes

collection
Characters of fruit Prekos Kom Geo
Weight of fruit (g) 185 180 130
Predominant form of spherical
spherical spherical
fruit sharp peak
Number of the
3; 4 5 3
seminal lodges
Exterior color of green, with light
green
immature fruit lid green
Exterior color of
red red red
mature fruit
Figure 9. Kom - 5 seminal lodges
The fruit weight ranged from 130 g (Geo) to

185 g (Prekos).
The shape and the color to physiological
maturity of the tomatoes presented a high
variability; were obtained green fruits, with tip
(Prekos), green fruits, spherical, with green lid
(Kom) and green fruits, spherical and green
fruits, lid without (Geo) - figure 7. The color
was red at physiological maturity at all hybrids.
The exterior aspect of the fruits was smooth
Figure 10. Geo - 3 seminal lodges
(Prekos) and easy costed (Geo, Kom).
195
Interpretation of the results concerning the The tomatoes fruits presented characteristics -
production / ha, by Duncan test, is shown in the color, weight, shape, aspect, taste and number
figure 11. of seminal lodges - optimal, meeting the
requirements of the producers and the
consumers.
The hybrids investigated have optimal
precocity and high production.
The Prekos hybrid is superior the Kom and Geo
hybrids.
The tomatoes collection researched is a
valuable source of germplasm for amelioration
works.
These 3 hybrids F1 of Bulgarian origin -
Prekos, Kom and Geo - behaved optimal in
greenhouse, in the climate conditions of
Figure 11. The production of the tomatoes hybrids Bucharest in 2012 year.
It is observed insignificant difference between REFERENCES

the production/ha obtained from Prekos (83 Maria C., Stoian L., Filipov F., Criste T.O., AmbĉruƔ S.,
t/ha) and Kom (80 t/ha) and significant Avasiloie D.I., 2009. Comparative and collection
difference from Geo (65 t/ha). study tomatoes hybrids cultivated in plastic houses in
biologic agriculture conditions, Analele Univ. din
CONCLUSIONS Craiova, seria Agriculturĉ-Montanologie-Cadastru,
vol. XXXIX, p. 61-65.
The tomatoes collection researched has an Vânĉtoru, C., 2006. Crearea de hibrizi F1 de tomate
important genetic variability of the timpurii cu plasticitate ecologicĉ Ɣi calitate
characteristics studied. superioarĉ, Tezĉ de doctorat.
Voican V., LĉcĉtuƔ V., 1998. Cultura protejatĉ a
legumelor în sere Ɣi solarii, Editura Ceres.
196
RESEARCH REGARDING THE BREEDING

OF PEACH IN DOBROGEA AREA
Liana Melania DUMITRU1, Corina GAVĂT2, Dan-Victor DUMITRU3,
Georgeta CARE‫܉‬U4 and Adrian ASĂNICĂ5
1
Research Station for Fruit Growing Constanta, Pepinierei Str. 1, 907300, Valu lui Traian, Romania
2
Ovidius University of Constanta, Aleea Universitatii, no.1, Constanta, Romania
3
Limagrain Romania, Drumul Garii Odai Street, no.1A, Bucharest, Romania
4
Bioterra University Bucharest, 97 Ion Ionescu de la Brad Blvd, 013812, Bucharest, Romania
5
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Blvd.,
Abstract
Peach is one of the most valuable species cultivated in Romania. At Research Station for Fruit Growing Constanta is
the National Peach Collection with 855 genotypes from worldwide. Between 1981-2012, our peach breeders sorted the
best genitors and made a lot of hybridizations, than they obtained thousand and thousand of hybrids. During the time,
31 new peach, pavie, nectarine and brugnone cultivars are registered to Bucharest ISTIS and this new biological
material enriches and diversifies the Romanian assortment. This paper presents seven new cultivars
Key words: Prunus persica (L) Batch, dwarf, fruit quality, processing
INTRODUCTION The rootstock utilised was ‘Tomis 1’, which

was registered in 1997 and it was obtained in
Peaches and pavies are appreciated for their our station by Dr. Alexandra Indreias.
nourishing and therapeutically qualities and The orchard density was 833 trees / ha, for
are recommended for fresh consumption and standard trees (4/3 m) and 2222 trees / ha for
for processing (Delgado, 1992; Bargioni, dwarf trees (3/1.5 m).
Pisani, 1993; Cepoiu, Manolache, 2006). The trees were observed from the phenol-
Thousand and thousand peach cultivars are in logical point of view. There were made bio-
the world and annually, the breeders obtain metrical measurements on fruits and trees;
new varieties (Monet, 1990; Fraccaroli, physico-chemical analyses on fruit; apprecia-
Bargioni, Febi, 2000; Sansavini, 1991; tions on productivity, behavior to the attack of
Dumitru, Cepoiu, Stanica, 2001). main diseases and parasites, etc.
The crown form was the improved vase.
MATERIAL AND METHOD
The biological material is representing by
seven new cultivars: ‘Cecilia’ – registered in ‘Redhaven’ is the American cultivar which
2000; ‘Raluca’ and ‘Catherine Sel.1’ – omo- was introduced in Romania in 1964. After 49
logated in 2001; ‘Florin’ and ‘Filip’ – in years, this variety persists to be cultivated in
2002; ‘Craita’ – in 2003; ‘Monica’ – in 2007. our peach-orchard. It is the control of this
The American cultivar ‘Redhaven’ – regis- experiment (Photo 1).
tered in 1964 in the Official Romanian Bree-
ding Cultivar List of Plant was control of this
experiment.
197
Photo 1- Redhaven (Control) Photo 3- Cecilia
The Romanian breeders try to obtaine new ‘Catherine Sel.1’, was obtained by Liana-
valuable cultivars, same (type) ‘Redhaven’, Melania Dumitru.
with yellow flesh, but not only, because the It is a clingstone cultivar, tree is standard, me-
tastes of consumers is changing day by day. dium vigorous, resistant to Taphrina defor-
Then, were created, for a change, aboriginal mans; hight and constant productivity; fruit is
cultivars with white or orange flesh, with big, orange with red, attractive, the flesh is
different taste, color, size, firmness, form, etc. orange, firm, flavoured, very sweet (Photo 4).
In this paper we present seven new cultivars
obtained at Research Station for Fruit
Growing Constanta, Romania.
‘Raluca’, the author is Liana-Melania Dumitru.
Is an early peach cultivar, similar to
Redhaven; tree is standard, semivigorous,
resistant to frost; autofertile; with big and
constant yield; the fruit is red and attractive;
the flesh is yellow and juicy (Photo 2).
Photo 4- Catherine Sel.1

‘Craita’ - the author is Liana-Melania Dumitru.
It is a dwarf clingstone cultivar; the hightness
of tree is 1.20-1.50 m; big and constant pro-
ductivity; fruit is yellow-orange, with yellow
and firm flesh, very good taste (Photo 5).
Photo 2- Raluca
‘Cecilia’, the authors are Liana –Melania

Dumitru and Vasile Cociu.
It is a dwarf peach with fruit similar to Photo 5- Craita
Redhaven; the highness of tree is about 1.40-
‘Florin’- the author is Liana-Melania Dumitru.
1.70 m; fruits are big, red, with yellow flesh
It is an early cultivar with flat fruit and
and good quality (Photo 3).
standard trees; big vigour, resistant to frost;
198
fruit is big for “sandwich” group; attractive, ‘Monica’- the authors are: Vasile Cociu,
yellow with red; orange flesh, juicy (Photo 6). Liana-Melania Dumitru and Preda Ionescu.
It is also a ”sandwich“ peach, which has the
ripening time after Filip; very attractive fruit,
red-carmin colou; white flesh, sweet and juicy
(Foto 8).
Photo 6- Florin
‘Filip’ - the author is Liana-Melania Dumitru.

It is the best Romanian peach cultivar with flat
fruit; the tree is standard, autofertil; has me-
dium-big vigour; very good and constant pro- Photo 8- Monica
ductivity; fruit is very attractive, excellent taste,
sweet, flavoured, rose-red, with white flesh; The most early cultivars are: ‘Raluca’ and
small stone, no adderence, juicy (Foto 7). ‘Florin’ and the latest are: ‘Cecilia’ and
‘Monica’ (Table 1).
The yield is between 22.5 t/ha (‘Redhaven’ –
Control) and 40.0 t/ha (‘Craita’, dwarf pavie).
‘Catherine Sel.1’ (pavie or clingstone
cultivar) has also a big production: 30 t/ha
(Table 1).
The mean weight of fruit varies between 73 g
(‘Monica’) and 225 g (‘Catherine Sel.1’).
The peach cultivars with flat-fruit have the
size of fruit smaller than the classic one, but
this fact is compensated by the excellent taste
and the atractivity of their fruits (Table 2).
The raport stone/fruit is between 3% (‘Filip’)
and 8% (‘Redhaven’- Control) and it denotes
the efficiency to processing.
Photo 7- Filip
Table 1. Ripening time and average yield (2010-2012) Valu lui Traian, Constanta, Romania
Average yield
Genotype Category Ripening time Destination of fruits
kg/tree t/ha
Redhaven
peach 09.07-16.07 27.0 22.5 flesh consumption and processing
(Control)
Raluca peach 30.06-07.07 29.0 24.2 flesh consumption
Cecilia dwarf peach 01.08-13.08 14.5 32.2 flesh consumption and processing
Catherine Sel.1 clingstone (pavie) 27.07-10.08 36.0 30.0 processing and flesh consumption
Craita dwarf clingstone 15.07-29.07 18.0 40.0 processing and flesh consumption
Florin peach with flat fruit 02.07-11.07 27.5 22.9 flesh consumption
Filip peach with flat fruit 14.07-29.07 35.0 29.2 flesh consumption and processing
Monica peach with flat fruit 03.08-13.08 32.0 26.7 flesh consumption and processing
199
Dry matter (determinate refractometrique) is areas from the south, west and central part of
between 10.5% (to ‘Raluca’) and 16% (to Romania and also for other European coun-
‘Monica’). trys, like Ungary, Bulgary, France, etc.
The acidity, which is expressed in mg. malic 2. All these new cultivars are more good than
acid / 100 g flesh fruit, varies between 0.32 control cultivar (‘Redhaven’) and enriched the
mg% (‘Filip’) and 0.67 mg% (‘Redhaven’- existing assortment.
Control) (Table 2).
ACKNOWLEDGEMENTS
Table 2. Quality test of fruit Valu lui Traian,
Constanta, Romania The paper was supported by UMPP – ASAS
Genotype Fruit Stone % Dry Acidity*
mean mean stone matter (mg%) Bucuresti, Sectorial Plan ADER 2020, Project
weigh weigh fruit (%) ADER 1.1.8., Contract 118/2011.
(g) (g)
Redhaven 150.0 12.0 8.0 11.0 0.67
REFERENCES
(Control)
Raluca 172.0 13.0 7.6 10.5 0.56
Cecilia 220.0 10.0 4.5 12.5 0.66 Bargioni, G., Loreti, F., Pisani, P.L. (1993).
Catherine 225.0 12.0 5.3 14.7 0.44 Performance of peach and nectarine in a high density
Sel.1 sistem in Italy, Hortscience, vol. 18(2) Italy.
Cepoiu, N., Manolache, C. (2006). Piersicul –
Craita 125.0 8.5 6.8 13.2 0.55
sortimente si tehnologii moderne. Editura Ceres,
Florin 105.0 6.0 5.7 11.5 0.40
Bucuresti.
Filip 77.5 2.3 3.0 14.8 0.32
Delgado M. (1992). Peches pour une meilleure tenue
Monica 73.0 2.7 3.7 16.0 0.36 des fruits. Lárboriculture fruitier. Nr. 450, Mai.
* Acidity: mg malic acid/100 g flesh fruit
Dumitru, L.M., Cepoiu, N., Stanica, F. (2001). New
dwarf, peach tree varieties registered in 2000 by Fruit
Generaly, the cultivar with flat fruit have Research Station Constanta, Romania. The Vth
more sugar and less acidity (‘Filip’ and International Symposium of Peach, Davis, California,
‘Monica’) than normal peach cultivars. S.U.A.
Fraccaroli, S., Bargioni, G., Febi, A. (2000). La
A big percent of dry matter have also the peschicoltura Veronese alle soglie del 2000. Verona-
clingstone (pavie): 13.2% (‘Craita’) and Italy.
14.7% (‘Catherine Sel.1’) (Table 2). Monet, R. (1990). Orientation actuelles des
programmes de creation varietale du pecher. Journees
CONCLUSIONS Peches et Nectarines. 10-11.01.Moissac.
Sansavini, S. (1991). La Peches-Enjeux technique de la
production italienne. L’arboriculture fruitiere, Nr.435,
1. The new cultivars obtained at Constanta are Janvier.
suitable not only for ecoclimatic conditions of
south-east of Romania, but also for other
200
PRESENT AND PERSPECTIVE OF ALMOND IN SOUTH-EASTERN
ROMANIA
Corina GAVĂ‫܉‬1, Liana Melania DUMITRU1, Georgeta CARE‫܉‬U2

1
Research Station for Fruit Growing Constanta, Pepinierei Str. 1, 907300, Valu lui Traian, Romania
2
Bioterra University, No. 81 Garlei Street, District 1, Bucharest, Romania
Abstract
Almond is almost unknown to most people in our country, even abroad is widespread and appreciated for its fruit with
many uses. At Research Station for Fruit Growing Constanta, during 1984-1994, it were studied over 45 cultivars of
almonds. Currently germoplasm consists of 54 cultivars and selections of almonds that have been studied regarding
behavior in the phenology and pollination process.
Key words: Prunus amygdalus Bartock, cultivars, phenology, pollination.
INTRODUCTION Absolute temperature beyond the limits of

resistance of almond species: - 26°C, -30 °C or
Almond belongs to the group of nuts crops and
has a major economic importance in above + 40°C is rare (once in 20 or once 30
nourishment industry, because of its many uses years). Rainfall is deficient to the requirements
and multiple chemical components of the fruit. of the trees; the average amount of rainfall is
Almonds is considered an almost complete around 400 mm, with unequal distribution in
fruit; depending of the cultivar, ripening time the active growing season (April 1 to
and place of culture their sweet or bitter core September 30). Chernozem soil type is deep,
containing large amounts of fat, protein with good condition for water circulation, well
substances, carbohydrates, minerals, etc. supplied with humus.
(Cociu, 2003, 2007). The almond genotypes were studied at RSFG
Being classified as thermopile tree species, the Constanta more than ten years. The planting
almond found in the south east part of the distance was 5 m between rows and 4 m
country optimal climatically conditions for between trees on row; the almond rootstock
culture, although almond orchards declined was bitter almond. The crown shape was
greatly, in the last two decades. vase.The trees were pruned every year,
Currently, almond became a 'luxury' fruit; their fertilized and irrigated; the phyto-sanitary
fruit being exported in high quantities in most treatments were applied uniformly in the field.
advanced countries at a higher selling price. All studied cultivars were observed from the
The purpose of this study is to provide data on phenological point of view. The beginning of
the almond assortment recommended for flowering was considered when the first open
climatic conditions in Dobrogea. flower was visible and the end of it was noticed
when the last petals of the flowers fell. The
MATERIALS AND METHODS blooming intensity was noted from 0 (absent)
to 5 (abundant), according with the research
RSFG Constanta is located in the south-eastern methodology of fruit tree breeding (Cociu,
Romania, in the area between the Danube and 1989).
the Black Sea and has specific steppe climatic The self fertility of almond cultivars was
conditions. The mean yearly temperatures are evaluated by isolating branches with flowers
11.6°C, hard winters and very hot summers using paper bags. The fruit were numbered and
with low rainfalls. Frosts return is a quite often were expressed as percentage. The kernel
phenomena in spring, fact that affects fruit trees strengthening occurs when the embryo
with early blooming as almond. cotyledons pass from liquid to solid state, and it
201
was evaluated by using a large-sized needle. longer flowering period, even over 30 days
The fruit on the branches were pierced during (Tuono). The flowering intensity was abundant
their growth. The kernel was considered and very abundant, being noted by 5 or 4-5 to
strengthened when the needle had not all studied almond cultivars. The kernel
penetrated the fruit. The almond kernel yield strengthening of almond begins on 8.06
was evaluated by weighing the tree crop (Ferragnes) and finish on 20.08 (Teteny
(kg/tree). Botermo, Nikitski, Feraduel). The kernel
strengthening phase has the highest
RESULTS AND DISCUSSIONS requirements for water and nutrients
consumption (critical phase). The fruit yield is
The beginning of the flowering was gradually,
reduced during the very dried growing seasons;
starting with Tuono (25.03), followed by Mari
many of them remain small, dry or
de stepa (29.03); the last one that flowering was
incompletely formed; also, the phenomena was
Tardy non Pareille (18.04). Also, the end of the
noticed by Cociu (1954). The ripening time
flowering was recorded between 16.04 (Mari
started on 3.09 (Preanîi), followed by Mari de
de stepa) and 1.05 (Ai). The flowering on the
stepa, continuing every 2 or 3 days, until on
same tree at the studied cultivars is gradually.
2.10 (Tuono) for a period of one month. All
That was noted to other fruit tree as peach and
cultivars studied are auto incompatible in the
apricot (Manescu, 1975). The late flowering
pollination processes, as shown in table 2.
cultivars flowering time ranged from 12 to 14
days; the cultivars that bloom earlier had a
Table 1. The phenology of flower buds and ripening time of almond at Valu lui Traian, south-eastern Romania
(multiannual date)
Beginning of End of Flowering time Kernel Ripening
Cultivar Intensity
flowering flowering (days) strengthening time
Preanîi 3.04 21.04 18 5 17.06 3.09
Mari de stepa 29.03 16.04 19 4 10.06 6.09
Teteny
6.04 22.04 16 5 20.06 10.09
Botermo
Lovrin 5.04 22.04 17 5 11.06 17.09
Pomorie 3.04 21.04 18 4-5 8.06 18.09
Thompson 8.04 27.04 19 5 17.06 19.09
Nikitski 9.04 27.04 18 3-4 21.06 22.09
Feraduel 16.04 28.04 12 5 20.06 28.09
Ferragnes 16.04 30.04 14 5 8.06 1.10
Ai 14.04 1.05 17 4-5 11.06 20.09
Tardy non pareille 18.04 30.04 12 4-5 10.06 20.09
Marcona 10.04 27.04 17 4-5 19.06 26.09
Tuono 25.03 28.04 34 2 9.06 2.10
Table 2. The pollination behavior of almond cultivars, Valu lui Traian

Self pollination Open pollination
Cultivar Number of flowers Number of Number of Number of
%
in paper bags fruits flowers fruits
Preanîi 264 0 0 - -
Mari de stepĉ - - - 98 16
Teteny
240 0 0 - -
Botermo
Lovrin 153 0 0 - -
Thompson 315 0 0 458 36
Nikitski 250 0 0 420 159
Feraduel
Ferragnes 320 0 0 197 40
Ai 255 1 0 - -
Marcona 338 0 0 - -
202
The highest yields were recorded at Preanîi (8.8 CONCLUSIONS
kg /tree), followed by Lovrin (7.0 kg/ tree) and
The almond cultivars studied provide good
Ferragnes (6.7 kg/tree), table 3. A big kernel
yields and can be recommended to be planted
weight was recorded to Feraduel (1.7 g). The
in orchards in south-eastern part of Romania
shells of the studied cultivars were both hard
although flowering time occurs earlier than in
and thin, table 3.
other fruit species.
At RSFG Constanta the present assortment has
the following cultivars and selections: Sabina, The almond cultivars studied are auto
Sandi, Cristi, Adela, April, Ana (created at incompatible; therefore it should be provided
RSFG Oradea) and Autofertil 1 Autofertil 2 pollinators cultivars for orchard.
Autofertil 3 (hybrids obtained at Studied cultivars yielding for one month,
RSFG Constanta) Teteny Record BT almond starting in early September (Preanîi) until early
1-12, Migdal RT 70-12, Migdal T.B. 12-24/61, October (Tuono).
12-25/51 Kedvenk, T.B. 12-27, Apolka 12-
33/36, Andosa, Szeget (almond cultivars and REFERENCES
selections introduced from Hungary). Cociu V., 1954. Migdalul. Ed. Agro-Silvica de Stat,
In 2012, a number of 54 genotypes were Bucuresti.
grafted in order to be introduced in germplasm Cociu V., Oprea St., 1989. Metode de cercetare în
found. ameliorarea plantelor pomicole. Ed. Dacia, Cluj-
Napoca
Table 3. Average yield of almond at Valu lui Traian, Cociu V., 2003. Culturile nucifere. Ed. Ceres, Bucuresti.
south-eastern Romania (multiannual date) Cociu V., 2007. Sa ne cunoastem si sa ne iubim pomii:
nucul, alunul, migdalul. Ed. M.A.S.T., Bucuresti,
Average Shell Kernel 2007.
Softness of
Cultivar yield weight weight Manescu Creola, Baciu Eugenia, Cosmin Silvia, 1985.
shell
kg/tree (g) (g) Controlul biologic în pomicultura. Ed. Ceres,
Preanîi 8.8 1.8 1.0 soft Bucuresti.
Mari de
3.4 3.5 1.4 hard
stepa
Teteny
3.8 2.2 1.0 soft
Botermo
Lovrin 7.0 4.6 1.2 hard
Thompson 3.0 3.1 1.0 soft
Nikitski 3.5 4.0 1.4 soft
Feraduel 5.0 5.9 1.7 hard
Ferragnes 6.7 3.5 1.4 hard
Ai 3.5 3.0 1.5 soft
Marcona 5.0 1.5 0.8 hard
Tuono 1.0 - - hard
203
THE INFLUENCE OF FERTILIZATION RECIPES UPON SEED
PRODUCTION OF MADARASENI CLIMBING BEAN VARIETY
Alexander Kurt HEITZ, Elena ‫܇‬TEFĂNESCU, Elena Liliana DUMITRA‫܇‬CU,

Minerva HEITZ
SCDL Iernut, Energeticianului street, no.1/A, 545100, Mures district, Romania
Abstract
The investigations were conducted at SCDL Iernut.. The experience has included 11 fertilization types based on
nitrogen, phosphorus and potassium (N, P2O5 and K2O), in four repetitions. The spread fertilizers was made gradually,
in three main points: 1. In autumn was applied the whole dose of P2O5 from superphosphate; 2. Before sowing, moment
in which was administered 1/2 N (nitrogen) and 1/2 K (kalium) doses; 3. During the growing season, in the
development plant stage of the climbing bean “early flowering', was applied 1/2 N (nitrogen) and 1/2 K (potassium)
doses.From the comparison of the yields productions as the average achieved over the three-year study of the
experimental variants, both toward the witness V1 as well as against the average of 11 variants revealed that the best
option was V4 (N/P2O5 /K2O -100/150/150) variant.
Key words: climbing beans, fertilization recipes, seed.
INTRODUCTION 100/150/300; in 4 repetitions, where V1-the

unfertilized variant was used as control group
Ensuring the environmental conditions specific
(Table 1, Figure 4).
to each cultivar determines the achievement of
cultivars production at the full potential. Both
temperature and humidity conditions and
cultivar specific nutrients are the main factors
in their productions (Heitz A.K., 2013).
In this paper are presented the results of
researches on the influence of some fertilizer
recipes (NPK) of Madaraseni climbing bean
variety under the environmental conditions of
SCDL Iernut.

Researches has been carried out in the period of
Figure 1. Madaraseni variety-plants
2010-2012 year on Madaraseni climbing bean
variety (Figure 1,2,3), created at SCDL Iernut.
It was used as a biological material – pre-basic
seed.
The purpose of the experiments was to force
the phonotypical expression of genetic potential
regarding the capacity of seeds production of
Madaraseni climbing bean by using the best
recipes of chemical fertilizers (NPK).
Experience has encompassed 11 variants
(N/P2O5/K2O):V1-0/0/0, V2-0/150/150, V3-
50/150/150, V4-100/150/150, V5-200/150/150,
V6-100/0/150, V7-100/75/150, V8-100/300/150,
V9-100/150/0, V10-100/150/75, V11- Figure 2. Madaraseni variety – pods and flowers
205
Method of working
Management of fertilizer was made gradually,
in three main points:
1. In fall was applied, on variants, the entire
dose of P2O5 from superphosphate;
2. At the preparation of the seedbed for
seeding, at which time was administered the
dose of 1/2 N (nitrogen) and 1/2 K (potassium);
3. During the vegetation period, in the develop-
ment phase-'starting blooming'-of the climbing
bean plant was applied the dose of 1/2 N
Figure 3. Madaraseni variety-seeds (nitrogen) and 1/2 K (potassium).
The cultivation technology
Table 1. Experimental variants Setting up experience has been carried out in
The applied fertilizer dose (kg s.a./ha)
the second decade of May, at the time when the
The variant ground was not recorded temperature decreases
N P2O5 K2O
V1 0 0 0 below the 8-10°C at the depth of sowing.
V2 0 150 150 The location of the experience
V3 50 150 150 The experience has been carried out on the
V4 100 150 150 ground with medium texture, with a neutral PH
V5 200 150 150
slightly acidic (pH 6.5-7.0). The land prepa-
V6 100 0 150
V7 100 75 150 ration began on fall through a furrow of 22-24
V8 100 300 150 cm deepness and through the fertilizers’ incor-
V9 100 150 0 poration (superphosphate) from the base fertili-
V10 100 150 75 zation. On spring, before sowing, was made the
V11 100 150 300 soil mobilization, herbicide, the application of
experimental variants, fertilizing with half from
the total dose of nitrogen and potassium on the
experimental variants. The experience was
encased after the hoeing vegetables, after the
planting scheme: 80cm between rows and 35
cm between plants/row (Figure 6).
Figure 4. Fertilization prescriptions of the experimental

variants of Madaraseni climbing bean, the average
(2010-2012) – SCDL Iernut
Figure 6. Sowing chart (scheme)
The setting of the experience-in superposed
blocks, randomized, four repetitions (Ceapoiu, Before sowing, the seed was treated with
1968) with tape on all the edges of experience Nitragin-beans.
(Figure 5). During the growing season were made 2 me-
chanical hoeing with the growers followed by
the manual hoeing on row (for three times).
Fertilization from the vegetation period was
carried out at the 'early blooming' time with the
second half of the nitrogen and potassium
Figure 5. Arranging experimental variants fertilizers.
206
During the growing season have been made Dispersional analysis (Ceapoiu N., 1968) has
phenotypically observations and biological pu- been determined by indicators relating the sum
rifications by which the untypical plants have of squared deviations for: total (SPT), rehear-
been removed, damaged by disease or pests sals (SPR), versions (SPV), error (SPE) and the
with mechanical blows from different sources. degrees of their freedom (GL) (Table 3).
Harvesting was performed in the physiological
maturity stage, gradually, on experimental Table 3. Dispersional analysis (2010-2012)
variants. Variability cause SP GL s2 Testul F
TOTAL 13,1139 43
RESULTS AND DISCUSSIONS REPETITIONS 0,05022 3
VARIANTS 12,774 10 1,277 130,64 (2.16; 2.98)
After extracting and selecting seeds manually, ERRORS 0,293 30 0,009
on variants, the quantity of produced seeds in
each variant has been weighed separately. The Because the calculated value 'F' is greater than
experimental results (Table 2, Figure 7) forthe the theoretical value of 'F' indicates that
production of seed were statistically processed. between variants exists differences significant
distinctly or very significantly, as it continues
the statistically calculation for the interpretation
of the obtained results.
Table 4. Influenԑa reԑetelor de îngrĉƔĉmintelor chimice

asupra producԑiei de sĉmânԑĉ/ha la soiul de fasole
urcĉtoare MĉdĉrĉƔeni, media pe 3 ani (2010-2012) –
SCDL Iernut Influence of chemical fertilizer recipes on
seed production/ha to the MĉdĉrĉƔeni climbing bean
variety, the average on 3 years (2010-2012) – SCDL
Iernut
Figure 7. Seeds production of the Madaraseni climbing
beans, the average on 3 years (2010-2012)-SCDL Iernut Yield % Diff. Diff.
Var. Signif Signif
(t/ha) x.med Mt (x.med) (Mt)
x.med 3,25 100 132 0 Mt 0,78 **
In comparative culture organized on variants in
V1 – Mt. 2,46 75,8 100 -0,78 00 0 Mt
four repetitions have been calculated the seed V2 2,86 88,0 116 -0,38 - 0,39 -
production/ha (Table 2) by which was V3 3,79 116 154 0,54 * 1,33 ***
established the fertilizers recipes influence on V4 4,23 130 171 0,98 *** 1,76 ***
seed production per unit area by using the V5 3,92 120 159 0,67 ** 1,45 ***
signification of statistical differences (Table V6 2,49 76,8 101 -0,75 00 0,03 -
3, 4). V7 3,18 97,9 129 -0,06 - 0,71 **
V8 3,06 94,1 124 -0,19 - 0,59 *
V9 3,13 96,3 127 -0,12 - 0,66 **
Table 2. Bean seeds’ production (t/ha) of Madaraseni
V10 3,53 108 143 0,28 - 1,06 ***
variety (2010-2012), on variants and repetitions – SCDL
V11 3,13 96,3 127 -0,12 - 0,66 **
Iernut
sd = 0,221; t5% = 2.04; t1% = 2.75; t0.1% = 3.65
Variant R1 R2 R3 R4 V mean DL 5% = 0,221 x 2.04 = 0,450
V1 2,43 2,5 2,43 2,5 9,86 2,465 DL 1% = 0,221 x 2.75 = 0,607
V2 2,7 3,06 2,83 2,86 11,45 2,8625 DL 0.1% = 0,221 x 3.65 = 0,806
V3 3,73 3,83 3,93 3,7 15,19 3,7975
V4 4,3 4,16 4,13 4,33 16,92 4,23 From the statistic analysis of the results, as
V5 3,8 3,86 3,93 4,1 15,69 3,9225 average on three years, concerning the
V6 2,6 2,46 2,53 2,4 9,99 2,4975 significance of the differences against the
V7 3,1 3,3 3,2 3,13 12,73 3,1825
V8 2,96 2,96 3,06 3,26 12,24 3,06
variants average (Table 4), have been resulting:
V9 3,06 3,2 3,06 3,2 12,52 3,13 -V4 has recorded a difference very significant,
V10 3,46 3,6 3,5 3,56 14,12 3,53 -V5 has recorded a difference distinctly
V11 3,16 3,1 3,03 3,23 12,52 3,13 significant,
-V3 has recorded a significantly difference,
207
-V5 has recorded a difference distinctly -V4 variant-100/150/150 has recorded a
significant, difference very significantly positive both from
-V1 and V6 have recorded a difference the V1-0/0/0 witness variant and from the
distinctly negative significant. average of the variants, from which results that
From the statistic analysis of the results, as V4 represents the best recipe of fertilization.
average on three years, concerning the -Increasing the dose of nitrogen is justified only
significance of the differences against the V1- up to 100 kg/ha, and the doses of phosphorus
Mt (Table 4) witness variant have resulted: and potassium are justified only up to 150
-V3,V4,V5,V10 have recorded a difference very kg/ha.
significantly positive towards V1 –Mt variant;
-xmed, V7, V9, V11 have recorded a difference REFERENCES
distinctly positive significant towards V1 –Mt
Ceapoiu N., 1968. Metode statistice aplicate în
variant; experientele agricole si biologice, Editura Agro-
-V8 has recorded a difference significantly Silvica Bucuresti.
positive towards V1 –Mt variant; Heitz A.K., 2013. Rezultate privind perfecԑionarea
-V2 and V6 have recorded a difference tehnologiei de producere a seminԑelor de fasole
insignificant positive towards the control. urcĉtoare, USAMV-Cluj Napoca, bc. doctoralĉ,
Facultatea de Horticulturĉ
CONCLUSIONS
The experimental results, as average on three
years of study, showed that:
208
DETERMINATION ON VITAMIN C IN SEVERAL OLD ROMANIAN
APPLE CULTIVARS BY HPLC DURING COLD STORAGE
Dan Petri‫܈‬or MANAFU, Dorel HOZA, Ligia ION

1
59 Marasti Blvd, 011464, Bucharest, Romania
Abstract
High pressure liquid chromatographic (HPLC) methods were used for measurement of vitamin C and organic acid
changes of forty old Romanian apple cultivars (“Prescurate”,“Gurguiate”,“Zori”,“Carla”,“Mohorat”, “Trotuse”, “Mere
Tari”,”Mar Orbai” etc.) during cold storage. Harvested apples at the last stage of commercial ripeness were placed in
perforated stored at 0°C temperature and 90-95% relative humidity for 60 days. Vitamin C content decreased in all
cultivars but no significant differences were found in the most important of them from the beginning to the end of the
storage. The highest share of total acids was contributed by citric acid. The high level of vitamin C was measured in the
cultivars” Trotuse”, “Ancuta”,”Wachsman Sammeling”and “Wachsman Amalie”. Malic acid content of cultivars also
decreased with storage time. Tartaric, oxalic and fumaric acid contents fluctuated during storage, but at the end of cold
storage these organic acids had decreased in comparison to initial values.
Key words: apple, acids, HPLC, organic ,storage, vitamin C.
INTRODUCTION Variety Office) are applied, as the brief

descriptions and number codes provide
The Apple (Malus x malus) is one of leading
sufficient information for cultivars to be
fruits which is being grown in temperate region
differentiated. They have the advantage that
of the world. Its beautiful appearance, crispy
they can be applied on an international scale
flesh, pleasant flavour and sweet taste attract
and enable the results obtained by different
the consumers and fetch high (Adisa, 1986)
research teams to be easily compared.
Of the old genotypes known to exist in the
The nutritional value of apples is mainly due to
Carpathian Basin, almost 200 local cultivars
the content of Vitamin C (Sanz et al., 1999). As
have been collected in the germoplasm
antioxidant content is becoming an increasingly
collection over the last years.
important parameter with respect to fruits and
Some of the cultivars found in the germoplasm
vegetables, it is of great interest to evaluate
collection could be use not only in breeding,
changes in the antioxidant status during fruit
but also in organic farming, so there is a great
storage (Perez and Sanz, 2001).
need for the re-evaluation of the old apple
During the postharvest period of strawberries,
cultivars. Some of the old apple varieties have
prompt cooling and providing proper
become well adapted to the soil and climatic
temperature (0°C) and relative humidity (90-
conditions of the Carpathian Basin producing
95%) are the most important factors to
good yields and highly appreciated fruit quality
preventing the undesirable quality changes
(Mitre et al., 2009)
(Kader, 1990). The concentration of organic
It is important to examine old apple cultivars
acids is an important factor influencing the
because the pomological descriptions available
organoleptic properties of fruits (Lee and
for old cultivars are not uniform. Many
Kader, 2000). Their changes during storage
collections of cultivar descriptions use several
should be reduced. Besides good sensory
names for one cultivar, or the same name for
features, consumers prefer apples because of
several cultivars. Nowadays, in most cases the
guidelines given by UPOV (Union their high content of vitamin C (Schöpplei et
Internationale pour la Protection des Obtentions al., 2002).
Végétales) or CPVO (Community Plant Vitamin C, one of the most important
nutritional quality factors in apples, has been
209
found to prevent the formation of N-nitroso Vitamin C (Ascorbic acid) and Organic Acid
compounds, the cancer causing substances Analysis
from nitrates and nitrites found in preserved The HPLC analysis was carried out to
meats and some drinking water (Du et al., determine the vitamin C and organic acids on a
2009). Vitamin C has many biological activities Shimadzu class LC VP HPLC system with
(reducing carcinogenesis and cardiovascular class LC-VP software, a pump (LC-6AD), and
diseases, stimulating the immune system) in the a UV-VIS detector (SPD-10AV VP). The
human body (Simon, 1992). columns used were YMC Pack-ODS (250 mm
There are several methods to determine vitamin x 4.6 mm I.D., 5 μm) for organic acids and
C content; however some of them need SGE (250 mm x 4.6 mm I.D., 5 μm) for
subjective evaluation and some are not vitamin C. The mobile phases were water
practical (Agar, 1995). Several postharvest adjusted to pH 2.2 with trifluoroacetic acid
factors influence the vitamin C and organic (organic acids) and to pH 3 with phosphoric
acid contents of apple. Despite many acid (vitamin C). Separation was carried out by
investigations in the area of nutrition and isocratic elution with a flow rate of 0.4 ml min-
postharvest changes of apples, knowledge 1 and column temperature was ambient. The
about the determination of vitamin C and UV detector was set at 210 nm and 254 nm,
organic acids by using HPLC is inadequate. It respectively. Quantitation was based on the
has been indicated that ascorbic acid content of peak area measurement.
fruit should be measured by HPLC because Sample (10 g) was extracted in 10 ml water
ascorbic acid produces an oxidative-reduction adjusted to pH 1.5 with trifluoroacetic acid for
reaction (Asami et al., 2003). The aim of this organic acids and with 10 ml phosphoric acid-
research was to measure the vitamin C water (2%, v/v) for vitamin C. The extracts
(ascorbic acid) and organic acid contents of 20 were filtered through filter paper. Then, 1.5 ml
old Romanian apples varieties by using High buffer (0.01 M KH2PO4, pH 8.0) was added to
Performance Liquid Chromatography (HPLC) 1.5 ml sample extract. From this, 1.5 ml
during cold storage period. (organic acids) and 1 ml (vitamin C) of these
mixtures were loaded on to C18 cartridges.
MATERIALS AND METHODS After loading, 3 ml water adjusted to pH 1.5
Forty old apples cultivars (Prescurate, with trifluoroacetic acid for organic acids and 2
Gurguiate, Viesti, Rosii Stetin, Zori, Carla, ml phosphoric acid-water
Mohorat, Gustav Durabil, Wachsman (2%, v/v) for vitamin C were passed through
Sammeling, Wachsman Amelie, Ancuta, the cartridges. For HPLC, 20 μl of the eluents
Ardelean, Trotuse,etc.) grown in the research were injected.
and application center of Horticulture
Department in Bucharest located in south of RESULTS AND DISCUSSIONS
Romania region were harvested at the last stage Generally, fruits and vegetables show a gradual
of commercial ripeness (red colour with a decrease in vitamin C content as the storage
surface area of > 75-80%). Harvested fruits in temperature or duration increases (Adisa,
the early morning were transported to the post 1986). In this research, change in vitamin C of
harvest laboratory within 30 min. Apples apples during cold storage is shown in Figure
cultivars were sorted to eliminate fruits with 1. Vitamin C levels decreased for most of
defects including overripe or too small fruit. cultivars from the beginning to the end of the
Fruits were selected randomly and placed in storage, but this reduction was not statistically
perforated (8 perforations with 10 mm diameter significant (P<0.05) in ‘Trotuse’ and ‘Ancuta’
on each box) plastic boxes (capacity: 750 g) for showed an average content of vitamin C at
each replicates. Four replicates were used per harvest of 35.32 mg/100 g and 31.42 mg/100 g,
treatment. Packaged fruits were stored at 0°C and at the end of the storage these values
temperature and 90-95% relative humidity for decreased to 14.94 mg/100 g and 13.42 mg/100
10 days. Apples fruits cultivars were analyzed g, respectively. (Figure 1) On the other hand a
at 5 days intervals (0, 5, and 10 days of storage) slight increase was found in vitamin C content
during cold storage. of apples stored in air (Perez and Sanz, 2001).
210
Likewise, vitamin C content of ‘Gurguiate, Table 1. Results concerning the vitamin C in old
Mohorat si Rosii de Stetin, Muntenesc cu coada Romanian apples varieties 0, 5, and 10 days of storage
scurta’ decreases drastically at the 15th day of Nr.
30.10.2012 04.11.2012 09.11.2012
storage in comparison to initial value (Figure Cultivar Mg/100 Mg/100 Mg/100
Crt.
g.p.p. g.p.p. g.p.p.
2). This can be due to continuous ripening 1. Prescurate 18.59 10.11 5.59
process of fruits. 2. Gurguiate 14.52 6.51 2.04
3. Red Free 12.45 8.24 3.45
Malus
4. 10.04 6.22 3.04
Floribunda
5. Viesti 16.54 8.45 4.52
6. Rosii de Stetin 12.82 4.22 2.82
7. Zori 18.86 9.15 4.86
8. Carla 19.15 8.98 4.17
9. Mohorat 12.49 7.52 2.79
10. Gustav Durabil 14.57 9.36 4.69
Figure 1. Vitamin C of old apples cultivars during cold Wachsman
storage. 11. 24.34 16.3 8.34
Sammeling
Wachsman
12. 28.55 19.51 10.55
Amalie
13. Ancuta 31.42 25.61 13.42
14. Ardelean 17.98 8.96 4.43
15. Trotuse 35.32 25.36 14.94
Rosii de
16. 25.86 13.51 4.86
Geoagiu
17. Knis 12.91 9.36 3.91
Nobile de
18. 21.78 12.36 5.78
Geoagiu
Figure 2. Vitamin C content of varieties ‘Gurguiate, Favoritul lui
19. 12.87 8.89 3.87
Mohorat si Rosii de Stetin, Muntenesc cu coada scurta’ Polocsay
20. Mere tari 14.73 8.52 4.73
21. Malus Teifera 15.28 7.69 5.28
22. Pokomache 15.01 8.61 5.01
23. Satmaresti 16.50 9.63 5.50
24. Cormose 18.83 12.31 4.83
25. Calugaresc 16.96 12.36 5.26
26. Anisovska 15.93 8.96 3.93
27. Marut alb 14.36 8.21 4.36
28. Seghese 15.12 9.65 5.12
29. Poinic 19.91 14.31 5.91
Figure 3. Vitamin C content of varieties ‘Gurguiate’ and Mar
30. 15.23 9.63 4.23
‘Trotuse’ at the end of stor¬age. Muntenesc
31. Smeurii 12.27 7.25 3.27
Vitamin C is quite unstable and thus it is also Muntenesc cu
32. 12.73 6.94 2.73
coada scurta
an indication of fruit freshness (Holcroft and
Rosior
Kader, 1999). Vitamin C content of ‘Gurguiate’ 33.
calugaresc
15.68 8.51 3.68
was lower than ‘Trotuse’ at the end of storage Rosior
34. 19.32 12.35 5.32
(Figure 3). It can be concluded that the change romanesc
in vitamin C content is cultivar dependent. 35. Mar Orbai 18.49 13.21 6.67
Verzi de
Therefore, this characteristic of cultivars should 36. 18.57 11.11 4.57
Radaseni
be taken into consideration in choosing a 37. Fara nume 24.42 21.32 9.42
cultivar for storage. The cultivars which lose Dulci de
38. 22.50 16.63 10.50
less vitamin C during storage could be Radaseni
preferred. 39. Cernenko 19.65 12.67 4.76
40. Rosu de Cluj 23.11 19.20 13.11
211
CONCLUSIONS practices. Journal of Agricultural and Food
Chemistry 51, p. 1237-1241.
The accurate analysis of vitamin C and organic Asif Ali M., Raza H., Azam M., Khan and Manzoor H.,
acids of apples by HPLC enables us to observe 2004. Effect of different periods of ambient storage
the quality changes during postharvest period. on chemical composition of apple fruit. Int. J. Agri.
Biol. 6 (2), p. 568-571.
Vitamin C and organic acid content of the Du G., Li M., Ma F. and Liang D., 2009. Antioxidant
majority of cultivars changed as a function of capacity and the relationship with polyphenol and
storage time. Both cultivars had lost vitamin C vitamin C in Actinidia fruits. Food Chemistry 113, p.
contents at the end of the storage, but ‘Trotuse’ 557-562.
showed a greater decrease than ‘Gurguiate’. Holcroft D.M. and Kader A.A., 1999. Controlled
atmosphere-induced changes in pH and organic acid
These results showed that changes in vitamin C metabolism may affect color of stored strawberry
contents of apples are cultivar dependent. On fruit. Postharvest Biology and Technology 17, p. 19-
the other hand, the consumer should take into 32.
Kader A.A., 1990. Quality and its maintenance in
consideration that the loss of vitamin C relation to postharvest physiology of strawberry, The
increases with storage time. During storage, the strawberry into the 21st century, proceeding of the
highest share of total acids was exhibited by third north American strawberry conference,
citric acid. This acid decreased by 10 days of Houston, Texas, p.145-152.
cold storage in comparison to initial values. Lee S.K. and Kader A.A, 2000. Preharvest and
postharvest factors influencing vitamin C content of
In future investigations, we propose that the horticultural crops. Postharvest Biology and
objective analytical determination of these Technology 20, p. 207-220.
critical components should be coupled with Mitre I, Mitre V, Ardelean M, Sestras R, Sestras
A, 2009. Evaluation of old apple cultivars grown in
subjective evaluation by a taste panel to central Transylvania, Romania. Not Bot Horti
provide useful and meaningful information Agrobo 37 (1), p. 235-237.
about quality changes of apples during the Pelayo C., Ebeler S.E., Kader A.A., 2003. Postharvest
storage. life and flavor quality of three strawberry cultivars
kept at 5°C in air or air + 20 kPa CO2. Postharvest
REFERENCES Biology and Technology 27 (2), p. 171-183.
Perez A.G., Sanz C., 2001. Effect ofhigh-oxygen and
Adisa V. A., 1986. The influence of molds and some high-carbon-dioxide atmospheres on strawberry
storage factors on the ascorbic acid content of orange flavor and other quality traits. Journal of Agricultural
and pineapple fruits. Food Chemistry 22, p. 139-146. and Food Chemistry 49, p. 2370-2375.
Agar T., 1995. A sensitive method to determination of L- Sanz C., Perez A.G., Olias R., Olias J.M., 1999. Quality
Ascorbic asid, dehydroascorbicasid and total vitamin of strawberries packed with perforated
C:microfluorometric method (in Turkish). Cukurova polypropylene. Journal of Food Science 64 (4), p.
University Journal of the Faculty of Agriculture 9 (1), 748-752.
p. 11-20. Schöpplein E., Krüger E., Rechner A., Hoberg E., 2002.
Asami D.K., Hong Y.J., Barrett D.M. and Mitchell A.E., Analytical and sensory qualities of strawberry
2003. Comparison of the total phenolic and ascorbic cultivars. Acta Horticulture 567, p. 805-808.
acid content of freeze-dried and air-dried Simon J.A., 1992. Vitamin C and cardiovascular disease.
marionberry, strawberry, and corn grown using Journal of the American College of Nutrition 11, p.
conventional, organic, and sustainable agricultural 107-125.
212
INFLUENCE OF WINTER FROSTS ON SOME PEACH CULTIVARS

OF DOBROGEA
Cristina MOALE
Research Station for Fruit Growing Constanta, No.1, Pepinierei Street, 907300,
Commune Valu lui Traian, district Constanta, Romania
Abstract
This heat-loving species always found good conditions for growth and fructification in the south-eastern part of
Romania, and especially in Dobrogea. Climate accidents are increasingly studied in fruit trees in recent years under
global climate change. The limitative factor of the peach production in this area is represented by temperature
oscillations during winter, i.e. relatively high values followed by low temperatures, which may compromise the fruit
yield in certain years (2010; 2011; 2012). At the Research Station for Fruit Growing Constanta, a total of 6 cultivars of
peach (Springcrest, Springold, Collins, Cardinal, Redhaven, Southland) with different maturation periods were studied.
This paper presents the manner in which the peach tree species replied to winter frosts in the climatic conditions
recorded in the winters of 2010, 2011 and 2012. The obtained results demonstrate the importance of choosing the
proper assortment of peach cultivars for the region.
Key words: Prunus persica, late frosts, Cardinal, Redhaven, Southland, loses.
INTRODUCTION damage caused by late frosts (Anconelli et al.,

2004; Sunley et al., 2006; Legave J.M. and
Peach fruit tree is the third species after apple
Clauzel G., 2006; Legave J.M. et al., 2008;
and plum trees in our country and is grown in
Chitu E. et al., 2004 and 2008) or by the
warmer areas with average annual temperature
disorders in the pollination and fruit setting
of 10 to 11.5°C, with deep porous soil, pH
processes (Zavalloni C. et al., 2006).The
between 5.7 and 7.5 and active limestone
purpose of this paper is to highlight the
content not exceeding 7% g/g when using franc
influence of winter frosts on some cultivars of
rootstock, and 15% when the rootstock is
peach production of Dobrogea in the lest three
almond (Stanica F. and Braniste N., 2011).
years.
Due to climate change in recent years it has
been found that the resistance of peach
cultivars is very different from one year to
another. The observations and determinations were
The Black Sea Coast is situated in the area with carried out in the plots cultivated with some of
the largest annual average sums of day length the nectarine tree cultivars 3 to 5 days after the
on the country’s territory, sums which exdeeds climatic accidents recorded in the years 2010,
2250-2300 hours (Paltineanu Cr. et al., 2000). 2011 and 2012. The plots are situated in the
Previous research papers hay revealed that the experimental base within the Research Station
impact of climatic changes upon fruit-growing for Fruit Growing (R.S.F.G. Constanta), Valu
species can already be felt. For instance, by the lui Traian. The degree of differentiation of the
end of the 1990s, the flowering of the trees in flowering buds was relatively good. Samples of
Germany was occurring several days earlier branches were collected and analysed, these
(Chmielewschi F.M. et al., 2004 and 2005). belonging to 6 peach tree cultivars: Springold,
The vegetative season in Europe became longer Springcrest, Cardinal, Collins, Redhaven and
by 10 days in the past 10 years (Chmielewschi Southland, which were planted in 1986. The
F.M. and Rotzer T., 2002). Due to the early stock parent that was used was the franc peach
flowering of the trees, in certain regions of tree with a density of 625 trees/ha (4m x 4m
Europe there was an increase in the risk of
213
planting scheme). The chosen shape of the in temperature in the month of February caused
canopy was the free palmette. the loss of some flowering bud, in early
The soil is a calcareous chernozem, with a cultivars such as Springold (61%), Springcrest
loamy texture and a low alkaline pH (8.2) on its (59%) and Cardinal (39%).
entire profile. On average, the climatic
conditions were also favourable to the growth
and fructification of the trees, with the
exception of the years 2010, 2011 and 2012,
when a strong frost occurred in January and
February, causing the loss of several flowering
buds. The climatic data were recorded with the
aid of an automatic meteorological station, type
WatchDog, and were processed as diurnal
averages.
It was found that the resistance is very different
peach cultivars from year to year due to climate
change in recent years and the magnitude of
climatic accidents.Determinations were carried
out in order to assess the losses of flowering
buds due to temperature variations during
winter and the low diurnal temperatures.

Although the south-eastern part of Romania has
been considered to be favourable to the culture
of peach tree, this suffered because of the
climatic variations, mainly the aggressiveness
of the low temperatures in alternation with the
maximum positive values. The peach tree
recorded losses because of these variations
which occurred during the dormancy period in Figure 1. Aspects of the winters of 2010, 2011 and 2012
the climatic conditions of 2010, 2011 and with the frost on the branches
2012.It was noticed that the resistance of peach
tree cultivars differs from one year to another In the October 2010-March 2011 period, the
because of the climatic changes occurred in the lowest temperature was recorded in January:-
past years. Other factors are: the alternation 12°C. The lowest temperature recorded during
between minimum and maximum temperatures this period affected Springold cultivars in 40%
during winter, which reduces the trees’ and Spingcrest with 38%.
resistance and last but not least, the severity of As can be observed in Figure2c, January was
the climatic accidents (Figure 1). the coldest month, with 9 days displaying
Figure 2 reveals the fact that the coldest month average diurnal values ranging between-10.2°C
in the period October 2009 – March 2010 was and-17.6°C. These values, together with the
January 2010, when, for 10 consecutive days, extreme amplitudes in February (7 days with
the values recorded ranged between-10.1°C average diurnal values ranging from-10.4°C to-
(January 29th) and-17.7°C (January 24th and 16.4°C) and 8 consecutive days of glazed frost
25th). Moreover, in the same period, the and ice on branches caused the loss of 31%-
temperatures in the valleys dropped bellow- 63% of the flowering buds of all the studied
18°C, up to-20°C (local observations). These cultivars.
values, together with the big diurnal differences
214
Figure 2. Air temperature (°C) in the cold periods: October 2009 – March 2010 (a), October 2010 – March 2011 (b),
October 2011 – March 20120 (c) at Valu lui Traian, Constanta
Thus, the losses for the Springold cultivar were 2010, 29% in 2011 and 66% in 2012, whereas
of approximately 61% in 2010, 39% in 2011 for the Collins cultivar, the values were 37% in
and 89% in 2012, there being differences 2010, 21% in 2011 and 54% in 2012. For the
between cultivars. The losses caused by frost Redhaven cultivar the values were the
for the Springcrest cultivar were of 59% in following: 32% in 2010, 23% in 2011 and 62%
2010, 37% in 2011 and 84% in 2012. For the in 2012. Finally, for the Southland cultivar, the
Cardinal cultivar the losses were of 39% in
215
losses represented 29% in 2010, 16% in 2011
and 48% in 2012 (Figure 3).
Figure 3. Procentage of peach tree flowering buds

perished due to frosts during the winter of 2010, 2011
and 2012 at Valu lui Traian, Constanԑa
Under these conditions, the Springold and

Springcrest cultivars were destroyed at a level
of magnitude over 60%, the Cardinal cultivar –
45%, the Redhaven cultivar, which was less
afftected, was destroyed at a level of 39%,
while the Collins and Southland cultivars were
affected with 37% and 31%, respectively
(Figure 3). The climatic accidents recorded in Figure 5. Aspects of the winter of 2012 with glazed frost
the months of January and February 2010 and on the branches
2012, when the temperature suddenly dropped
to-17°C (minimum diurnal temperature in
2010) and-16.4°C + 8 days of hoarfrost in 2012
affected the peach production for the early CONCLUSIONS
cultivars Springold, Springcrest and Cardinal The fruit production of the peach tree species
and partially for the Redhaven, Collins and was affected in variable percentages according
Southland cultivars (Figure 4 and 5). to the cultivar, following the climatic accidents
recorded in the winters of 2010, 2011 and
2012.
The novelty of the results is the fact that the
frosts in the winters of 2010, 2011 and 2012
affected the peach tree species according to the
cultivar (approximately 31-63%).
The flowering buds losses were over 60% in
Springold and Springcrest cultivars: however
these cultivars were also planted in the lowest
altitude locations.
The smallest losses in the three studied years
(2010, 2011 and 2012) were recorded the
Southland cultivar.
Figure 4. Procentage of peach tree flowering buds
There was an increasing trend in frost damages
erished because of frosts (average over the three years),
Valu lui Traian for the last three years.
216
REFERENCES vegetation in Saxony (Germany). Int. J. Biometeorol,
50, p. 96-104.
Anconelli S., Antolini G., Facini O., Giorgiadis T., Legave J.M. and Clazel G., 2006. Long-term evolution
Merletto V., Nardino M., Palara U., Pasquali A., of flowering time in apricot cultivars grown in
Pratizzoli W., Reggitori G., Rossi F., Sellini A., southern France: wich future imtacts of global
Linoni F, 2004. Previsione e difesa dalle gelate warmings Acta Horticulturae, 714, p. 47-50.
tardive – Risultati finali del progetto DISGELO. Legave J.M., Farrera I., Almeras T., Calleja, M., 2008.
CRPV Diegaro di Cesena (FO). Natiziario tecnico Selecting models of apple flowering time and
N.70, ISSN 1125-7342, p. 64. understading how global warming has had an impact
Chitu E., Butac M., Ancu S. and Chitu V., 2004. Effects on this trait. Journal of Horticultural Science &
of low temperatures in 2004 on the buds viability of Biotechnology, 83, p. 76-84.
some fruit species grown in Maracineni area. Annals Paltineanu Cr., Mihailescu I.F., Seceleanu I., 2000.
of the University of Craiova. Vol. IX (XLV), ISSN Dobrogea, conditiile pedoclimatice, consumul si
1435-1275, p. 115-122. necesarul apei de irigatie ale principalele culturi
Chitu E., Sumedrea D., Paltineanu C., 2008. agricole. Editura Ex Ponto, Constanta, p. 258.
Phenological and climatic simulation of late frost Stanica F., Braniste N., 2011. Ghid pentru
damage in plum orchard under the conditions of pomicultori Editura Ceres, Bucuresti 2011 ISBN
climate changes foreseen for Romania. Acta 976-973-40-0859-9 p. 93-104
Horticulturae (ISHS) 803, p. 139-146. Sunley R.J., Atkinson C.J., Jones, H.G., 2006. Chill unit
Chmielewski F.M., Rotzer T, 2002. Annual and spatial models and recent changes in the occurrence of
variability of the begenning of growing season in winter chill and soring frost in the United Kingdom.
Europe in relation to air temperature changes. Clim. Jurnal of Horticulturae. Science & Biotechnology,
Res. 19 (1), p. 257-264. 81, p. 949-958.
Chmielewski F.M., Muller A., Bruns E., 2004. Climate Zavalloni C., Andersen J.A., Flore J.A., Black
changes and trends in phenology of fruit trees and J.R., Beedy T.L., 2006. The pileus project: climate
field crop in Germany, 1961-2000, Agricultural and impacts on sour cherry production in the great lakes
Forest Meteorology 121 (1-2), p. 69-78. region in past and projected future time frames. Acta
Chmielewski F.M., Muller A., Kuchler W., 2005. Horticulturae, 707, p. 101-108.
Possible impacts of climate change on natural
217
INFLUENCE OF FUNGICIDES AND ANTAGONISTIC YEAST PRODUCT
ON POSTHARVEST STRAWBERRIES QUALITY
Cristina PETRI‫܇‬OR1, Gheorghe CÂMPEANU2, Elena DELIAN2

1
Research Station for Fruit Tree Growing Baneasa, 4 Ion Ionescu de la Brad Blvd.,
District 1, Bucharest, Romania
2
59 Marasti Blvd., District 1, Bucharest, Romania
Abstract
Decay of fruits after harvest often causes loss as a great 30-40% of harvest crop. Much of this is due to rot
microorganisms which are currently controlled by fungicides and antagonistic yeast treatments but they may have
potential toxicity on human health and the environment. Biological control of postharvest diseases presents an
alternative and attractive option. Therefore the aim of this study was to evaluate effects of preharvest application of
fungicide treatments on decay and quality of strawberry fruit and during storage. Strawberry fruits were analysed in
all experimental variants for quality parameters (dry matter, titratable acidity, soluble solids, ascorbic acid content,
anthocyanins) at harvest and after cold storage. The results obtained indicates that preharvest application
of antifungic treatments maintaing quality of strawberry postharvest and during storage and reduce the appearance of
gray mold. Vitamin C and soluble solids slightly decreased after cold storage period for both control and treatments
variants. Also, preharvest treatment does not affected the total anthocyanins content in fruit at harvest and during cold
storage.
Key words: biologic control, Botrytis cinerea, decay, fruit quality.
INTRODUCTION large volumes. Due to high moisture, sugars

and acids content, these fruits are high
Strawberries are known as a highly perishable
perishable, being an ideal substrate for the
fruit and susceptible to mechanical injury,
proliferation of microorganisms, such as fungus
physiological deterioration and microbial
of the generous: Botrytiscinerea and Rhizopus
decay, but very appreciated by the consumers
stolonifer.
(Costa et al., 2011). However, a
Among the main problems associated with the
considerable amount of strawberry fruit is lost quality of strawberry, we can distinguished the
during fruit growth and after harvest because grey mold (Botrytis cinerea) a common type of
decay.
rottenness that attacks the fruit during any of its
The flavour is one of the most important
developing stage, and is the main disease
properties that gives commercial value to the
during ripening time. (Sesan, 2006; Wszelaki
fruits in generally. Strawberry flavor is
and Mitcham, 2003).
conditionated in part by the balance between
Due to the high affinity to rotting, researches
sugars and acids expressed in ripe fruit. It is
are being conducted to find a method of
very important to know the best stage at which
conserving the fruit for a longer period by the
we can harvest the fruits. Attempts have been
use different methods in order to make its
made to assess the stage of ripeness of
transport to farther markets viable.
strawberry fruits in terms of titratable acidity or
Promising results have been achieved using
sugar/acid ratio.
antagonistic microorganisms to effectively
The high perishability of strawberry is the
inhibit postharvest pathogens of
reason for its relatively short period of harvest
compels the producer to sell the fruits different harvested commodities (Abano and
immediately, evidently prejudicing him with Sam-Amoah, 2012; Zhao et al, 2011;
respect to the reduced price due to its sale in Xianghong and Shiping, 2009; Grabenisan et
al., 2007; Janisiewicz and Korsten, 2002).
219
Taking into the account these and the fact that weight in a oven at 105°C, the results were
fruits are eaten especially by the children and expressed in percentage
by the people with health problems, the - soluble solids content (SSC) was determined
researchers are concerned to find storage by measuring refractive index of strawberry
methods without chemicals like synthetic juice using an Abbe refractometer with
fungicides (De Souza et al.,1999; Sanz et al., temperature correction, and the results were
1999). The cold storage atmosphere prevents expressed as °Brix
decay development by retarding pathogenic - titratable acidity (TA) content was measured
microorganisms growth and reducing pathogen by titration of fruit juice with solution 0.1 N
enzyme activity (Menel et al., 2012). NaOH until reaching an endpoint of pH 8.1
The use of synthetic fungicides render severe and expressed as a percentages of citric acid
side effects affecting the environment and -the ratio between the soluble solids content
human health. The usage of antagonistic yeast and the titratable acidity, which reflects the
product against postharvest pathogens offers a fruit taste feature, was derived.
viable option with hopeful results. - ascorbic acid content was
The potential use of Saccharomyces cerevisiae spectrophotometrically determined using the
yeast was studied and emphasize by some
2,6-dichlorophenol-indophenol method and the
authors for corn and sorghum species (Piccinin
results were expressed as mg /100 g FW
et al., 2005; Roncatto and Pascholati, 1998).
- total anthocyanins content was determinated
Until now, in literature there are very few
using the pH diferential method (Giusti and
information about the effects of S. cerevisiae
Wrolstad, 2001). The pigment content was
yeast on disease and maintaining quality calculated and expressed as pelargonidin-3-
postharvest of strawberry (Gouvea et al., 2009). glucoside/100 g FW, the most abundant
Therefore, the objective of this study is to anthocyanin in the strawberry fruit.
evaluate the combined effect of antagonistic - the presence of Botrytis cinerea was visually
yeast (based on S.cerevisiae), synthetic
evaluated during the experiment, expressed as
fungicides and cold storage to prevent decay
a percentage of fruit showing decay symptoms.
development and extend the shelf life of
strawberry.
MATERIALS AND METHODS Strawberry fruits were analyzed in all
experimental variants for quality parameters at
Strawberry cultivars studied were Favette,
harvest and after 6 days of cold storage (4-
Cardinal, Pandora, Hood. For all cultivars were
5ºC) in the aim to evaluate influence of
applied three plant treatments prior to
antifungic treatments on fruit quality
harvest, in different stages: at full bloom, fruit
evolution.
onset and preripening of fruit in three
experimental variants: The dry matter content remained practically
V1-control-plants was sprayed with distilled constant at Favette and Pandora cultivars at
water harvest for all 3 variants (table 1). However we
V2-plants was sprayed with Topsin solution can observe an increase of dry matter for V2
V3-plants was sprayed with antagonistic yeast and V1
product (suspension of Saccharomyces variants at Cardinal and Hood at harvest. After
cerevisiae) storage dry matter increased slightly in case all
Samples were taken from 15 fruit at harvest variants studied for all four cultivars (table 2).
and after 6 days during cold storage (4º-5ºC). The fruits treated with antagonistic yeast (V3)
There were three replication for the assays in had higher levels of the SSC to control for all
each treatment, and the experiment was cultivars studied at harvest stage. These results
repeated in two seasons. Fruits quality are in accordance with dates obtained by
attributes was analyzed by specific methods: Gouvea et al., 2009. Strawberry fruit SSC
- dry matter was measured by drying some decreased slightly after 6 days of cold
known amount of fresh fruit to a constant storage for all three variants studied. Similar
220
results were obtained by Costa et al., 2011 and of Botrytis cinerea compared to other, after 6
Almenar et al., 2007. This parameter is of days of storage.
commercial interest, especially for fresh fruit, The quantity of decayed fruit increases with
because the consumer prefer sweeter fruit. storage time but is decrease in variants treated
Little differences in TA content were also with fungicides and antagonistic yeast (table 2).
observed among treated strawberry and control In our study the presence of Botrytis
at harvest (table 1) Strawberry presented an cinerea was observed in great percent at
increase in acidity during storage as seen in untreated sample especially after 6 days of cold
table 2. These results are in agreement with storage. These results are in agreement with
studies of De Souza et al., 1999; Sanz et al., observations of Costa et al., 2011 and Menel et
1999. al., 2012. Thus it can be concluded that as both
The SSC/TA ratio decreased after 6 days treatments with fungicides and antagonistics
of cold storage ranging from 16.62 to 8.54 yeast support resistance to infections and thus
(table 2) with values above the commercial increase shelf –life of cultivars.
required (8.00) characterized by equilibrate According to the results obtained by us, an
taste. essential role in maintaining the quality of
Sugars and acids are utilized as the main fruits and disease resistance postharvest it has
substrates of respiratory metabolism, causing the antioxidant capacity of cultivars expressed
corresponding changes in SS, TA and pH their increased content in anthocyanins,
during storage. The differences in TA and SSC ascorbic acid, polyphenols. Spraying with
results among different experiments may be fungic treatments were effective in inhibiting
related to different respiratory rates of strawberry fruit decay especially at harvest.
cultivars. Thus as higher SSC degradation is Mold development on the fruits were also
related to great respiratory rate and to higher reduced by cold storage and treatments with
fruit decay. yeast.
At harvest there are no differences between the
anthocyanins content of varieties treated with CONCLUSIONS
fungicides or yeast product and the untreated
The results showed that efficacy of
varieties (table 1). The content of anthocyanins
yeast product in inhibiting gray mold decay
varies according to the cultivar. Such as Hood
and maintaining the quality of fruit during
cultivar have a content higher compared to
storage. Evolution of quality parameters
Favette and Cardinal and closed to
postharvest and after cold storage was
Pandora These results are in agreement with dependent on cultivar.
results of Costa et al., 2011 and Zheng et al.,
2007. An essential role in maintaining the quality of
After 6 days of storage the total anthocyanins strawberries and disease resistance
content increase slightly. There are no postharvest it has the antioxidant capacity of
differences between cultivars treatments and cultivars.
untreatment after storage. Therefore a combination of yeast product
The strawberry are fruits with medium ascorbic treatment with resistant cultivar provides a
acid content and all cultivars studied presents great new potential in preventing and
an average content of 65 mg/100 g fresh controlling major diseases.
weight and varied with cultivar at harvest. The results suggest that application
After 6 days of cold storage ascorbic acids of antagonistic yeast product before
content decrease for all cultivars studied and harvest may be a promising technology to
there are no differences between control and
maintain quality of strawberry postharvest and
treatment fruit (table 2).
during cold storage.
It can be seen that the cultivars with high
content of anthocyanins at the same time have a REFERENCES
high concentration of ascorbic acid. These
cultivars have also had a low percentage Abano E.E., Sam-Amoah L.K., 2012. Application of
antagonistics microorganisms for the control of
221
postharvest decays in fruits and vegetables. Int. J. Montero T., Molla E., Esteban R., Lopez-Andreu F.,
Adv. Biol.Res., 21 (1), p. 1-8. 1996. Quality attributes of strawberry during
Almenar E., Del-Valle V., Hernandez Munoz P., ripening. Sci. Horticulturae., 65, p. 239-250.
Lagaron J.M., Catala R., Gavaro R., 2007 Equilibrum Piccinin E., Di Pierdo R.M., Pascholati S.F., 2005. Efeito
MAP of wild strawberries. J.Sci. Food Agric., 87, p. de S.cerevisiae na produtividade de sorgo e na
1931-1939. severidade de doencas foliares no campo.
Costa F.B., Duarte P.S., Puschmann R., Finger F.L., Fitopatologia Brasileira, 30, p. 5-9.
2011. Quality of fresh cut strawberry. Hortic.Bras., Roncatto M.C., Pascholati S.F, 1998. Alteracoes na
29, p. 477-484. atividade e no perfil electroforetico da peroxidase em
De Souza A., Scalon S., Chitarra M., Chitarra A., 1999. folhas de milho e sorgo tratades com levedura
Post-harvest application of CaCl2 in strawberry S.cerevisiae. Sci.Agricola, 55, p. 395-402.
fruits: evaluation of fruit quality and post-harvest Sanz C., Perez A., Olias R. Olias J. 1999. Quality of
life. Cienc. E Agrotec. Lavras, 23 (4), p. 841-848. strawberries packed with perforated polypropylene..J.
Giusti M.M; Wrolstad R.E., 2001. Unit F 1.2: Food Sci., 64, p. 748-752.
Characterization and measurement of anthocyanins Sesan T.E. 2006. Integrated control of strawberry
by UV–VIS spectroscopy. In Wrolstad, R. E., (Eds), diseases. Phytopatol. Pol., 39, p. 133-148.
Current Protocols in Food Analytical Chemestry; Wszelaki A., Mitcham E., 2003. Effect of combinations
John Wiley & Sons: New York, F1.2.1 – F1.2.13. of hot water dips, biological control and controlled
Goueva A., Kuhn O.J., Mazaro S.M., Mio L.L.M., atmospheres for control of gray mold on harvested
Deschamps C., Biasi L.A., Fonseca V.C., 2009. strawberries. Postharvest Biol. and Technol., 27, p.
Control of leaf and flower diseases and postharvest 255-264.
quality of strawberry plants treated with S.cerevisiae. Xianghong M., Shiping T., 2009. Effects of preharvest
Hortic. Bras. 27 (4), p. 527-533. application of antagonistic yeast combined with
Grebenisan I., Cornea P., Mateescu R., Cimpeanu C., chitosan on decay and quality of harvest table grape
Olteanu V., Campeanu G., Stefan L.A., Oancea F., fruit. J. Sci. Food Agric., 89 (11), p. 1931-1939.
Lupu C., 2007. Metschnikowia Pulcherrima a new Zheng Y., Wang S.Y., Wang C.Y., Zheng W., 2007.
yeast with potential for biocontrol of postharvest Changes in strawberry phenolics, anthocyanins and
fruit rots. Acta Hort.767, p. 355-360. antioxidant capacity in response to high oxygen
Janisiewicz W.J., Korsten L., 2002. Biological control of treatment. Leb. Technol., 40, p. 49-57.
postharvest diseases of fruits. Ann. Rev. Zhao Y., Wang R., Tu K., Liu K., 2011. Efficacity of
Phytopathol., 40, p. 411-441. preharvest spraying with Pichia guilliermondii on
Menel K., Faten K., Moktar H., 2012. Combining postharvest decay and quality of cherry tomato fruit
biocontrol agent and high oxygen atmosphere to during storage. Afr. J. Biotechnol., 10 (47), p. 9613-
reduce postharvest decay of strawberries. Afr. J. 9622.
Microbiol. Res., 6 (24), p. 5179-5187.
222
BEHAVIOUR OF SOME NEW VARIETIES OF TABLE GRAPES
IN THE FIRST THREE YEARS AFTER PLANTING ON IMPROVED
SANDY SOILS FROM SOUTHERN OLTENIA
Iulian RĂ‫܉‬OI1, Mihaela CROITORU1, Emanuela Cristina VLADU2

1
Research–Development Centre for Agricultural Plants on Sands–Dĉbuleni, Street Victoriei, 130,
Code 207220, Dĉbuleni, Romania
2
Faculty of Agriculture and Horticulture, Str. Libertĉԑii, nr. 19, Craiova, Romania
Abstract
The study was effectuated out on a number of 12 varieties of autochthonous and foreign origin. The experience was
founded in the year 2010. Climatic conditions were favorable for cultivation of vines in year I and II and less
favourable in the third year after planting, when they recorded, in winter, the minimum negative temperatures (-27 °C),
well below the limit of resistance of the vine and in the summer very high temperatures associated with drought
rendered and sunstroke. After planting all vines were entered in vegetation. At the end of vegetation period the
percentage of normally developed vines was between 75 and 100. In year II continued the process of planting in places
empty. In the year III (2012) have obtained the grapes on the buds situated at base of vines because the buds situated
above the snow (about 35-40 cm thick) were perished all buds. With all these difficulties were emphasized a few
varieties from the point of view of precocious and from the point of view of the potential to make on the short elements
(2-3 eyes). From the point of view of precocious has noted the Prima Cl. 1022, that reached maturity of consumption at
15.07.2012. Transilvania and the Prima Cl. 1022 varieties, were highlighted, and in terms of the production of grapes,
which means they have the potential to make on the short elements. The Prima Cl. 1022 achieved 9998 Kg/ha yield
and Transilvania achived 10073 Kg/ha yield.
Key words: range, sandy soils, table grapes, vine.

Viticulture is an important branch of culture in The study was effectuated out on a number of
our country. Culture of table grape varieties is 12 varieties of autochthonous and foreign
the second production direction for harvesters origin. The experience was founded in the year
in the areas with higher heat as sandy soils 2010. The climatical conditions were favorable
from Southern and South-Western Oltenia. for cultivation of vines in year I and II and less
Vine varieties with table grapes are appropriate favourable in the third year after planting, when
conditions of culture in our country (Martin T. they recorded, in winter, the minimum negative
et al., 1974). temperatures (-27 oC), well below the limit of
In order to establish the different types of table resistance of the vine and in the summer very
grape varieties have carried out studies on their high temperatures associated with drought and
behaviour in different areas (Baniԑĉ P., sunstroke.
Vlĉdoianu Em., 1979; Costescu Adriana et al., The studied varieties were the following:
2012; Dumitru I. et al., 2009; Rotaru L., 2005; Silvania, Timpuriu de Cluj, Muscat de
Mohammad A, Popa A., 2005). Hamburg Cl. 4 Pt., Tamina, SomeƔan,
After an assortment of table grape varieties is Splendid, Napoca, Victoria, Prima Cl. 1022,
continuous improvement a priority of this Coarnĉ neagrĉ selecԕionatĉ, Muscat de
process (Cichi D, Costea D.C., 2008; Popa C. Hamburg Cl. 202, Transilvania. Were planted
et al., 2008; Popa C. et al., 2009; Stroe M.V. et 20-40 vines from each variety. The
al., 2012). fertilization, at land preparation, made with 60
t/ha manure, 300 kg/ha Complex 15 15 15. At
planting were applied 5 Kg/pit
223
manure semifermentated. In vegetative period, - number of shoots with thickness exceeding 6
in may month, was applied 100 kg/ha Complex mm at the second internode;
15 15 15. To combat pests and diseases, we - grapes production in III year after planting.
maked a total of 11 chemical treatments, 3 with The climatical conditions were favourable in I
Ridomil plus 48,5 WP – 0.3% + Sulfomat and II years (2010 and 2011 years) after
80PU - 0.5%, 3 with Shavit F 72 WDG - 0.2%, planting and less favourable in III year (2012
3 with Champ 77 WG 0.3% + Sulfomat 80PU year). In 2012 year perished all buds located
- 0.5% and 2 with Dithane M45- above the layer of snow, which have 35-40 cm
0.2%+Sulfomat 80PU -0.5%. thick. Although all vines entered in vegetation
Were effectuated the following experimental after planting but not all have developed
observations and measurements: normally in the first year (Table 1). At the
- entrance in vegetation; Transilvaniavariety, all planted vines have
- planting rate of striking root; developed normally. In others, losses were
- the number of eyes formed on the vine during between 1 and 9 vines, respectively 2.5% at the
the year; varieties Coarnĉ neagrĉ selecԕionatĉ and
- annual increases total length; Muscat Hamburg Cl. 202 and 25% at the
variety Someƕan.
Table 1. Percentage of vines developed normally at the end of vegetation table grape varieties in first year after planting
Remaining vines Number of vines sickly or feeble
Variety Number of planting vines
nr. % nr. %
Silvania 40 33 82.5 7 17.5
Timpuriu de Cluj 20 18 90 2 10
Muscat de Hamburg Cl. 4 Pt. 40 36 90 4 10
Tamina 20 19 95 1 5
SomeƔan 20 15 75 5 25
Splendid 40 37 92.5 3 7.5
Napoca 20 17 85 3 15
Victoria 40 31 77.5 9 22.5
Prima Cl. 1022 40 31 77.5 9 22.5
Coarnĉ neagrĉ selecԑionatĉ 40 39 97.5 1 2.5
Muscat de Hamburg Cl. 202 40 39 97.5 1 2.5
Transilvania 40 40 100 - -
The vigour of vines is shown by the length of

the annual total number of nodes formed on Table 2. Vine vigour in the first year after planting the
vine (Table 2). The total length of annual varieties of table grapes in first year
increases recorded the values between 173 Total length of annual
Number of
cm/vine at Victoria variety, and 507 cm/vine at Variety increases in the vine
nodes formed
(cm)
Transilvania variety. With good results in this
Silvania 230 65
regard were highlighted Tamina variety (453 Timpuriu de Cluj 185 58
cm /vine). The worst result were achieved at Muscat de
293 81
Timpuriu de Cluj variety (185 cm/vine) and Hamburg Cl. 4 Pt.
Someƕan variety (188 cm/vine). Tamina 453 110
SomeƔan 188 49
Although, internodes length is character
Splendid 296 63
variety, the number of nodes formed on a Napoca 326 87
vines are approximately proportional to the Victoria 173 39
length total annual increasing. The largest Prima Cl. 1022 199 53
number of nodes formed at Transilvania Coarnĉ neagrĉ
368 83
variety (120/vine) and the lowest, the Victoria selecԑionatĉ
variety (39/vine). Muscat de
385 91
Hamburg Cl. 202
In II year after planting continued the process Transilvania 507 12
ofplanting in places empty.
224
In this year the buds have resisted over the buds go in the vegetation at the Tamina
winter, so that the percentage of viability of variety, 68 percent. With the growth of buds
vegetation was 100, all varieties. over 90% were most varieties, 8, Silvania and
Plant vigour, expressed through the length of Muscat of Hamburg, with a percentage of 95.
vegetative increases and the number of shoots Other varieties have a percentage of the growth
with a diameter greater than 6 mm above the of buds between 80 and 89.
insertion point, the values differ from one Vines vigour was expressed by the sum of total
variety to another (Table 3). annual increases, the number of eyes formed on
the vine and the number of shoots with a
Table 3. The viability of the buds at the entrance of diameter greater than 6 mm, in the course of a
vegetation and vigor all the different varieties of vines year.
with table grapes in the II year of planting
The difference of vigour between the vines are
Number of very large, in specially, as regards the amount
Viability of
Total shoots with a
the buds at of the total annual increases and the number of
annual diameter greater
Variety the entrance eyes formed on the vine in the course of a year
increases than 6 mm above
of vegetation (Table 4).
(cm/vine) the insertion
%
point/vine Thus, if the Silvania variety recorded 625
Silvania 100 153 3 cm/vine, the annual increases and 64 eyes
Timpuriu de formed on the vine, at the Victoria variety, the
100 280 3
Cluj
Muscat de
same elements have values of 1364 cm/vine
100 300 4 and 84 eyes/vine. The less vigorous varieties
Hamburg
Tamina 100 275 2 are part of Silvania, are Timpuriu de Cluj and
SomeƔan 100 555 2 Someƕan. Differences were recorded regarding
Splendid 100 620 3 of the number of the shoots with diameter of 6
Napoca 100 410 3 mm to the vine, which has values from 3 to 5.
Otilia 100 366 3
Victoria 100 260 2
Although it suffered considerable losses of
Prima Cl. buds and wood stocks were able to fruiting,
100 350 3 even if not at the level of genetic potential. Had
1022
Coarnĉ demonstrated the potential of fruiting of these
neagrĉ 100 980 4 varieties to make grapes on the short elements
selecԑionatĉ (2-3 eyes length). If some varieties of fruiting
Muscat de
process was symbolic, others that production
Hamburg Cl. 100 554 3
202 was at the level of a normal year from
Transilvania 100 770 4 climatical point of view, with a large capacity
of fruiting on the short elements inserted to the
The most vigorous variety was Coarnĉ neagrĉ vine base, such as the Transilvania (10073
selecԕionatĉ, which on the four shoots Kg/ha) and the Prima Cl. 1022 (9998 Kg/ha),
registered the annual increases of 980 (Table 5). A level of production have been
cm/vine. The variety with vigour of the lowest satisfied with the varieties Muscat de Hamburg
was Silvania (153 cm/3 shoots). (5302 Kg/ha), Muscat de Hamburg Cl 202
In the III year (2012) have obtained the grapes (4999 Kg/ha) and Victoria (4923 Kg/ha).
on the buds located at base of vines because the Without the potential for fruiting on the short
buds situated above the snow layer (about 30 elements were Otilia (1515 Kg/ha) SomeƔan
cm thick) were all perished. (2196 Kg/ha), Napoca (2272 Kg/ha) and
Because to the reduce temperature value the Coarnĉ neagrĉ selecԕionatĉ (2575 Kg/ha). The
dry cutting was effectuated using the short quality of production of grapes had advantages
elements, of 2-3 eyes length. Even in these and disadvantages due to the climatical
conditions have not been in all growth buds, at conditions of this year for agriculture (Table 5).
all varieties. The percentage of bud growth was
between 70 and 100 (Table 4). Two varieties
have a viability percentage of 100%, Timpuriu
de Cluj ƕi Splendid, only. The lowest number of
225
The advantages in terms of the content of total
sugars, which recorded higher values. Instead
the weight of 100 grains and total acidity
titrable were smaller. Varieties of table grapes
accumulates usually, lower levels of sugars, at
the consumption maturity.
In this year the content of sugars exceeded the
value of 152 g/l in all varieties, from the
Transilvania variety, to 241 g/l. The lower
sugar content of 152 g/l was recorded the
Prima Cl. 1022 variety, which has reached
Figure 1. Prima Cl. 1022 variety maturity early consumption, to date 15.07.
2012.
Table 4. The viability of buds at the entrance of vegetation and vigour all the different varieties of vines with table
grapes in the 3rd year of the planting
The viability of the bud
Sum of total Number of eyes Number of shoots with a diameter
at the entrance of
Variety annual increases formationed on the greater than 6 mm, in the course of
vegetation
(cm/vine) vine a year mm/vine
%
Silvania 95 625 64 3
Timpuriu de Cluj 100 658 66 5
Muscat de
95 788 82 5
Hamburg
Tamina 68 826 86 5
SomeƔan 92 690 72 5
Splendid 100 770 67 5
Napoca 92 818 64 3
Otilia 84 790 74 4
Victoria 84 1364 84 4
Prima Cl. 1022 87 898 65 5
Coarnĉ neagrĉ
90 1124 85 5
selecԑionatĉ
Muscat de
90 1068 80 5
Hamburg Cl. 202
Transilvania 100 1256 99 5
A sugar content of over 200 g/l were recorded Someƕan, Napoca, Timpuriu de
and the varieties Otilia (204,5 g/l), Muscat de Cluj. Total titrable acidity
Hamburg (214,1 g/l). A sugar content of more expressed in g/l H2SO4, decreased due to very
than 180 g/l have been Tamina and Coarnĉ high temperatures and drought in all
neagrĉ selecƜionatĉ (184,3 g/l), Someƕan varieties studied, with values between 2.1 and
(185,4 g/l) and Timpuriu de Cluj (192,8 g/l). A 4.2 g/l H2SO4. The lower the value of the total
lower potential of sugar, along with the Prima titrable acidity was the Silvania variety (2.1 g/l
Cl. 1022, are Napoca (162 g/l). H2SO4). Higher values, which have contributed
Climatical conditions influenced the negative to a more balanced taste, were recorded at
weight of 100 grains of grapes specially to late Transilvania and Tamina varieties (4 g/l
maturing varieties. The varietiy which has H2SO4.
recorded the lowest weight, 167 g, Lower values of total titrable acidity registered
was Silvania and the variety with the highest at varieties Timpuriu de Cluj (2,15 g/l H2SO4),
weight was the Tamina, 661 g. Were Napoca (2,25 g/l H2SO4) and Victoria (2,8 g/l
emphasized the Victoria (648 g) and H2SO4).
Transilvania (616 g) varieties. Varieties with a
weight of 100 grains smaller are Silvania,
226
In this year the vegetative stage of vines were of view. The appearance of leaves started most
carried out close to normal until around June 15 early on the Someƕan at 04.04.12 and the latest,
(Table 6). Amid increasing temperature on the date of 14.04.12, at Coarnĉ neagrĉ
and installation of drought, the sum of selecԕionatĉ variety. The end of this vegetative
temperature for a certain vegetative stage was stage occurred, most early on the Someƕan on
achieved in a 9.4.2012, and later, on data 20.04.12 at Coarnĉ
shorter time, so the vegetative stage have neagrĉ selecԕionatĉ variety. The Prima Cl.
succeeded with rapidity. In this way the 1022 variety, which was the early, the
precociousness of varieties has increased, appearance of leaves began on the 9.4.2012 and
evidence that some varieties of ripe stage finished in 16.04.2012. Blooming stage began,
began on the 26.06.2012, at Prima Cl. 1022 most early, on 12.05.2012 and ended,
variety. at early, on 23.05.2012 data to Prima Cl.
The appearance of leaves, flourished and 1022 variety.
started farming grains stages were conducted
like some normal years of climatical point
Table 5. The production of grapes and the quality of the different varieties of vines in the 3rd year after planting
Yield Weight of 100 grapes grains Total sugar Total titrable acidity
Variant
Kg/ha g g/l g/l H2SO4
Silvania 2575 167 173.7 2.1
Timpuriu de Cluj 1628 261 192.8 2.15
Muscat de Hamburg 5302 305 214.1 3.8
Tamina 2424 661 184.3 4
SomeƔan 2196 237 185.4 3.75
Splendid 4544 399 173.7 3.1
Napoca 2272 265 162 2.25
Otilia 1515 250 204.5 3.5
Victoria 4923 648 153.8 2.8
Prima Cl. 1022 9998 372 152 3.8
Coarnĉ neagrĉ selecԑionatĉ 2575 316 184.3 3.75
Muscat de Hamburg Cl. 202 4999 389 196 3.5
Transilvania 10073 616 241 4.2
Table 6. Phenological observations at different vine varieties with table grapes in the 3rd year after planting, 2012year
The appearance of leaves Blooming Farming grains Ripe stage
Variant Maturity
Biginning end Biginning end -Biginning- -Biginning-
Silvania 10.04.12 17.04.12 20.05.12 03.06.12 27.05.12 10.07.12 20.08.12
Timpuriu de Cluj 06.04.12 12.04.12 19.05.12 03.06.12 25.05.12 07.07.12 16.08.12
Muscat de Hamburg 06.04.12 12.04.12 21.05.12 03.06.12 26.05.12 12.07.12 17.08.12
Tamina 06.04.12 12.04.12 20.05.12 04.06.12 26.05.12 12.07.12 17.08.12
SomeƔan 04.04.12 09.04.12 20.05.12 04.06.12 26.05.12 13.07.12 14.08.12
Splendid 05.04.12 12.04.12 22.05.12 04.06.12 27.05.12 08.07.12 14.08.12
Napoca 07.04.12 13.04.12 14.05.12 29.05.12 19.05.12 06.07.12 20.08.12
Otilia 05.04.12 12.04.12 20.05.12 04.06.12 26.05.12 09.07.12 17.08.12
Victoria 10.04.12 16.04.12 22.05.12 06.06.12 27.05.12 15.07.12 20.08.12
Prima Cl. 1022 09.04.12 16.04.12 12.05.12 23.05.12 18.05.12 26.06.12 15.07.12
Coarnĉ neagrĉ selecԑionatĉ 14.04.12 20.04.12 23.05.12 09.06.12 28.05.12 18.07.12 25.08.12
Muscat de Hamburg Cl. 202 09.04.12 15.04.12 22.05.12 06.06.12 27.05.12 12.07.12 20.08.12
Transilvania 12.04.12 17.04.12 23.05.12 09.06.12 28.05.12 18.07.12 22.08.12
Blooming stage was immediately followed by of growth of the grains overlap a few days over
the beginning of the growth of the grains, this stage, because the blooming has broken
which triggered the main early on 25.05.2012 down. The following vegetative stages were
data at Prima Cl 1022 variety. Where as produced in fewer days than was known due to
blooming stage lasts about 12 days, the period the accumulation in a shorter time to
227
temperature required for a different stages. As REFERENCES
I mentioned above ripe stage began on June Baniԑĉ P., Vlĉdoianu Em., 1979. Studiul comportĉrii
6.06. 2012 at Prima Cl 1022 variety and on unor soiuri cu struguri pentru masĉ pe nisipurile
6.07.2012 at Napoca variety. ameliorate din Oltenia. Analele SCCCPN Dĉbuleni,
Publishing Scrisul românesc, Craiova., vol. III, p.
CONCLUSIONS 445-454.
Cichi D.D., Costea D.C., 2008. Soiuri de viƜĉ de vie
In first year at the Transilvania variety, all cultivate ƕi cultivabile în România. Publishing Arves,
planted vines have developed normally. In Craiova, p. 300-308.
others, losses were between 1 and 9 Costescu A., Dejeu L., Popa C., 2012. Evaluating the
quality of the table grape varieties obtained and
vines, 2.5% at Coarnĉ neagrĉ selecԕionatĉ cultivated in the vineyard ctefĉneƕti – Argeƕ.
variety and Muscat Hamburg Cl. 202 variety, Scientific papers of University of Agronomic
and 25% for the Someƕan variety. Sciences and Veterinary Medicine of Bucharest,
Faculty of Horticulture, Series B. Horticulture,
From point of view of vigour emphasized Volume LVI. p. 69-72.
Transilvania variety with 120 nodes formed on Dumitru I., Cezarina Necula, Camelia Popa, ctefania
vine and 507 cm the total length of annual Iordache, Cristina Rizescu, 2009. The behavior of
increases. variety for table grapes – Muscat Iantarnii in
vineyards conditions of ctefĉneƕti Argeƕ. Bulletin
In the II year of planting the vine vigour, UASVM Horticulture, 66(1), p. 272-275.
expressed through the length of vegetative Rotaru L., 2005. The behaviour of some new varieties of
shoots and the number of shoots with diameter table grapes in Romania, in the ecoclimatical
greater than 6 mm/shoot above the insertion conditions of the nord-est region. Agricultural
University – Plovdiv, Bulgaria, Scientific Works, vol.
point, the values differ from one variety to
L., Book 6, Jubilee Scientific Conference ,,State of
another. The table grape varieties at more the art and problem of agricultural sciense and
vigorous variety was Coarnĉ neagrĉ education”, 19-20 october.
selecԕionatĉ variety, which on the four shoots Martin T. et all., 1974. Strugurii de masĉ. Editura
registered a value of 980 cm. CERES, BucureƔti.
Mohammad Ahmad Abdel Majid Bishtawi, Popa A.,
The year three after planting, also, is for 2005. Comportarea unor soiuri de masĉ în condiƜiile
formation. Because of this, and to the fact that ecopedoclimatice din centrele viticole Dĉbuleni,
in 2012 the buds located at the height under 15- Banu Maracine, Drĉgĉƕani. Analele UniversitĉƜii din
20 cm, were affected by the negative minimum Craiova, vol X (XLVI). Editura Universitaria,
temperatures, in the winter time, the varieties in Craiova, p. 39-44.
Popa C., Necula C., Cichi D., Giugea N., 2009. Studies
question have not been expressing the true on the behaviour of variety Golden ctefĉneƕti in
potential of fruiting. In this regard for the next vineyards ctefĉneƕti and Banu Mĉrĉcine. Analele
year will take action to protect 2-3 shoots. UniversitĉƜii din Craiova, Seria Biologie,
With all these difficulties were able to tear off a Horticulturaĉ, Tehnologia Prelucrĉrii Produselor
Agricole, Ingineria Mediului, vol. XIII (XLIX), p.
few varieties, from the point of view of the
45-48.
precociousness, or from the point of view of the Popa C., Cichi D., Necula C., 2008. Argessis and Golden
potential to fruiting on the short elements (2-3 ctefĉneƕti new varieties for table grapes with
eyes length). biological strength. Proceedings of the 32st World
Congress of Vine and Wine, 7th General Assembly of
From the point of view of precociousness the O.I.V., Verona, Italia. Edition Naklada.
grapes table varieties noted the Prima Cl. 1022 Stroe M. V., Bucur G. M., 2012. Study regarding the
that reached consumption maturity at 15.7.12. influence of low winter temperatures between 2011-
Transilvania variety and the Prima Cl. 1022 2012 on the viability of winter buds of some table
grape varieties in the conditions of the didactic
variety, were highlighted, and in terms of the experimental field in Bucharest. Scientific papers of
production of grapes, which means they have University of Agronomic Sciences and Veterinary
the potential to fruiting on the short elements. Medicine of Bucharest, Faculty of Horticulture,
Series B. Horticulture, Volume LVI, p. 181-184.
228
RESEARCH REGARDING THE BEHAVIOR OF CLONAL FETEASCA

NEAGRA 10 PT TO LOCAL CLIMATE CHANGES
Marinela STROE1, Sofia ISPAS2, Drago‫ ܈‬MATEI2, Damian ION2, Elena DUMITRU2
1
9 Marasti Blvd., 011464, Bucharest, Romania
2
Pietroasa Vineyards Research and Development Station, Pietroasele, 127420, Buzau, Romania
Abstract
Throughout numerous research stations and prestigious institutes and wine traditions in our country, owner of
germplasm fond, we encounter vineyard center Pietroasa, which quality attributes derive from, on one hand the
ecopedoclimatic specific conditions existing here and on the other hand from the scientific activity headed to creating
new vine varieties and improving the main soils of the assortment through clonal selection. In the last years, though, as
in almost all our country regions, we assist with certain worry to a series of extreme climate events (strong winds,
maximum extreme temperatures in summer, minimum extreme temperatures in winter as well as the phenomenon called
freezing rain, all with effects on the normal growing cycle of vine plants. In this paper it is observed the influence of the
climate changes on the agrobiological and technological potential of the clonal selection Feteasca neagra 10, the
newest achievement of S.C.D.V.V. Pietroasa (patented in 2010) between 2010-2012. Climate data has been collected
from the research station’s own weather station and implied daily observations regarding the evolution of the
parameters – temperature, precipitations, insolation – and based on these parameters were calculated the climate
indexes that define the favorability degree of an area, as well as the Huglin index. The results obtained after the study
prove that they are in direct correlation with these area climate changes, and that on the short run have a positive
influence on the precocity of grape maturation, on the sugar accumulation potential, all together giving an extra quality
to the final product, the wine.
Key words: climatical index, grape varietes, favourability, vineyard.
INTRODUCTION (Tonietto and Carbonneau, 2004, Laget et al.,

2008). The observations made are of local
Although in the vineyard’s assortment prevails
interest as well as national interest, because it
grape varieties for white wines, the main
gives undeniable proofs of climate annual
winery profile is obtaining white, superior
changes, of which manifestations have
quality wines, in the Pietroasa wine area,
consequences on the annual growing cicle of
characterized by a moderate drought
the vine. (Jones et al., 2005). The necessity of
microclimate, warm temperate, with cool nights
our reasearch derives from the fact that, in
(IS1, IH4, IF3), there are favorable conditions
present time, the wine assortment is formed of
for varieties of quality red wines (Feteasca
old varieties and the replacement of these ones
neagra, Babeasca Neagra, Merlot). In the
with new clonal selections is wanted, and have
present study, the evolution of qualitative
to correspond with the following parameters: to
parameters of the clonal selection Feteasca
make maximum usage of the climate
neagra 10 obtained in 2010 at P.V.R.D.S
conditions, to have medium productivity and
Pietroasa was observed in the conditions
vigor, constant quality productions according to
determined by area’s climate changes troughout superior quality wines, and the quality to be
three wine years (2010-2012), which proved to expressed in a superior alcohol and acidity
be special under the climate recorded indexes potential, and to have a very good pest,
report. At the same time were analyzed the environment factors and diseases resistance and
correlations met between the accumulation and so on.
increase of the sugar quantities of the grape
must and the higher values of the Huglin index
229
To accomplish the objective presented above,
the research was made between 2010-2012 in Tm = Medium air temperature (ºC)
an experimental device placed on an sloping Tx = Maximum air temperature (ºC)
land, in the superior third of the slope with k = day length coefficient according to the
southeastern exposition and 12% inclination. lattitude, with values between 1,02-1,06 for
The soil is limestone, the mother rock is at low lattitudes of 40-500, and for Romania (44,10 –
depth, the reaction is low alkaline, with a high 46,00) it has the value of 1,04.
level of calcium carbonate which varies This reference index is used on a large scale in
between 14% in the A horizon and 20-36% in vineyards because it gives information about
the B horizon; in the C horizon limestone the heat potential of the area, presenting a high
mother rock predominates. The biological primary importance in choosing the right
material which is the object of this research is assortment on one hand and it is positively
the clonal selection Feteasca Neagra 10Pt correlated with the accumulated sugar quantity
(Table 1). The selection was grafted on the on the other hand. The values of this index
Kober 5 BB rootstock, the grapevines were calculated in different wine regions determines
conducted on a semi-stem (Guyot on a semi- this way not only a classifications of the
stem) at a planting distance of 2,0/1,2m, with a indexes, but the establishment of the minimum
load of 30 buds/vine. The data was collected temperature required for the progress of the
from the vineyard’s own weather station and growing cycle of the vines in that area.
regarded daily observations about the evolution The clonal selection (Table 1) was observed
of the parameters – temperature, precipitations, throughout the whole phenological specter, and
insolation and based on these parameters were in the harvesting moment, on a medium sample
calculated the climate indexes which define the of 15 grapes there were made the following
degree of favorability of an area, the real determinations: average weight of a grape,
heliotermic index (IHr), the hidrothermal average weight of 100 grapes, gluco-
coefficient (CH), the bioclimatic index of vine acidimetric index, production/vine, sugar (g/l),
(Ibcv), oenoclimatic aptitude index (IAOe), as acidity (g/l sulfuric acid). The results obtained
well as Huglin index calculation. The Huglin were analyzed with the one-dimensional
index (HI) is calculated from April the 1st to indexes – arithmethic mean, maximum, and
September 30th, in the northic hemisphere and minimum, indexes that can be applied for the
it’s defined as follows: majority of the quantitative characters which
have the property to variate in time and space.
Table 1. Main characteristics of the clonal selection Feteasca Neagra 10 Pt

Ampelographic characteristics
Clonal selection of the Feteasca neagra variety, characterized by a large productivity
potential accompanied by a high sugar accumulation potential.
The grape is medium-large, cylindrical-conical, compact, with small, black grapes,
uniform in size and colour, without manifesting the grape shrinking disease called
“small grains” and “very small grains”.
Agrobiological and technological characteristics
Fertility: 68% fertile buds
Grape weight: 142g
Production per bud: 2,8 kg
Sugar: 242 gramms per liter
Total acidity: 5,5g/l H2SO4
Production direction (clonal selection type)
It ensures quality productions and obtaining high quality red wines, intense in colour,
smooth and balanced, with controlled name of origin (D.O.C).
Important attributes of the selection: good productivity, high sugar content which in
favorable years can reach 267 g/l (quality clone).
230
RESULTS AND DISCUSSIONS temperature of-1,1ºC. The amount of bud
losses was due to the large interval in which
Climate features of the wine years during
temperatures maintained critical, but also to the
experimentation period
rain phenomenon which froze on the vines
Wine year 2010. Under the aspect of the
strings (freezing rain) signaled between
thermal regime, January was extremely cold,
February the 4th-February the 6th. Spring was
and between January the 22nd – January the 31st
close to the normal limit, and the summer of
there were registered consecutively minimum
2012 was extremely drought, with a high
temperature values of the air under 25ºC, the
hydric defficit on the base of a large thermal
absolute value of winter (of the month) was-
surplus which marked the progress of the
26,6ºC, on the soil being of-27,9ºC, affecting physiological and biochemical processes at
the biological resistance of the plants. The normal parameters, but as well as on the quality
hydric regime was a little bit over the normal and quantity of the grape production. The
values in spring, accompanied by the thermal summer of 2012 was remarked by a large
regime as well as over the normal for the number of days with consecutive maximum
period, associated with the overheated temperatures over 35ºC (41ºC-August 15th)
temperatures, higher than 35ºC from August and consecutive nights (tropical) with
which favored the installation of hydric stress minimum temperatures of the air larger than
and the rush of ripening process of the grapes, 20ºC. Autumn was extremely hot, with air
the dehydration of the grapes and the reducing
temperatures of 33ºC (September), poor in
of their volume. Autumn was not uniform,
precipitations and the rain deficit accentuated
drought in September and extremely cold in
in autumn was rebuilt increasingly starting with
October (-4,4ºC), and in November it was
November.
registered a thermal surplus of +73,6ºC, The analysis of climate conditions in relation
(maximum values of 24ºC). to the synthetic indexes
Wine year 2011. Regarding the temperatures, Analyzing the growing active period in
winter was close to the multi-annual values of accordance with the active balance, we can
the season. Summer was close to the normal conclude that the year of 2012 was the only
thermal regime, with a medium season year in this study interval that had a high
temperature of 21,5 ºC from the multi-annual thermal contribution (3835,5) with multiple
average of 21,3ºC. The rain regime was influences (positive and negative) in the growth
variable during the summer, knowing a growth and development of plants. So, the level and
of 77,8 mm between June-July when the amount of temperature degrees associated
hidrometeorological extreme phenomenons with a plus of insolation hour number, but also
were signaled such as torrential rains, wind the soil drought cumulated with the atmosphere
intensifications with an aspect of storm and drought, determined the maturation phase of
severe hail on 24th of August which by the grapes, 7 days earlier than normal (25th of
intensity and duration produced damages of July), determining an advance of the full
about 75-90%. Autumn was not uniform under maturity. Analyzing the values of the four
the thermal and hydric aspect, excessively hot, synthetic indexes, it can be observed that the
with maximum values over 33-34ºC in the air wine station registers high heliothermic
temperature, in September, and cold with resources, which have as a correspondent low
negative values under-5,2ºC in October. water resources and that the most sensitive is
Wine year 2012. The cold season registers the bioclimate index, which’s large specter is
severe temperatures (under -23ºC) and snow situated between 5,38-11,2. Regarding the
(February). Extreme negative temperatures, evolution of the values of Huglin index, the
blizzard and glazed frost between January 24th values recorded during the time of the study
and February 6th brought values of-23,1º C in show that it suffers a growth tendency from one
air temperature, on soil recording -26,7ºC. year to another, with some exceptions (2007-
February registered a record medium 2009), reaching a maximum of 2639,7 in the
temperature value of -5,5ºC which was 4,4º C year of 2012, conditions in which the wine
lower than the average multi-annual areal characterized by a warm temperate
231
climate (IH4), becomes for this year a hot with a minimum of only 20% in the year 2012,
climate (IH5) – (IS1, IH5, IF3). minimum which was due to the large time
Analyzing the obtained qualitative data period in which the temperatures maintained
It is observed that, the results of the experiment critical, but also to the phenomenon of rain
are directly correlated with the unfavorable frozen on the vine strings (freezing rain),
evolution of the climate factors during 2010- between February the 4th-February the 6th.
2012 and that, each year of culture, through the Analyzing the recorded production of 6,3 tones
evolution of the weather recorded phenomenon, per hectar it is also observed that the smallest
leaves a mark on the manifestation of one and value is recorded by the clonal selection in
each variety. Although the clonal selections 2012, when it obtained the smallest values of a
comes from an old local soil (Feteasca neagra), grape medium weight values (175g), as well as
with a climatic remarkable adaptability, the a minimum weight value of 100 grapes (140g).
waves of cold and the absolute minimum It can be mentioned the fact that on this fond of
temperatures recorded in the air of-26,6 0 C low productivity, the sugar accumulated
(January 2010), of-23,20C (January 2012) quantity reached the maximum level of 243 g/l,
produced important bud losses during the quantity that offers qualitative constancy and a
growing rest period. high alcohol potential because this selection
In table 3, it is observed that the clonal accumulates in the good wine years, around
selection Feteasca neagra 10 Pt, records a 242 g/l.
medium value of 42% winter buds viability,
Table 2. Evolution of the climate elements in the wine area of Pietroasa (2007-2012)
Average Year Year Year
Specification 2007- Max Min
2010 2011 2012
2009
global 4233,4 3920,4 4019,1 4205,7 4233,43920,4
Thermic balance active 3577.2 3473,1 3388,3 3835,5 3835,53388,3
useful 1677,2 1626,2 1616,2 1955,6 1955,61616,2
Absolute minimum Air -17,13 -26,6 -16,1 -23,1 -16,1 -26,6
temperature°C Soil -19,5 -27,9 -17,4 -26,7 -17,4 -27,9
The sum of the hours of real insolation (Sir) 2060,7 2036,4 2049,3 2125,3 2125,32036,4
The sum of the annual precipitations (mm) 522,6 655,2 601,1 579,6 655,2 522,6
Number of days of active period 205,6 214 207 220 220 205,6
The hydrothermic coefficient CH) 0,82 1,17 1,19 0,97 1,19 0,82
The real heliotermic index (IHr) 1,37 1,12 1,05 1,08 1,37 1,05
The viticultural bioclimatic index
Indices agroclimatics 9,05 5,96 5,38 11,2 11,2 5,38
(Ibcv)
Index of the oenoclimatic aptitude
5185,7 4816,4 4373,2 5074,5 5185,74373,2
(IAOe).
Table 3. Evolution of quality parametres during 2010-2012

Weight of
% Gluco- Average one
Yield Sugar Acidity g/l Full
Specification viable Acidimetric weight of hundred
(kg/vine) (g/l) H2SO4 maturity
buds Index a grape (g) grapes
(g)
Clonal selection Feteasca neagra 10 Pt
2010 57 8,0 235 5,5 4,3 180 210 16.09
2011 49 7,0 231 5,8 4,0 180 165 18.09
Wine 2012 20 6,3 243 5,5 4,4 175 140 10.09
year average 42 7,1 236,3 5,6 4,2 178,3 171,7 15.09
min 20 6,3 231,0 5,5 4,0 175,0 140,0 10.09
max 57 8 243,0 5,8 4,3 180,0 210,0 18.09
232
Figure 1. Evolution of Huglin Index between 2007-2012 in the wine area of Pietroasa
Figure 2. Evolution of Huglin Index and content sugars (g/l) for clonal selection Feteasca neagra 10 Pt
A partial conclusion that can be made is that under the form of torrential rains, wind
the particularities of these wine years left a intensifications with storm aspect and extreme
mark on the agrobiological and tehnological hail on the 24th of August, which by
behavior of the clonal selection Feteasca neagra intensification and duration produced damages
10 Pt, and that particularly, the productions in the Pietroasa area of 75-90%, and in the year
obtained in this years are much under the of 2012, due to the extreme air temperatures
selection limits, practically hierarchial limits (-23,1ºC) and (-26,7ºC – record value) at
descending, as follows: 2010, 2011, 2012 soil, which lead to bud losses of approximately
without being majorly affected by those 80% for all cultivated varieties in this wine
parameters that define and insure the quality of area.
a wine (sugar, acidity). After the study, following the evolution of
It is worth mentioning the fact that, low Huglin Index values in the wine area of
productions of the year 2011 were due to the Pietroasa (index that offers relations regarding
hydrometeorological extreme phenomenons the thermal potential of the wine area) and the
233
quantities of sugar accumulated in the culture technologies, oenological practices and
maturation process, it can be observed a direct so on.
correlation in general (figure 2) and only in the These information represent the basic elements
conditions of the year 2012 the recorded values taken into consideration for a better, deeper
overcome the potential of the clonal selection reflection on what it means choosing the
(242 g/l). These accumulations (235 g/l, 231 assortment, on introducing into culture some
g/l) reach a level which insures obtaining a varieties and clonal selections more appropriate
good alcoholic potential for superior quality for the culture technologies, on finding some
wines. Based on the same data, it can be long-lasting adaptation solutions to the climate
observed a precocity of grape maturation (6-8 changes of the technologies, oenological
days in advance) undependable of the practices and so on.
production year.
In conclusion, the biological value of the new
clones obtained by applying the clonal selec-
tion is sustained by the hereditary analyzed
specific of each variety, biotype, or assortment
group.
REFERENCES
Huglin P., 1978. Nouveau mode d’évaluation des
possibilités héliothermiques d’un milieu viticole.
Comptes Rendus de l’Académie d’Agriculture,
France, p. 1117-1126.
Tondut J.L., Laget F., Deloire A., 2008. Climat et viti-
culture: evolution des temperatures sur le departe-
Figure 3. Clonal selection Feteasca neagra 10 Pt, 2010 ment de l’Herault, un exemple de rechauffement
climatique-Revue francaise d’oenologie, publication
officialle des oenologues de France. Article
techcnique R.F.O.E. nr. 219.
Jones G. V., White M. A. Cooper O. R., Storchmann K.,
CONCLUSIONS 2005. Climate change and global wine quality.
It is observed that, special climate features of Climatic Change 73, p. 319-343.
Laget F., Kelly M.T., Deloire A, 2008. Indications of
the last years, defined by the climate unspecific climate evolution in a mediterranean area conside-
changes to Pietroasa station, determines a faster rations for the wine and viticulture sectors. Organi-
process of the phenophases and have an effect sation Internationale de la Vigne et du Vin, Verona,
on the precocity of grape maturation and sugar Italia, le juin 2008.
Tonietto J. and Carbonneau A., 2004. A multicriteria cli-
accumulation which finally bring a plus of
matic classification system for grape-growing regions
quality to the wines that are obtained. worldwide. Agricultural and Forest Meteorology 124,
Clonal selection newly obtained Feteasca p. 81-97.
neagra 10 Pt present promising perspectives Tonietto J. and Carbonneau, A., 2004. A multicriteria
climatic classification system for grape-growing
due to the high degree of adaptation, and the regions worldwide. Agricultural and Forest
success of integrating and expanding it in the Meteorology 124, p. 81-97.
culture depends on finding adaptation and long- *** O.I.V. guidelines for studies on the effects of climate
lasting solutions to the climate changes in change in vitiviniculture and proposed adaptations.
Organisation Internationale de la Vigne et du Vin,
Paris, le 13 mars 2012.
234
PHYLOGENETIC ANALISYS OF MANGIFERA BASE ON RBCL
SEQUENCES, CHLOROPLAST DNA
Suparman SUPARMAN1, Adi PANCORO2, Topik HIDAYAT3

1
Department of Biology Education, Universitas Khairun, jalan bandara Babullah Ternate,
Maluku Utara, Indonesia
2
Genetics Laboratory, School of Life Science and Technology,Institut Teknologi Bandung,
Jalan Ganesha 10, Bandung, Indonesia
3
Department of Biology Education, Universitas Pendidikan Indonesia (UPI),
Jalan Setiabudi 229 Bandung, Bandung, Indonesia
Abstract
Genus of Mangifera has 69 species that mostly distributed around Borneo, Sumatra, Java and Malay Peninsula.
Phylogenetic study of this genus is conducted in order to investigate the ancestor trait and relationships among those
species. Phylogenetic tree is constructed based on nucleotide variation in rbcL gene within 16 samples of Mangifera :
13 species from Indonesia and 3 species from Thailand. Two species from the other genera are added as outgroups.
Genomic DNA was extracted using CTAB protocol and amplified with rbcL primers. Sequencing result is analyzed
using BLAST function on NCBI. Multiple sequence alignment from all samples of rbcL sequences is generated using
Bioedit and ClustalX program. Subsequently phylogenetic is constructed by using Maximum Parsimony method in
PAUP* 4.0b10 software. The aligned rbcL comprised 905 characters which had 72 characters of parsimony
informative with consistency index (CI) 0,889 and retention index (RI) 0,962. Phylogeny generated four main groups.
Group I consist of M. cochinchinensis and M. macrocarpa (Thailand); group II : M. indica M. cesia, M. aplanat and M.
altisima ; group III : M. laurina, M. longipes, M. similis, and M. gedebe ; group IV : M. laurina (Thailand), M. foetida,
M. caesia, Mangifera spp, and M. odorata. Phylogenetic analysis revealed that Mangifera is monophyletic. There is a
diversification between M. laurina from Indonesia and Thailand, as well as M. macrocarpa. Phylogenetic analysis also
provides information which support the assumption that M. odorata is a hybrid of M. indica and M. foetida, and
strongly support the assumption that M. longipes is a synonim of M. laurina.
Key words: Mangifera, Phylogenetic, rbcL.
INTRODUCTION complexity of the vegetative and generative

organ. The newer classification base on
Mangifera is a genus of Anacardiaceae. Most
morphology is doubted (Yonemori et al.,
of its member are spread in Borneo, Sumatra,
2002).
Java, Malay peninsula, and also other part of
It can be revealed by uncertain position for 11
Asia (Mukherjee, 1953). Classification system
species, beside that, there are two controversial
of Mangifera has been developed. Mukherjee
species: M. longipes and M. odorata. In the old
(1953) classified Mangifera in two sections
classification there is M. longipes (Mukherjee,
with five species incertaesedis.
1953; Hou, 1978) but in the latest classification
Today Mangifera has 69 species and classified
there is not (Kosterman and Bompard, 1993).
to three subgenus they are Mangifera, Limus
They said that M. longipes is synonym with M.
(Marchand), and uncertain position Koster-
laurina but they showed different some
mans and Bompard (1993).
morphology characters.
Mangifera was determined from one ancestor
In other species, Mangifera odorata was the
(Mukherjee, 1953) otherwise Kostermans and
hybrid result between M. indica dengan M.
Bompard (1993) contradicted that theory. They
foetida (Hou, 1978), but Kosterman and
suggested that the genus original was two
Bompard (1993) rejected the statement.
different ancestors.
Some previous molecular phylogenetic
Classification of Mangifera is still labile
analyses in Mangifera were done. A research of
(Hidayat dkk, 2011). It is because the
internal trancribed spacer (ITS) DNA nuclear
235
ribosomal to investigate 13 species of (Forestry Departemnt of Kasetsart University,
Mangifera (Yonemori et al., 2002); Using Bangkok). Two Outgroup, they are Bouea
amplified fragment length polymorphism macrophylla from Bogor and Anacardium
(AFLP) information by Yamanaka (Yamanaka occidentale. The last outgroup is taken from
et al., 2006); using trnL-F gene sequence to NCBI genebank (Aguilar and Sosa, 2004).
analysis four species of Mangifera (Fitmawati Three main steps of research are rbcL primer
and Hartana, 2010); also phylogenetic and design, DNA genome isolation from Mangifera
diversification of Mangifera from Indonesian leaf and rbcL amplification, and the last is
and Thailand by Hidayat (Hidayat et al., 2011). phylogenetic tree construction.
All molecular phylogenetic researches of Template of rbcL gene was retrieved from
Mangifera were to analysis the phylogenetic MangiferaindicarbcL gene in NCBI (Gadek, et
and phyletic original of ancestor. So that, it is al., 1996). That sequence was used for
quite important to construct phylogenetic tree designing primer both rbcL-F and rbcL-R by
and analyze phylogenetic of Mangifera using GenamicsExpression software and confirmed
different molecular marker, especially based on with primer blast at NCBI.
rbcL gene sequence as marker in plant. rbcL is DNA Genome was extracted from Mangifera
gene for coding ribulose-1,5-bisphospate leaf using CTAB method protocol (Porebski et
carboxylase (RuBisCO). al., 1997) with modification. Then, rbcL gene
All kind of plants have this gene with moderate was amplified by PCR and sequenced in
mutation. Mutation in rbcL has positive Macrogen Inc (Korea) with the same primer.
correlation with species diversification in For constructing Phylogenetic tree, all the
Angiosperm (Barraclough et al., 1996), so it is sequences were edited and performed
expected will be able to give phylogenetic alignment by Bioedit and ClustalX program
information closer to the real condition. (Thompson et al., 1997)
Phylogenetic tree constructed with maximum
MATERIALS AND METHODS parsimony (MP) and neighbour joining (NJ)
using PAUP* 40.b10 (Swofford, 2002).
16 samples of Mangifera, 13 samples of leaf
Appearance the phylogenetic tree use tree view
are collected from Indonesia (Kebun Raya
win 32 software (Roderic, 2001).
Bogor) and three samples from Thailand
Table 1. Plant material and origin

Number NAME OF SPECIES ORIGIN
1 Mangifera caesia Jack Java, Indonesia
2 Mangifera similis Auet Sumatera, Indonesia
3 Mangiferamacrocarpa Blume Java, Indonesia
4 Mangifera laurina Blume Java, Indonesia
5 Mangiferagedebe Miquel Sumatra, Indonesia
6 Mangifera indica Lin Java, Indonesia
7 Mangifera sp Borneo, Indonesia
8 Mangiferaapplanata Kosterm Borneo, Indonesia
9 Mangiferacasturi Kosterm Borneo, Indonesia
10 Mangiferaodorata Griff Java, Indonesia
11 Mangiferafoetida Lour Java, Indonesia
12 Mangiferaaltissima Blanco Java, Indonesia
13 Mangiferalongipes Griff Java, Indonesia
14 M. cochinchinensis Engler Thailand
15 Mangiferalaurina Blume Thailand
16 Mangifera macrocarpa Blume Thailand
17 Bouea macrophylla Griff * Java, Indonesia
18 Anacardium ocidentale Lin** Accession number in NCBI: AY462008.1
= outgroup
* = outgroup which taken from NCBI
236
RESULTS AND DISCUSSIONS laurina (Thailand), M. sp, M. kasturi, M.
foetida, and M. odorata.
Phylogenetic tree result
The result reveal that two species of Mangifera
The aligned rbcL comprises 905 characters. Of
from Thailand grouped in one but other species
these, 807 characters are constant and 72 are
(M. laurina) join to Indonesian Mangifera. The
potentially parsimony informative. From the
group systems show some differences with
most parsimony tree (MPTs), consistency index
classification system made by Kostermans and
(CI) is 0,889 and retention index (RI) is 0,962.
Bompard (1993).
The values showed that all characters are
Monophyletic character of Mangifera ancestor
important in constructing tree and RI reveal
trait based on rbcL gene shows the same result
that homoplasy is very small.
with ITS (Yonemori et al., 2001) and matK
Phylogenetic tree as shown in figure 1, it was
(Hidyat et al., 2011) with different DNA
constructed with maximum parsimony method
sequences. Overall results of Mangifera
and bootstrap 1000x. Neighbourjoining (NJ)
ancestor are monophyletic. The monophyletic
method is also done to show difference of
ancestor of Mangifera is supported by character
genetic distance and analyze similarity
of stomata (Hidayat et al, 2009). Therefore, the
sequence among samples.
consequence for the ancestor is agree with
Phylogenetic analysis Mangifera
Mukherjee (1953), that said Mangifera come
Phylogenetic analysis from the tree had
from one origin and divided into three species.
revealed the important answer about the
That is M.duperreana as root of section I, M.
ancestor trait. It is monophyletic tree with four
lagenifera and M.macrocarpa as root of section
main groups. The first group consists of two
II. That species are the oldest among all species
species from Thailand which are M.
of Mangifera.
macrocarpa (Thailand) and M. cochincinensis.
Phylogenetic analysis also shows biogeography
Group II consist of M. indica, M. caesia, M.
relationship of Mangifera. It can be seen from
aplanata, and M. altisima. Group III consist of
the diversification of same species, which is
M.longipes, M. laurina, M. similis, and M.
taken from difference land with long distance.
macrocarpa. Group IV consist of mix samples
Phylogenetic pattern among species also give
from Thailand and Indonesia, such as M.
information in species status and taxonomy
implication in genus Mangifera.
Figure 1. One of the most parsimony tree with bootstrap 1000x. The number on the node is Bootstrap value in%.
237
Biogeography of Genus Mangifera between M. odorata and M. foetida is higher
Two species of Mangifera from Thailand made than M. indica and M. odorata (Kiew et al.,
group I: M. cochynsinensis and M. macrocarpa 2003; Teo et al., 2002). They indicate that M.
(gambar III.1), meanwhile M. laurina joint in odorata is hybrid result of M indica and M
group III. It reveals diversification among foetida, it was followed by backcrossing with
species from Indonesian islands and Thailand M. foetida. So, it refers to be similar with M.
especially in M. laurina and M. macrocarpa foetida than M. indica.
from Thailand and Indonesia. The next research using matK sequences
Phylogenetic analysis based on matK (Hidayat analysis shows a different result. It shows that
et al., 2011) in Mangifera also shows M. odorata is closer to M. indica than M.
separation between species which come from foetida (Hidayat dkk, 2011). This difference
different geography. It may be caused by result among rbcL gene, ITS and matK still
different natural geographical condition since support hybrid status of M. odorata). It needs
many years ago. So the sequences of DNA are more analysis using three combination of that
changed or mutated. Another hypothesis is marker to answer that controversial.
calculated from different variety of sample, yet Phylogenetic tree give information of M.
this hypothesis is weak. longipes status. Species M. longipes in newer
Phylogenetic relathionship and member classification of Mangifera is synonym with M.
status of Mangifera laurina. Species of M. longipes Griff spread in
Some closes species based on the phylogenetic Sumatera, Malay Peninsula, Borneo, Lesser
tree, are M. cochinshinensis and M. Sunda island and Philipina (Hou, 1978).
macrocarpa from Thailand. These species are however M. laurina Blume is endemic species
group I. While in group II, M. caesia, M. in Philippines archipelago and Selayar island
aplanata, and M. altissima also had a close (Sulawesi) with local name are Mangga Aer,
relationship and sistergroup with M. indica. Mangga parih and Apale/i (local name in
Relationship between M. altissima and M. Palawan island). Based on the analysis, it is
applanata also close Mangifera phylogenetic possible that both of them are different species.
based on matK (Hidayat dkk, 2011). In group
III, M. gedebe, M. similis, and M.
macrocarpa closed and sister group with M
laurina & M. longipes.
Group III is similar to matK phylogenetic,
otherwise M. macrocarpa in matK is Thailand
samples. Group IV, M. odorata, M. spp and M.
casturi closed and sister group with
M. foetida, beside M. laurina from Thailand is
in group but outer than other.
Relationship in phylogenetic based on rbcL
sequences also reveals status of M. odorata and
status M. longipes. Species of M. odorata is the
hybride of M. indica and M. foetida (Hou,
1978) . The conclusion does not directly agree
with that opinion, but our analyses reveal it is
possible. Not all the species (M. odorata,M.
indica and M. foetida) are in one group. M.
odorata and M. foetida are in one grup (group
IV), while both of them are separated with M.
indica (group II).
M. odorata and M. foetida also have close
relationship based on ITS marker (Yonemori et
Figure 2. Phylogenetic tree using Neighbour Joining
al., 2002). AFLP analysis in showing hybrid methods. Numbers on the nodes are bootstrap value in%
status of M. odorata reveal that similarity index and number bellow is genetic distance.
238
Phylogenetic tree using MP likely to support ancestor, there are diversification between
that M. longipes is synonim with M. laurina. It Thailand and Indonesian sample.
show on phylogenetic tree, M. longipes and M. It result also supports that M. odorata is hybrid
laurina make one same clade at one internal result of M. indica and M.Foetida. The analysis
nodus. In phylogenetic, it means booth of them also support that M. longipes is synonym with
come from one ancestor and are very close M. Laurina.
taxon. Phylogram tree (fig2) using NJ methods
reveal some genetic distance between M. The classification system is revealed quite
laurina and M. longipes but very little. differently with previous system.
Therefore, the conclusion for this controversy
is strongly support that M. laurina is synonym ACKNOWLEDGEMENTS
with M. longipes. The research is supported by AP project 2009-
Taxonomic implication 2010 and genetics laboratory of SITH ITB. We
Phylogenetic information of Mangifera based would like to thank Puri Arta as research
on rbcL can become reference and base in assistant of Pancoro group, Asri P lestari,
Mangifera classification without ignore Husna N Praja, all ITB genetic laboratory
morphology and anatomy information as the members and Desy Apriliani (Udayana
first reference. Topological analysis of tree University) for discussing the grammar.
Phylogenetic uncover different pattern with
newer classification of Mangifera. For example REFERENCES
the closer kinship species M. laurina, M.
Aguilar C.J., Sosa V., 2004. The evolution of toxic
gedebe, M. sismilis and M. macrocarpa, are phenolic compounds in a group of Anacardiaceae
different subgenus and different section. genera. Taxon Journal 53 (2), p. 357-364.
Phylogenetic based on rbcL gene is supported Barrachlough T.G., Harvey P.H., Nee S., 1996. Rate of
by matK gene and this difference pattern of rbcL gene sequences evolution and species
diversification in flowering plants (Angiospermae).
classification also indicated by ITS marker
The Royal Society. Proc. R. Soc. Lond. B 263, p.
(Yonemori et al., 2002). It means that the 589-591.
classification system of Mangifera today is Fitmawati, Hartana A., 2010. Phylogenetic Study of
inconsistence. Mangifera laurina and its related Species Using
In different case, as a reference, species cpDNA trnL-F spacer Marker, HAYATI Journal
Bioscience Vol. 17 No.1, p 9-14.
member of Caragana (Fabaceae) are reformed
Gadek P.A., Fernando E.S., Quinn C.J., Hoot S.B.,
after molecular analysis from tribe of Galegeae Terrazas T., Sheahan M.C., and Chase M.W., 1996.
to become different tribe of Hedysarea (Zhang Sapindales: molecular delimitation and infraordinal
et al., 2009). Based on molecular information groups. Am. J. Bot. 83 (6), p. 802-811.
rbcL, trnS-trnG and ITS, another section and Hidayat T., Pancoro A., Kusumawaty D., Eiadthong W.,
2011. Molecular Diversification and Phylogeny of
group in Caragana are recommended to
Mangifera (Anacardiaceae) in Indonesia and
contemplate and observe Thailand. Proceeding of the International Conference
Our research was limited in samples and on Advanced Science, Engineering and information
sequence of base so it is too early in Technology, Putrajaya, Malaysia, p. 88-91
recommending for classification reform but the Hou D., 1978. Anacardiaceae (revisions). Flora
result can consider in reanalysis of Mangifera Malesiana, Series I, 8 (3), p. 395-548.
Kiew R. Teo L.L, Gan Y.Y., 2003. Assesment of the
classification. It is strongly supported by hybrid status of some Malesian plants using
another molecular marker such as ITS and Amplified Fragment Length Polymorphism. Telopea
matK, so it is very important for collaborating 10 (1), p. 225-232.
some molecular marker in making best Kostermans A. J. G. H., Bompard J. M., 1993. The
classification system of Mangifera. manggoes: Their Bothany, Nomenclature, Horti-
culture and Utilization. IBPGR Academic Press.
Harcourte Brace & Company. London.
CONCLUSIONS Mukherjee S.K., 1953. Origin, Distribution, and
Phylogenetic affinity of the species of Mangifera L.
Phylogenetic analysis of 16 species of Mangi- Journal of the Linnean Society, Botany. LV, p. 65-
fera using rbcL gene sequence in chloroplast 83.
reveal that Mangifera is a monophyletic Mukherjee, S.K., Litz R.E., 2009. Introduction: Botany
and Importance. The mango 2nd Edition. Botany
239
productionand uses. Center for tropical Agriculture length polymorfism. Molecular ecology 11,
and Botany-CAB International. Blackwell sciene Ltd., p. 1456-1469.
Porebski S, Bailey L.G., Baum B.R., 1997. Modification Thompson J.D., Gibson T.J., Plewniak F., Jeanmougin,
of a CTAB DNA extraction Protocol for Plants F., Higgins D.G., 1997. The ClustalX windows
Containing High Polysaccaride and Polyphenol interface: flexible strategies for multiple sequence
Components, Plant Molecular Biology Reporter 15 alignment aided by quality analysis tools. Nucleic
(1), p. 8-15. Acids Research, 25, p. 4876-4882.
Roderic D.M., 2001. Tree View Win 32. http://taxo- Yamanaka N., Hasran M., Xu D. H., Tsunematsu H.,
nomy.zoology.gla.ac.uk/ rod/rodhtml.. Idris S., Ban, T., 2006. Genetic relationship and
Sawangchote P., Grote P.J., Dilcher D.L., 2009. Tertiary diversity of four Mangifera species revealed through
Leaf Fossils of Mangifera (Aanacardiaceae) from Li AFLP analysis, Genetic Resources and Crop
basin, Thailand as examples of the Utility of Leaf evolution 53, p. 949-954.
Marginal Venation Characters. American Journal of Yonemori K., Honso C., Kanzaki S., Wiadthong
Botany 96 (11), p. 2048-2061. W., Sugiura A., 2002. Phylogentic relathionship of
Swofford D.L., 2000. PAUP*, Phylogenetic Analysis mangifera species revealed by ITS sequences of
Using Parsimony (*and Other Methods). Versi nuclear ribosomal DNA and a possibility of their
4.0b10. Sinauer Associates. hybrid origin. Plant Syst. Evol. 231, p. 59-75.
Teo L.L., Kiew R., Set O., Lee S.K. Gan Y.Y., 2002. Zhang M., Fritsch P.W., Cruz B.C., 2009. Phylogeny of
Hybrid status of kuwini, Mangifera odorata Griff. Caragana (Fabaceae) based on DNA sequence data
(Anacardiaceae) verified by amplified fragmenth from rbcL, trnS–trnG, and ITS. Journal Molecular
Phylogenetics and Evolution 50, p. 547–559.
240
VARIABILITY OF SOME APRICOT VARIETIES AND HYBRIDS

PRODUCTIVITY TRAITS CREATED IN ROMANIA
Valerica TUDOR, Adrian ASĂNICĂ, Georgeta TEMOCICO
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Blvd, District
1, 011464, Bucharest, Romania
Abstract
Current requirements of the species Prunus armeniaca in terms of creating new varieties require a conducted extensive
research in the apricot breeding program in the south-eastern of Romania. It’s been proceeded for early selections
based on correlations in order to create new varieties with high productivity and organoleptic qualities. Characteristics
and traits of the 36 varieties and hybrids of apricot studied, grouped according to the period of maturation, were
studied starting with the IPGRI descriptors used in Genus Prunus. The characteristics were followed: trunk cross-
sectional area (cm2), fruit production (t/ha), the number of fruit tree branches unit length of thick branch and fruit
branch type specific for apricot. The resulting correlations between fruit production (t/ha) and the number of fruit tree
branches unit length of thick branch R2=0,1084***. For series of data belonging to fruit production (t/ha) and number
of fructification branches (spur branches, short branches, long branches and mixt branches) the correlation coefficient
had a lowered value, between 0,0007 si 0,0524**. So, this resulted in a somewhat correlation between fruit production
(t/ha) and number of spur branches to the unit length of thick branch R2= 0524**.
Key words: apricot, varieties, productivity, fructification branches, correlations.
INTRODUCTION The trunk cross-sectional area was calculated

after the formula TSA (cm2) = D x d, in which
The creation of apricot varieties with different
D = diameter of the trunk on the rows direction
fruit maturation periods, especially extra early
and d = diameter of the trunk perpendicular on
and late maturation (Bassi D. and Audergon
the row direction.
J.M., 2006), has been a priority since 1980 to
Characteristics of fructification type is a
improve the program in Romania. The market
genetic particularity and it shows the
had a demand for extra early apricots
predominating fructification of the varieties. 3
(Audergon J.M., 1995), until recently satisfied
trees were marked from each variety and
by importing them from the Mediterranean
hybrid, choosing and marking the thick branch
countries like Italy, France, Spain and Turkey
in which the dynamically numbered and
is a strong argument for the scientists involved
measurements of the fructification branches
in the improvement of this species.
(Cociu V. and Oprea St., 1989). They were
counted and registered: number of fructification
branches unit length of thick branch, number of
The biological material is represented by 36 spur branches unit length of thick branch,
varieties and hybrids of apricot with different number of short branches unit length of thick
fruit maturation periods: very early (ve), early branch, number of long branches unit length of
(e), middle (m) and late (l). thick branch and number of mixt branches unit
These were grouped according to the period of length of thick branch.
maturation and studied starting with the IPGRI Fruit production was calculated from the
descriptors used in Genus Prunus. medium production, cross-referred to the
The characteristics were followed: trunk cross- density of 625 trees per hectare (4 x 4m).
sectional area (cm2), fruit production (t/ha), the For a more objective interpretation, the results
number of fruit tree branches unit length of were statistically processed using statistical
thick branch and fruit branch type specific for software, obtaining the coefficient of variability
apricot.
241
analysis of variance to express the variability in Valeria (ve), Viorica, Carmela (e) with 26
the character analysis. branches, Dacia (e) and Rares (ve) with 25
branches, Ilinca (m) – 24 branches, Alexandru
RESULTS AND DISCUSSIONS and Andrei (m) each with 21.
The variability of number spur branches /linear
Trunk cross-sectional area (cm2)
meter of thick branch has a high value
The lower section of the trunk had the
expressed by the coefficient of 71,57%.
phenotypes: Andrei (m) with 180 cm2, 82.12.2
Number of short branches /linear meter of
BIV (e) and Valeria (ve) with 184 cm2 and
thick branch
Rares (ve) with less than 190 cm2. The most
The phenotype 85.2.89 BIII (m) had the most
phenotypes with over 250 cm2, resulted to be:
short branches number/linear meter of thick
Adina (l), Excelsior, Ilinca, Bucovina (m) and
branch (over 22), followed by the phenotypes:
Favorit (l).
Adina (l), 85.4.108 BIII (m), 85.3.100 BIII (m),
Significant differences were provided for a
82.28.62 BIV (m) and 82.12.7 BIV (l), with
probability of error of up to 5% between
medium between 15-20 short branches /linear
maturation groups, with limits ranging from
meter of thick branch. The variability of the
189 cm2 to 231 cm2 (Figure 1). Variability to
number of short branches/linear meter of thick
the index of section of the trunk has a high
branch had a high value, expressed by the
value, expressed by the variability coefficient
coefficient of 52,61%.
of 55,92%.
Number of mixed branches /linear meter of
thick branch
The phenotypes with the most mixed branches
number were: 82.16.7 BIV (l) with 26 mixed
branches/linear meter of thick branch,
Excelsior (m), 82.15.48 BIV (l), 82.32.9 BIV,
82.7.65 BIV,
Ilinca (m) and 82.4.41 BIV (l) between 20 and
25 mixed branches/linear meter of thick branch.
Groups of very early phenotypes do not bear
fruit on the mixed branches.
Significant differences were provided between
Figure 1. Phenotype influence on cross-sectional area of the late maturation group (15 branches), the
the trunk based on the year of study medium (10) and the early (2 branches) (Figure
2). The variability of the number of mixed
The total number of fructification branches / branches /linear meter of thick branch has a
linear meter of thick branch high value, expressed by the coefficient of
The phenotype Ilinca (m) had the highest 102,05%.
average number with 47 of fruiting branches.
45 of fruiting branches had the phenotypes:
Viorica (e), Nicusor (m) and Excelsior (m).
With 44 of fruiting branches presented the
phenotypes: Adina (l), Favorit (l) and Carmela
(e) each with 43 of fruiting branches and Dacia
(e) with 40 of fruiting branches. The coefficient
of variability of the total number of
fructification branches/linear meter of thick
branch, expressed a medium-high value by the
coefficient of 21.81%.
Number of spur branches / linear meter of
thick branch Figure 2. Influence of maturation class of fruits on on the
The phenotypes with the bigest number of spur number of medium branches / linear meter of thick
branches were: Nicusor (m) – 27 branches, branch based of the year of study
242
Number of long branches /linear meter of
thick branch
The phenotypes with highest number of long
branches number with medium maturation
were: 85.18.5BIII, 85.1.96 BIII – Nicusor,
85.4.108 BIII, 85.4.95 BIII, Excelsior Mt.,
85.2.89 BIII and the phenotype with early (e)
maturation Carmela. The variability of number
long branches /linear meter of thick branch has
a high value, expressed by the coefficient of
59,66%.
Fruit production (t/ha)
Figure 4. Intensity correlation between fruit production
The most productive phenotypes were: Dacia, and tree trunk cross sectional area
Viorica (e), followed by Excelsior (m), Adina
(l), Carmela (e), Nicusor, Siret, Ilinca, Favorit,
Bucovina, the differences were not statistically
assured. Variability in fruit production (t/ha) The correlation of coefficient calculated
had a high value, expressed by the coefficient between the number of fructification branches
of variability of 72,96%. and number of spur branches was 0,2379
Correlations between fruit production (t/ha) (Figure 5), between the number of fructification
and its components branches and number of long branches 0,1072
On the 36 phenotypes a series of correlations (Figure 6), between the number of fructification
were made between fruit production (t/ha) and branches and number of short branches 0,0623
its components referring on the number of the (Figure 7) showing a high correlation, while the
fructification branch / linear meter of branch correlation coefficient obtained between the
and the type of fructification branches with number of fructification branches and number
direct implication on fruit production. First of mixed branches had a smaller value of
correlation is showed between fruit production 0,0117 (Figure 8), which indicate a reducted
(t/ha) and the number of fructification branches degree of correlation.
per unit length of thick branch, by the existence
of a high coefficient of correlation 0,1084
(Figure 3).
Figure 5. Intensity correlation between the number of

branches of fruit and number of may branches to the unit
length of thick branch
Figure 3. Intensity correlation between fruit production
and the number of fruit tree branches unit length of thick
branch
A strong correlation was observed between fruit

production (t/ha) and tree trunk cross-sectional
area which is based on determining a high
correlation coefficient of 0,7748 (Figure 4).
243
highlighted by a correlation coefficient of 0,466
(Figure 9), but with other types of fruit
branches, the correlation is different.

fructification branches and number of long branches to
the unit length of thick branch
Figure 9. Intensity correlation between cross-sectional

area of the trunk and the number of fruit branches to the
unit length of thick branch
CONCLUSIONS
These significant correlations were found
between:
- fruit production (t/ha) and number fruiting
branches/linear meter of thick branch R2 =
0,1084***.
branches of fruit and number of short branches to the - fruit production (t/ha) and tree trunk cross-
unit length of thick branch sectional area R2 = 0,7748***.
- the number of fruit branches and the number
of spur branches R2 = 0,2879***.
- the number of fruit branches and the number
of long branches R2 = 0,1072 ***.
- trunk cross-sectional area and the number
fruiting branches / linear meter of thick branch
R2 = 0,466 ***.
REFERENCES
Audergon J.M., 1995. Variety and breeding, apricot
culture. Acta Horticulturae 384, p. 35-44.
Bassi D., Audergon J.M., 2006. Apricot breeding: update
and perspectives. Acta Horticulturae 701, p. 279-294.
Balan V., Tudor V., Petrisor C., 2006. Maintenance of
branches of fruit and number of mixt branches to the unit
biodiversity of apricot tree phenotypes in Romania.
length of thick branch
ActaHorticulturae 701, p. 199-206.
Cociu V., Oprea St., 1989. Metode de cercetare in
Correlation between trunk cross-sectional ameliorarea plantelor pomicole, Ed. Dacia, Cluj-
area and the number fruiting branches Napoca.
Direct relationship between trunk cross- Tudor V., 2010. Teza de doctorat. Cercetari privind
comportarea noilor soiuri si hibrizi de cais obtinuti la
sectional area and the number of fructification
S.C.D.P. Baneasa pentru zona de sud a tarii.
branches/linear meter of thick branch is
244
NEW H1 BUZAU F1 HYBRID OF EGGPLANT OBTAINED

AT V.R.D.S. BUZĂU
Costel VÎNĂTORU, Eliza TEODORESCU, Bianca ZAMFIR
Vegetable Research and Development Station Buzau, No. 23, Mesteacanului Street,
zip code 120024, Buzau, Romania
Abstract
The absence of local hybrids for greenhouses imposed starting an intensive breeding program at V.R.D.S. Buzau since
1996. The main purpose of the program is obtaining valuable hybrids which show strongly F1 heterosis. Through inter
and intraspecific hybridization works in Solanum genus, besides disease resistance inheritance, valuable features can
be obtained: genetical resistance at extreme weather, extremely high or low temperatures, water stress or salinity
(Downey M.C.,1991). Obtaining productive hybrids with genetical resistance at Verticilium dahliae fungus allows the
elimination or the decrease of chemical treatments which would lead to cost reduction and environmental pollution
decrease (M. Tudor,1996). After evaluation and intensive breeding work with germplasm resource, it was obtained a
number of 22 stable genitors. After general and specific combining ability were obtained a large number of hybrid
combinations. L1 A and L1 S hybrid showed F1 superiority and phenotipical uniformity, obtaining H1 Buzau F1 hybrid
in 2010. Comparative crops both from greenhouses and field revealed valuable genetical resource which demonstrated
phenotipically reproductive and adaptive heterosis and also high productivity and ecological plasticity.
Key words: breeding, heterosis, hybrid, genitor, germplasm.
INTRODUCTION field where was intensively improved. Working

field contains 22 valuable genitors which are
Hybrid F1 eggplant seeds become a necessity,
part of the conservative selection plan. The
especially for glass crops. In our country, the
main criteria which formed the base for
lack of local hybrids at these species led to the
choosing the material for collection and to
purchase of foreign hybrids at very high prices
transfer it in the working field were:
and these did not meet the consumers and
- genetical inheritance of the genitors which
growers requirements. As a result, Breeding
manifests clearly important phenotypical
Laboratory from V.R.D.S. Buzau studied a
features
research plan since 1996 which aimed
- genitors stability and uniformity expressed
obtaining F1 local hybrids at eggplant in
through decreased variability of the main
competition with ones from prestigious brands.
characters and their progeny transfer
In the breeding works has been studied a
- genetical ability of the genitors to
valuable genetic material, adapted to our
hybridization process, this aim being reached
environmental conditions but it had not been
by testing combining general and specific
neglected foreign genotypes which had shown
ability
important features.
The 22 genitors that form the work field were
crossed and were obtained a number of
combinations in order to obtain reproductive,
The research started in 1996 acquiring valuable adaptive and metabolic heterosis. Hybrid
genetical material for collection field. combination which demonstrated clearly this
Germplasm resource contains over 60 phenomenon was realized between L 1 A and L
important lines advanced breeded. After 1 S genitors. It was used classical hybridization
forming the collection field, it was evaluated by female flowers castration and elimination of
with observation sheets and chromosomal map. stamens before opening to avoid self
After the evaluation the important material was pollinating.
transferred from the collection field to the work
245
without heat and in open field. Crop technology
was the classical one for each system. To
highlight the main parameters of the new
hybrid, Aragon by Hazera, a top market hybrid
was used as monitor.The main data from the
both crop systems measured at genitors, new
hybrid and monitor plants and fruits are
presented in table nr. 1,2, 3 and 4:
Table 1. The main biometric data measured in

greenhouse
Shoot
Plant no. Leaf Plant
Figure 1. Hybridization Cultivar height no./plant Habit diameter
(cm) main sec. (cm)
big small
L1A 200 3 8 32 36 erect 70
As novelty in hybridization process (Figure 1) L1S 80 3 6 35 62 erect 65
was the implementation of a new technology H1 Bz F1 100 4 8 52 86 Globular 70
method of pollen transfer from maternal to ARAGONF1
92 4 8 48 68 globular 67
paternal genitor. This method was elaborated at (MT)
V.R.D.S. Buzau and consists of using a liquid
solution of water and sugar or honey mixed The registered values highlight the main
with patern pollen and then the flowers are characters distinctibility of the genitor, hybrid
sprayed bathing with this solution. This and monitor plants. In what concerns plant
method has many advantages as: height, genitor L1 A range first followed by H1
-the liquid solution feeds and hydrate pollen Bz. In what concerns shoots number/plant, H 1
grains giving them long life and resistance to Bz came first followed by monitor. The big
drought. number of leafs, superior to genitors and
- adding pollen grains to female flower is a monitor hybrid demonstrates that this plant
softer action avoiding aggression and manifest somatic heterosis which is an
mutilation. important feature for breeding. Altough
- sugar or honey are adherent so they are fixing genitors of the hybrid have erect habit, F1
the pollen grains to flower stigma avoiding hybrid resulted has an uniform globular shape
pollen release. resembling with the one of monitor. Plant
-higher efficiency, secure and easer work in the diameter highlights increased vigor of the
hybridization process. hybrid from both genitor and monitor.
RESULTS AND DISCUSSIONS Table 2. The main biometric data measured in field
Shoot
The research undertaken at this species from Plant Leaf Plant
no.
1996 since now had finished with valuable Cultivar height no./plant Habit diameter
results: (cm) main sec. (cm)
big small
-it was constituted and conservated a L1A 118 3 6 24 22 erect 46
germplasm resource of which could be L1S 68 3 5 26 36 erect 40
obtained new valuable creations H1 Bz F1 75 4 6 38 48 Globular 45
-were obtained 22 important genitors with high ARAGONF1
71 4 5 32 41 globular 42
ability to create new varieties and hybrids (MT)
-the entire collected material was tested for
general and specific combining ability and the The values registered in field are significantly
results were saved on computer reduced at all studied parameters both at
-H1 Buzau F1 hybrid was obtained in 2010 genitors and H1 Bz hybrid and monitor. The
which meets the main proposed objective. habit of the plant was not transformed in this
H1 Buzau F1 hybrid was studied 3 years after environmental conditions.
the release in two crop systems: greenhouse
246
Table 3. The main biometric data measured at fruits in greenhouse
Fruit Fruit diameter Fruit
Fruits no. Fruit colour
Cultivar weight (cm) lenght Pulp consistency
/plant
(gr) base middle top (cm) outside inside
L1A 12 380 3.4 5.5 1.5 24 black Yellow Normal
L1 S 6 441 4.8 8.1 4 20 black Yellow Normal
H1 Bz F1 8 777 5.4 8.4 6 28 black White Fluffy
ARAGON F1 (MT) 8 628 4.8 7.2 5.1 26 black White Fluffy
Table no. 3 presents that the number of fruits fruit base, middle and top shape, measurements
per plant at H1 Bz hybrid represented an which demonstrated H 1 Bz superiority. The
average of the genitors values but average inside and outside fruit colour and consistency
weight was significantly higher than gemitors shows that hybrid production is high quality
and monitor. The fruit shape could be and meets the present requirements of the
reconstituted easily after the values concerning consumers. (Figure 2).
Table 4. The main biometric data measured at fruits in field

Fruit Fruit diameter Fruit
Fruit colour
Cultivar weight (cm) lenght Pulp consistency
(gr) base middle top (cm) outside inside
L1A 223 2.8 4.3 1.3 19 black Yellowish white Normal
L1 S 315 3.6 6.8 3.3 17 black Yellowish white Normal
H1 Bz F1 482 4.5 7.2 5.4 22 black White Fluffy
ARAGON F1 (MT) 420 3.9 6.6 4.6 21 black White Fluffy
Biometric measurements registered in the field

shows that all studied cultivars presented
significantly reduced values at all characters,
only inside and outside colour and pulp
consistency remaining unchanged. Even in this
crop system, the new hybrid showed superiority
both to the monitor and genitors.
Figure 3. Hybridization (fruit group detail)
CONCLUSIONS
The registered values of H 1 Bz hybrid (Figure
Figure 2. Crop detail; fruit lenght and longitudinal 3) in the two crop systems, both greenhouse
section of fruit
and field, showed clearly reproductive and
adaptive heterosis phenomenon objectified
through yield significantly higher than genitors
247
but the fruit had a reduced number of seeds and REFERENCES
the pulp is white and fluffy. Bunescu D, Sindile N., Atanasiu C., 1972. Comportarea
After testing for 3 years at V.R.D.S. Buzau and unor soiuri, linii si hibrizi de patlagele vinete, Anale-
in other vegetable areas where the seed had vol. II, I.C.D.L.F. Vidra, Ed. M.A.D.R.-A.S.A.S.,
Bucuresti, p. 11-23
been spread, they came to the conclusion that Dracea I., 1972. Genetica. Editura Didactica si
this new hybrid must be introduced widely for Pedagogica, Bucuresti, p 317-332
production replacing the missing varieties for Tudor M., 1996. Posibilitatea obtinerii formelor
greenhouse and field so it was registered and androsterile de patlagele vinete prin hibridarea
proposed starting with 2013 for patenting. interspecifica” “Anale”-vol. XIV, I.C.D.L.F. Vidra,
Ed. M.A.D.R.-A.S.A.S., Bucuresti, p. 53-59.
248
NEW LINES OF AMARANTHUS OBTAINED AT V.R.D.S. BUZĂU
Bianca ZAMFIR, Costel VÎNĂTORU, Eliza TEODORESCU
Vegetable Research and Development Station Buzau, No. 23, Mesteacanului Street, zip code
120024, Buzau, Romania
Abstract
The conservation and revaluation of biodiversity initiated by S.C.D.L. Buzau and Genetics and Breeding Laboratory
aimed to study Amaranthaceae species. These species were neglected until now both scientifically and as crop. The
appeareance of these species is not known but it is well known that were here since ancient times. A proof is the
existence of endemic populations and a wide range of biotypes which contains 16 species of Celosia and Amaranthus
with origin in the Romanian geographic area.The research of S.C.D.L. Buzau during 2005-2012 highlighted new
valuable data, especially in what concerns their multiple uses and wide range of expressivity of these species. This
study of 3 new obtained lines is a step towards this species. Data and germplasm source accumulated till now
guarantee that in the future we can enrich scientific data.
Key words: biodiversity, biotype, endemic, expression, germplasm.
INTRODUCTION
Modern possibilities to inform people
nowadays and free travelling abroad since 1990
highlighted new valuable data about
Amaranthaceae family. Altough for many
people this species is considered a weed, the
scientists proved otherwise, that this can be a
valuable food, an exceptional medicinal herb,
an important biomass resource and last but not
least a real ornamental plant. In the past, in our
country, this plant was collectively known as
”red amaranth”, being used in Romanian
households in various dishes and wild amaranth
cultivars were used in animal feed. As the time
passed this edible plant was neglected and
nowadays we rarely find it in traditional
households. (Figure 1)
Starting 2005, Breeding Laboratory
of V.R.D.S. Buzau studied this species
creating and implementing a specifical Figure 1. Amaranthus seedlings lines
breeding program for this species.
The main objectives of this program were:
-preservating genetic sources and enriching
countinously the general collection field with MATERIALS AND METHODS
new genotypes
-valuable genotypes breeding for obtaining new Breeding works started with a documentation
creations with phenotypical expression specific program focused on national and international
for uses direction achievements. After this study we concluded
-gathering a database for better knowing the that nationally this species is little known
species. compared with international top achievements.
249
Genetic autochthonous heritage was from rare villages placed 700-800 m altitude.
inventoried and 16 species were discovered in The residents used it in the past as edible plant
spontaneous flora, many belonging to especially to prepare soups. As the plant
Amaranthus retroflexus, Amaranthus liividus matured, it lost its juiciness becoming string
and Amaranthus blitoides species. Worldwide and being used for animal feed. After
we found that are over 800 species of specifically selection works we limited the
Amaranthus. main characteristics variability, we eliminated
The next step aimed to form a collection field atypical biotypes and the species performances
which has presently 20 valuable genotypes dramatically increased. The main use of the
from local and foreign origins. After line is the edacious one because of its exception
intensively breeding works, 3 of them were properties : juiciness of shoots and leaves, yield
promoted in the work field: L1, Amaranthus potential, over 22 t/ha and last but not least red
retroflexus, L4, Amaranthus caudatus, L5, or garnet natural colour present all over the
Amaranthus cruentus. These lines correspond plant.
D.U.S. criteria demonstrating distinctness,
homogeneity and stability as for were
undergone to conservative selection program.
Crop establishment was made by seedlings
grown on 70 holes alveolar pallets on red
grounded nutritional turf substrate. Seedlings
production is similar to the other vegetable
species production, to mention that seedlings
were thinned after spring and a single plant was
left per hole. This work was necessary because
of the extremely small size of the seeds,
making imposible the introduction only of one
seed in a hole. Field crop establishment was
made on 1,4 m shaped land using L 445 tractor
in aggregate with MMS 1,2. Planting was made
in equidistant rows spaced at 70 cm and 35-40
cm distance between plants per row. The crop
Figure 2. Seedling details: entire plant, upper and
did not require special care works, were only underside of the leaf
manually and mechanical breed and irrigated.
Was not necessary to apply chemical or
biological treatements against pests and
diseases or soil and foliar fertilization. The 3
crops displayed original potentiall for
successfully ecological cultivation.

Breeding works ended obtaining until now 3
new valuable lines with different application
directions. Also a rich germplasm collection
was gathered containing valuable lines in
Figure 3. L1 crop and inflorescence detail
different breeding state, one of them grown for
the first time in our country and would be
L4- Amaranthus caudatus
presented in our future works.
This line (Figure 3 and 4) was cultivated also
The obtained lines are the following:
for the first time in our country, was purchased
L1-Amaranthus retroflexus
through a biologic material exchange with a
This line (Figure 2) comes from an endemic
private Dutch collector. This species is
local population discovered in the Buzau
collectively called ”elephant trunk”, similar
mountain side, Lopatari locality composed
250
varieties existed in our country too but called characters variability cultivar and after the
”turkey crest”. Initially this cultivar presented implementation of the breeding program we
many biotypes but after a rigouros selection limited these characters variability to a normal
atypical biotypes were eliminated, the main state. The aim of breeding was to use the plant
biotype that respected criteria required by as an ornamental one but we did not exclude
”variety” notion was maintained. other uses, especially alimentary one. This
In the breeding program, the main objective for plant is vigorous, remarkable by its erect spike
this line was aimed on ornamental use of the inflorescence intense red garnet coloured,
plant that was successfully accomplished. The extremely beautiful. (Figure 7). The studies
possibility of using this line like an edible plant undertaken until now showed that this biologic
is not excluded but we mention that the edible creation and also the previous ones did not
vegetative mass yield is smaller than the one require special technologies, L4 and L5 could
obtained at L1 and more restricted concerning be cultivated in protected grounds and
period of time. It can be used with that purpose ornamental pots mentioning that their size
until flowering. dramatically diminished in pots compared with
natural field conditions.
Figure 6. Seedling details: entire plant, upper and

Figure 4. Seedling details: entire plant, upper and underside of the leaf
underside of the leaf
Figure 5. L4 crop and inflorescence detail Figure 7. L5 crop and inflorescence detail
L5-Amaranthus cruentus The main characteristics of Amaranthus lines in

This line (Figure 5 and 6) comes from the same seedling state are presented in table 1 and the
place as line 4. This line was also cultivated main characteristics of the plants in table nr.2:
from the first time in our country since 2006.
At the beginning it behaved as a large main
251
Table 1. The main characteristics of Amaranthus
seedlings lines
Characteristics/lines L1 L4 L5
Sowing date 3.04.2012 3.04.2012 3.04.2012
Spring date 9.04.2012 9.04.2012 9.04.2012
Planting date 23.05.2012 23.05.2012 23.05.2012
Seedling height (cm) 20 22 24
Collar diameter (mm) 4 3 4
Number of leaves 16 10 12
Leaf lenght (cm) 3 5,7 6
Stalk lenght (cm) 2,3 2,3 2 Figure 10. L5 seeds detail
The undertaken research demonstrate that all 3

obtained lines produce a large number of seeds,
L5 ranks first after L4 and the last being L1. Table 2. The main characteristics of the plants
We conclude that seed maturation is phased Character/line L1 L4 L5
starting with inflorescence base to the top. All Plant height (cm) 85 165 115
the lines preserve germination ability because Stem height (cm) 6 28 16
of seed body covered with a glassy and chitin Number of shoots/plant 12 3 7
integument that confers long storage period. Plant diameter (cm) 70 55 75
greenish- purple garnet-
According to the conducting tests made in 2005 Inflorescence colour
red red red
and restored on the same seed batch in 2012 Inflorescence length (cm) 12 78 38
germination percentage meanwhile has been Number of inflorescence
4 6 8
decreased averagely for all the lines with 5%. ramifications
The seeds sizes are too small, L1 has a seed of 1- rose-
Seeds colour black black
1,2 mm diameter (Figure 8), L 4 (Figure 9) white
presents a very shiny seed of 1 mm diameter and
L5 (Figure 10) has a smaller seed of 0,8 mm,
slightly flattened similar with grains of sand.
CONCLUSIONS
Research carried out in 2005-2012 ended until
now with the following results:
-a germplasm collection was gathered at this
species from collection field and work field.
-breeding works for L1, L4 and L5 lines ended
and would be registered and proposed at
I.S.T.I.S. for patenting and seed production and
Figure 8. L1 seeds detail
broad range multiplication.
-a valuable database was gathered which would
contribute successfully at breeding works.
REFERENCES
Bayer company product, 1996. Determinator de buruieni,
p. 27-29.
Bayer company, 2012. Catalog de produse, p. 208.
Pârvu C., 2006. Universul plantelor, Editura ASAB,
Figure 9. L4 seeds detail Bucuresti, p. 21-22.
252
PLANT
PRODUCTION
SYSTEMS
THE EFFECT OF CONTAINER TYPE AND SOIL SUBSTRATES ON

GROWTH AND ESTABLISHMENT OF SELECTED LANDSCAPE TREES
Hani AL-ZALZALEH
Aridland Agriculture Department, Kuwait Institute for Scientific Research, P.O.Box:24885, Safat,
13109, Safat, Kuwait
Abstract
Root coiling and spiraling are the problems faced by the nurserymen for producing quality tree seedlings for
landscaping. The effects of various container types and substrate interactions on plant growth, and the influence of
container type on post transplanting in the desert environment were investigated. Two arid- region plant species known
for producing deep taproots (Acacia saligna and Eucalyptus viminalis) were selected for the study. Conventional
nursery pots were compared with root trainers and spring rings to determine the root growth and architecture. Results
showed that Acacia plants grown in spring rings showed significant increased plant height where as conventional pots
give highest root weight and as a consequence produced greater plant biomass. Clear trends for Eucalyptus was less
obvious, but tended to contrast with the findings for Acacia. Studies on the effect of combination of organic soil and
container type revealed that Eucalyptus plants grown in conventional containers have the highest plant growth. Among
the soil mixes, Eucalyptus grown in 100% clay soil had a greater leaf area. When the plants were transplanted into an
arid landscape, the plants grown in the spring rings distributed in all directions in the soil, and this habit is likely to aid
the tree in future. In this study, the results showed that container type could affect the aerial parts but this depends on
the plant species. Results demonstrated that spring rings reduce harmful root biomass (encircling roots) and encourage
root primordia. Differences in root and shoot growth resulting from the use of a range of growing media did not seem
to interact with container type. The effect of the spring ring on plants grown in the landscape was obvious visually in
the short term but not apparent from growth quantification.
Key words: arid, containers, landscaping, root trainers, spring rings.
INTRODUCTION the development of a few dominant roots, and

so produce a fibrous root system on all sides
Development of management strategies that
that holds the root ball together (Mullan and
potentially promote rapid post-transplant root
White, 2002). The longevity of individually
growth is the key to successful seedling
container grown trees depends on container
establishment. The urbanization demands huge
volume, dimensions and the container shape.
quantity of diversified quality planting
Container type (Sutherland and Day, 1988) and
materials, growing medium and the plant
container dimension (Schuch and Pittenger,
containers. Moreover, with the introduction of
1996; Nesmith and Duval, 1998) also have a
indoor and miniature gardens different types of
marked effect on root and plant growth
containers and soil mixes are found to be
(Handreck and Black, 1984). In a work on
essential for the proper growth of the plants.
Eucalyptus camaldulensis, Ngulube (1989) find
Plants grown in conventional containers for too
that seedling growth increases with planting
long often have deformed roots that are kinked
tube size.
or grow along the sides or bottom of the root
Soil physics also interacts with root
ball. Root restriction is an inherent problem
architecture. The physical property of the soil
with container grown trees (Arnold, 1996).
determines the growth of the root system
Delay in transplanting from a conventional
(Cockroft and Wallbrink, 1966). Roots tend to
container to the landscape increases the chance
elongate more in a sandy soil whereas they are
of developing poor root architecture. Many
short and more branched in a loamy soil (Perry,
alternative container types have been designed
1982; Muthana et al., 1984). When the physical
to reduce the incidence of deformed roots
factors experienced by container grown plants
(Gilman et al., 2003). The important factor in
are compared to landscape destination, the
deciding an improved container is to prevent
255
performance of the container plants might be compared with root trainers (4x10x3cm), and
improved in long term. The growing media spring rings (3.5x10x3.5cm). Every week each
texture could affect plant growth since it will container was turned 90 degrees so that light
control moisture, aeration and nutrients levels around each plant were relatively even.
(Awang and Hamzah, 1986). The rate and After fifteen weeks, plants were harvested and
pattern of root growth in the soil vary with the recorded the data. The number of leaves per
physical, chemical, and microbiological plant was counted and leaf area was measured
properties of soil (Brown and Scott, 1984). The with an automatic leaf area meter (Delta T
physical properties of the soil can modify root Devices). Leaf and shoot fresh weight was
diameter, development of root hairs and the taken immediately after excision from plant.
branching pattern of lateral roots (Lucas, 1987). Leaf and shoot dry weights were recorded. Dry
However the interaction between the container weight for leaf and shoot was determined after
size and soil substrates is less well understood drying for 72 hours at 80°C. Shoot height from
and less frequently studied. the soil level to the tip was recorded. The fresh
Considering the massive greenery activity in and dry weight of the root and the root length
Kuwait, it is important to produce plants with was also measured. The experiment was laid
quality characteristics, and with no initial out in a randomized design with five plants per
deformation in their root system. To achieve treatment. Three blocks consisted of three
this objective, suitable plants as well as the best treatments with five replications, giving a total
possible production technologies for of 45 replicates for each experiment
optimization of greenery enhancement is to be Experiment no; 2
developed (Bhat, 1997; Taha et al., 1988). A total of 120 uniform seedlings were chosen
Poorly formed root systems may disrupt for the trial. The container treatments were
management objectives and cause unplanned Conventional pots, Spring rings and Root
maintenance expenses. The development, size, trainers where as clay 100%, sand 100%,sand
form and function of root systems are 85% and clay 15%, sand 70% and clay 30%,
controlled by environmental and management sand 55% and clay 45 were the soil series
conditions that modify the expression of treatments. Throughout the study, containers
characteristics (Harris, 1992). The findings of were rotated and excess bottom roots were
this study are likely to help landscape engineers clipped to maintain root growth within the
and environmentalists. containers. The time gap between the two
The present study tries to understand the destructive harvests was five months. The
effectiveness of alternative containers and experiment was laid as a completely
different soils on tree growth. Evaluation of randomized design with eight replications.
different containers on plant growth after Experiment no. 3
transplanting in the field at a desert Eucalyptus seedlings grown in United
environment was also studied. Kingdom were air shipped to Kuwait and was
experimented at Salmiya waterfront experiment
MATERIALS AND METHODS station. Spring rings, Root trainers, and Round
containers were used as treatments. The
Experiment no.1
dimensions were 3.5x10x3.5cm, 4x10x3 cm
The first two experiments were conducted at a
and 3.5x10x3.5cm respectively for Spring
greenhouse of Plant Sciences Department,
rings, Root trainers, and Round containers. The
University of Reading, United Kingdom with
plants remained in the containers for nine
an average daily maximum temperature of
months and then transplanted into an open field
34°C and a minimum of 18°C. The Seeds
in a randomized block design at a spacing of
obtained from Chiltern Seeds Company were
3x3 m. Destructive harvesting took place after
germinated in plug trays. The dimension of
a year. All plants were carefully dug up from
each cell in the tray was 3.7x5.5x1.5 cm. Three
the field and the soil particles were washed off.
weeks after germination, seedlings were
Fine sieves were used to prevent any loss of
transplanted into the treatment containers filled
root biomass.
with SHL potting mixture. Conventional
nursery plastic pots (4.5x9x3cm) were
256
Data were subjected to statistical analysis with growth. For example, on apple trees caused a
the SAS (SAS Institute Inc., Cary, NC) decrease in leaf area and dry weight of total
package. Method of least significant different plant, but these growth declines may be
(LSD) was applied to separate means. expected where resources are limiting relative
to the ability of the root system to meet the
RESULTS AND DISCUSSIONS needs of the top growth (Ferree, 1989). It was
found that in spring rings under both water and
Effect of container geometry
root restrictions branching of the shoot and
The effect of different containers on root and
total plant dry matter accumulation were
shoot growth of Acacia saligna and Eucalyptus
greatly reduced (Krizek and Dubik, 1987).
viminalis was listed in (Table.1). A. saligna
The actual mechanism by which the difference
plants grown in spring rings show a significant
in plant height among different containers
increase in plant height. None of the
could occur is not clear. It may be due to the
experimental containers allowed Acacia plants
container shape and the openings around spring
to produce a marked difference in leaf area or
rings that will produce a better growing
leaf number. Even though the leaf fresh and dry
medium as a result of better gas exchange. The
weight was higher in conventional pots, it did
growing media in containers should have high
not vary significantly from the spring rings.
water movement, good drainage and aeration
The negligible difference in the shoot fresh and
(Donahue et al., 1983). The excess water not
dry weight and also total top biomass fresh and
used by a seedling produces a waterlogged
dry weight reveals that the differences in
condition that impairs aeration; this in turn
containers did not affect much in the shoot
reduces photosynthesis, translocation and
growth of the plants. The low fresh and dry
growth (Sutherland and Day, 1988). It may also
weight of roots in spring rings may be due to
be that the proliferation of root tips due to air
the self pruning of roots when come in contact
pruning in spring rings could lead to an
with air after emerging from the numerous
increase in root produced hormones.
holes. The net result shows that the total plant
Alternatively, plants grown in spring rings have
biomass has significantly higher in
suffered from higher levels of moisture loss and
conventional pots and root trainers than other
hence the reduction in root growth could be a
treatment. Any environmental change or
form of stress response.
restriction might affect the plant morphological
Table 1. Effect of different containers on root and shoot growth of A. saligna and E. viminalis.
Acacia saligna Eucalyptus viminalis
Parameters
CP RT SR CP RT SR
Plant height (cm) 57.40b 51.20b 60.90a 85.83a 75.17b 84.90a
Leaf area (cm2) 34.94 24.32 30.69 41.57 37.38 41.25
Leaf number 17.67 14.80 14.67 179.20 174.80 189.40
Leaf fresh weight (gram) 17.14a 11.79b 13.63a 6.77b 7.99a 6.43b
Leaf dry weight (gram) 3.20a 2.25b 2.93a 2.72 2.71 2.67
Shoot fresh weight (gram) 5.35 4.47 5.58 7.85b 6.30b 8.64a
Shoot dry weight (gram) 1.46 1.26 1.77 3.26a 2.39b 3.44a
Total top biomass fresh weight (gram) 22.49 16.26 19.21 17.33 16.99 17.74
Total top biomass dry weight (gram) 4.66 3.51 4.70 5.97 5.10 6.11
Root length (cm) 16.43c 23.70a 19.90b 14.80c 21.40a 19.20b
Root fresh weight (gram) 15.19a 6.20b 5.52b 11.77b 16.30a 11.63b
Root dry weight (gram) 4.74a 2.73b 3.52ª 1.60b 2.28a 1.76b
Total plant biomass fresh weight (gram) 58.77 49.68 49.32 29.10 33.30 29.37
Total plant biomass dry weight (gram) 9.40a 6.24b 8.22ª 7.57 7.38 7.87
CP: Conventional Nursery Pot; RT: Root Trainer; SR: Spring Ring; Level of significance (0.05)
Within each row means followed by a different letter are significantly different from each other.
In E. viminalis, conventional pots produced significantly from spring rings. No significant

plants with maximum height but did not vary differences are seen among different containers
257
in leaf area and leaf number. The difference in chemical factors that can affect the shoot and
shoot fresh and dry weight was found to be root ratio (Aung, 1974) . Different soil media
negligible in both conventional pots and spring can affect growth and possibly survival of
rings. No marked significant variation in total container grown seedlings. However in this
top biomass showed that shoot growth was not trail the effect of soil type was not significant
affected by the differences in containers. for plant height but Eucalyptus grown in soil
Schuch and Pittenger (1996) grew Eucalyptus with 100% clay did have a greater leaf area.
citriodora in two different containers and found The results again suggest that different plant
no differences in shoot dry weight. Root length, parts respond differently to different types of
root fresh and dry weights were significantly environment.
higher in root trainers than the other treatments. The total aerial dry weight was affected
Root length is influenced by container depth strongly by interactions between container, soil
and hence perhaps it is not surprising that root and harvest time but the relationship was
trainers gave the highest value. The type of complex and clear trends are hard to discern.
nursery container used during production can There was an interaction between container
have a dramatic impact on root morphology of type and harvest time and soil type and harvest
container grown plants (Arnold, 1996). time. This could reflect the relative rates at
Effect of different soil mixes and container which roots colonize the different soil volumes
type over two periods of destructive harvest and the time at which some growth equilibrium
is reached. Root vigor can be determined by
Table 2. Interaction level of soil mixes and containers at weight increment over a standard time (Rogers
two harvest level. and Vyvyan, 1934). A desirable trend was that
Interaction Plant Leaf Aerial Root Total sand performed well at the first harvest but
parameters height area weight weight weight poorly by the second. This could be due to
Containers * * * * * nutrient exhaustion or inability to effectively
Soil * * * *
meet the moisture needs of the larger plant
Containers X
* biomass. In this study the container type had
Soil
Harvest * * * * * great impact on root dry weight but there is
Containers X inevitably an interaction with time (Gilman and
* * *
Harvest Kane, 1990).There was also a strong relation
Soil X Harvest * * * * between soil and harvest period for root dry
Containers X weight. Data from an underground root
Soil *
X Harvest laboratory has shown that the extent of contact
Level of significance-0.05. between root and soil is dynamic and can vary
with time (Atkinson and Wilson, 1979). The
The above showed that the plant height was longer the roots are growing in the same media
affected positively by the time period and in the same container the greater the
(expected) but also by container type. Plants increase the root biomass that is likely to be
grown in a conventional container were the produced, but fluctuations in root mass can also
tallest in comparison to plants grown into other occur. However if a plant is left for a long time
types of container. The container formation in the same container it will become root bound
may retain soil moisture more successfully, or and the roots themselves will become the
produced a root patterning that allowed more barrier to aeration and water movement. This
effective nutrient up take those results in an might be not true with the new spring rings. In
increased plant height. However it is important this study air pruning affects root biomass and
not just to focus on height as an indicator of led to less overall plant biomass, but longer
growth success as plants grown in spring rings term trails may give different results.
had a higher leaf area. It is known that growing Effect of container type on post
media can be the determining factor for plant transplanting
development and vigor. Different inorganic soil The data from (Table 3) showed that plant
ratios can give negative or positive effects on height increment and number of branches did
plant growth, based on both physical and not differ significantly between the treatments.
258
Also, the dry biomass and root length did not type and shape had direct impact on root
significantly among the treatments. Plants behavior but not necessarily on root production.
which were grown in the spring ring containers Among the soil substrates Eucalyptus grown in
had root systems that were distributed evenly 100%clay had a greater leaf area. Spring ring
through the soil and in all directions. The root containers reduced harmful root biomass and
systems from plants grown in root trainers and encircling of roots. The plant root system was
round containers had roots that were more well distributed when grown in the field, and
active in the base and greater biomass. It is well no deformed roots were detected in trees
recognized that tree survival and growth is transplanted from spring ring containers.
strongly influenced by the root system. The
root system is the means by which soil-based ACKNOWLEDGEMENTS
resources are used, tree anchorage is achieved
The author would like to thank Kuwait
(Fitter, 1991).
University and Kuwait Institute for Scientific
Table 3. Effect of alternate containers on plant growth in
Research for providing the finance,
arid climate infrastructural facilities and encouragement.
Air Round
Parameter Root Trainer REFERENCES
Pruner container
Plant height increment 55.8 78.0 72.0 Arnold M.A., 1996. Mechanical correction and
Number of branches 24.0 22.0 30.0 mechanical avoidance of circling of roots
Root biomass 7.54 8.32 10.18 differentially affect post transplant root regeneration
Root length 57.19 63.3 42.70 * and field establishment on container grown Shumark
Level of significance-0.05 oak. Journal of American Society of Horticulture
Science, 121, p. 258-263.
Atkinson D., Wilson S.A., 1979. The root soil interface
A positive root distribution was found in plants and its significance for fruit tree roots of different
Sprig ring containers. This would improve the ages. In: Harley J.L., Scott R.R (Eds), Soil Root
tree’s ability to tolerate the harsh environment Interface. Academic Press, p. 259-271.
of Kuwait’s desert. In the long term, plants Aung L.H., 1974. Root and shoot relationship. In: Carson
E.W (Eds), Plant Root and its Environment.
grown in conventional containers might face
University Press, Virginia, p. 29-61.
problems with environmental stresses in Awang K., Hamzah M.B., 1986. Effect of potting
Kuwait. Good root systems can be shaped in mixtures and fertilizers on the growth of Acacia
nurseries using proper containers (Long, 1978). mangium wild seedlings. Malaysian Application
There was only a significant difference in the Biology, 15 (1), p. 31-42.
Bhat N.R., 1997. Screening of selected plants for
root length. This could aid the plant in
landscape beautification and greenery development in
absorbing moisture during drought stress and Kuwait. Kuwait Institute for Scientific Research,
strengthen anchorage in high winds. From the Report No. 5143, Kuwait.
observations and the data, it is clear that plant Brown D.A., Scott H.D., 1984. Dependence of crop
growth was not affected by the container type. growth and yield on root development and activity.
In: Barber S.A., Bouldin D.R (Eds), Roots, Nutrient,
The plant root system was well distributed in
Water Influx and Plant Growth. Soil Science Society
all directions when growth in the field, and no of America, p. 101-136.
deformed roots were detected in plants initiated Cockroft B., Wallbrink J.C., 1966. Root distribution of
in spring ring containers. orchard trees. Australian journal of Agriculture
Research (17), p. 49-54
Donahue R.L., Miller R.W., Shickluna J.C., 1983. An
CONCLUSIONS
introduction to soils and plant growth. Englewood
This study reveals that spring rings have better Cliffs, Prentice Hall, New Jersey.
Ferree D.C., 1989. Growth and carbohydrate distribution
results on A. saligna plant height whereas
of young apple trees in response to root pruning and
conventional pots gave the highest in total tree density. Horticulture Science, 24 (1), p. 62-65.
biomass production. Clear trends were less Fitter A.H., 1991. Characteristics and functions of root
obvious for Eucalyptus, but tended to contrast systems. Marcel Decker, New York, 3-25.
with the findings for Acacia. Container type Gilman E.F., Kane M.E., 1990. Root growth of Red
maple following planting from containers.
could affect the aerial parts but this depends on
Horticulture Science, 25 (5), p. 527-528.
the plant species. On the other hand container
259
Gilman E.F., Grabosky J., Stodola A., 2003. Irrigation Muthana K.D., Meena G.L., Bhatia N.S., Bhatia O.P.,
and container type impact on Red maple (Acer 1984. Root system of desert tree species. My Forest,
rubrum L.) five years after landscape planting. (3), p. 27-36.
Journal of Arboriculture, 29 (4), p. 231-235. Nesmith, D.S., Duval J.R., 1998. The effect of container
Handreck K.A., Black N.D., 1984. Growing Media for size. Horticulture Technology, 8 (4), p. 495-498.
Ornamental Plants and Turf. New South Wales Nglube M.R., 1989. Polythene tube sizes of rising
University Press, Sydney, Australia. Eucalyptus seedlings for dry land afforestration
Harris R.W., 1992. Integrated management of landscape programmes in Malawi. Journal of Tropical Forestry,
trees, shrubs and vines. Englewood Cliffs, Prentice 5 (1), p. 30-35.
Hall, New Jersey. Perry T.O., 1982. The ecology of tree roots and practical
Krizek D.T., Dubik S.P., 1987. Influence of water stress significance. Journal of Arboriculture, 8 (8), p. 197-
and restricted root volume on growth and 211.
development of urban trees. Journal of Arboriculture, Rogers W.S., Vyvyan M.C., 1934. Rootstock and soil
13 (2), p. 47-55. effect on apple root systems, The Journal of
Long J.N., 1978. Root system form and its relation to Pomology and Horticulture Science, 12 (1), p. 110-
growth in young conifers. In: Eden E.V., Kinghorn 150.
J.M (Eds), Proceedings of the Root Form of Planted Schuch U.K., Pittenger D.R., 1996. Root and shoot
Trees Symposium, Victoria Canada, 16-19 May. growth of Eucalyptus in response to container
British Columbia Ministry of Forestry, Canada, p. configuration and copper carbonate. Horticulture
222-240. Science, 31 (1), p. 165.
Lucas W. J., 1987. Functional aspects of cells in root Sutherland R.J., Day R.J., 1988. Container volume
apices. In: Gregory P.J., Lake J.V., Rose A (Eds), affects survival and growth of White Spruce, Black
Root Development and Functions. Seminar Series 30, Spruce and Jack Pine Seedlings. Northern Journal of
Cambridge University Press, p. 123-136. Applied Forestry, 5, p. 185-189.
Mullan G.D., White P.J., 2002. Seedling quality making Taha F. K; D. Houkal; A. Hegab; V. Agarwal; E. El-
informed choices. Department of Conservation and Nasri; and M. Khan. 1988. Plant testing program for
land management, Wheat belt Region, Western the Kuwait waterfront project. Vol II, Kuwait
Australia. Institute for Scientific Research, Report No. KISR
28995, Kuwait.
260
THE GROWTH CHARACTERISTICS OF SIX PEAR CULTIVARS UNDER

THE “TRIDENT” TRAINING SYSTEM IN SOUTH-EAST OF ROMANIA
Iuliu CEAN, Florin STĂNICĂ
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Blvd. MĉrĉƔti,

Bucharest, 011464, Bucharest, Romania
Abstract
New orchards are heading to increase the planting density per hectare or to create an increased number of productive
structures (scaffolds, axes, etc.) per surface unit. One way to accomplish the second task is to divide the growth vigor
over more branches. This goal can be achieved by new tree training systems asthree-axis shape called “Trident”
“Candelabro”, “Chandelier” or “Candlestick”. A replicated trial was established in the orchard of the University of
Agronomic Sciences and Veterinary Medicine of Bucharest to evaluate the behavior of some self-rooted pear cultivars
on “Trident” training system. The orchard spacing was 4 X 2.0 m and studied varieties were Abbé Fétel, Conference,
Clapp’s Favorite, Max Red Bartlett, Beurré Bosc and Alexander Lucas. The trunk diameter, total annual shoot length
and shoot number, tree height and other growth parameters were measured annually at the beginning of growing
season. The obtained results indicate differences between varieties. The greatest values for height tree were registered
in Abbé Fétel variety in both season and the lowest values for Clapp’s Favorite variety in 2011 and Max Red Bartlett
variety in 2012.The data referring to trunk cross section pointed out very significant positive differences at Abbé Fétel
and significant positive differences in case of “Conference” variety from average used as control in 2011. In 2012, two
varieties showed significant positive differences from the average experience, respectively Conference and Max Red
Bartlett.In 2011 varieties Conference, Abbé Fétel and Max Red Bartlett produced more long shoots than the average
of trial and in 2012 the varieties mentioned above and Beurré Bosc” formed long shoots more thanthe average.
Key words: orchard system, self-rooted trees, tree growth.
INTRODUCTION fire blight (Erwinia amylovora) (Spornberger

et. al., 2008).
Tree architecture is an important aspect for the
The “Trident” system proposes a central
breeders having regard that growth vigour and
specific type of growth and leader and two side branches that are trained
fructification affects directly the number of vertically that means finally the tree present
three leaders (Vercammen, 2011). Distributing
trees/unit of area. The need to reduce both
vegetation over three axes induces less vigour
pruning costs and the use of growth regulators
since tree sends nutrients responsible with
changed the objectives of researches mainly in
growth in three axes instead of one. As bi-axis
optimization of training methods based on
natural tree habit (Lauri et. al., 2000). There are system “Trident” system is based on the same
numerous technical and organizational concept and the same effects, such as: a good
innovations (cultivars, rootstocks, cropping exposure of fruit to sunlight, reducing tree
techniques and defense techniques) that affect height, reduction of cultural practices, less use
the whole life of an orchard (Galli et al., 2011). of growth regulators, considerable speeding of
Two aspects, trees cultivated on their own roots harvest and pruning should appear (Dorigoni,
and “Trident” training system were the subject 2008). The aim of the present work was to
of our study. study the behavior of six self-rooted pear
The use of self-rooted cultivars has had a great varieties in terms of vegetative growth of the
success in pear in the last decade. It offers the trees.
possibility to obtain high quality yields and it
is good technique that can be extend in pear MATERIALS AND METHODS
orchard (Stanica et al., 2000). It also could The study was conducted between 2011-2012
provide some tolerance to disease, especially in a modern pear orchard located in Bucharest
261
area of latitude 26.5 degree East and longitude
44.3 degree North. The altitude is about 90 m
above the sea level.
The plant material used in this study included
self-rooted cultivars “Abbé Fétel”, “Max Red
Bartlett”, “Conference”, “Beurré Bosc”,
“Alexander Lucas”, “Clapp’s Favorite”.
Spacing between rows was 4 m and in the row
2 m, the trees being leaded as “Trident” leading
form. A randomized block design for each
cultivar in tree replications with three trees per
plot was set-up.
There were used two support systems, one
namely T 4- wire with galvanized wire (figure
1) and the other with two wire and three
bamboo tutors/tree (figure 2).
Figure 2. Two wire and three bamboo tutors
The existing drip irrigation system on each

rows provides 2l/hour water. It consist of
continuous dripping line and individual
drippers every 0.5.m.
The soil is typical brown-reddish with 40%
clay content in the surface layer.
The average annual temperature is 10.6C and
annual sum of precipitation is 574.3 mm.
Measurements were carried out at the
beginning of each season, early in the spring,
with roulette and caliper and results were
expressed in cm.
The trunk thickness was measured at 50 cm
above ground and was used to calculate the
trunk cross sectional area. Also were measured:
tree height, the total length and/or number of
vegetative shoots. Total shoots were measured
or counted and classified as vegetative shoots
or flowering shoots. Some data were processed
with variance analysis and t-test was applied.

Figure 1. T-4 wire support system RESULTS AND DISCUSSIONS
To assure stability of system in ground was The growing vigour of the trees cultivated in
used classical anchorage system and on the row high density system shows us that between the
every 10 meters, concrete espaliers were pear varieties have appeared differences
placed. regarding the trunk thickness growth, the height
The alleyways were cultivated with perennials of trees and transversal cross section.
and were mowed mechanical in the growing The trunk is an important element which
season. On tree row the soil was maintained characterizes the tree vigour and it is analyzed
clean of weed by hand and mechanical and correlated with a series of other biometrical
cultivation. process and indices (Comanescu et al., 2012).
The analysis of tree height values among the
varieties showed that tree height was lowest in
262
“Clapp’s Favorite” in 2011 where the height of “Conference” and “Max Red Bartlett”.
the tree constituted 170 cm and “Max Red Significant negative differences, as compared
Bartlett” in 2012 with the height of the tree with average, taken as control, registered the
constituted 200 cm. The highest values for this “Clapp’s Favorite” variety. Vigour with
parameter was registered in “Abbé Fétel” in insignificant differences, as compared with
both seasons, with the height of the tree average had the varieties “Beurré Bosc”,
constituted 250 cm in 2011 and 280 cm in 2012 “Clapp’s Favorite”, “Alexander Lucas”, “Max
whereas in other varieties the recorded values Red Bartlett” in 2011 and “Abbé Fétel”,
were intermediate (table 1). “Beurré Bosc” and “Alexander Lucas” in 2012.
Values of the trunk thickness comprised The average of annual vegetative shoot growth
between 2.10 and 2.93 cm in 2011 registered in 2011 was 147.8 cm/tree in “Clapp’s
the pear tree varieties: “Max Red Bartlett: (2.70 Favorite”, 257.8 cm/tree in “Beurré Bosc”,
cm), “Clapp’s Favorite” (2.10 cm), “Beurré 288.2 cm/tree in “Alexander Lucas”, 320.1
Bosc” (2.62 cm), “Alexander Lucas” (2.50 cm), cm/tree in “Conference”, 327.7 cm/tree in
“Abbé Fétel” (2.93 cm) and “Conference” “Max Red Bartlett” and the highest value
(2.88 cm). In 2012 the recorded values were (413.5 cm/tree) in “Abbé Fétel”. In 2012 the
placed between 2.80-3.82 cm with lowest registered values were as follows: 346.5
values at “Clapp’s Favorite” (2.80 cm) and cm/tree in “Alexander Lucas”, 360.1 cm/tree in
highest at “Conference” variety (3.82 cm). “Clapp’s Favorite”, 386.8 cm/tree in “Abbé
Growth of trees, expressed as a trunk cross Fétel”, 405.6 cm/tree in “Conference” and 411
section area registers extreme values, cm/tree in “Beurré Bosc” varieties (fig. 3). In
comprised between 3.5 cm2 at “Clapp’s 2011 trees from “Conference”, “Abbé Fétel”
Favorite” variety and 6.7 cm2 at “Abbé Fétel” and “Max Red Bartlett” produced more long
variety in 2011. In the next year the values shoots than the average of trial (292.5 cm/tree).
comprised between 6.2 cm2 at “Clapp’s In 2012 the varieties mentioned above and
Favorite” variety and 11.6 cm2 at “Max Red additional “Beurré Bosc” produced long shoots
Bartlett”. The data from 2011 were statistically more than the average (384 cm/tree).
processed as compared to the average of the In 2011, a large number of vegetative spurs
trial, used as control and pointed out very produced “Conference” (68) and “Beurré Bosc”
significant positive differences at “Abbé Fétel” (45) while “Max Red Bartlett” and “Clapp’s
and significant positive differences in case of Favorite” formed the fewest number of spurs
“Conference” variety. In 2012 two varieties (39 and 38).
showed significant positive differences from
the average of experience, respectively
Table 1. Vegetative growth in 2011 and 2012

Differences
Transversal cross section
Tree height (cm) Trunk thickness (cm) 2 as to average Significance
Pear variety (cm )
(cm2)
2011 2012 2011 2012 2011 2012 2011 2012 2011 2012
Abbé Fétel 250 280 2.93 3.48 6.7 9.5 +1.3 +0.35 N
Conference 210 250 2.88 3.82 6.5 11.4 +1.1 +2.25
Beurré Bosc 190 250 2.62 3.28 5.4 8.5 0 -0.65 N N
Clapp’s Favorite 170 220 2.10 2.80 3.5 6.2 -1.9 -2.95 N
Alexander Lucas 180 210 2.50 3.14 4.9 7.7 -0.5 -1.45 N N
Max Red Bartlett 180 200 2.70 3.84 5.7 11.6 +0.3 +2.45 N
Average 196.6 235 2.62 3.39 5.4 9.15 - - - -
DL 5 %=0.80 cm2 (2011) N= not significant DL 5%=1.8 cm2 (2012)
DL 1%=1.14 cm2 *= significant difference DL1%=2.5 cm2
DL 0.1%=1.65 cm2 **= distinctive significant difference DL 0.1%=3.7 cm2
263
In 2012 “Alexander Lucas” produce the largest Table 2. Flowering shoots (cm/tree) registered between
number of vegetative spurs (122), followed by 2011-2012
Beurré Bosc“ (80) and the lowest number was Flowering shoots (cm/tree)
registered in “Clapp’s Favorite” (table 3). Pear variety Brindles Offshoots Total length
‘11 ‘12 ‘11 ‘12 ‘11 ‘12
The total length of the flowering shoots
A. Fétel 33.1 302.2 11.8 61.8 44.9 364
registered the highest value in both years for
Conf. 27.5 321.7 15.3 14.5 42.8 336.2
“Max Red Bartlett” (119.4 cm/tree in 2011 and Beurré Bosc 16.8 213.5 0 7.8 16.8 221.3
395.8 cm/tree in 2012) and the lowest value for Clapp Fav. 17.6 271.2 0 22 17.6 293.2
“Beurré Bosc” (16.8 cm/tree in 2011 and 293.2 Al. Lucas 103.8 250 8.6 107.8 112.4 357.8
cm/tree in 2012) (table 2). The varieties “Max Max Red
93.3 363.1 26.1 32.7 119.4 395.8
Bart.
Red Bartlett”, “Conference” and “Abbé
Fétel” produced over than 300 cm/tree of
flowering brindles in 2012 (table 2).
The values of offshoots length varied between
0 and 26.1 cm/tree in 2011 and 7.8 -107.8
cm/tree in 2012 with the highest value
registered in “Max Red Bartlett” variety in
2011 (26.1 cm/tree) and “Alexander Lucas”
variety in 2012 (107.8 cm/tree) (table 2).
“Alexander Lucas” variety formed the largest
number of flowering dards in 2011 (67) and
“Abbé Fétel” variety in 2012 (33) (table 3).
Trees formed also fruit bourses, one of them
remained undeveloped others are formed by
different shoots as spurs, dards or spurs and
dards. “Abbé Fétel” and “Conference” formed
Figure 3. Long shoots registered (cm/tree) between
constantly spurs, dards and bourses but the 2011-2012
highest number of bourses with dards was
registered in 2011 for “Alexander Lucas”
variety (99) followed by “Clapp’s Favorite”
variety with 54 bourses with dards (table 3).
Table 3. Average number/tree and type of vegetative and flowering shoots

Vegetative
Flowering shoots (no/tree)
Pear variety shoots (no/tree)
Spurs Fruit bourses
Dards
undeveloped with spurs with dards with spurs&dards
2011 2012 2011 2012 2011 2012 2011 2012 2011 2012 2011 2012
Abbé Fétel 49 51 24 33 3 5 57 6 5 1 4 0
Conference 68 54 25 10 0 16 10 61 0 0 0 0
Beurré Bosc 54 83 9 5 0 0 0 8 0 0 0 0
Clapp’s Favorite 38 50 14 3 0 3 5 2 54 0 0 0
Alexander Lucas 45 122 67 24 0 3 5 11 99 0 0 0
Max Red Bartlett 39 60 11 22 7 0 54 57 1 8 0 0
CONCLUSIONS that could be interpreted as a uniformity of

growth of studied cultivars.
The results showed that the studied pear
varieties have capability to growth in Bucharest In 2011 trunk cross section area showed diffe-
area. rences allowing cultivars to be ranked in order
of decreasing vigor: “Abbé Fétel”, “Confe-
In term of tree height we registered insigni-
ficant differences between self rooted varieties rence”, “Max Red Bartlett”, “Beurré Bosc”,
“Alexander Lucas” and “Clapp’s Favorite”. In
264
2012 the order was “Conference”, “Max Red Proceedings of the XIth International Symposium on
pear. Vol.2. p. 247-280.
Bartlett”, “Abbé Fétel” “Alexander Lucas”
Lauri P. E., Costes E., 2000. European pear architecture
and “Clapp’s Favorite”. and fruiting-branch management: overview of an
INRA Research Program. Acta Horticulturae no. 596.
ACKNOWLEDGEMENTS Proceedings of the VIII th International Symposium
on pear. Vol. 2. p. 621-626.
This work was developed and financed within Stanica F., Dumitrascu M., Peticila A., 2000. Behaviour
the framework of POSDRU/CPP 107/DMI of three pear cultivars propagated in vitro and self-
1.5/S/76888 Project. rooted, on tatura trellys canopy. Acta Horticulturae
th
no. 596. Proceedings of the VIII
International Symposium on pear. Vol.2. p.647-649.
REFERENCES Spornberger A., Brunmayer R., Fischer G., Kaufmann
Comanescu D., Petre G., Petre V., 2012. The behavior of C., Osterc G., 2008. Testing of pear trees on their
some apple trees varieties with genetic disease- own roots in comparison with important used
resistance in a high density system. Scientific papers. rootstocks under organic farming conditions with
Series B. Horticulture. Vol. LVI., p. 63-68. special regard to fire blight (E. amylovora). In: Boos.
Dorigoni A., 2008. Bi-axis-an alternative training system Markus (Ed.) Ecofruit - 13th International Conference
for apple growing. In Australian fruitgrower. 11 (2), on Cultivation Technique and Phytopathological
12-16. Problems in Organic Fruit-Growing: Proceedings to
Galli F., Ancarani V., Serra S., Musacchi S., 2011. Trai- the Conference from 18th February to 20th February
ning systems and roostocks for high density planting 2008 at Weinsberg/Germany, p. 216-219.
(HDP) of the cultivar “Abbé Fetel”: developmental Vercammen J., 2011. High-density pear systems
trials in Italy. Acta Horticulturae no. 909. compared. Good Fruit Growth. September 2011.
265
RESEARCHES ON THE MICROSPOREGENESES
AND POLLEN TUBE DEVELOPMENT OF SOME CHERRY VARIETIES
IN EXPERIMENTAL CONDITIONS
Maria IORDACHE
Research-Development Station for Fruit Trees- Growing Baneasa,

4 Ion Ionescu de la Brad Blvd., District 1, 71592, Bucharest, Romania
Abstract
Biological characteristics of pollen formation and development are dependent on weather conditions in the winter and
early spring thermal stabilization. In the last years, the weather disturbances manifested by late frosts, affected,
mainly, physiological processes in mature pollen, which occurred by the reducing pollen germination capacity both as
a percentage and also the development in terms of development in length (LPT) of the pollen tube. It were used specific
methods Carnoy fixation for high lighting the microsporogenesis stages and the germination on liquid medium in order
to selection optimal variants for the maximum potentialities of the pollen biological value. The work has been done on
Romanian varieties of sweet cherry with different periods of ripening: Boambe de Cotnari, Severin, Daria, from
Research & Development Station for Pomiculture Baneasa orchards. We observed a normal evolution at the anthers an
the trades level of microspores, consisting a good premise for the germinative manifestation capacity of the pollen. In
vitro conditions of the developmentdynamics of the pollinic tube varied from 18% at 45% as dominant values. In
conclusionwe was considered germinated pollen all the granulates that had pollinic tubes length approximately equal
with double the diameter pollen.
Key words: cherry, length pollen tube, microsporogenesis.
INTRODUCTION between the type and diaphragm

microsporogenesis mature pollen grains.
Microsporogenesis is determined by genetic
Hedhly et al. (2004), said the pollen
factors and is dependent or conditioned during
germination is the stage preceding the polenic
his deployment, by sudden thermal fluctuations
tube growing in stil. Each of these two stages
in winter wich often produce profound
(germination and pollen tube growth is
disturbances.
stimulated (driven) by ambient thermal
Microsporogenesis begins with reduction
conditions such as: moderate temperature that
division (R!) and marks the passagethe
stimulates the stigma secretion, increases the
transition from deep winter rest to optional rest
adherence of the pollen and promotes the
(Bordeianu et al.,1961; Tarnavschi, 1963).
germination and the slightly higher temperature
Transition to the tetrad stage, then uninucleate
accelerate the pollen tube growth and simulates
microspores and pollen stage transition to
the process of fertilization (Hedhly, 2004).
binucleat pollen, depends on
Concerning nutrition media for the pollen
Pollen maturation phase corresponds to the
germination consulted in national literature on
biological threshold (+6.5°C) for swelling buds different species of fruit trees, these contains
(IvaƔcu, 2002). 1,5% agar-agar (Cociu, Oprea, 1989; Butac et
Gonzales et al. (2001), in its study on al., 2006; Blidariu et al., 2008), but also with
microsporogenesis, said on the other species some exceptions such as liquid medium
economic value, there is no strict relationship (Iordache et al., 2010).
between the type and configuration The object of this paper/research, is the
microsporogenesis fourfold orientation is analysis of the pollen through microscopically
strongly influenced by tree especially during methods, microsporogenesis determination,
meiosis and there is also no direct correlation degree of maturation pollen by the evolution of
sporoderma, the final size from young
267
microspore to mature pollen, determina- Acetic Acid (ACA) or Methylene Blue vital
tion/analysis of pollen viability and germina- dye alcoholic solution (Andrei et al., 1972).
tion capacity, and the relationship between They highlighted easier the differences between
variations of media and dynamic pollen tube the microspores with normal maturation of the
germination, of three Romanian varieties of immatures, were identified viable microspores
cherry. by the non viables.
These three varieties of cherry are available in At the pollen viability were estimated (V%)
our plantation of fruit trees and have not been viability and germination capacity (G%) for
investigated (studied) and characterized from each variety separately. They used anthers
this point of view. extracted from several flowers forming a
homogeneons sample that represents faithfully
MATERIALS AND METHODS the biological potential of the pollen at that
time. Viability (V%) was expressed as a
In 2011 there were evaluated microscopically
percentage in comparison of the viable pollen
three Romanian cherry cultivars with medium
with all pollen grains of microscopic fields
and late ripening period: Severin, Daria, and
examined.
Boambe de Cotnari. The age of the trees
To assess (estimate) the capacity of
alternates between 7 and 9 years and belong to
germination (G%), anthers were placed in each
the Baneasa SCDP collection. The samples
small bottle as indicator (watch glass) and few
consisted of flowering buds and open flowers
drops of distilled water for hydration for pollen
that were harvested as follows: flowering buds
release.
were collected in February-March and in April
These unessential process and comparable with
the flowers were collected in the first day of
natural hydration of pollen on the stigma
anthezis and then the flowering buds.
secretion (Xie B. et al., 2010).
Flowering period lasted approximately 7 days.
The pollen contained in each watch glass was
The flowering shoots were first fixed in Carnoy
an sample mean for the cultivar examined.
solution for several hours then preserved in
From the sample mean of each variety have
ethanol 70ºC (Andrei et al., 2003). been sowings of germination media two
Open flowers and the buds being opened different concentration of sucrose (15% and
(balloon stage) were analyzed immediately 20%).
after harvest (not being necessary or The culture media that are used to the assess of
appropriate their setting and preserve). the pollen germination are liquid media
By dividing into sections (severing) the
(distilled water) containing and 0,01% boric
flowering buds that are being in progress
acid (H3BO3).
(stage) before the swelling buds (pre-swelling)
For each concentration of sucrose were seeded
and swelling of the bud stage (March-April),
three versions (v1, v2, v3) with which (by means
we obtained the necessary data in the process
of them) was tasted the action of some flower
of observing the early stages of the
parts on (upon) germination.
microsporogenesis (tetrad with microspores,
For the safety results were made in all three
both very young and young microspores, the repetitions (parallel sowing) as follows:
gradual appearance of the specific elements of - v1 – the drop of liquid medium has been
sporoderma, the apertures forming, etc.)
seeded only with pollen;
The microscopical examination af samples in
- v2 – the drop of liquid medium has been
March has made on permanent preparations in
seeded with pollen together with pestle;
glycerin gelatin, using optical microscopy IOR
- v3 - the drop of liquid medium has been
type ML4-M. It was used objectives 10x, 20x
seeded with pollen accompanied by empty
for camera and 40x for microscopic
anthers.
examination.
Pestle was introduced to try a simulation of the
For better observation (examination) of the
conditions in vivo referring to the stimulating
morphological elements (features) mentioned,
effects that gineceu induced on the germination
the preparations were stained with Carmin
release (on the stigma) and then on the
development of the pollen tube. Pestle but
268
could have a negative effect of environmental
contamination with saprophytic germs (yeast,
molds) and may be itself an undesiderable
nutritional support for the development of these
germs.
Therefore, similarly I kept 3-5 anthers emptied
in the drops (v3), to pursue these possible
negative processes.
After sowing the first laboratory tests were
done after an interval of 5 hours.
Microscopic examination of samples taken in
April, was done by transmitted light and the
phase contrast with objectives 10x, 20x, 40x. Figure 1. Pollen mother cells (PMC), Ob.20x, Oc.10x
To maintain unaltered microscopic
preparations, both microspors extracted from
the flowering buds (February-March) and the
mature pollen extracted from open flowers or
buds in the process of flowering (April) used to
assess the viability and germinative capacity,
were included after examination, in permanent
preparations in glycerin gelatin (Andrei et al.,
2003).

Concerning microsporogenesis and the
development of young microspores, the Figure 2. Tetrade chain of microspores in cherry variety
Boambe Cotnari, Ob.20x, Oc.10x
flowering cherry buds taken in February it was
revealed the normal development of anthers in
On March 18 began to appear very young
appearance and size during organogenesis in
microspores that still coexist with tetrades and
the three varieties studied.
the flowering cherry buds of 21 March it was
The flowering cherry buds of 8 March – were
observed that anthers, microspores very
pointed out (highlighted) tetrades of
young contains, recently released from the
microspores that characterizes pre-swollen bud
tetrad. Exin contour was devoid of visible
stage (before flowering buds swelling). The
ornaments and was examined with objectives
appearance being normally not observed
10x,20x,40x.
distartions of the microspores in tetrad or
Contour was approximately circular. Uniform
disproportionate development between
appearance, almost spherical, is explained by
microspores. It was also observed the
the lack of sporoderma stratification.
uniformity and normality of the cellular content The apertures not appear obvious just because
between tetrad components. exin is still thin and devoid (without)
The microscopic field were observed and ornamentations. In some granules, aperturs are
pollen mother cells (PMC), due to non marked by obvious folds.
synchronizing of microsporogenesis process The flowering cherry buds of 25 March noted
(Figure1, Figure 2 ). tjat microspores are large rand have a
maximum size of approx. 23,5 ʅ. Change in
sizes and uneven appearance of microspores
are due to non synchronizing of maturation
stage of microspores at different anthers of
some bud.
There are also differences from one variety to
another on the stage of maturation of
269
microspores at certain date. Microspores are
significantly different from those of 21 March
as they start to differentiate at sporodermas
level weaks ornamentations and we observe the
apertures shape. However it also notes the
cytoplasmic granulation at the granules with
still thin sporoderma .
Concerning mature pollen: as the flowering
cherry buds of 6 April, sporoderma has a
specific appearance for mature pollen, we
proceeded of ots application to test the
viability. Were revealed the microspores Figure 4. Staining Pollen with methylene blue vital
appearance with a normal development for dyestuff alcoholic solution, to highlight the presence of
approx. 70% in deep red and yellow oil droplets that always accompany young pollen
maturation in Daria variety, Ob.20x, Oc.10x
microspores containing reduced or absent
cell and pollen with methyl blue staining
The results of 3 repetitions for each
vital dyestuff alcoholic solution, to highlight
experiment, were expressed as a percentage
the presence of oil droplets that always based on the corresponding arithmetic mean
accompany young pollen maturation (Figure 3 (Figure 5).
and Figure 4).
The pollen tube length (PTL) / variety
Viability and germinative capacity of the three
correlated with average sucrose % in variants
Romanian varieties of cherry have maximum
v1, v2, v3 are thus: pollen tube germinated at
value for version 2 (v2) with 20%
cherry varieties in the Romanian culture media,
sucrose. Boambe de Cotnari cultivar had
varies in length from approx. 30ʅ to about
viability (V%) 80% and maximum
400ʅ. (Figure 6).
germination (G%) of 48%. Severin
To determine if a relationship exists between
variety had viability (V%) 75% and maximum
pollen tubes development and the medium the
germination (G%) of 25% and Daria variety
pollen germinated it was formed the graphic
had viability (V%) 60% and the maximum
which were placed at intervals in order of
germination (G%) of 18%.
As currently practiced were considered as length (ʅ) all „PTL max” and the corres-
being germinated the grains that has pollen ponding experiments (Figure 7).
tube lenght at least equal twice the diameter of
pollen.
Figure 5. Dynamic pollen (V% and G%) for 3 varieties

of cherry in variants (v1,v2.v3) with 20% sucrose.
Figure 3. Red color, intense reaction to viable mature
pollen during the test for viability, in cherry Severin
variety, Ob.10x, Oc.10x.
270
and variety Daria is in the last place with 60%
viability and 18% maximum germination.
The best germination of all varieties was
obtained in variant (v2/medium + pollen +
pestle) with 20% sucrose. Thus confirming the
stimulant role of pestle in triggering of
germination and pollen tube growth.
The poor germination was v3 with 20%
sucrose and v3 with 15% sucrose in all
varieties. Version 3 (v3/medium + anthers)
usually has a minimum value due to the
negative influence of environmental anther
Figure 6. Mature pollen during germination, in cherry tissue on germination.
Boambe de Cotnari variety , Ob.10x, Oc.10x
For version (v1) 20% sucrose, germination was
equivalent to (v1) 15% sucrose and and had
moderate values. Version 1 (v1/medium +
pollen) can be considered indicative value for
potential germination of pollen specific
granules in the absence of pistle influence.
PTL max. was recorded in variety Boambe de
Cotnari (400 ʅ) also in the version (v2) on an
average of 20% sucrose.
The 3 Romanian varieties cherry have brought
forth the specific potential of each.
It confirms good germination (18-45%) and the
corresponding binding undisturbed weather
Figure 7. Dynamic pollen tube length (PTL ʅ) for 3 conditions during flowering and
varieties of cherry in variants (v1,v2.v3) with 20% microsporogenesis.
sucrose
REFERENCES
Andrei M., Paraschivoiu R., 2003. Microtehnica
Botanicĉ. Editura Niculescu. BucureƔti, p. 120-223.
CONCLUSIONS Andrei M., Rĉdulescu D., 1972. Caiet pentru tehnica
As a result of these experiments conducted in preparĉrii Ɣi conservĉrii materialului biologic–
Tehnica obԑinerii preparatelor microscopice. (Fac.
2011, in which has been evaluated the
Biologie) Univ.Bucuresti. p. 1-83.
biological value of the pollen at 3 varieties of Balan V., 2008. Caisul Ɣi caisele. Editura Ceres
Romanian cherry, we conclude the following: Bucuresti.
The pollen maturation went in normal Baciu E., 1971. Contributii la studiul microsporogenezei
la unele specii din subfamilia prunoideae. Lucr.St.
physiological conditions, undisturbed in
seria B XIV 1971. Horticulture IANB. Bucuresti, p.
accordance with the evolution of relatively 241-245.
mild weather winter 2011. Blidariu A., Iordĉnescu O., Micu R., Drĉgunescu A.,
Tetrades and microspores had a normal aspect 2008. Researches concerning pollen’s germination
and viability of some sour cherries varieties in the
for the development phasem. plain area of Banat. Bulletin Horticulture UASVM.
Mature pollen showed viability between 60% Bucuresti. vol. 65(1), p. 505-507.
and 80% and germination 18% - 45%. Bordeianu T., Tarnavschi I., Radu I. F., Bumbac E.,
Botez M., Andrei M., 1961. Studiul privind repausul
The best germination has been on liquid de iarna si pragul biologic la mugurii floriferi de cais.
medium with sucrose 20% and (H3BO3) 0,01%. Revista Studii si cercetari. Seria biologie, 4.
Butac M., Militaru M., 2006. Fertilitatea Ɣi germinarea
Boambe de Cotnari cultivar is in the top, both polenului la genotipuri de mĉr, pĉr, prun, cireƔ Ɣi
in viability (80%) and in germination (48%)
271
viƔin utilizate ca genitori potentiali în ameliorare. ICDP-PiteƔti Mĉrĉcineni, Scientific Papers of the
Lucrarile Stiintifice ale ICDP PiteƔti R.I.F.G. PiteƔti, vol XXVI, p. 46-50.
Mĉrĉcineni.vol.XXII:20-27. IvaƔcu A., Toma St., 2001. Autofertilitatea nectarinului
Cociu V., Oprea, St., 1989. Metode de cercet. în si influenta unor fungicide asupra germinarii
ameliorarea plantelor pomicole. Ed. Dacia, Cluj- polenului. Lucr. St. ICPP Pitesti Maracineni. vol.
Napoca, p. 82-87. XX, p. 62-68.
Gonzales F., Rudall P.,J., Furness C., 2001. IvaƔcu A., 2002. Sĉ redescoperim piersicul. Ed.
Microsporogenesis and systematic of Universitas Company. BucureƔti, p. 13-221.
Aristolochiaceae. Botanical Journal of Tarnavschi, I., Bordeianu, T., Radu, I.F., Bumbac, E.,
Linnean Society, vol. 137, p. 221-224. Botez, M., 1963. Diferenԑierea mugurilor de rod Ɣi
Hendhly A., Hormaza JI., Herrero M., 2004. Efect of microsporogeneza, Acta Botanica Hoti
temperature on pollen tube kinetics and dynamics Bucurestiensis (1961-1962), fascicol 1. (vol. Festiv),
in sweet Cherry Prunus avium (Rosaceae). American p. 343-361.
Jurnal of Botany 91(4)m p 558-564. Xie, B., Wang, X., Hong, Z., 2010. Precocious pollen
Iordache M., besan T., Andrei M., 2010,Researches on germination in Arabidopsis plants with altered
viability and germinative capacity of the pollen in callose deposition during microsporogenesis,
some romanian appricot varieties. Symposium ISHS- Springer, Planta 231, p. 809-823.
272
RESEARCHES ON POLLEN VITALITY IN SOME APRICOT HYBRIDS
Maria IORDACHE, Lenu‫܊‬a COROIANU
Research-Development Station for Fruit Trees - Growing Baneasa,

4 Ion Ionescu de la Brad Blvd, District 1, 71592, Bucharest, Romania
Abstract
Pollen vitality as a biological feature is an important factor in the reproduction on amfimictic way and has major
implications for the quantity and quality of fruit. In 2012, the negative effects upon the flowering buds that are
produced in winter by climatic factors manifested by sudden thermal fluctuations with persistent frost and hard frost,
without intermediate temperatures from a period to another have led to strong hurting of buds of fruit. Physiological
disturbances due to the low temperatures have had a prolonged effect with repercussions in the microspores
maturation, regarding the pollen viability and germinative capacity in some apricot tree. The object of the work is to
evaluate the performance in germination %R(G/V) of the pollen, relationship expressed through germinal capacity and
of mature pollen viability released from anthers that was affected by frost. There were evaluated microscopically the
pollen vitality at apricot tree, hybrids: HB.82.62B.IV. and Nicusor cultivar with a different maturation period from the
existing collection of SCDP Baneasa. As a result of the effectuated experiment there were obtained following values:
the two biological indicators of mature pollen from apricot, the germinal capacity (G%), viability (V%) and their
relation expressed by the performance in germination %R(R/V), on both sucrose environments (15% and 20%),have
had values between 11%-33% for germinal capacity (G%), 25%-50% for viability (V%)and for efficiency in
germination %R(G/V)between 44%-77% . In conclusion, leaders were the 826.62 hybrid and Nicusor cultivar.
Key words: germination capacity, pollen tube, viability.
INTRODUCTION Boric acid (H3BO3) was added to the medium

in vitro, at various concentrations (Butac et al.,
The assessment of the fertility degree through
2006; Iordache et al., 2010).
pollen vitality and “fruit bounded, fruit set”
Both germination and pollen tubes
quantity in natural conditions for fruit trees
development, are stimulated and depended by
holdings, always involves, the effect of
ambient thermal conditions.
environmental conditions, too.
Temperature during germination, has a
In vitro experiments of the pollen viability and
determinative effect on pollen tube kinetics and
germination, is practiced method for the
dynamics (both in medium as in style),
fertility estimation of pollen of fruit growing
stimulating then the fertilization process
species, (cultivar or hybrid), in forecasting
(Hedhly et al., 2004), in comparative study of
crop, and for to check resistance, tolerance and
two cultivars of Prunus avium L., Spain and
adaptability pollen (respectively cultivar), to
Canada.
the fluctuations and weather risks (very cold
The temperatures that for the pollen
winter frosts return spring frosts, etc.,).
germination used were were between 18°C, and
In vitro experiments are a good test for
25°C (Butac et al., 2006; Pĉdureanu, 2007;
forecasting fertility rates in plantation flowers
Blidariu et al., 2008).
(Hedhly et al., 2004).
The favorable temperature of pollen tube
Concentrations of sucrose used by some
researchers for the pollen germination testing in development for fruit trees, is between 10°C
vitro environments, were different, (Cociu and 20°C, (Hedhly et al., 2004).
and Oprea, 1989; Butac et al., 2006; The temperatures below 10°C and above 20°C
Pĉdureanu, 2007; Blidariu et al., 2008; determine the reduced germination rate and
Iordache et al., 2010). pollen tube development (Hedhly et al., 2004).
273
The objective of this paper, is to evaluate the This essential process is comparable with
potential fertility pollen, in laboratory natural hydration of pollen on the stigma
experimental conditions. secretion (Xie B. et al., 2010).
These apricot hybrids experienced in this Then separately, were made sowing on
research, are existing in ours fruit tree germination media in 2 different and separated
plantation and have not been examined / tested concentration of sucrose (15% and 20%) in
and characterized and this point of view. the which added 0,01% boric acid (H3BO3).
pollen germination (in vitro), in liquid medium We believe that, the pollen germination
(deprived of agar-agar), because we considered advantage on the liquid medium directly on
it may be relatively comparable, with slide glass, allows at better microscopic
intercellular fluid composition of stylar tissue, examination through transparency and the
that pollen tube develops, and allow better transmited light unlike the germination on solid
dispersion of pollen and thus favors in liquid medium in Petri dishes, which cannot be
medium, the development of pollen tubes. examined only in direct light at o “power
enlargement“ of max. 200x for stereo
MATERIALS AND METHODS magnifier.
Nicusor cultivar. Age of the trees is 8, with Also the pollen germination testing, was done
medium and late ripening period. In April (on in 3 different germination the tasting in 3
the first day of anthesis in 04.04.2012), there germination variants (v1,v2,v3) by introducing
were taken from open flowers and flowering of some floral parts (ginaeceum / pistil and the
buds for determing the viability and the remaining emptied anthers), in germination
capacity of pollen germination. medium to emphasize their influence / action
To asses the viability and to represent as real on pollen germination (Iordache et.al., 2010).
possible the biological potential of the pollen at So each microscopic slide was a test variant
that time, to each sample and analysis partly, (V1,V2,V3) thus as follows:
were used fresh anthers that were extracted - Variant V1- liquid drops was seeded only
from the stem filaments of the flowers or with pollen
current flowering buds. - Variant V2 – drop of liquid was seeded with
directly on microscope slide glass, there were pollen together pistil, for a simulation of the
applied (according to the Method Andrei and conditions in vivo, relating to the stimulating
Paraschivoiu, 2003), directly on the fresh and effects that gynaeceum induces on starting
mature pollen, e few drops reagent 2,3,5- of germination (on stigma) and then on
Trifeniltetrazol Clorid, for coloring reaction pollinic tube development.
(Andrei and Paraschivoiu, 2003). - Variant V3 – liquid drop was seeded with
The pollen viability was evaluated under a pollen together remaining emptied anthers
microscope in transmitted light, by examining for to have in view these possible negative
of the morphological and physiological processes.
characteristics of the pollen cell. Slides with media were kept at on average
The method is recommending the counting the temperatures 17°C to 20°C in wet atmosphere
colored grains only as a result of the deep red so that the liquid medium doesn’t evaporate and
reaction (Andrei and Paraschivoiu, 2003). thus it is maintained constant concentration in
The viability was expressed in per cent (V%) boric acid and sucrose.
confronted by the total grains counted in the To reduce the risk of environmental
field by reporting of the viable pollen to total contamination and to avoid the deterioration of
grains of microscopic fields examined. germination medium, all the tools with which
For creating the media culture in vitro to they were working, including filter paper and
determine / assess germination capacity (G%) cultural medium were sterilized previously
of the mature pollen, was hydrated (previously) (Andrei and Paraschivoiu, 2003)..
the pollen, released from anthers fresh , on After sowing, the first laboratory tests were
several slides glass. made after a period of 5 hours of testing and 24
hours.
274
As currently is practiced they were considered μ in optical meridian section (image obtained in
germinated grains that had pollen tube length at equatorial view).
least twice the pollen diameter.
To point out the pollen tube and nuclei were
applied specific colorings on germination
media with dilluate solution of Methyl Blue.
(Andrei and Rĉdulescu, 1972).
The germinative capacity of the viable pollen
was expressed as a percentage (G%) based on
the corresponding arithmetic media.
Then the values of germination (G%) were
reported, the viability (V%) corresponding to
the hybrid / cultivar to obtain of the efficiency
in the germination of pollen % R(G/V).
After the microscopical preparations, the Figure 1. Viability at Nicusor apricot cultivar,
germinated pollen was included in glycerin 05.Apil.2012
jelly to maintain the microscopical preparation
unaltered (Andrei and Paraschivoiu, 2003). It was found that in terms of size and
For microscopic examination was used optical morphological aspect and the
microscope IOR type ML-4M. apertures development, the germinal grains, so,
To point out the viability and the pollen with the normal physiological development
germination, examination, assessments and have dimensions close to those typical of the
photographs were made in transmitted light, same species (Tarnavschi et al., 1981-1984).
polarized light, and objectives 10x, 20x, 40x Regarding evaluation of germination (G%) by
and C.F. (phase contrast) with 10x ocular. the action of pollen composition averages
It was used ocular micrometer to measure on 15% and 20% sucrose: the germinative
polinic dimensions. capacity (G%) of each hybrid and cultivar
individually has expressed by two maxim
RESULTS AND DISCUSSIONS values corresponding germination on the two
Regarding pollen viability evaluation (V%): medium with 15% and 20% sucrose, to variant
(v2).
viability ratio (%) is the first condition in
The highest values of germination capacity
pollen germination and gives us information
about the probability of fertilization of the (G%) were at the Hybrid 82.6.62.B.IV. and
pistil. Nicusor cultivar, (table 1, figure 2, figure 3):
After the application of the specific enzymatic 28% and followed by 33% on sucrose medium
method for the determining viability (V%) of 20% followed by 33% and 37% on sucrose
the pollen, the intense red color reaction has medium 15%.
occurred at the following hybrids of apricot: It is a remarkable fact that from the point of
Hybrid 82.6.62.B.IV. had maximum of approx. practical view, in general the germination (G%)
50% and at the apricot Hybrid 82.28.62.B.IV. in 30% is considered satisfactory, because the
has registered a low value of approx 25%, specialized literature recognizes that this
having as leaders / having in view the germination is representative for thefertility
viability), the Hybrid 82.6.62.B.IV. and degree of the flowers, respectively the binding
Nicusor cultivar (Table 1, Figure 1). of future fruit (Ivascu, 2001).
The viable mature pollen grains at apricot, had Therefore, germination value (G%)
the following dimensions: from 48,3μ - 50,1μ presented in table and graph, are the
maximum values recorded for each hybrid, to
in the equatorial optical section (image
certain concentration of the medium with
obtained in polar view) and from 44,0 μ - 46,3
sucrose included in the experiment.
275
Table 1. Relationship between germination G% viability and germination yield % R(G/V) at the apricot cultivars and
hybrids evaluated in 2012
MATURE POLLEN
Germination max.(G%) of total Germination max.(G%) of total Germination max.(G%) of total
Hybrid/cultivar pollen pollen pollen
Zh 20% Zh 20% Zh 20% Zh 20%
HB
11 15 25 44 60
82.28.62.B.IV
HB 82.4.41.B.IV 17 19 30 57 63
HB 82.6.62.B.IV 28 33 50 56 66
NICUbOR 33 37 48 68 77
(*)The viability is determined by coloring with 2,3,5 Trifeniltetrazolclorid
(**)The germination productivity (% RG/V) is calculated by the ratio of germination/viability (%)
negative influence of the anthers) and can be

considered the indicative value for the specific
germination potential of pollen grain.
The percentage germination (G%) appears
correlated with viability (V%) respecting the
natural relationship between them.
For each hybrid and cultivar as well, the
germination value were assigned to the
viability values (V%), separately for
germination medium with sucrose 15% and
separately for the germination medium with
Figure 2. Apricot hybrid 82.662.BIV. on medium, with
115% sucrose (04.April.2012)
20% sucrose.
In this way was given by the productivity in
Regarding the evaluation of pollen germination germination % R(G/V), that expressed the
(G%) by the action of experimented floral parts degree of correlation between the two
in 3 variants (v1,v2,v3), on pollen germination biological characteristics of the pollen (the
on the mediums with 15% and 20% sucrose: power of germination and pollen viability) and
the maximum values obtained depending on the the germination relation/viability expresses as
variants are representative for pollen germinable, viable the pollens are, because not
germination from each of the hybrids studied. everything is viable has the power/ its ability to
The highest germination values are observed at germinate.
in second variant (V2/medium+pollen+pistille) The highest potential in germination %R(G/V)
and it is confirmed the incentive role of the is 77%, the leader being Nicusor cultivar of
pistil (at both mediums with 15% and 20% apricot Hybrid 82.6.62.B.IV. on average of
sucrose), except apricot hybrid 82.28.62.B.IV., 15% sucrose and the lowest %R(G/V) is 44%
where V1>V2 on both environments. for Hybrid 82.28.62.B.IV. on average 20%
Generally the size relation between the three sucrose .
variants (v1,v2,v3) is the following:
- Variant (V2/medium+pollen+pistil) has
maximum value because the incentive role
of the pistil in the germination and the pollen
tube growth.
- Variant (V3/medium+anthers), has a
minimum value as a result of a possible
negative influences on germination that the
anthers tissue has.
- Variant (V1/medium+pollen), has an average Figure 3. Action composition average 15% and 20%
value (in the absence of favorable influence of sucrose on pollen germination of apricot cultivars and
the pistil, and the absence of the hybrids evaluated (2012)
276
CONCLUSIONS between these two biological characteristics of
the pollen.
From experiments in 2012 in which was
evaluated the viability (V%), the germination
REFERENCES
capacity (G%) and the efficiency in
germination %R(G/V), we have drawn the Andrei M., Paraschivoiu R., 2003.
following conclusions: Microtehnica Botanicĉ. Editura Niculescu.
BucureƔti, p. 120-223.
The flowering of the apricot this year started in Andrei M., Rĉdulescu D., 1972. Caiet pentru tehnica
the first days of April. preparĉrii Ɣi conservĉrii materialului biologic–
The investigated apricot cultivars and hybrids Tehnica obԑinerii preparatelor microscopice.
(Fac.Biologie) Univ.Bucuresti, p. 1-83.
have yielded in 2012 accordingly to the specific Baciu E., 1971. Contributii la studiul microsporogenezei
and individual potential but with negative la unele specii din subfamilia prunoideae. Lucr.St.
influences due to the microsporogenesis that seria B XIV 1971. Horticulture IANB. Bucuresti, p.
was damaged in part and poor flowering in 241-245.
small proportion. Blidariu A., Iordĉnescu O., Micu R., Drĉgunescu A.,
2008. Researches concerningpollen’s germination
Regarding the two biological indicators of the and viability of some sour cherries varieties in the
pollen, the viability V% and germination G% plain area of Banat. Bulletin Horticulture UASVM.
and their relationship expressed by efficiency Bucuresti. vol. 65(1), p. 505-507.
in germination %R(G/V), on both sucrose Butac M., Militaru M., 2006. Fertilitatea Ɣi germinarea
polenului la genotipuri de mĉr, pĉr, prun, cireƔ Ɣi
medium (15% and 20%), were obtained the
viƔin utilizate ca genitori potentiali în ameliorare.
following values: Lucrarile Stiintifice ale ICDP PiteƔti
The highest germination yield %R(G/V), it has Mĉrĉcineni.vol.XXII, p. 20-27.
Nicusor apricot cultivar on 15% Cociu V., Oprea, St., 1989. Metode de cercet. în
sucrosemedium that presented 77% R(G/V) in ameliorarea plantelor pomicole. Edit. Dacia Cluj-
Napoca, p. 82-87.
terms of only 48% viability (V%) and 37% Hedhly A, Hormaza J.I., Herrero M., 2004. Efect of
germination (G%). temperature on pollen tube kinetics and dynamics
The best germination percentage regarding the in sweet Cherry Prunus avium (Rosaceae). American
Jurnal of Botany 91(4), p. 558-564.
action in media composition were recorded on Iordache M., besan T., Andrei M., 2010.Researches on
liquid medium with 15% confronted with 20% viability and germinative capacity of the pollen in
sucrose medium. some romanian appricot varieties. Symposium ISHS-
ICDP-PiteƔti Mĉrĉcineni,Scientific Papers of the
The highest values of germination and also
R.I.F.G. PiteƔti, vol XXVI, p. 46-50.
of experienced floral representative parts in 3 IvaƔcu A., Toma St., 2001. Autofertilitatea nectarinului
variants (v1,v2,v3), has consistency two variant si influenta unor fungicide asupra germinarii
(v2/medium+pollen+pistil) under the stimulant polenului. Lucr. St. ICPP Pitesti Maracineni.
influence of pestle on both environments. vol.XX, p. 62-68.
Pĉdureanu, S., 2007. Citologia germinarii polenului de
Therefore the variant V2 we consider more Ampelopsis brevipedunculata (Maxim) Trautv. Lucr.
concluding, because of the interaction between St. Universitatea Al. Ioan Coza.IaƔi, vol.50, p. 237-
pollen and pistil for binding fruits prognoses 242.
than V1. Pĉdureanu, S., 2007. Anomalii aparute in procesul de
germinare al polenului la unele Vitaceae, Lucr.St.
In vitro conditions, the germination (G%) of Universitatea Al. Ioan Cuza IaƔi, vol.50, p. 231-236
the pollen expresses by the pollen fertility Tarnavschi, I., berbĉnescu J. G., Mitroiu, R.N.,
potential and this relationship germination Rĉdulescu, D., 1981-1984. Monografia polenului
viability expresses as germinable and vigorous florei din Romania, Ed. Academiei RSR, vol. 1-4
are viable pollens and the germination degree Xie, B., Wang, X., Hong, Z., 2010. Precocious pollen
%R(G/V) express the correlation degree germination in Arabidopsis plants with altered
callose deposition during microsporogenesis,
Springer, Planta 231, p. 809-823
277
SOME MORPHOLOGICAL PROPERTIES OF DIRECT SOWED SWEET CORN
Ferenc OROSZ
Department of Vegetable and Mushroom Growing, Faculty of Horticultural Science, Corvinus

University of Budapest, H-1118 Budapest, Ménesi u. 44, Budapest, Hungary
Abstract
In our trial we compared the effect of propagation time and floating cover on the growing season on some valuable
properties of sweet corn. The following technological variations were compared with the help of the variety Spirit
(normal sweet, very early ripening): 1. direct seeded plants with floating cover (with 2 sowing dates); 2. direct seeded
plants without cover (with 2 sowing dates). The covering by earlier sowing time had favourable influence on plants
highness, ear weight, ear length and no influence on tassels length, and dept of seeds. The covering by later sowing
time had favourable influence on tassels length, ear weight, ear length and dept of seeds and no influence on plants
highness.
Key words: sowing time, plants covering.
INTRODUCTION After multi-year trial Berzsenyi et al. (1998)

have studied the effect of different sowing
Based on its present growing area, the sweet
times on maize development. Direct seeded
corn is the vegetable which is grown on the
sweet corn under vlies cover showed earlier
greatest area in Hungary. After dates of
ripening and gave better yields in the
Hungarian Fruit & Vegetable Interprofessional
experiments of Kassel (1990).
Organization in 2003 the growing area was
In case of direct seeding, as propagation
about 38,000 hectares. After 2003 followed a
method, another earliness increasing solution is
sudden and sharp decline, so in 2005 the
the temporary covering with plastic or vlies,
growing area was “just” 24,000 hectares. After
used in different combinations (Hodossi and
diminishing, the plant returned in rise, in 2006
Kovács, 1996).
against over 30,000 hectares.
About the covered early sowing as a
As early as in the beginning of the 20th century
technological variation (Aylswirth, 1986)
some researchers (Cserháti, 1901) highlighted
mentioned, that from an early sowed crop,
the importance of the sowing date. Ripening
made in first week of April, arranged in twin
can occur earlier when sowing earlier and using
rows (42 cm) and covered by plastic, we could
high quality seeds as compared to normal or
harvested marketable cobs.
late sowing. I’só (1969) and Pásztor (1966), after
their multi-year sowing date trial, concluded the MATERIALS AND METHODS
following: in the case of an earlier sowing seed
germination will be more protracted, but from the The experiment was set up in 2008 on an area
point of view of fruit maturing it was more equipped for irrigation at the Experimental
favourable than late sowing. Farm of the Faculty of Horticulture of the
Also I’só and Szalay (1966, 1969), studied occur Corvinus University of Budapest.
of maize generative phenophases. They con- The results of the analysis of the soil sample
cluded, that by earlier sowing germination will be collected at the beginning of 2006 from the trial
more protracted, but silking and harvesting occur area prior to direct seeding are contained in
sooner than by lately sowing time. Table 1.
Table 1. Soil analysis results
279
The pH of soil was considered calcarous. The plot, respectively. All treatments were set up in
nutrient content of soil in nitrogen was low, in four replications.
phosphorus very good and in potash good. Fertilization was done by top dressing with N.
The test variety was Spirit, a normal sweet corn No farmyard manure was applied.
with a very early growing period (85 days). During the experiment, we studied some plant
Average plant height is 159 cm, ear height is 37 morphological properties according to the
cm. Average ear length was 19.6 cm in the following:
variety comparison trials carried out by the highness of plants (cm), length of tassels (cm),
Central Agricultural Office and average ear Ears, together with the husks, were collected
weight was 245 g (Kovács, 2002). from the four central (two twin) rows. After
The following treatments were applied during that 20 ears of average appearance were
the experiment: selected from each row and the following
P1 = uncovered direct seeded (April 8th), P2 = measurements were carried out: unhusked ear
covered direct seeded (April 8th), P3 = covered weight (gram), total ear length (cm), depth of
direct seeded (April 21th), P4 = the control, seeds (mm).
uncovered direct seeded (April 21th). The statistical analysis of the results was
By both sowing times (April 8th and April 21th) carried out by using the programme RopStat
a part of the stand was covered with Novagryl 1.1. When the standard deviations were
floating row cover having a weight of 19 g/m2 identical the mean values were compared by
at the two propagation times in order to pairs using the Tukey-Kramer test, while in the
enhance earliness. The floating row cover was case of the non identical standard deviations the
removed on May 13th. The stand was created to means were compared using the Games-Howell
contain 60,607 plants per hectare, according to test (Vargha, 2007).
the recommendations of the owner of the
variety, at a spacing of 110+40x22 cm in twin RESULTS AND DISCUSSIONS
rows. Each plot had an area of 6x7m (8 parallel
The highness of plants (cm) is represented in
rows and 30 seeds sown in each row). The edge
the figure 1.
was the outer two rows of the 8 rows of the
Figure 1. Highness of plants
The effect of covering (P2) was favourable on earlier sowed (P1) uncovered and P2 (covered)
plant high compared to uncovered (P1) treatments. Among other treatments plant
treatment by earlier sowing time. The highest highness no significantly difference.
value of plant highness was registered by plants Evolution of tassels length (cm) is summarised
of (P4 control) treatment, difference was on figure 2:
significantly (at p<0.01 level), compared to
280
Figure 2. Tassels length
In case of tassels length the time of later covered (P2) treatment and longer, but not
sowing has greater influence. Plants from later significantly, compared to earlier sowed
sowed covered (P3) and uncovered, control uncovered (P1) treatment.
(P4) treatments had significantly (at p<0.01 The unhusked ear weight (g), one of the major
level) longer tassels compared to earlier sowed yield parameters, is illustrated in figure 3.
Figure 3. Unhusked ear weight
Analysing the measured data for unhusked ear significantly higher (at p<0.01 level) compared
yield, we saw that the average weight of the ears to the uncovered treatment P1 and higher, but
of the treatment P2 (earlier seeded, covered not significantly, compared to P4 treatment.
plants) was significantly (at p<0.01 level) higher The data concerning, an important charac-
as compared to the other treatments. teristics for market appeal, total ear length (cm)
The average unhusked ear weight of the P3 are contained in figure 4.
treatment (later seeded, covered plants) was
Figure 4. Total ear length
281
Studying the data of total ear length, we found cantly higher (at p<0.01 level) compared to the
that the lengths of later seeded, uncovered other treatments. No statistically demonstrable
(control) treatment P4 were also statistically difference was found between the ear length of
significantly (at p<0.01 level) lower to the sizes the treatments P1 and P3.
of the other treatments (P1, P2 and P3). From customer viewpoint depth of seeds (mm)
The average total ear length of the P2 treatment is an important parameter and the measured
(earlier seeded, covered plants) was signifi- average results are presented on figure 5.
Figure 5. Depth of seeds
Analyzing the size (depth) of seeds we Berzsenyi Z., Ragab A. Y., Dang Q. L., 1998. A vetésidƅ
observed a statistically demonstrable (at p<0.01 hatása a kukorica hibridek növekedésének
level) difference among control treatment (P4) dinamikájára 1995-ben és 1996-ban.
Növénytermelés, 47 (2), p. 165-180.
and other treatments. Seeds depth of later Cserháti S., 1901. Általános és különleges
seeded, covered treatment (P3) was bigger, növénytermelés. II. kötet, Magyaróvár, p. 527.
sustained statistically (at p<0.01 level), Hodossi S., Kovács A., 1996. A koraiság javításának
compared to the other treatments. jelentƅsége és lehetƅségei a csemegekukorica
termesztésben. Hajtatás, korai termesztés, 27 (3), p.
CONCLUSIONS 11-13.
I’só I., 1969. Kísérletek a kukorica korai vetésével
Effect of covering has favourable effect on high- (1965-1968). In: Kukoricatermesztési kísérletek
ness of plants by earlier sowing time, in 2008. 1965-1968. (Szerk. I’só I.). Akadémiai Kiadó, p.
Covering had also positive effect on evolution 248-255.
of tassels length by later sowing time. I’só I, Szalay D., 1966. Egyedfejlƅdési vizsgálatok a
kukorica vetésidƅ kísérletekben. In:
The unhusked ear weight presented the highest Kukoricatermesztési kísérletek 1961-1964. (Szerk.
results in case of treatment P2 (earlier seeded, I’só I.) Akadémiai Kiadó, p. 233-239.
covered). In case of later seeded treatments (P3, I’só I, Szalay D., 1969. Egyedfejlƅdési vizsgálatok a
P4) the results were quite square. kukorica vetésidƅ kísérletekben. In:
Measuring ear length, we observed the same Kukoricatermesztési kísérletek 1965-1968. (Szerk.
tendency as in case of ear weight. P2 treat- I’só I.) Akadémiai Kiadó, p. 237-247.
ment’s ear produced the highest values. Kassel L.V.G., 1990. Direktaussaat von Zuckermais
unter Vlies. Gemüse, 26 (7), p. 350.
From customer viewpoint important parameter, Kovács F., 2002. Csemegekukorica. In: Füstös Zs.
depth of seeds, the later seeded, covered treat- (szerk): Leíró fajtajegyzék, OMMI.
ment P3 presented the better results, in 2008. Pásztor K., 1966. A vetésidƅ és a vetésmélység hatása a
kukorica termésére. In: Kukoricatermesztési
REFERENCES kísérletek 1961-1964. (Szerk. I’só I.). Akadémiai
Kiadó. Budapest, p. 240-251.
Aylswirth J. D., 1986. Harvest sweet corn by the fourth. Vargha A., 2007. Matematikai statisztika. Pólya Kiadó.
American Vegetable Grower, 34 (2), p. 37-38.
Budapest.
282
ORNAMENTAL PLANTS,
DESIGN AND
LANDSCAPE
ARCHITECTURE
SOME CONTRIBUTIONS ON INTRODUCTION OF THE

GENUS ABIES MILL. SPECIES IN THE REPUBLIC OF MOLDOVA
Vasile BUCATEL
Botanical Garden (Institute) Academy of Sciences of Moldova, 18 Padurii Street, Chisinau,

Moldova
Abstract
The main objectiveof the presentpaper is to studythe biological peculiaritiesof the genus Abies species and
formsgrowing and newly introduced in the Republic of Moldova, by their subsequent identification of the most
perspectives. As a resultof the investigationsfor the first time arerefined the taxonomicalcomposition that include 23
species, 3 hybrids and 26 forms and cultivars. The questions ofgrowth and development, also the peculiarities
offlowering andseed-bearing are studied. Thesustainability of the species and forms ofthe genus Abiesto unfavorable
environmental factors i. e. to drought hardiness experimentally are established. The peculiaritiesof seed andvegetative
propagationare investigated. For the first timeare tested variousways ofgrafting for decorative formsoffir in thesoil and
climatic conditions. Based on the analysis of obtained data are proved the perspectiveof breeding somespecies
andgarden formsby vegetative ways. The optimal grafting terms,graftingmodalities and their modificationswith
reference to the conditions are recommended. A result of investigationsselected andrecommended for usein green
buildingthe mostornamental speciesand cultivars offir.
Key words: introduction, coniferous, fir, species, cultivars.
INTRODUCTION The introduction in green plantings

composition the introduced species is one of
Fir (Abies Mill.) is a genus of evergreen forest-
the perspective ways of enrichment the
forming woody plants in which are provided
biological diversity, as well as increasing the
more than 50 main species is one of the oldest
aesthetic value of cultural landscapes. The
of the eleven existing genera of the pine
representatives of the genus Abies does not
(Pinaceae Lindl.). The species of this genus
grow in natural conditions of the Republic of
predominantly in mountainous regions of the
Moldova. The first steps on introduction of firs
northern hemisphere, where they form dark
relate to the second half of XIX century –
coniferous forest are widespread. The most of
beginning of XX in the gardens and parks of
them in the area of sub-zones of middle and
southern taiga of Siberia and North America, as the landlords (ʤ̦̬̖̖̔̏ ʦ. ʻ. 1957; ʸ̨̖̦̯̖̽̏
well as in the mountainous forests of the ʿ. ʦ., 1967). Furthermore, the experience on
temperate and subtropical zones of Central and introduction of Abies species was accumulated
Southern Europe, North Africa and foreign in the botanical gardens and arboretums and,
Asia are located (ʶ̨̬̼̣̏ ʧ. ʦ. ̛ ̬̔., 1986). particularly active fir has been implemented
The species of genus Abies have a number of from the middle of XX century. However, up to
valuable ornamental qualities necessary in present not yet summarized the rich experience
green building - this is the durability and in creating and growing of fir plantings in the
monumentality, the high sanitary and Republic of Moldova.
recreational properties and the emotional
impact on people. These properties in MATERIALS AND METHODS
combination with a diversity of ecological As biological material for the investigations
peculiarities of different species of fir it can be were served the species and cultivars of Abies
successfully used to create park, forest park, genus, which grows in the Botanical Garden
and other types green spaces. Academy of Sciences of Moldova (the old and
new territory), arboretums, parks and squares
285
of Chisinau, also the old parks. For carrying out A. numidica De Lann.
-
the actual researches a number of known ex Carr.
A. pinsapo Boiss. 'Glauca'
methods, recommendations for clarification of
'Glauca',
the species composition, determination of heat A. procera Rehd. 'Kelleris',
and drought resistance, winter hardiness, 'Obrighoven'
reproductive ability, level of adaptation and the A. recurvata Mast. -
perspective of introduction have been used A. sachalinensis
-
(ʧ̛̬̭ ʧ. ʰ., ʪ̬̖̖̭̦̼̖̏ … 1975; ʫ̡̨̬̥̌̏ ʥ. (Schmidt) Mast.
A. sibirica Ledeb. -
ˁ., 1981; ʯ̱̬̖̍̌̏̌ ʽ. ʻ., 1979; ʰ̨̦̏̌̏̌ ʯ. ˔., A. spectabilis (D.Don)
1982; ʺ̨̡̛̖̯̔̌ … 1975; ˈ̨̨̬̥̏̌ ˃. ʦ. 1980; Spach
-
ˋ̨̖̬̖̪̦̌̏ ˁ. ʶ., 1975). A. veitchii Lindl. -
A. x vilmorinii Mast. -
CONCLUSIONS
As a result of determining and clarifying the
taxonomic composition of the genus Abies in As a result of determining and refinement of
the Republic of Moldova we have established the taxonomic composition of the genus Abies
the 23 species, 3 hybrids, 26 forms and in perennial plantations of the Republic of
cultivars (Table 1). Moldova revealed 51 taxa. Our studies
concerning the growth and development of the
Table 1. Taxonomic composition of genus Abies Mill. genus Abies have shown that the soil and
species in the Republic of Moldova. climatic conditions of the Republic of Moldova
Species and hybrids Cultivars are favorable for growth of many ornamental
Aurea, Columnaris, fir species and cultivars. The entry of 16 fir
Abies alba Mill.
'Pendula', 'Pyramidalis' species in the generative phase indicates to
A. amabilis (Dougl. ex their adaptability to new environmental
-
Loud.) Forb. conditions. The good germinating capacity of
A. arizonica Merr. -
A. x arnoldiana Nitz. Ioan Pavel II
seeds of some fir species creates the possibility
'Nana', of their mass reproduction and its following use
'Piccolo', in the ornamental gardening. On the example of
A. balsamea (L.) Mill.
'Hudsonia' fir blue species was proved that the last have a
Pyramidalis high heat resistance with respect to the types.
A. borisii-regis Mattf. - Thus, when creating a green plantations under
A. cephalonica Loud. -
A. cilicica Carr -
conditions of increased heat should be given
'Argentea', preference to the species with a blue coloration
A. concolor (Gord.) of the needles. Based on the researches was
'Compacta',
Ldl.
ex Hildebr.
'Violacea', proved the perspectivity of reproduction of fir
'Lowiana' species and cultivars by vegetative way: low
A. fraseri (Pursh) Poir. -
growing form by cuttings and with high stems
A. holophylla Maxim. -
A. homolepis Sieb.et
by grafting. For landscape gardening we can
- recommend 13 fir species and, their ornamental
Zucc.
A. x insignis Carr. ex. cultivars.
Bailly - The highest number of forms is distinguished:
in Rev.
Brilliant
A. concolor, A. koreana and A. procera. Taking
'Brevifolia', into account the global floristic reserves of the
A. koreana Wils. 'Piccolo', genus (56 species, 2 subspecies, 9 hybrids, 2
'Lumenetta', varieties and 625 cultivars) [ʦ̛̭̣̖̌̽̏ ʻ. ʧ.,
'Silberlocke'
˄̵̨̦̌̏ ʦ. ʦ., 1949; ʶ̨̬̼̣̏ ʧ. ʦ. ̛ ̬̔., 1986;
A. lasiocarpa (Hook.)
'Compacta' Den Oden P., Boom B. K. 1978; Aris G.
Nutt.
A. nephrolepis Trautv.) Anders and Derek P., 2012; ], the assortment of
-
Maxim. used in the green building of the Republic of
A. nordmanniana 'Golden Spreader', Moldova is comparatively poor. This basically
(Stev.) Spach 'Pendula'
286
it is A.alba and A.concolor. The other species introduction plays winter hardiness, of plants,
are used for creating decorative groupings in moreover in the process of acclimatization, it
botanical gardens, arboretums, old parks, as can change. Currently, 90% of cultivated
well as in private gardens. Seasonal the growth species of the genus Abies have the highest
of shoots is one of the main periods of woody scale of hardiness - I. The part of species has a
plants life, closely related with climatic transitional point, depending on the climatic
conditions of growing. conditions of the year - I-II. During the period
The study of growth and development of of investigations types and forms of fir showed
introduced plants in different soil and climatic the complete drought resistance, i. e. in all
conditions allows to judge about their cases was observed the drought resistance - V
adaptation to the new environment and to by M. R. Duval-Stroev five-point scale [1966].
identify the existence of perspective for the We have also investigated the peculiarities of
economy. Our observations showed that in seed reproduction. In our experiment, seeds of
Central of Moldova (Chisinau) at the the local reproduction were used. In the
investigated species of fir the growth axial research program was to identify the optimal
shoots begins in late April – early May, with an growing seedlings of some fir species, for what
average daily temperature of 8-16o C. The end were tested different variants and substrates
of growth in most species occurs at the end of and pre-sowing preparation of seeds, as well as
June – beginning of July. Deadlines of different sowing dates. The higher germination
beginning and end of growth vary from year to of seeds group up to 56% of A. concolor and A.
year, so that the duration of growth is different. nordmanniana on the substratum consisting of
The most intensive growth of shoots is sod soil and river sand (3: 1) was attested. The
observed in May. Blossoming and seed wearing use of chemical solutions (potassium
is an important moment in the life of any plant. permanganate - 1%, heteroauxin - 0.01%,
The entry into generative phase is one of the superphosphate - 0.5%) for pre-sowing
criteria for assessing the success of plant preparation of seeds led to a significant
introduction. Under the conditions of Republic increase in soil germination. Along with the
Moldova 'blossom' and form seeds of 16 seed method of reproduction, which for the
species of fir. Their strobilation occurs in the most species of Abies was the major, we carried
first half of May, with an average daily air out the experimental study on the impact of
temperature 9-18° C and the sum of positive different growth factors on the rooting of
cuttings dwarf cultivars. We have précised and
temperatures 290-480° C. Strobilation period
expanded the reproduction methods of fir
varies from year to year, is dependent on the
cuttings. The higher percentage of rooting from
weather and lasts from 6 to 12 days. Seed
40 till 55% of the cuttings had the following
ripening begins in the first decade of October.
cultivars: A. balsamea Nana൏, A. concolor
Whole period of cones from flowering to
maturity, depending on the species, lasts 100 to Compacta൏, A. koreana Piccolo൏, A.
130 days. For the full development necessitates lasiocarpa Compacta൏. For the first time in the
the sum of positive temperatures – 2150-2800° soil and climatic conditions of Republic
C. The determination of the quality seeds has Moldova was carried out researches on
shown high laboratory germination (over 70%) inoculations different species and cultivars of
in A. concolor, A. nordmanniana and A. the genus Abies. The periods, optimal methods
numidica, average (40-50%) at A. alba, A. and the impact of chemicals on the intergrowth
sibirica, A. pinsapo and low (10-25%) in other of inoculations were studied. In our country
species. In our opinion low seeds germination great attention was paid to the involvement of
is due to the insufficient number of trees of that different fir species and cultivars by
species. As a result of experimental study (the transplantation methods. On the basis of the
testing into the water chamber of obtained data, we formulated the following
ultrathermostat UT-15) was established more conclusion that a highly ornamental fir species
expressed heat resistance of fir species needles and cultivars should be propagated by grafting.
with blue color as compared to green. It is The optimal for the reproduction is in the
known that an important role in the fissure of axial sprout through the apical buds
287
by cambium on the very center – method ʪ̬̖̖̭̦̼̖̏ ̛̬̭̯̖̦̌́ ʧ̨̨̣̦̌̏̐ ʥ̸̨̡̨̨̛̯̦̖̭̌̐ ̭̌̔̌
modified by us. The best results are obtained by ʤʻ ˁˁˁˀ. 1975. ʺ.: ʻ̡̱̌̌, 547 ̭.
ʪ̣̀̏̌̽-ˁ̨̯̬̖̏ ʺ. ˀ., 1966. ʰ̨̛̯̐ ̶̨̡̛̛̛̦̯̬̱̔
grafting during the spring period, at the
̵̡̨̛̖̬̯̦̼̔̌̏ ̖̬̖̖̔̏̽̏ ̛ ̡̡̨̛̱̭̯̬̦̌̏ ̏ ̐.
beginning of the swelling buds and in summer- ʶ̨̬̭̦̬̖̌̔̌ ̛ ̡̛̪̖̬̭̪̖̯̼̏ ̵̛ ̨̨̛̛̭̪̣̦̽̏̌́̚ ̣̔́
fall after the end of shoot growth. The ̨̛̖̣̖̦̖̦́̚ ̵̦̭̖̣̖̦̦̼̌ ̥̖̭̯ ʶ̛̱̦̍̌. ʤ̴̨̯̬̖̏.
processing of the grafts cut site by solution of ̛̭̭. ̡̦̌̔. ̨̛̣̍. ̡̦̱̌. ʶ̨̬̭̦̬̌̔̌, 24 ̭.
succinic acid (0.01%) and dimethyl sulfoxide ʫ̡̨̬̥̌̏ ʥ. ˁ., 1981. ˀ̨̛̥̦̙̖̦̖̌̚ ̵̬̖̖̭̦̼̔̏ ̛
(0.1%), directly before inoculation leads to ̵̡̡̨̛̱̭̯̬̦̼̌̏ ̛̬̭̯̖̦̜̌ ̖̣̖̦̼̥̚
increasing the percentage of survival. On the ̸̡̨̛̖̬̖̦̦̖̥̏̌. ʶ̛̛̹̦̖̏: ˌ̶̛̛̯̦̌, 222 ̭.
basis of many years of study the growth, ʰ̨̦̏̌̏̌ ʯ. ˔., 1982. ʥ̸̨̨̡̛̛̛̣̖̭̖̐ ̨̨̭̦̼̏ ̛ ̛̪̬̖̥̼
̨̨̛̖̖̯̯̦̏̐̌̏̐ ̨̛̬̥̦̙̖̦̌́̚ ̵̬̖̖̭̦̼̔̏ ̛̬̭̯̖̦̜̌
development, sustainability and decorativeness ̛̭̯̖̣̖̼̥̍̏ ̸̡̛̖̬̖̦̥̌. ʶ̛̖̏: ʻ̡̨̱̌̏̌ ̡̱̥̔̌,
for green building of our country we 288 ̭.
recommend the following species of the genus ʶ̨̬̼̣̏ ʧ. ʦ., ʺ̛̬̱̦̌̌̔̔ ʰ. ʰ., ʺ̵̛̖̖̏ ʻ. ʰ.,
Abies such as: A. alba, A. balsamea, A. ʶ̨̡̨̌̏̌̚ ʻ. ˇ. ʿ̵̛̯̌. ʺ., 1987. ʤ̨̨̛̬̪̬̥̯̐̔̌̚,
cephalonica, A. concolor, A. holophylla, 239 ̭.
A.homolepis, A. koreana, A. nephrolepis, A. ʸ̨̖̦̯̖̽̏ ʿ. ʦ., ʿ̡̛̬̌ ʺ̨̛̛̣̔̌̏. ʶ̛̛̹̦̖̏, 1967.
nordmanniana, A. numidica, A. pinsapo, A. ʶ̬̯̌́ ʺ̨̨̡̣̖̦̭̔̏́̾, 94 ̭.
ʺ̨̡̛̖̯̔̌ ̴̸̵̨̨̡̛̛̖̦̣̖̭̐ ̛̦̣̖̦̜̌̍̀̔ ̏
procera, A. sibirica, and also their highly
̸̵̨̡̛̛̯̦̖̭̍̌ ̵̭̌̔̌ ˁˁˁˀ. ʺ., 1975. 27 ̭.
ornamental cultivars. ˈ̨̨̬̥̏̌ ˃. ʦ., 1980. ʺ̸̨̡̛̛̖̯̖̭̖̔ ̡̛̱̦̌̌́̚ ̨̪
̨̛̬̥̦̙̖̦̌̀̚ ̶̵̨̨̛̛̦̯̬̱̬̦̦̼̔̏̌ ̵̬̖̖̭̦̼̔̏
REFERENCES ̛̬̭̯̖̦̜̌ ̸̡̛̖̬̖̦̥̌. ʺ.: ʦʤˁˈʻʰʸ, 45 ̭.
ʤ̦̬̖̖̔̏ ʦ. ʻ., 1957. ʪ̖̬̖̏̽́ ̛ ̡̡̛̛̱̭̯̬̦̌ ˋ̨̖̬̖̪̦̌̏ ˁ. ʶ. 1975. ˁ̨̛̭̱̭̯̼̖̔ ̛̬̭̯̖̦̌́ ˁˁˁˀ. ʸ.:
ʺ̨̛̛̣̔̌̏. ʺ.: ˀʰʽ ʤʻ ˁˁˁˀ, ̼̪̏. 1, 207 ̭. ʻ̡̱̌̌, 510 ̭.
ʦ̛̭̣̖̌̽̏ ʻ. ʧ., ˄̵̨̦̌̏ ʦ. ʦ. ˀ̨̔ ̵̛̪̯̌. ʦ ̡̦., Den Oden P., Boom B. K., 1978. Manual of cultivated
conifers. The Hague–Boston–London: M̌rtinus
1949. ʪ̖̬̖̏̽́ ̛ ̡̡̛̛̱̭̯̬̦̌ ˁˁˁˀ:
Nijhoff, p. 526.
ʧ̨̨̣̭̖̥̖̦̦̼̖. ʺ.-ʸ., ̛̔̚-̨̏ ʤʻ ˁˁˁˀ, ˃. I, ̭. 53-
Encyclopedia of Conifers, 2012. Compehensive Guide to
103.
Cultivars and Species by Aris G. Anders and Derek
ʧ̛̬̭ ʧ. ʰ., ʯ̱̬̖̍̌̏̌ ʽ. ʻ., 1979. ˄̸̨̨̛̭̯̜̭̯̏̽
P., Spicer, Hardcover, 2 volums, p. 1507.
̵̛̖̖̯̯̦̼̏̐̌̏ ̨̨̬̦̐̌̏ ̵̵̨̜̦̼̏ ̡ ̨̡̨̼̭̜̏ Krüssmann G. Handbuch der Nadelgehölze,
̯̖̥̪̖̬̯̱̬̖̌. ˀ̶̡̛̖̌́ ̵̵̨̜̦̼̏ ̦̌ ̛̖̜̭̯̖̔̏ 1983. Berlin, Hamburg, Parey, p. 396.
̵̨̛̪̬̖̙̺̏̔̌̀ ̴̡̨̨̯̬̌̏. ʶ̨̡̬̭̦̬̭̌́, ̭. 5-14.
288
RESEARCHES CONCERNING THE POSTHARVEST CARE

OF LISIANTHUS RUSSELIANUS CUT FLOWERS
Erzsebet BUTA, Maria CANTOR, Mihai BUTA, Denisa HORT, Orsolya VALKAI
University of Agricultural Sciences and Veterinary Medicine of Cluj, 3-5 Manastur Street, Cluj
Napoca, Romania
Abstract
Lisianthus popularity is due not only to the wide range of assortment (small-flowered varieties Piccolo type, edging -
Panther Curly, striped -Lilac Shadow), but also due to the attractive character of flowers. Purple color of the petals is
the dominant at the most variety (35 %), followed by white (21 %), pink (12 %), yellow (8 %), and green (9 %),
varieties with bicolor petals (9 %). Experiences regarding the postharvest care, using Lisianthus russellianus varieties
have been developed in the flower shop “Decor Studio”, Cluj-Napoca, Cluj County.
Biological material used in experiments with Lisianthus russellianus varieties, consisted in tree cultivars as following:
'Piccolo White” (white flowers) “Mariachi Pink” (pink flowers), “Echo Blue” (blue flowers). During the experiences it
was investigated the effect of four solutions (Belle Fleur, Floralife, Vitalife and tap/normal water) on the morphological
characters of the studied varieties and the on period of storage. The results obtained show that the variety with the
longest storage period is “Echo Blue” (30 days), and the most favorable nutrient solution was Fleur Bell.
Key words: preservation, nutrient solutions, Eustoma.
INTRODUCTION flowers are distributed on a stem that opens

successively (Armitage, 2004).
Lisianthus russellianus is relatively new
Plant breeders around the world have
species in floricultural assortment which it
discovered its marvelous properties as a cut
belongs to the Lisianthus genus, family
flower, and flowers have been bred into a
Gentianaceae. This species is known as
myriad of colors, occurring as singles or
Eustoma grandiflorum (Armitage, 2001).
doubles in florists’ coolers across the country
Lisianthus genus originates in North America,
(Armitage, 2001). Lisianthus is the most
especially Mexico. Genus name allude at the
important greenhouse cut flowers, this North
beauty of calyx and corolla, the shiny satin
American species continues to be crossed by
aspect and very nice border of the flower
American, Dutch, Japanese, and Israeli
(„liseé” in French – means smooth).
breeders (Armitage and Laushman, 2003).
In the areas of origin, it is spontaneous species
Some of the cut flower cultivars are also used
inhabits grasslands stretching from Nebrasca to
in garden design, particularly the Yodel series
Colorado, Texas and Mexico (Cantor 2010;
(single flowers) and the Echo series (double).
Bala, 2010).
In Texas is popularly known as 'blue bell', ‘Yodel Lilac’ and ‘Echo White’ have performed
'prairie rose', and 'prairie gentian'. quite well in outdoor beds in Athens (Armitage,
From the wild forms with blue petals resulted 2004).
through breeding new forms with a great It is needed well-drained soils, and can be
perfection extremely varied flowers with colors propagated by seed. Plants are raised almost
and shapes (Toma, 2011; Draghia, 2011). exclusively from seed by specialist
The leaves of this 40 cm tall plant are thick and propagators; terminal cuttings are only
blue-green. The flower are commonly violet to occasionally used because they tend to flower
irregularly (Armitage, 2004).
lavender but have been bred in white, pink, and
Regarding the harvesting of Lisianthus many
purple, usually with a darker eye in the center.
growers find that best results occur when the
Flower can be simple or abundant and more
central bud is removed, so that more flowers
will be open simultaneously. Harvest when one
289
flower is fully colored. Postharvest life is RESULTS AND DISCUSSIONS
excellent, 10–15 days. Small buds often fail to
The recorded data concerning the effect of
develop after harvesting, and flowers
nutrient solution on the postharvest life of
(particularly blue and pink flowers) fade badly
Lisianthus were statistical interpreted with
in low light conditions; if placed in high light,
„LSD” test (Least Significant Difference) to
these conditions become less severe (Kawabata
illustrate the significance of differences.
1995). A 25% decrease in light intensity
At the set up of experiences, were made some
determine results a 40% decrease in color
observations were made on morphological
intensity (Griesbach 1992). Several solutions
characters of varieties studied. Were analyzed
have been tested, with varying results.
the following characteristics: flower stem
Interestingly, Song et al. (1994) found that
length, number of leaves, flower diameter,
pretreating stems with STS (silver thiosulfate)
number of petals and number of flowers per
or Chrysal AVB prior to placing in
stem.
preservatives had little effect on longevity but
Regarding the effect of nutrient solution on the
resulted in more flowers opening in the vase.
length of floral stem can observe that all
Other research showed that treatment with 0.1
solutions appear with a non significant
mM STS for 24 hours before placing in
difference, which means that neither influenced
distilled water increased the vase life
this character (Table 1). The result from Table
significantly. Sucrose too has been studied and
2 shows the similar data. Neither cultivar
recommended as an alternative to STS. Another
influenced favorable the stem length.
recipe, consisting of 10% sugar, citric acid, and
antimicrobial agents, pulsed for 24 hours, Table 1. The influence of nutrient solution on the length
resulted in 13-day postharvest life and opening of floral stem at Lisianthus russellianus
of all flower buds on the cut stem (Armitage,
Stem length
2003). Nutrient ±D Signification of
Absolute Relative
solution (days) difference
(cm) (%)
MATERIALS AND METHODS Tap water
68,11 100,0 0,00 -
(C)
Experiments concerning the postharvest care of Bell Fleur 66,47 97,6 -1,64 -
Lisianthus russellianus were done at „Decor Vitalife 67,89 99,7 -0,22 -
Studio” flower shop from Cluj-Napoca, Cluj Floralife 66,28 97,3 -1,83 -
county. Experiments were installed on LSD (p 5%) 2,11
11.11.2011. It took on average of 38 days. LSD (p 1%) 2,89
LSD (p 0,1%) 3,93
Observations were made at an interval of two
days between 15.11-21.12.2011. Light and
Table 2. Unilateral influence of cultivars on the stem
moisture conditions were specific as a normal length at Lisianthus russellianus
living space.
The biological material used in experiments Stem length
±D Signification of
Cultivars Absolute Relative
with species Lisianthus russellianus, consisted (cm) (%)
(cm) difference
in three cultivars, as follows: Piccolo White Piccolo
(white flowers), Mariachi Pink (pink flowers), 66,79 100,0 0,00 -
White (C)
Echo Blue (blue flowers). The material used Mariachi
66,10 99,0 -0,69 -
comes from the Netherlands and was acquired Pink
by the company Greenlit from Cluj-Napoca. EchoBlue 68,67 102,8 1,88 -
LSD (p 5%) 2,57
The control of experiments was Piccolo White LSD (p 1%) 4,25
cultivar. LSD (p 0,1%) 7,96
As nutrient solution were used the followings:
Belle Fleur, Floralife, Vitalife and tap/normal In the Table 3 are presented the data
water. concerning the influence of nutrient solution on
The experience was bifactorial with 12 variants the number of leaves at Lisianthus russellianus
which were placed in randomized blocks, in cultivars. The result shows that the best nutrient
three repetitions. solution was Vitalife, which achieved a very
290
significant difference. The solutions like Bell Table 6. The unilateral influence of cultivar upon flower
Fleur and Floralife registered significant diameter at Lisianthus russellianus
positive difference. Regarding the cultivar Flower diameter
influence, Mariachi Pink shows a distinct Cultivars Absolute Relative
(cm) difference
significant difference, that exceed the control (cm) (%)
Piccolo
with 7,67 pieces (Table 4). White (C)
4,33 100,0 0,00 -
Mariachi
Table 3. The influence of nutrient solution on the number 5,75 132,7 1,42 *
Pink
of leaves at Lisianthus russellianus cultivars Echo Blue 6,50 150,0 2,17 ***
Number of leaves LSD (p 5%) 0,94
Nutrient ±D Signification of LSD (p 1%) 1,56
Absolute Relative
solution (piece) difference LSD (p 0,1%) 2,91
(piece) (%)
Tap water
22,0 100,0 0,00 - Concerning the unilateral influence of cultivar
(C)
Bell Fleur 28,89 131,3 6,89 * upon flower diameter at Lisianthus
Vitalife 32,67 148,5 10,67 *** russellianus, the results described in the Table
Floralife 28,33 128,8 6,33 * 6 shows that Echo Blue registered very
LSD (p 5%) 5,56
LSD (p 1%) 7,63 significant differences that exceed the control
LSD (p
10,38
with 2.17 cm.
0,1%)
Data from Table 7 shows that one of nutrient
solutions had a favorable influence on the
Table 4. Unilateral influence of cultivars on the number
of leaves at Lisianthus russellianus number of flowers/stem. Bell Fleur nutrient
solution determines a very significant
Number of difference of 1.05 cm, which exceeds the
leaves ±D Significati
Cultivars Absolut (piece on of
control of experiment with 9.3%.
Relativ
e ) difference
e (%) Table 7. The unilateral influence of nutrient solutions on
(piece)
Piccolo White (C) 24,67 100,0 0,00 - the number of flowers/stem at Lisianthus russellianus
Mariachi Pink 32,32 131,1 7,67 ** No. of flowers/stem
EchoBlue Nutrient ±D Signification of
26,92 109,1 2,25 - Absolute Relative
solution (piece) difference
(piece) (%)
DL (p 5%) 4,31
Tap water
DL (p 1%) 7,14 11.28 100,0 0,00 -
DL (p 0,1%) 13,36
(C)
Bell Fleur 12.33 109,3 1,05 ***
Vitalife 10.36 91.8 -0,92 ooo
Just one of the nutrient solution influenced Floralife 11.38 100.8 0,01 -
favorable the diameter of flower. Bell Fleur LSD (p 5%) 0,43
generated a difference of 0.53 cm, which shows LSD (p 1%) 0,59
LSD (p
a significant differences comparing with the 0,81
0,1%)
control (tap water). The rest of solutions
determine a negative difference (Table 5). Table 8. Cultivars influence upon the number of
flowers/stem at Lisianthus russellianus
Table 5. The influence of nutrient solution on the Number of
diameter of flowers at Lisianthus russellianus cultivars flowers/stem ±D Signification of
Cultivars
Flowers diameter Absolute Relative (piece) difference
Nutrient ±D Signification of (piece) (%)
Absolute Relative
solution (cm) difference Piccolo
(cm) (%) 10,17 100,0 0,00 -
Tap water White (C)
5,42 100,0 0,00 - Mariachi
(C) 13,08 128,7 2,92 *
Bell Fleur 5,96 109,8 0,53 * Pink
Vitalife 5,36 98,8 -0,07 - Echo Blue 9,75 95,9 -0,42 -
Floralife 5,38 99,2 -0,04 - LSD (p 5%) 2,02
LSD (p 5%) 0,43 LSD (p 1%) 3,34
LSD (p 1%) 0,59 LSD (p 0,1%) 6,26
LSD (p 0,1%) 0,81
291
Results from table 8 shows that Mariachi Pink Table 11. Unilateral influence of nutrient solutions on the
registered significant differences concerning postharvest period
the number of flowers/stem. The difference was Number of days
Nutrient
2.92 pieces, which exceed the control cultivar. Absolute Relative
solution (days) difference
Concerning the results from Table 9 neither (days) (%)
Tap water
solutions influenced favorable the no. of (C)
22,11 100,0 0,00 -
petals/flowers. Bell Fleur generates a difference Bell Fleur 34,89 157,8 12,78 ***
of 0.33 cm, but it is not statistically assured. Vitalife 17,67 79,9 -4,44 000
Floralife 34,00 153,8 11,89 ***
Table 9. Unilateral influence of nutrient solution on the LSD (p 5%) 2,53
no. of petals/flowers at Lisianthus russellianus cultivars LSD (p 1%) 3,47
LSD (p
4,72
No. of petals/flowers 0,1%)
Nutrient ±D Signification of
Absolute Relative
solution (piece) difference
(piece) (%) Regarding the unilateral influence of cultivars
Tap water upon postharvest period, the results from Table
10,22 100,0 0,00 -
(C)
Bell Fleur 10,56 103,3 0,33 -
12 show that Echo Blue cultivar achieved
Vitalife 9,89 96,7 -0,33 - significant difference and this exceed the
Floralife 9,22 90,2 -1,00 - control cultivar with 4.92 days.
LSD (p 5%) 2,10
LSD (p 1%) 2,87 Table 12. The unilateral influence of cultivars upon
LSD (p
0,1%)
3,91 postharvest period
Number of days
Table 10. The unilateral influence of cultivars upon the Cultivars Absolute Relative
(days) difference
number of petals/flower at Lisianthus russellianus (days) (%)
Piccolo
Number of 25,67 100 0,00 -
White (C)
petals/flower ±D Signification of
Cultivars Mariachi
Absolute Relative (piece) difference 25,25 98,4 -0,42 -
Pink
(piece) (%)
Echo Blue 30,58 119,2 4,92 *
Piccolo
5,00 100,0 0,00 - LSD (p 5%) 3,04
White (C) LSD (p 1%) 5,03
Mariachi LSD (p 0,1%) 9,41
13,33 266,7 8,33 ***
Pink
Echo Blue 11,58 231,7 6,58 ***
LSD (p 5%) 1,79
CONCLUSIONS
LSD (p 1%) 2,96
LSD (p 0,1%) 5,54
Analyzing the obtained results from researches
concerning the postharvest care of Lisianthus
Data from Table 10 shows the unilateral cut flowers using three cultivars and four
influence of cultivars upon the number of nutrient solutions results the following
petals/flower at Lisianthus russellianus. conclusions:
Cultivars Mariachi Pink and Echo Blue show Analyzing the length of floral stem under the
very significant differences exceeding the effect of four nutrient solutions can conclude
control cultivar with 8.33 pieces respectively that neither solution influenced favorable this
6.58 pieces. character. Results shows that neither cultivar
In the Table 11 is presented the unilateral influenced favorable the stem length.
influence of nutrient solution on the postharvest The best nutrient solution regarding the number
of Lisianthus russellianus. Bell Fleur and of leaves was Vitalife, which achieved a very
Floralife assure a long period of postharvest life significant difference. The solutions like Bell
from 12.78 days to 11.89 days, comparing with Fleur and Floralife registered significant
the control. positive difference. Regarding the cultivar
influence, Mariachi Pink shows a distinct
significant difference, that exceed the control
with 7,67 pieces.
292
It was studied the influence of nutrient Echo Blue cultivar achieved significant
solutions on the diameter of flowers at difference and this exceeds the control cultivar
Lisianthus russellianus cultivars. Bell Fleur with 4.92 days.
generated a difference of 0.53 cm, significant
differences comparing with the control (tap REFERENCES
water). Echo Blue registered very significant Armitage A.M., 2001. Armitage’s manual of annuals,
differences that exceed the control with 2.17 biennials, and half-hardy perennials. Timber Press,
cm. Portland – Oregon.
Regarding the unilateral influence of nutrient Armitage A.M., Laushman J.M., 2003. Specialty cut
flowers: the production of annuals, perennials, bulbs,
solutions on the number of flowers/stem at and woody plants for fresh and dried cut flowers.
Lisianthus russellianus, that Bell Fleur Timber Press, Portland ͼ Cambridge.
achieved a very significant positive difference Armitage A.M., 2004. Armitage’s, Garden annuals, A
of 1.05 cm, which exceed the experiment color encyclopedia, Timber Press, Portland ͼ
control. Mariachi Pink registered significant Cambridge.
differences concerning the number of Bala Maria, 2010. Floricultura speciala. Timpolis
Publishing House, Timisoara.
flowers/stem. The difference was 2.92 pieces, Cantor M., 2008. Plante ornamentale de interior.
which exceed the control cultivar. Todesco Publishing House, Cluj Napoca.
Concerning the influence of nutrient solution Draghia L., Chelariu L., 2011. Floricultura speciala. Ion
Ionescu de la Brad Iasi Publishing House.
on the no. of petals/flowers at Lisianthus Griesbach R. J., 1992. Correlation of pH and light
russellianus cultivars, results show that neither intensity on flower color in potted Eustoma
solution recorded favorable influence. Cultivars grandiflorum Grise. HortScience 27 (7), p. 817–818.
Mariachi Pink and Echo Blue show very Kawabata S., Ohta M., Kusuhara Y., Sakiyama R., 1995.
significant differences exceeding the control Influences of low light intensities on the
pigmentation of Eustoma grandiflorum flowers. Acta
cultivar with 8.33 pieces respectively 6.58
Hortic. 405, p. 173–178.
pieces. Toma F., 2009. Floricultura si arta florala. Vol. I-V.
In the case of the unilateral influence of Invel Multimedia Publishing House, Bucharest.
nutrient solution on the postharvest of Song C.Y., Bang C.S., Huh K.Y., Lee D.W., Lee J.S.,
1994. Effect of postharvest treatment and
Lisianthus russellianus, can conclude that preservative solutions on the vase life of cut
solutions as Bell Fleur and Floralife assure a Eustoma. J.Korean Soc. Hort. Sci. 35 (5), p. 487–
long period of postharvest life from 12.78 days 492.
to 11.89 days, comparing with the control.
293
USE OF ORNAMENTAL PLANTS ON DIFFERENT SOIL TYPES
FROM TRANSYLVANIAN PLAIN
Erzsebet BUTA, Mihai BUTA, Maria CANTOR, Denisa HORT, Anca HUSTI
University of Agricultural Sciences and Veterinary Medicine of Cluj,

3-5 Manastur Street, Cluj-Napoca, Romania
Abstract
The paper include necessary issues to help specialists in landscape architecture to choose dendro-floricol assortment,
which exploit the studied maximum potential edaphic conditions, given the multitude of requirements expressed by
flower plants to edaphic environment. To highlight the issues shown above it was chosen to exemplify some soil types
from Transylvanian Plain where soil conditions are not the best for all ornamental plants. Thus we studied and
analyzed the main physico-chemical properties of calcareous soils, sandy, acidic soils and substrates with moisture
excess. The main ornamental plants presented in this paper are adapted to these extreme conditions and can be a
solution for use in landscaping.
Key words: soil types, ornamentals, landscape design.
INTRODUCTION or soapy and are easily compacted. Sandy soils

feel gritty and will not stick together to form a
Soil occupies a well settled place in the
ball (Reed, 2011; Paulette et al., 2010). They
biosphere, finding the boundary between two
are light and free draining and quick to warm in
worlds, lithosphere and atmosphere, forming
spring, but they will need frequent irrigation
the so-called pedoshere. It is known that the
and fertilizing. Chalky soils are alkaline,
soil has an important influence on health and
usually pale in color and stony, with chunks of
plant growth rate. The soil has a strong
alkaline minerals visible on the surface. They
influence on the plants (Reed, 2011). The
are often shallow and sometimes sticky. The
knowledge of soil types helps in keeping and
ideal soil type is a loamy one, which has an
growing plants effectively and the use of soil
approximately equal mixture of clay, silt, and
type required for plant will be essential in the
sand. Loamy soils are good for the widest
growth and development of its faster (Paulette
possible range of plants (Reed, 2011).
et al., 2010).
Bellow is presented the studied soil types and
This paper is based on the study of plants
the dendro-floricol assortment.
grown on different soil types and it’s a helping
hand in choosing these for specific conditions
or places in the garden.
In most soils, the relative proportion of clay, Soils were analyzed according to the
sand, and silt particles influence its physical “Methodology of soil study development-
and chemical nature. The main exception is ICPA-1987 (Research Institute for Pedology
peaty soil, which is dark in color and rich in and Agrochemistry) completed by soil
organic matter. Peaty soils are derived from classification as SRTS-2012 (Romanian Soil
sedges or mosses, which have decomposed in Toxonomy System).
waterlogged conditions. They are acidic and 1. Calcaro-rendzic leptosols (WRB – SR-
moisture-retentive, providing ideal conditions 1988) present the next succession of horizons:
for acid-loving plants like rhododendrons Am A/R Rrz.
(Reed, 2011). The phisico-chemical properties of calcaro-
Clay soils are fertile but are slow to warm in rendzic leptosols is characterized by: field
spring, sticky, and slow-draining after rain, capacity (CC%) between 23 and 41%; wilting
baking hard in dry weather. Silty soils feel silky coefficient (CO%) 6-14%; available moisture
295
holding capacity (CU%) 4.5-7.1%; the content 74 ppm; soil texture is sandy for the entire
of organic matter is middle; the content of N is profile > 57% sand (Buta, 2009).
middle for the entire soil profile 0,172-0,262%; The recommended dendro-floricol assortment
the mobile P is low in the entire soil profile is the following: Stipa gigantean, Portulaca
(10-16 ppm); the content of mobile K is middle grandiflora, Salvia splendens, Celosia argentea
for Am and low for A/R; cation exchange var. cristata, Delphinium cultorum, Santolina
capacity (T) is 37-38 me/100g soil; degree of chamaeciparyssus, Hibiscus syriacus, Betula
base saturation V% is higher 87-92%; the soil ermanii, Pinus sylvestris Aurea Group, Robinia
pH is slightly alkaline (Buta, 2009). pseudoacacia ‘Frisia’, Cytisus x praecox, Erica
Due to favorable physicochemical properties, australis, Lavandula pedunculata subsp.
calcaro-rendzic leptosols are distinguished Pedunculata, Lavatera x clementii, Perovskia
through a very high fertility. ‘Blue Spire’, Phlomis fruticosa, Achillea
Many of the world’s favorite plants occur ‘Walther Funcke’, Dictamnus albus, Eremurus
naturally on alkaline or limestone soils. They robustus, Eryngium x tripartitum, Lupinus ‘The
include pinks, clematis, and many of the jewel- Chatelaine’, Oenothera macrocarpa,
like alpine plants found growing on the Ornithogalum umbellatum, Salvia officinalis
limestone mountains of Europe and Asia. Soils ‘Tricolor’ (Reed, 2011; Toma, 2009).
over limestone are almost invariably alkaline in 3. Distric cambisols (WRB – SR-1988)
nature, but they can also be very fertile if they present the next succession of horizons: Ao Bv
are deep and rich in organic matter – a wealth C.
of plants give their ornamental best on such The majority of acid-preferring plants are
soils (Reed, 2011; Cantor, 2008). For calcaro- originally from woodland areas, and they prefer
rendzic leptosols the following species are a cool, more or less shady environment and a
recommended: Chamaecyparis lawsoniana soil that is leafy, organic, and moist but
‘Intertexta’, Fraxinus ornus, Morus nigra, welldrained. In nature, such soils are fairly
Buddleja sp., Cornus mas, Cotinus coggygria, fertile because nutrients are annually
Deutzia crenata ‘Nikko’, Helianthemum replenished by the recycling of fallen leaves.
‘Rhodanthe Carneum’, Potentilla fruticosa ‘Red There are also many acid-preferring plants that
Ace’, Campsis radicans, Jasminum nudiflorum, need or tolerate more open sites in sun, such as
Clematis ‘The President’, Asplenium witch alder, Lithodora diffusa ‘Heavenly Blue’,
trichomanes, Colchicum autumnale, Dicentra and most heather (Reed, 2011; Draghia, 2011).
spectabilis, Amarantus caudatus, Dianthus The phisico-chemical properties of district
caryophyllus, Cheiranthus cheiri,Alyssum cambisols is characterized by: field capacity
maritimum, Iresine lindenii, Iresine herbstii, (CC%) between 25 and 32%; wilting
Myosotis alpestris, Cercis siliquastrum, coefficient (CO%) 7-10%; available moisture
Platycodon grandiflorus, Pulsatilla vulgaris, holding capacity (CU%) 25-32%; the content
Rudbeckia laciniata ‘Herbstsonne’, Cotoneaster of organic matter is low; the content of N is
franchetii, Leontopodium alpinum (Selaru, middle for the entire soil profile 0.150-0.260%;
2007; Iliescu, 2006). the mobile P is low in the entire soil profile (<
2. Calcaric arenosols (WRB – SR-1988) 1.2 ppm); the content of mobile K is middle for
present the next succession of horizons: Ap Ao Ao-Bv (23 ppm); cation exchange capacity (T)
A/R A/B ka. is 17-29 me/100g soil; the soil is very acid with
The phisico-chemical properties is a pH between 4.3-4.6 (Buta, 2009).
characterized by: field capacity (CC%) between For district cambisols are recommended the
27 and 39%; wilting coefficient (CO%) 22- following species: Abies lasiocarpa var.
23%; available moisture holding capacity arizonica ‘Compacta’, Acer japonicum
(CU%) 3.7-16.10%; the content of organic ‘Aconitifolium’, Cercis canadensis ‘Forest
matter is low for the entire profile; the content Pansy’, Camellia japonica ‘Lady Vansittart’,
of N is low for the entire soil profile 0.112- Calluna vulgaris, Dryopteris filix-mas, Erica
0.130%; the mobile P is low in the entire soil cinerea ‘Romiley’, Hamamelis ‘Brevipetala’,
profile (4-8 ppm); the content of mobile K is Magnolia liliiflora ‘Nigra’, Magnolia stellata,
middle for Am – 135 ppm and low for A/R –
296
Pinus sylvestris ‘Gold Coin’, Rhododendron plants. These plants can also be used to
luteum, Skimmia japonica ‘Rubella’, Vaccinium surround ponds or pools to bridge the gap
vitis-idaea, Deschampsia flexuosa ‘Tatra Gold’, between water and land. Here, they will mask
Gentiana sino-ornata, Lilium superbum the edge of the water in an attractive way, and
(Cantor, 2008; Reed, 2011; Toma 2009). if the water is still clear, plants like Salix alba
4. Hyperskeletic leptosol (WRB – SR-1988) ‘Britzensis’ or Lysichiton camtschatcensis give
present the next succession of horizons: Ao R. more than double the value when their form is
There are recommended species which tolerate reflected in its mirrorlike surface (Reed, 2011).
very sandy, stony, or shallow and alkaline soils. The phisico-chemical properties of haplic
Hot and dry sites present a challenge to plant gleysols are characterized by the followings:
survival, not only because of the obvious lack clay has high values of 22.8% in Aow horizon,
of moisture needed for growth, but also and lower in A/Go horizon (21.63%); the
because the leaves of many plants – even some content of N is high for the entire soil profile
committed sun-lovers – scorch in very hot sun, 0,500% in the first cm; the mobile P is low in
particularly where the water supply is short or the entire soil profile (1.2-0.2 ppm); the content
unreliable (Reed, 2011). of mobile K is low (7-15 ppm); cation
The phisico-chemical properties of exchange capacity (T) is 13-21 me/100g soil;
hyperskeletic leptosol are characterized by: degree of base saturation V% is lower 40-60%;
field capacity (CC%) between 10 and 20%; the the soil pH is acid 5.2-5.4 (Buta, 2009).
content of N is very low for the entire soil Plant species recommended for this soil type
profile 0.70 ppm; the mobile P is low in the are the following: Metasequoia
entire soil profile (< 1.5 ppm); the content of glyptostroboides, Salix alba ‘Britzensis’,
mobile K is low for the entire profile (67-120 Cornus alba ‘Elegantissima’, Rhododendron
ppm) (Buta, 2009). ‘Bow Bells’, Vaccinium corymbosum, Astilbe x
Plants for these sites: Adonis vernalis, Alyssum- crispa ‘Perkeo’, Carex pendula, Darmera
saxatile, Gleditsia triacanthos ‘Rubylace’, peltata, Filipendula rubra ‘Venusta’, Fritillaria
Robinia x slavinii ‘Hillieri’, Caragana meleagris, Gunnera manicata, Hosta ‘Frances
arborescens ‘Nana’, Cytisus multiflorus, Williams’, Iris versicolor ‘Kermesina’, Lobelia
Lavandula dentate, Phlomis purpurea, Allium cardinalis, Hemerocallis flava, Iris sibirica,
hollandicum ‘Purple Sensation’, Amaryllis Lysichiton americanus, Lythrum salicaria
belladonna, Anthemis tinctoria ‘E.C. Buxton’, ‘Feuerkerze’, Matteuccia struthiopteris,
Catananche caerulea ‘Major’, Echinops ritro Pontederia cordata, Primula japonica
‘Veitch’s Blue’, Festuca glauca ‘Blaufuchs’, ‘Postford White’, Rheum palmatum
Fritillaria imperialis, Gaillardia x grandiflora ‘Atrosanguineum’, Rodgersia pinnata
‘Kobold’, Geranium cinereum ‘Ballerina’, ‘Superba’, Sagittaria latifolia (Reed, 2011).
Oenothera speciosa ‘Rosea’, Papaver orientale
‘Allegro’, Tulipa praestans ‘Unicum’, Verbena CONCLUSIONS
bonariensis, Viola x wittrockiana, Ajuga This paper aimes to support experts in
reptans, Sedum sp., Anemone cornaria, Oxalis landscaping for choosing dendro-plants flower
adenophylla, Lobelia erinus, Saxifraga assortment depending on restrictive soil
cuneifolia (Reed, 2011; Iliescu, 2006; Selaru, conditions.
2007, Chelariu, 2011).
For example were chosen five soil types, as the
5. Haplic gleysols (WRB – SR-1988) present
most representative with calcareous substrates,
the next succession of horizons: Ao AGo Gr.
sandy, acidic, skeletic and excess moisture.
The plants which are developing well on this
type of soils are known as moisture-lovers, but Depending on restrictive soil conditions has
they are often sold as bog plants. This can be been established an assortment of dendro-
misleading, since many moisture-loving plants floricol plants which is suitable for landscape
will not tolerate totally waterlogged soils. design.
Boggy soil saturated with water is usually
better for shallow-water, or marginal aquatic
297
REFERENCES Draghia L., Chelariu L., 2011. Floricultura speciala. Ion
Ionescu de la Brad Iasi Publishing House.
Buta M., 2009. Aprecierea calitativa a solurilor din Iliescu Ana-Felicia, 2006. Arhitectura peisagera. Ceres
dealurile Cojocna Sic subunitate a Campiei Publishing House, Bucharest.
Transilvaniei. PhD thesis, Cluj-Napoca. Paulette L., Buta M., 2010. Notiuni teoretice de cartare si
Reed C., 2011. Plants for places. Dorling Kindersley bonitare a terenurilor agricole, Risoprint Publishing
Limited Publishing House, UK. House, Cluj-Napoca.
Cantor M., 2008. Plante ornamentale de interior. Selaru E., 2007. Cultura florilor de gradina. Ceres
Todesco Publishing House, Cluj Napoca. Publishing House, Bucharest.
Chelariu E.L., 2011. Evaluation of the assortment of Toma F., 2009. Floricultura si arta florala. Vol. I-V.
grasses decorative by leaf. Bulletin USAMV Cluj – Invel Multimedia Publishing House, Bucharest.
Napoca, Seria Horticulture, Vol. 68 (1), p. 548. ***WRB (World Reference Base for Soil Resources).
298
‘CANDIDA ALI’ AND ‘EXCELSA’ - ROMANIAN Gladiolus CULTIVARS

RECENT HOMOLOGATED
Maria CANTOR1, Lenu‫܊‬a CHI‫܇‬2, Erzsebet BUTA1, Denisa HORT1

1
University of Agricultural Sciences and Veterinary Medicine of Cluj, 3-5 Manastur Street, Cluj
Napoca, Romania
2
Fruit Research Station Cluj, Horticultorilor Street, no.5, Cluj Napoca, Romania
Abstract
Gladiolus x hybridus L. is a popular bulb plant grown in Romania in field for cut flowers in summer season. Nowadays
in Romania the activity for improve the assortment of gladiolus by breeding program is limited. This is because of the
small number of researchers devoted to sustainable breeding work. The Floriculture Department of University
Agricultural Sciences and Veterinary Medicine Cluj, in collaboration with Research Fruit Station Cluj, do an intensive
from many years until the present. ‘Candida Ali’ and ‘Excelsa’ cultivars have recently been registered and patented
(2011) having a great floral potential do to their color and good morpho-decorative characteristics.
Key words: cultivar, breeding, characters, selection, bulb plant.
INTRODUCTION that have a broad spectrum of colors and

desirable characters such as: multiple
Gladiolus x hybridus L. is a popular
flowering, vigor, resistance to pests and
floricultural crop in Romania grown mainly for
diseases, different colors etc. ‘Candida Ali’ and
cut flowers. The modern Gladiolus cultivars
offer a diversity of colors, shapes, and sizes ‘Excelsa’ have recently been registered and
that is available in few other flowering plants patented.
(Cantor and Tolety, 2010). Origin
During the last quarter of a century an ‘Candida Ali’, tested as H 1/20, resulted from a
increasing interest was generated in new crops. controlled cross between ‘Early Riser’ and
Dozens of new species and genera enter the ‘Priscilla’, made by M. Cantor and L.M. Chis at
commercial arena each year. Some new UASVM Cluj-Napoca in 2001, fallowed by
cultivars are only selections; others are results clonally selection and vegetative multiplication
of intra-and interspecific hybridizations (Craig, by corms (Figure 1). Further characterization
2003). of this hybrid began in 2007 at ISTIS Bucharest
Currently many hybridizers work on creating (The State Institute for Variety Testing and
new Gladiolus cultivars, but in Romania this Registration).
activity is limited. This is because of the small ‘Excelsa’ resulted from the intraspecific
number of researchers devoted to sustainable hybridization method between the cultivars
work for improving the Gladiolus assortment ‘Priscilla’ and ‘Speranta’. The cross was made
by breeding in order to obtain new varieties in 2001 by M. Cantor, and it was selected as a
with superior characteristics and more adapted hybrid H 18/1 in 2003 (Figure 2).
to the climate of Romania. The purity certificate no 1324/2009 was
Gladiolus cultivars suitable for cultivation obtained in 2009 under the name ‘Candida Ali’
under the temperate climate of the and ‘Excelsa’ after being tested in ISTIS
Transylvanian areas of Romania have been Bucharest on the base of the DUS (distinctivity,
developed by the Floriculture Department, uniformity and stability) test and was
University of Agricultural Sciences and recommended for introduction as commercial
Veterinary Medicine, from 1998 until the crops in Romania.
present. A total of 14 new Gladiolus cultivars
299
Figure 1. Pedigree of ‘Candida Ali’
‘Excelsa’ resulted from the intraspecific uniformity and stability) test and was
hybridization method between the cultivars recommended for introduction as commercial
‘Priscilla’ and ‘Speranta’. The cross was made crops in Romania.
in 2001 by M. Cantor, and it was selected as a In 2011 ‘Candida Ali’ (patent no. 00252) and
hybrid H 18/1 in 2003 (Figure 2). ‘Excelsa’ (patent no. 00251) were patented as
The purity certificate no 1324/2009 was protected cultivars (Figure 3A, B).
obtained in 2009 under the name ‘Candida Ali’ To maintain the characteristics of those
and ‘Excelsa’ after being tested in ISTIS cultivars, they must be vegetative propagated
Bucharest on the base of the DUS (distinctivity, by corms and cormels.
Figure 2. Pedigree of ‘Excelsa’
Figure 3. A. Candida Ali (H 1/20)
300
Figure 4. Excelsa (H 18/1)
Description prolific corm producer (115 cormels/corm)

‘Candida Ali’ cultivar has a delicate color of which facilitates multiplication (Table 3).
florets (dark pink bronze with intense pink The performances of the new cultivars were
neck, white stripes) and it is currently a popular compared with a very popular cultivar in
cultivar on the market (Table 1). It is an early Romania, ‘Priscilla’ which is also one of the
midseason bloomer in Transylvania area. The parents in the cross-breeding process.
flowers are bell-shaped when open and have In 2009 the cultivar ‘Candida Ali’ received a
good longevity in the vase as cut flowers. It has Diploma and Silver Medal at the International
a good vigor (112.1 cm), a long spike and Salon of Research and Invent ‘PROINVENT’
Cluj-Napoca.
Table 1. Morphological characteristics of the new Gladiolus cultivars

Floret Another
Cultivars Flower color Spot Use
shape color
Dark pink bronze with intense pink neck, Cut flower, border or group in
Candida Ali Round yes purple
white stripes the field
Excelsa Purple red with white narrow Round none white Landscape designCut flower
Priscilla-
Light rose with dark rose lines Round yes white rose Cut flower, garden
control
Table 2. Quantitative characteristics of the new gladiolus cultivars

Days to Plant Spike No. of Flower Vase
No. of simultaneously flowering
Cultivars flowering height length florets/ width life
florets
from planting (cm) (cm) flower (cm) (days)
Candida Ali 77 112.1 74.0 15.4 11.5 5.7 5.4
Excelsa 66 100.4 45.0 14.3 11.4 5.2 5.0
Priscilla-
82 121.3 86.2 15.0 11.5 5.1 4.7
control
Table 3. Corm productivities of new Gladiolus cultivars

Cultivars No. of cormel/plant Circumference of corm (cm) Corm weight(g)
Candida Ali 115 14.4 42.5
Excelsa 42 13.8 33.7
Priscilla-control 65 14.0 41.3
301
The ‘Excelsa’ cultivar is characterized by the UASVM Cluj-Napoca, by addressing requests
remarkable achievement of combining superior to Maria Cantor at the Department of
morphological characteristics. This cultivar Floriculture, room 91.
blooms earlier than many commercial
Gladiolus cultivars, 66 days from planting, and REFERENCES
it has a lovely color that looks beautiful in Cantor M., Tolety J., 2011. Gladiolus, p. 133-160. In:
vases (Table 2). Chittaranjan Kole (eds.). Wild Crop Relatives:
As a conclusion the new cultivars represents a Genomic and Breeding Resources. Plantation and
step forward in combining a high qualities in Ornamental Crops. Springer, Heidelberg.
genus Gladiolus, they contributed to improving Cantor M., 2006. Genetic breeding of Gladiolus hybridus
in Romania, Proc. ASHS, HortScience 41 (4) :1041
the Romanian assortment. (abstr.).
Availability Craig R., 2003. Creating a more beautiful world: a
Limited quantities of ‘Candida Ali’ and century of progress in breeding of floral and nursery
‘Excelsa’ cultivars may be obtained from plants, HortScience 38 (5), p. 931.
302
RESEARCHES CONCERNING THE MULTIPLICATION IN VIVO OF

LISIANTHUS FOR PROMOTING IN ROMANIAN GREEN HOUSES
Maria CANTOR, Rodica POP, Iudita Elisabeta CSETE, Buta ERZSEBET, Anca HUSTI
University of Agricultural Sciences and Veterinary Medicine, Faculty of Horticulture, 3-5 Manastur
Street, Cluj-Napoca, Romania
Abstract
Current concerns of plant growers in Romania are to improve the flowers assortment with new species. Our researches
focused on herbaceous ornamental plant Lisianthus russelianus Hook., (Eustoma grandiflora L.). It is a relatively new
species in the range of cut and potted flowers for her beautiful colored and vase life. The new species introduced
requires establishing efficient multiplication techniques. The biological material used in the experience were seeds from
Sakata company (USA), represented by three cultivars: ‘Echo Lavender’, ‘Flamenco White’ and ‘Mirage Pastel Pink’.
Also vegetative multiplication by cuttings was experimented on different culture substrate. Plants were grown in
greenhouses of USAMV Cluj-Napoca and Botanical Garden “Alexandru Borza” Cluj-Napoca. The results obtained will
be using for Romanian growers for diversification their assortment in greenhouse.
Key words: eustoma, cultivars, propagation, seeds, cuttings, Gentianaceae.
INTRODUCTION flowers in summer (Roh et al., 1989). In recent

decades, breeders have developed a variety of
Lisianthus is a relatively new species in the
cultivars with respect to many traits such as
range floricultural, Japan being the largest
uniform flowering throughout the year, lack of
producer. Lisianthus is a species with great
rosetting, heat tolerance, flower color, and
horticultural potential in Romania.
flower size and form, including double flowers
Lisianthus is a moderately cold-tolerant annual
etc (Harbaugh, 2006). The importance of this
or biennial plant native to the southern part of
ornamental flower is due to its beauty, diversity
the United States and Mexico (Roh and
of colors, excellent keeping quality, and wide
Lawson, 1988), belong to Gentianaceae family.
range of different forms (Ali et al., 2008,
In Texas is popularly known as 'blue bell',
Kanwar and Kumar, 2009). It is known that to
'prairie rose' or 'prairie gentian'. Genus name
this genus Lisianthus (Eustoma) are belonging
alludes to the beauty calyx and corolla, the
27 species, herbaceous and woody plants. It is a
flower look is glossy, satin and beautiful border
relatively new species in the range of cut and
(„lisieé” in French means smooth, glossy).
potted flowers.
From crossing wild forms, which shows blue
Due decorative qualities lisianthus culture's
flower petals, resulting in improvement works
expansion took in most of Europe and thus
form a large flower perfection extremely varied
flower growers and enthusiasts have expressed
in color and shape.
a particular interest in this crop. Lisianthus
In Europe started to be cultivated only after the
flowers are much used by those who deal with
1970s. After France, the Netherlands ranks
flower arrangements and bouquets for different
second in the culture of this beautiful flower. In
occasions. Lisianthus is highly regarded not
Romania the first cultures were established
only as a cut flower, and as the plant pot.
from Companies Codlea and early cultures
Currently, in our country, lisianthus culture is
were initiated at University of Agronomic
not widespread, although there is market
Sciences Bucharest since 1989 (Cantor, 2009).
demand. Most flowers sold and used by florists
This plant grows to 50-75 cm in height with
are imported from Holland.
20-40 flowers. By nature, Lisianthus initially
For the new species introduced are required
forms a rosette and grows very slowly during
efficient multiplication techniques to be
the winter, stems elongate in the spring, and it
established.
303
Eustoma randiflorum is commonly propagated flower buds open in cones than 5 cm in
by seed or cutting. Sexual propagation used to diameter, showing many shades of purple.
obtain seedlings seeds brought from abroad ,,Flamenco White”. The flowers are simple, is
(Netherlands, USA, France, etc). From a gram suitable for cultivation in summer when
of seeds can be obtained about 8000 plants temperatures are high and days are long. Stems
(Bala, 2010). are vigorous and flowers on top of them are
Generally, sowing the plants of Lisianthus is in white. Leaves are skin, colored bluish green,
autumn or January-February. Industrial culture, located opposite the stem. Stem height is 50
sowing can be done in half, and according to cm. Blooms two weeks earlier than hybrid
this period, the number of days to flowering Mirage Pastel Pink.
may vary. ,,Mirage Pastel Pink”. Flowers are simple,
Propagation by cuttings is less practiced. ideal for summer flowering. Has smaller petals,
Cuttings are cut to a length of 10 to 15 cm and are resistant to transport. The flowers are
(which have three pairs of leaves) and placed pink, with the little white. The leaves are green
on the substrate of peat and perlite, sand or and vigorous stems are about 40-50 cm in
perlite simple. Rooting takes place for 40-50 length. It is resistant to high temperatures and
days. The disadvantage of this method is that botrytis.
the percentage of shoots of the plant is weaker, Experience was made in greenhouses of
we get a few plants and can easily transmit USAMV Cluj-Napoca and the greenhouses of
diseases and pests (Toma, 2009). the Botanical Garden Alexandru Borza Cluj-
Napoca.
MATERIALS AND METHODS Propagation by seeds
For the new species introduced are required Sowing was done on 04.03.2011, in small
efficient multiplication techniques to be pockets trays using the neutralized peat
established. The study was about conventional substrate. The seeds were sown on the surface
propagation methods, by seeds. The biological because they are photosensitive (germinate in
material used in the experience comprised in the presence of light). Greenhouse temperature
seeds from Sakata Company, represented by was 20-22°C during germination, and then
three F1 hybrids of Lisianthus russelianus: decreased to 18-20°C. Relative humidity was
„Echo Lavender”, „Flamenco White” and 70-75% and 80-85% of the substrate,
„Mirage Pastel Pink”. These were used to maintaining this level through daily watering.
obtain plants to start the in vitro and in vivo Germination occurred at 21 days, after which
experiments in order to establish the observations were made on the percentage of
germination and the rooting rates. Seeds were germination. During the period of germination
treated thiuram pelleted. The biological were assured maintenance, or weeding,
material presents the following characters: watering and ventilation greenhouse. Lisianthus
,,Echo Lavender”. It is one of the most from each hybrid were sown one hundred
seeds.
popular cultivars with early flowering. Plants
After about six weeks on 4/24/2011 plants
are vigorous in spring, while in summer
produced two little leaves true. Four days later,
droughts become more fragile. The leaves are
on 05.28.2011 was carried out first
5-8 cm long, elliptical, slightly sharp and
transplantation in alveolar larger trays, then on
succulent; they look dull and bluish-green
6/10/2011 moved in pots 7x7cm (Figure 1).
color, with 3-5 ribs clearly visible. Summer
304
Figure 1. Plants in cellular trays and pots (original)
Vegetative propagation by cuttings For rooting of cuttings were used three types of
Cuttings were made from plants grown in the substrate:-S1-sand river; -S2-peat + sand,
greenhouse of the Botanical Garden 'Alexandru mixture of 1:1 and; -S3-peat + sand + garden
Borza' Cluj-Napoca from the seeds of the three soil, mixture of 1:1:1.
hybrids studied. Leaves were removed from After 40 days there have been observations on
cuttings length exempting those in the apical rooting percentage. In vivo plants were grown
zone (Figure 2). and maintained in the greenhouse of the
Cuttings were trimmed to the size of about USAMV Cluj-Napoca and served to multiply
eight cm and planted in wooden boxes on by cuttings and in vitro propagation.
different rooting substrates.
305
Figure 2. Aspects of in vivo propagation by cuttings (original)
RESULTS AND DISCUSSIONS Table 1. The percentage of germination in vivo three

hybrids examined
Results of germinationrate
No of Percentage of
In vivo experience in seed germination Hybrid No of seeds
seeds geminated seeds
percentages first comment on were made at name germinated
sown (%)
about 21 days, at which time it was considered Mirage
100 64 64
the emergence over. Data on the percentage of Pastel Pink
germination are shown in Table 1. The Echo
100 69 69
Lavander
performed analyzes on the percentage of Flamenco
germination is a weak seed germination in all 100 62 62
White
hybrids analyzed, with an average rate of 65% Average 100 65 65
(Table 1).
Analyzing the data in Table 1 it can be seen
that the highest percentage of germination was
obtained in the F1 hybrid Echo Lavender
306
respectively 69%, followed by hybrid Mirage Data obtained shows that the seeds size and
Pastel Pink with a germination rate of 64%. ecological conditions influenced negatively the
The lowest percentage of germination was germination percentage, registering an average
obtained in hybrid Flamenco White of only of only 65% for the analyzed hybrids.
62%. The experiments conducted shows that species
The data obtained are in accordance with the Lisianthus russelianus Hook. is quite
literature, which mentions a low germination in recalcitrant to conventional vegetative
this species, both because of the very small size propagation, by cuttings, regardless of the
of seeds and germination special conditions, substrate used.
namely the presence of light (Cantor, 2009).
The small percentage of rooting, probably due
Results for rooting cuttings
to the fact that greenhouse facility was not
Data on percentage of rooting cuttings from
equipped with 'mist system' that does not
three hybrids analyzed are presented in Table 2.
ensure a high air humidity nor stimulators were
Table 2. Rooting percentage in the three Lisianthus used rootedness.
hybrids We recommend the promoting culture in our
Number of country, of the species Lisianthus russelianus
Percentage of
rooted Number of Hook., by enriching assortment with new
Variant1 rooting
cuttings rooted cuttings cultivars.
(%)
used
S1E 30 0 0 Biological material obtained by applying
S2 E 30 5 16 conventional propagation methods lead to
S3E 30 3 10 obtaining parent plants which can be used as a
S1F 30 0 0 basis for in vitro multiplication that will
S2F 30 4 13 produce an unlimited number of plants in a
S3F 30 3 10
relatively short time.
S1M 30 0 0
S2M 30 8 26
S3M 30 4 13 REFERENCES
Total Ali A., Afrasiab H., Naz S., Rauf M., Iqhbal J., 2008. An
270 27 10
number efficient protocol for in vitro propagation of carnation
1Substrate 1Hybrids;
S1-river sand; E-Echo Lavender;
(Dianthus caryophyllus L.). Pak. J. Bot. 40: 111-121.
S2-peat + sand, mixture 1:1; F-Flamenco White; Ardelean M., Sestras R., Cordea M., 2007. Tehnica
S3-peat + sand + garden soil, mixture 1:1:1; M-Mirage Pastel Pink experimentala horticola, Ed. AcademicPres, Cluj-
Napoca.
From the table it can be seen that the highest Bala Maria, 2010. Floricultura speciala, Ed. Timpolis,
Timisoara, p. 320.
percentage of rooting was obtained in hybrid Cantor Maria, 2009, Floricultura generala, Ed. Todesco,
Mirage Pink Pastel on sand and peat substrate Cluj-Napoca, p. 64-65.
mixed 1:1 with 26%, followed by hybrid Echo Harbaugh B.K., 2006, Lisianthus, Eustoma
Lavender on the same substrate, 16%. A small grandiflorum. In: Anderson NO (Ed), Flower
percentage of rooting was recorded and the Breeding and Genetics, Springer, Netherlands, pp
645–663.
substrate composed of soil-peat-sand in a ratio
Kanwar J.K., Kumar S., 2009. Influence of growth
of 1:1:1. Pastel Pink Mirage hybrid resulted in regulators and explants on shoot regeneration in
a 13% and other hybrids with a percentage of carnation. Hort. Sci. 36: 140-146.
10%. If the substrate consists of river sand has Roh M.S., Lawson R.H., 1988. Tissue culture in the
no rooted cuttings. improvement of Eustoma. HortSci 23, p. 658.
Roh M.S., Halevy A.H., Wilkins H.F., 1989. Eustoma
grandiflorum. In: Halevy AH (Ed), Handbook of
CONCLUSIONS Flowering, CRC Press, Boca Raton, FL, pp 322–327.
Based on the experiences made the following Toma F., 2009. Floricultura si arta florala, Vol. 1, Ed.
Invel Multimedia Bucuresti.
conclusions are:
307
THE INFLUENCE OF FERTILIZERS APPLIED ON CONTAINERIZED

CULTURE OF THUJA OCCIDENTALIS COLUMNA
Georgeta CARE‫܉‬U1, Liana Melania DUMITRU2, Corina GAVĂ‫܉‬2

1
Bioterra University, Ion Ionescu de la Brad 97, Code 013812, Bucharest, Romania
2
Fruit Research Development Constanԑa, Pepinierei st. 1, Code 907300,
Valul lui Traian, Constanԑa, Romania
Abstract
The containerized culture of the ornamental plants has an increasing importance for producers. These are interested in
finding the proper solutions for the insurance of the best growth conditions for the plants. Fertilizers are indispensable
for success of the type of culture at high parameters.Researches have been done at the Fruit Research Development
Constanta between 2004-2006.The biological material used for studies was represented by plants of Thuja Occidentalis
Columna. Substratum for culture, resulted by mixing some compounds, were represented by: Substratum 1 made by:
ground celery, ground leaf, peat and sand 1:1:1:0,5; Substratum 2 made by: forest compost and perlit 3:1.
Experimental scheme included 6 variants: 2 controls unfertilized, with plants cultivated in the two substratum; 2
variants with substratum fertilized with forest compost NPK 15:15:15; 2 variants fertilized during vegetation with Coïc
nutritive solution. There were organized (6) six variants with four (4) replications. During the three years of studies has
been done agrochemical analysis of substratum from containers, in May and in September, to establish: pH; total
nitrogen; humus %,; organic substance; phosphorus; potassium. The observations made on the plants consisted in:
biometric measurements of the plants in May and September regarding: height of plants (cm), trunk thickness diameter
(mm), number of offshoots; agrochemical analysis for finding the provisioning level in nutritive elements of the plants.
The best substratum for Thuja Occidentalis “Columna” was represented by substratum 1 with complex fertilizer (NPK)
15:15:15 applied 5 kg/mc before planting in containers. Substratum 1, fertilized before planting in containers leaded to
significant growth. Coïc solution applied during vegetation had also considerable influence on plants growth.
Key words: complex fertilizer, nutritive solution, substratum.
INTRODUCTION Experimental scheme included 6 variants: -2

controls unfertilized, with plants cultivated in
The containerized culture of the ornamental
the two substratum; -2 variants with substratum
plants has an increasing importance for
fertilized with forest compost NPK 15:15:15; -
producers. These are interested in finding the
2 variants fertilized during vegetation with Coïc
proper solutions for the insurance of the best
nutritive solution. There were organized (6) six
growth conditions for the plants.
variants with four (4) replications. Each
Fertilizers are indispensable for success of the
replication included three plants. Plants of
type of culture at high parameters, so that it is
Thuja were planted in containers with 12 cm
necessary to solve the aspects of using them.
diameters.
Analyses and observationsSubstratum.
During the three years of studies has been done
Researches have been made at the Fruit agrochemical analysis of substratum from
Research Development Constanta between containers, in May and in September, to
2004-2006. The biological material used for establish the following parameters: pH (in
studies was represented by plants of Thuja water) – potentiometer; total nitrogen (N), by
Occidentalis Columna, multiplied before by Kjeldhal method; humus%, by Walklay Black
cuttings. Substratum for culture, resulted by method (modified by GogoaƔa); organic
mixing some compounds, were represented by: substance%, by wet combustion method;
-Substratum 1 made by: ground celery, ground phosphorus (P), ppm in Al, by Egner – Rhiem
leaf, peat and sand 1:1:1:0,5.-Substratum 2 Domingo method; potassium, ppm in Al, by
made by: forest compost and perlit 3:1. flame photometry. Biological material. The
309
observations made on the plants of Thuja from wet mineralization and colorimetric dosage-
containers consisted in: -biometric K%, by wet mineralization and flame
measurements of the plants in May and photometry
September, for every vegetation cycle,
regarding:-height of plants (cm) -trunk RESULTS AND DISCUSSIONS
thickness diameter (mm) -number of offshoots-
In table 1 are presented the effects of different
agrochemical analysis for finding the
nutrition of the plants about the height, trunk
provisioning level in nutritive elements of the
thickness diameter and number of offshoots.
plants which were made in May and September
to determine:-N%, by Kjeldhal method-P%, by
Table 1. Biometric determinations of Thuja occidentalis " Columna"
Table 1 shows that the best results were variant from substratum 2, with light
registered at fertilized variants, in substratum 1: composition.
22,6 cm increase growth for fertilizing with Statistic interpretation of the results of the
NPK and 2,9 cm for nutritive solution. biometric measurements are included in table 2
Number of offshoots was also bigger in these and figure 1.
variants towards of unfertilized control and
Table 2. Statistical interpretation of the growth increase at Thuja Occidentalis " Columna"
Height in 2004 Height in 2006 Increase
Variant Difference Signification
(cm) (cm) growth
(cm) %
V1 Substratum 1- control 20,2 35,0 14,8 100 - -
V2 Substratum 1 + NPK 30,2 52,8 22,6 152,7 +7,8 *
V3 Substratum 1 + nutritive
27,2 49,1 21,9 147,9 +7,1 *
solution
V4 Substratum 2- control 27,8 39,4 11,6 100 - -
V5 Substratum 2 + NPK 30,1 45,3 15,2 131,0 +3,6 -
V6 Substratum 2 + nutritive
26,1 42,3 16,2 139,6 +4,6 -
solution
x= 17,05; DL 5% = 6.39; 1% = 10,03; 0,1% = 17,08
310
Figure 1. The dynamic height growing of the plants
Plants of Thuja occidentalis “Columna” from Fertilization of plants from substratum 1 with
substratum 1 fertilized with NPK had a Coïc solution during the vegetation determined
progress of growth with 52,7% bigger than the a growth of 47,9 cm towards the control (table
unfertilized control. 3).
The analysis of the results shows the following
provisioning of plants in N, P, K.
Table 3. Average content in nutritive elements from plants at Thuja Occidentalis " Columna"
2004-2006
Variant N% P% K%
May Sept. May Sept. May Sept.
2,37 2,56 1,48 1,63 0,34 0,40
2,81 3,08 1,69 1,89 0,42 0,48
2,69 2,93 1,59 1,78 0,37 0,43
2,05 2,36 1,40 1,57 0,32 0,37
2,28 2,53 1,54 1,70 0,38 0,44
2,36 2,62 1,49 1,66 0,36 0,41
The best provisioning was founded at V2, N in September, 1,78 P% and 0,43% K. Both
fertilized with NPK (3,08% N in September, variants (V2 and V3) content plants from
1,89% for P and 0,48% for K). substratum 1, with peat.
Nutritive solution (Coïc solution) applied Results of agrochemical analysis of substratum
during the vegetation, had also a good are included in table 4.
influence for plants provisioning at V3 2,93%
311
The values of pH diminished in all variants, Potassium had the biggest value at V2,
being 5,8 at V5. Total content of soluble salts fertilized with NPK (378 ppm).
was situated in normal limits between 0,12% at Evolution of content in P and K from
V1 and 0,29% at V5. Phosphorus (P) from substratum is underlined by graphs 2 and 3.
substratum diminished, the value being at
inferior limit of a temperate provisioning.
Figure 2. Content of P
312
Figure 3. Content of K
Variation of pH of substratum and total content

in soluble salts is indicated by graphs 4 and 5.
Figure 4. Variation of pH
313
Figure 5. Content of total soluble salts
CONCLUSIONS Total content in nitrogen (N) showed a good

provisioning of substratum. The values of
The best substratum for Thuja Occidentalis
phosphor (P) were temperate and potassium
“Columna” was represented by ground celery,
(K) diminished by plants consumption, but
ground leaf, peat and sand 1:1:1:0,5
remained at good and very good values.
(substratum 1) with complex fertilizer (NPK)
15:15:15 applied 5 kg/mc before planting in The biggest values of nitrogen (N) from leafs
containers. had a considerable correlation with the biggest
height of plants.
Substratum 1, fertilized before planting in
containers leaded to significant growth. Coïc The values of P and K showed a good
solution applied during vegetation had also provisioning of plants, the biggest values
considerable influence on plants growth. registered at plants from substratum 1 fertilized
with NPK before planting.
Substratum and fertilization didn’t have an
important influence on trunk thickness of REFERENCES
plants, these being dependent on morphological
characteristics of the variety. Charpentier S., 1985. Equilibres chimiques et
precipitations dans les solutions nutritives. P.H.M.
The best behavior of the plants was at pH=7,4 Rev. Hortic. 258, p. 19-24.
in substratum 1. The total content of salts Davidescu D., Davidescu Velicica, 1992. Agrochimie
increase in both substratum, because of horticola, Ed. Academiei Române, Bucuresti.
fertilization but remains in normal limits. Krüssman S., 1981. Die Baumschule, Verlag Paul Parey,
Berlin.
314
HISTORICAL ANALYSIS AND STUDY OF CURRENT STATE OF BRAN

CASTLE DOMAIN, INORDER TO RESTORE THE HISTORIC
LANDSCAPE ESEMBLE – FORMER ROYAL RESIDENCE
Elisabeta DOBRESCU, Anca STĂNESCU
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti, District 1,

Abstract
National landscape needs to create benchmarks for national identity, especially because it is just beginning. In fact, if a
historic landscape path could no longer be restored, then landscapers will need to refer to the tradition of a foreign
nation. The smaller the funds for management, the greater it’s importance. Assessment of impacts on historic gardens
and parks refer to their condition at the time of the study. Due to maintenance deficiencies, management, financing and
lack of a national strategy for the conservation, improvement and use of historical monuments with landscape interest,
we are currently witnessing rapid degradation of the few landmarks that nation-wide landscape holds. Most
restorations were aimed at construction areas, the domains of gardens and parks, sometimes with surfaces of tens of
hectares, are not at all addressed, or addressed only theoretically. This study will explore in a historical and landscape
point of view, the Bran Castle Park, as well as make an analysis of the current status, necessary studies in order to
professionally restore the historic area.Knowing the main aspects of accounting and inventory of historical components
assembly also includes a range of information that help sustainable management strategy in the future. Preservation,
conservation,but also restoration and revitalization of cultural heritage landscape is a core concern in the development
of a cultural society. These testimonies of the past are very important milestones, necessary in order to understand the
historical context of the evolution of society. Maintenance and development of the historical monument landscape
values, in conjunction with the architectural may lead in the future to a sustainable development of the monument, a
concept that can be incorporated into future marketing strategies.
Key words: Historical garden, historical identity, restoration, revitalization, landscaping herritage.
INTRODUCTION functions needed by society, by engaging

appropriate techniques and materials used.
Awareness on knowing the cultural heritage,
Knowledge, investigation and preservation or
instilling respect for national identity for the
restoration of these gardens is perhaps just as
appropriation inherited values as elements of
important as other cultural values that are part
national identity and continuity are values that
of the heritage of a country and, in many cases,
can be inspired only knowing the history and
the World Heritage (Law no 451, 2002).
successive transformations undergone by a
Any intervention will be recorded in an
monument over time until now.
analytical and chronological order to follow the
In complex analysis of domain structure, in-
time evolution and sequence of works
depth historical study of the assembly and the
performed, but also to allow the retrospective
current state of the monument are the essential
control of the procedure and to ensure
points of any debut in a professional study of a
consistency of subsequent interventions.
landscape restoration assembly.
Like any restoration, the main objective is the
development of new concepts in terms of
preservation and conservation of the site of the Bran Castle was built as a royal fortress
old structures of historical value. This objective through the privilege signed by the Hungarian
can be achieved through a multidisciplinary king Louis I of Anjou on November 19th, 1377.
approach and inventory analysis studies by It is the oldest building-the royal residence,
adopting optimal solutions, introducing new preferred especially the second Romanian
queen, Queen Maria.
315
The same intention of giving the Castle was
once again two years later, this time to the new
sovereign of Romania Mare.
For the fate of the castle, it was its chance to
return to life, the passion of Queen Maria, who
transformed the city into a welcoming lovely
summer residence of the royal family. Without
restorations made by order of the Queen, by
architect Karel Liman, with money provided by
the domain administrator Crown Prince Barbu
btirbey, the castle would probably have been
Figure 1. Plan of Bran domain (Ion N.D., 2003)
affected by indifference and degradation that
led to the disappearance of many medieval
Built by the inhabitants of Brasov since 1378, it
monuments.
was in the successive possession of ruler
Until 1920, when it is donated to Queen Maria
Mircea cel Bĉtrân (between 1412 to 1418) and
of Romania, the castle was owned by Forestry
then Iancu de Hunedoara who made the first
Office in Brasov. But starting this year (1920),
interventions on the city, ordering repair and
the castle and its fields will enter a complex
strengthening works. From the late fifteenth
process of restoration and renovation.
century (1498) and by the middle of the
eighteenth century is used as the customs,
providing management functions of the royal
domain. The architecture of the castle is
enriched in 1593 with a round tower added to
the southwest corner of the building, and
between 1622-1625 with a gate tower, built
after a rectangular plan.
As part of administration and customs control,
there are no records on the presence of gardens,
at that time they probably had utility role.
Between 1883-1886, the area was turned over
to the inhabitants of Brasov, the castle received
the second intervention, restoration required
Figure 3. Queen Maria in the park near Mĉgura Branului
after employment of an Austrian regiment. In
(Ion N.D., 2003)
1916 is offered as a gift on the occasion of the
coronation of Emperor Charles I of Austria-
Hungary. He is forced to decline due to
collapse of the monarchy and creation of
Romania Mare, on 1 December 1918.
Figure 2. Bran Castle seen from Mĉgura Branului (Ion

N.D., 2003)
Figure 4. Interior courtyard of Bran Castle (Ion N.D., 2003)
316
Early interventions focused on transforming the special care, by the chief gardener of the castle,
medieval castle with its sober and Petre Conrad, under the guidance of the royal
unwelcoming style into a modern and parc chief, Constantin Pamula.
comfortable home, without harming its
originality, as shown in the Queens memoirs: 'I
did nothing which would take away the feudal
appearance, I didn’t transform the quickness of
the stairs, I didn’t raise the roofs nor did I
straighten the crooked rooms'. Under the
guidance of Czech architect Karel Liman Qeen
Maria brought improvements for 18 years
(1920-1938) in the comfort of housing, water
and electricity connected the whole assembly,
introduced telephony and the lift serving the
castle with its four floors and also created the
link between the castle and the park.
In the period 1920-1922 the first references to
the Bran Castle gardens appear. Creating a
pictorial, free style garden, the architect Karel
Liman, followed valuing dominant architectural
elements, a unique way of undermining the
Figure 6. Queen Maria in the garden (Ion N.D., 2003)
green area to the adjacent construction. Bran
domain was expanded, encompassing meadows
The Palace Parc was enriched with “fourty
around the castle.
apple trees, twenty trees, fifty cherry trees,
In the composition appeared construction
twenty five prune trees and seventy blueberry
facilities completed to the requirements of the
shrubs” brought by the royal garden direction
passionate queen: Tea house, built from
wooden beams (144m.p.), Guest house, built in Cotroceni. Also, the park lake was populated
with 1000 trouts and a few swans.
from raw stone (78 m.p.), Princess Ileana’s
Children house (43 m.p.), New personal house
(176 m.p.), Staff housing (378 m.p.), Horse
stables, Hunting house, Wooden church, two
huts and six garages.
Figure 7. Queen Maria by the swan lake in Bran Castle

Parc (Ion N.D., 2003)
Unfortunately, on 18th July 1938, Queen Maria

dies. The Bran estate becomes the property of
Figure 5. The tea house and maintenance people in the princess Ileana, the restorations and
Bran Castle Parc (Ion N.D., 2003) maintenance go on for nine more years. The
first years of this period (1938-1943) are
In the year 1922 modern greenhouses were dedicated specially to the current repairs of the
commissioned, heated by radiators and a plan castle, which due to rare inhabitation suffered
was made by the royal house architect (Karel (princess Ileana lived there six months a year,
Liman) for a rose garden. The garden had respecting the condition imposed by King
317
Carol the second, her brother, on her marriage Romanian cultural legacy. Today only three
to the archduke Anton of Habsurg) Due to the sections function: Castle Section – with pieces
Princesses marriage with Prince Anton of of the royal family patrimony (many of them
Habsurg, she was revoked and forced to live in disappeared in the communist regime period),
Sonnberg castle, Austria. Starting with 1943, Medieval Customs Section – in process of
the princess will permanently live in the restoration and Ethnography Section – in the
country, living in the castle only in the summer park near the Castle.
months and tending more to charity works.
The magnitude of the domain transformations RESULTS AND DISCUSSIONS
was greatly diminished, this period overlapping
with that of the war, when all the country was Current state
going through rough social, material and The expansion which the domain had during
economical times. the time of Queen Maria is no longer valid.
Still, Princes Ileana inherited the spirit and
charitable soul of Queen Maria, throughout her
stay in Romania, looking toward helping and
supporting the nearby residents and the war
casualties. In this purpose she built with great
sacrifice and calling to many acquaintances
who could help her, a hospital on an estate
close to the Castle. By doing this, she could
express the great love and consideration which
she had for her mother, naming the hospital
“Queens Heart”.
The abdication of King Mihai I, on 30th of
December 1947, releases the domain in the
possession of the Romanian government. Figure 9. Guest house in the natural park (Dobrescu E.
Princess Ileana is forced to leave the country 2009)
the political conditions allowing her to return to
the Castle only in 1990. Of the total surface ”233 acres to which 183
forest acres (fir and beech), 93 acres of
meadow and 2 acres of grasslands are added”
(Ion N.D., 2003) accessible and arranged for
touristic purpose are just the spaces around the
castle.
Figure 8. Queen’s Heart” Hospital in Bran (Ion N.D.,

2003)
In the year 1957, 10 years after the instauration

of People’s republic of Romania, the Bran
Castle became a museum, the communist
regime starting a long period of degradation Figure 10. Lake landscape park (Dobrescu E., 2009)
and estrangement of the wealth of the royal
family, which although were not Romanian In development is the Medieval customs area.
born, protected, contributed and cherished the Many of the buildings, surrounded by their
318
respective terrains, are now out of the touristic
route of the Bran estate. The surface of the Park
holds the Castle area, the park area to the
former garage workshops and the ethnographic
area in the park. The other areas are not
presented, some of them being the property of
other institutions.
The Palace Park is precarious maintained, the
lake is clogged, the mature vegetation needs
regeneration works and the young vegetation is
abusively and wrongly added. The bath house
with the swimming basin, placed beyond the
river are not on the touristic route. The same Figure 12. Wrong approach in the context of a natural
for the wooden Church, the Big House, the style park (Dobrescu E., 2009)
Hospital and the cript where Queen Maria’s
heart was placed until 1970.
Figure 13. Inner courtyard of Bran Castle (Dobrescu E.,

2008)
Figure 11. Thuja Occidentalis in a degraded state
(Dobrescu E., 2009) The Bran Monument did not reveal any
documentation regarding the garden
Note that the park had, during the Queen, a surrounding the castle, not until it entered the
strong direction for natural landscape design, possession of the royal court. The wish of
the grasslands and the lake shores were Queen Maria, to be surrounded by a landscape
designed to be natural, free, the meadow was fitting her passion for nature, gave birth to the
mowed manually, without o special concern for design which we can analyze today (with a bit
accuracy and minute details. The flowers were of imagination). Let us not forget that then, the
natural, wild species and they gave the place young sovereign came from a country with a
the charm sought by the Queen and the strong landscaping tradition (England), with
cultivated species were only to be found near very refined tastes and an inclination towards
the castle. Fruit bearing trees only completed the romantic style. All the transformations
the already present masses of trees resembling made to the castle and the estate were grafted
those found in the nearby forests, thus showing on the old structure of the domain, under the
the pragmatism of the natural style and the needs identified at that time.
desire to be close to nature.
We cannot ignore the fact that, currently, the
landscape is not in accord with it’s original
style and does not respect the romantic
character created in it’s glory days.
319
future restorations have to keep in mind the
historical moment marked by Queen Maria and
the aspect of the landscape created in that
period. All the restoration interventions have to
have as a historic mark the period between
1920 and 1938, taking in consideration the
current necessity to adapt the historical
monument to the touristic functionality and not
as a housing facility. Also we have to reclaim
the domains belonging to the Queen which
have a strong historical hold.
The new functions have to keep account of the
Figure 14. Tea house in the natural park (Dobrescu E., original atmosphere without major alterations
2008) to the whole image.
Restoration, as an actualization of a work of
art, is included just to this filtration and accu-
mulation of data; it is thus natural to identify
two stages: the first is the reconstruction of the
authentic text of the work, the second
intervention over the matter from which the
work is composed.
This study is not only a research theme, but
also an action to induce or recover the respect
towards the history and national values of
patrimony, without which a true restoration
could not take place.
Figure 15. Guest house in the natural park (Dobrescu E., REFERENCES
2008)
L451/2002. Conventia europeana a peisajului, adoptata
CONCLUSIONS la Florenta la 20 octombrie 2000
Ion N.D., 2003. Castelul Bran-Resedinta a reginei Maria
Following the historical review no documents si a printesei Ileana, Ed. Tritonic.
were found regarding restorations previous to Dobrescu E. Arhiva personala - foto 2007-2009.
Brandi C., 1996. Teoria restaurarii, trad. Ruxandra
the ones made by the royal house architect, Balaci, Editura Meridiane, Bucuresti, p. 81.
Karel Liman. All the transformations following
1938 have no value from a historical or stylish
points of views. As such we can consider that
320
OBJECTIVE NECESSITY OF STUDY AND PROFESSIONAL

APPROACH TO RESTORATION OF HISTORICAL LANDSCAPE
ENSAMBLES IN ROMANIA
Elisabeta DOBRESCU
University of Agricultural Sciences and Veterinary Medicine of Bucharest, 59 Marasti, District 1,

Abstract
Major concerns for preserving the national cultural identity are timid in regards to the landscape, perhaps a lack of
funding and focus on other areas of interest. Architecture has received greater concern, but even here the situation was
not very happy. All the restoration / revitalization interventions are spread, there is no coherent approach to the works,
based on priorities for action which result from the analysis of degradation, vulnerability, and overall value of
monuments.Therefore study and research for the restoration of parks and historic gardens should be thorough,
currently lacking a methodology for analysis and evaluation of historical monuments adapted to the specific landscape
that is different from architectural specifics. Studies for a professional approach to historic landscape restoration
assemblies could be a starting point in developing the methodology for the restoration of historic parks and gardens in
Romania.
Key words: Historical identity, cultural landmarks, restoration, the actual functionality, historical garden.
INTRODUCTION determines the degradation over time of the

general aspect of the landscape and often leads
Keeping and preserving the cultural heritage is
to important losses. Preserving the landscape in
a necessity in the context of recognizing the
such cases means defending them from
historic, architectural and artistic inheritance of
physical destruction, maintaining the basic,
Romania, but also for understanding the stages
original characteristics of the shapes and the
of social, political and cultural development of
composing elements that lasted through time.
the Romanian territories. The gardens and
The importance given to restoration and
parks that belong to the historic edifices, as
conservation of the historical heritage of
monuments of the past, represent testimonies of
landscape architecture in different European
certain stages of civilization and culture of a
countries reflects in putting in the general
people, of the way in which historical,
attention, inclusion in the touristic circuit,
economical, social factors as well as the beliefs,
publishing of specially magazines, formation of
the scientific and technical knowledge of the
professional associations, and especially in
time determined certain shapes for the space of
allocating funds and attracting sponsors for
human living.
financing studies and restoration projects.
Knowing, investigating and conserving or
restoring these gardens could prove to be as
important as doing so with any of the other
cultural values that make up the historical In Romania there are over 29.000 historical
heritage of a country and, in many case, on the monuments, of which over 4.000 are in a state
world (Legea 451/2002). of advanced degradation, collapse and pre-
In the case of gardens, the effect of the exterior collapse.
climate conditions on the specific constructions Historical monuments, according to the
and mostly on the vegetation, correlated with definition accepted by the National Ministry of
the potential life span of the botanic species, Historical Monuments and of Cultures and
321
Cults, and in conformity with the current laws,
are estate goods, constructions and land
situated on the territory of Romania, or outside
the borders, properties of the Romanian state,
significant for the history, culture and national
and universal civilization.
All mentioned above belong to the national
cultural heritage and are protected by laws
specific to historical sites.
The list of the monuments is pretty vast, yet
many of the aforementioned are already
physically gone (like the Vĉcĉreƕti Estate, in
Dambovita county), and most didn’t benefit Figure 2. Image from the restauration of the Venetian
from studies or conservation and restoration terraces, done in the time of Martha Bibescu (Chiliman
A., 2000)
interventions.The few restorations undergone
lately did not made themselves remarked for
professionalism.
Figure 3. Planting on the venetian terrace, at the last

restauration of the parc palace Brâncovenesc in
Figure 1. VĉcĉreƔti Mansion, in VĉcĉreƔti, Dâmboviԑa MogoƔoaia, restauration of a poor quality
county (vanished since the comunist period) (Ion N.D.,
2008)
The authenticity of the site refers at the flat
drawing, the volume of the constituent
A professional approach of the historical elements as well as all the other vegetal or
monuments, as it is viewed by the last mineral details that it encompasses. Any
international conventions concerning cultural attempt to conserve or restore it assumes a
heritage, landscape, monuments and sites, show simultaneous intervention on all the parts of the
the importance that these have in the cultural ensemble, in order not to affect the structure of
heritage of a community (Florence cart). the initial composition.
The process of professional restoration of the Restoring and conserving the historical gardens
historical gardens involves an inventory of its involves not only the comprising elements but
comprising elements and specialized also the general context, defined by the exterior
interventions considering their restoration, environment in which these exist. All the
conservation and up-keeping, obtaining and changes that happen in the physical
maintaining a high degree of authenticity. environment endanger the ecological
equilibrium of the site.
Intervention done on the historical monuments
are made only by respecting the Agreement of
the Culture and Cults Ministry; the force
majeure events are an exception, but with the
condition that the changes are reversible.
322
According to the current laws, the interventions One of the core ethical principles is that the
on any historical monument are represented by restorator must have the necessary qualification
all the research endeavors, construction, for conservation and restauration activities.
extension, repair, consolidation, restoration, The conservers and restaurateurs specialized in
conservation, landscape setups, as well as any certain sectors of activity should limit
other involvements that modify the aspect of themselves only at the activities specific to their
the monument, including current repairs, field of study and should not consider
maintenance work, exterior illumination, safety themselves specialists in other domains
measures or decorative efforts. connected to their own (for example painting
In the same set of interventions done on the restorators reconstituting statues)
monument are the temporary or permanent The quality of restorations is the defining
placements of physical boundaries, protection element of a specialist, not the quantity or the
structures, pieces of fixed furniture, advertising value of the restored object.
signs, signage or any kind of markings on the A vast professional experience is necessary,
monument, movement of the entire gained through continuous formation, through
construction, setting up means of access, collaboration with other specialists from
pedestrian and non-pedestrian, other utilities, connected domains, for a full knowledge of the
indicators, including the ones in the protection qualities and abilities of a specialist in
areas of the monument. restoration works.
Maintaining a critical attitude regarding the
traditional materials and methods used in
conservation and restoration of the degraded
elements is a necessity, considering that all the
manufacturers promote their own materials and
work methods.
Any specialist activating in this field is obliged
to demonstrate a profound respect for the
aesthetic, historic and physical integrity of the
restored object.
Any investigation or treatment applied on a
historical piece must be made within the limits
of the competency of the restorator.
Figure 4. „An amusement parc” created on the spot in the For each oeuvre that has a historical or artistic
honor Court of the Brâncovenesc Palace in MogoƔoaia, characteristic the specialist must use the highest
image which alters the character of the monument and most exact standard of treatment. Certain
(Dobrescu E.) opportune treatments will be preferred to
others, any other type of treatment that is
All the interventions that affect the monument, considered unfit for the conservation or
other that the ones concerning changing restoration of the piece being damaging.
destination, maintenance or current repairs, no The materials used for restoring the monuments
matter what their source of finance and the will have the quality of being reversible, so that
nature of the property, are done under the their potential removal in the future won’t
inspection and control of the Culture and Cults affect the physical integrity of the restored
Ministry, of the Directions for Culture, Cults object. The changes brought though the works
and National County Cultural Heritage and of of restoration must be made to the step that the
the Municipality of Bucharest. original object remains recognizable.
Conservation and maintenance interventions This creates a limitation of aesthetically
that are permitted must respect a series of reintegration.
ethical principles without which the project The quality of the restorer’s labour is given by
would not be subject to a certain quality of
his capacity to keep up with the latest
restoration (AIC, 1976).
developments of the technology involved in
this field. For this, the specialist is forced to
323
consult the scientific novelties and develop his “urban reservation”, “area of cultural and
aptitudes so that he can offer the best treatment natural protection” etc.
in a diverse range of situations. So, the notion of “historic monument”
The responsible restorer has the obligation to encompasses the isolated architectural creation,
coordinate the activity of the auxiliary the urban and rural settlement, as well as the
personnel, so that the protection and integrity domains that surround it, parks and gardens,
of the cultural good is assured. A series of which, together, bring the testimony of a
actions which might degrade the site over time civilization representative of a historical period.
are forbidden. Such actions include the Any historical monument has available, from
execution of alleys with paved concrete, any its setup in the territory, a protective space,
attempts to mask the lower part of the which gives its individuality among the
buildings, painting with synthetic substances or surrounding edifices.
replacing covers. It is also forbidden to plant
any large scale trees at less than 15m from the
monument or the execution of burials at a
distance that’s less than 6m from the church
walls. Depositing, even temporary, of chemical
substances or flammable products, solvents or
other dangerous substances inside or near the
monument are sanctioned according to the local
laws (Legea 41/1995; Legea 50/1991; Legea
10/1995).
Neither is depositing of construction materials,
utilitary materials or household items near of
inside the monument allowed. The change of
usage for the historical monument, digging,
erecting new edifices without specialist
archeological assistance or executing
constructions for new buildings in the
functional area or the protection area of the
Figure 5. Creation of a protection zone for monuments in
monument also enters under the rule of law a rural area
(Legea 11/1994).
The specific protection areas (established
RESULTS AND DISCUSSIONS through the urbanism documentations approved
For the professional approach of the restoration by the Historical Monuments Committee), the
process for historical gardens and parks, the artistically components of the areas, the
specialist must also have knowledge of the comprising elements of the area and the interior
Cultural heritage, the Natural Heritage and and exterior furnishing elements, as they are
implicitly the Historical garden, how the defined by the application set of rules, are
historical monument classification works, and considered part of the historical monument.
which are the main characteristics needed for The research regarding the inventory of the
an edifice to be declared a historical landscape heritage is an indispensable step in
monument. the restoration study, as picturing the current
Another important issue to be aware of is the picture can establish the necessity and the
juristic regime of the monuments, what is there urgency of the conservation and restoration
are of protection and what the protected area is interventions.
comprised of, as well as the interventions that In this context, every historical monument must
are permitted on a historical monument. dispose of an inventory of its composing
The Venetian Carta (1964) gave a wider elements (done by the owner or the
interpretation to the notion of “historic administrator).
monument”, introducing new concepts as This inventory is made up of:
“historic ensemble”, “monumental center”,
324
-constructions – buildings with main functions,
household side buildings, property walls,
towers, living spaces, religious edifices, altars
etc.;
-exterior arrangements – access roads, stairs,
walk paths, roads, parks, plantations, basins,
statues, lakes, exterior installations, fences;
-other elements – graveyards, archeological
elements;
-mobile cultural goods;
This data is gathered in the Analytic paper of Figure 6. The ruins of the Cantacuzino palace from
the monument, which also includes details FloreƔti, jud. Prahova, foto 2007 (Dobrescu E.)
regarding the official denomination, address,
short description, date of construction, history
and state of conservation, sketches and photos
of the property, juristic regime, cadastral
survey, urbanistic reglementations, building
founder, prior restoration workings.
To be able to make an objective decision
regarding the restoration or revitalization of a
historical monument, we must know its origin,
the influences that determined the choice for a
certain style of architecture, the factors that
contributed to its changes over time. A
professional approach of restoration must lead
to the establishment of the global value of the Figure 7. The Istrate Micescu mansion from MiceƔti –
historic monument and to planning the jud. ArgeƔ (Ion N.D., 2008)
interventions that must be done, depending of
the degree of vulnerability and the historic and Sadly, we can observe that in the very
aesthetically importance of the composing important publication that catalogues historical
elements. gardens in the world, The Oxford Companionto
gardens 2, Romania is only mentioned a few
CONCLUSIONS times, for the Golescu family and baron
Bruckental from Avrig gardens (page 475-476),
The existence of many gardens in Romania, the Brâncuƕi sculptural site from Tg.Jiu,
which, even though appear on the List of informations offered by Maria Golescu in the
historical monuments, are little or not known at XX century. In the same volume, Bulgaria has
all, some in state of forgetfulness, pray to a 2,5 page synthesis, Hungary around 2 pages
natural or anthropic degradation, some (Oxford Companion to Gardens, 1986).
arranged through interventions unfit for their
In order to be considered a piece of art, the
initial value, constitute a compelling argument
garden must benefit from objective recognition,
for the professional approach of the process of
it must recreate the artistic sensation every time
restoration.
it’s visited, it must represent beauty by itself,
,,… Through restoration we understand any like a painting, it must allow for “the play of
intervention aimed to bring to its efficiency a imagination in contemplation”.
product of human activity” (Brandi C., 1996).
Any intervention done to work of art depends
on this recognition by its state: “a work of art,
no matter how old or classic it is, actually
comes into being and not only for the potential
as a work of art, when it lives in a certain
individualistic experience” (Dewey, 1951).
325
,,The restoration is the methodologic moment All of these recordings, previous to the
of recognition of the work on art in its physical professional restoration process, must make up
consistency and in its double aesthetic polarity, the primary data base which will enable a
that aims to transfer it in the future.” (Brandi qualified approach in restoring the important
C., 1996) landscape monuments from Romania
In the case of gardens which do not have a
historical documentation which can certify the REFERENCES
initial image of the monument before Legea nr. 451 din 8 iulie 2002 pentru ratificarea
restoration, it can come to interpreting data Convenԑiei europene a peisajului, adoptatĉ la
from similar monuments from the same period Florenԑa la 20 octombrie 2000 (L451/2002). Law
no.451 from 8th of April 2002 for the ratification of
or to an innovative or eclectic approach to the
the European Convetion on Landscape, adopted in
process. In this case valuable elements from a Florence at 20 October 2000
historical point of view are kept and new L 41/1995; L 56/1998: L 5/2000; L 182/2000 The main
functions can be introduced according to the normative acts with incidence in the domain of
neccesities of the space utilization. historical monuments.
Dosar restaurare parc Palat MogoƔoaia, 2000; Parc
The newly introduced functions must take into Kiseleff, Parc Herĉstrĉu. Restoration file Palat
account the original atmosphere of the Mogoƕoaia park, 2000. Park Kiseleff, Park Herĉstrĉu.
monument without altering the image as a Ion N.D., 2008. ReƔedinԕe Ɣi familii aristocrate din
whole. România , Ed. Institutul Cultural Român, p..308.
Carta de la Florenԑa, 1982.
The analysis criteria are utilized when reaching Chiliman A., 2000. Dosar restuarare, Fotografie de
a diagnostic and constructing a plan of epocĉ, Arhiva personala.
restoration, as a revival, as a reconstitution of Dobrescu E., Teza de doctorat. Studii privind
the authenticity of the work of art:,,Restoration, revitalizarea ƕi restaurarea unor grĉdini din România,
as an actualization of the work of art, is realizate în sec. XIX – XX, sub influenԑa modelelor
included in this filtration and accumulation of francez ƕi Italian, p. 42.
Codul eticii Ɣi standarde de practicĉ în activitatea de
data; so it is natural to identify two stages: first,
conservare Ɣi restaurare. Institutul American pentru
of reconstitution of the authentic text, second, Conservarea Operelor de artĉ Ɣi cu caracter istoric
of intervention upon the matter that makes up (AIC), 1976.
the piece” (Brandi C., 1996). Legea 41/ 1995, Legea 50/ 1991, Legea 10/ 1995, Cod
penal art. 217, 218, 219, Cod penal art. 360. Legea
The insufficient preoccupation in the domain of nr. 11/1994.
restoration and revitalization of landscape Monumente Istorice. Manualul Administraԑiei Publice
monuments, the lack of specialty studies and Locale, p. 29.
documents of evidence, which may bring into Dobrescu E., 2007. Teza de doctorat-Studii privind
the attention of the Culture and Cults Ministry revitalizarea ƕi restaurarea unor grĉdini din România,
realizate în sec. XIX – XX, sub influenԑa modelelor
the imperative of restoration based on scientific
francez ƕi Italian, p. 19.
basis of historical parks and gardens, is the The Oxford Companion to Gardens, 1986. Oxford
main argument for getting back the cultural and University Press, New york, p. 475-476,506, 541.
historical identity. Currently, in the archives of Kant I., 2008. Critica facultĉԑii de judecare, Editura All,
the Culture and Cults Ministry as well as the Bucuresti, p.159.
achives of the Town Halls that act as owners of Dewey J., 1951. Arte come esperienza, La nuova Italia,
the landscape monuments, there are no Firenzze, p. 130.
Brandi C., 1996. Teoria restaurĉrii; trad. Ruxandra
complete documents that present a clear and up Balaci, Ed. Meridiane, BucureƔti, p. 33, 37, 81.
to date inventory and also a timeline of prior
restoration work.
326
SPONTANEOUS SPECIES WITH ORNAMENTAL POTENTIAL:

ASTER OLEIFOLIUS (LAM.) WAGENITZ (I) - MORPHOLOGY,
ECOLOGY, CHOROLOGY
Mihaela Ioana GEORGESCU, Ioana Marcela PĂDURE, Florin TOMA, Monica BADEA,
Sorina PETRA
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Mără‫܈‬ti Blvd.,

Abstract
Morphological characters and environmental factors requirements for Aster oleifolius (Lam.) Wagenitz [syn. A. villosus
(L.) Sch.Bip; Linosyris villosa (L.)DC.] (Asteraceae) are presented as arguments to introduce this species among the
ornamental plants. A chorology map, based on the original or collected data from different herbaria from Romania and
references, gives the country spread of this species.
Key words: Aster oleifolius, Asteraceae, morphology, ecology, chorology.
INTRODUCTION October (Figure 1). A. oleifolius has an excel-

lent potential as ornamental plant in gardens.
Aster oleifolius (Lam.) Wagenitz [syn. A.
villosus (L.) Sch.-Bip., non Thunb.; Galatella
villosa (L.) Rchb.f.; Linosyris villosa (L.) DC.;
A. cinereus Korsh.; Chrysocoma villosa L.;
Crinitaria villosa (L.) Grossh.; Conyza
oleifolia Lam.] from Asteraceae is a perennial
herb, 13-35 cm, stem is ascending to erect,
densely hairy, leaves alternate, simple, lan-
ceolate to oblanceolate, 15-40cm/10mm; soon
leafless and glabrous below, with oblanceolate, Figure 1. The capitula and leaf morphology in Aster
greish-white-tomentose leaves above. Capitula oleifolius (orig.)
shortly pedunculate, narrowly infundibuliform, The species A. oleifolius was described by
in dense corymbus. Involucral bracts is several Linnaeus with syn. Chrysocoma villosa L. in
rows, subacute to subobtuse, long-ciliate, the Linnean Herbarium [S-LINN], in Sweden
outer tomentose, the inner somewhat lanate at (http://linnaeus.nrm.se/botany/fbo/c/chrys/chry
the apex; ligules absent; papus-hairs inequal vil.html.en) (Figure 2).
(Merxmuller and Schreiber, 1976). A. oleifolius
is a xeric steppe species on calcareous soils (in
the nemoral areas and in the forest-steppe only
on sunny steep clines) with continental Eura-
sian distribution (Badarau, 2006).
Some species of Aster L. are cultivated and
sold in the horticultural trade. Some of these
species are widely distributed and have been
known in cultivation for a long time. Due to the
general aspect of plant and the greish-white-to-
mentose leaves above, A. oleifolius may be used
as ornamental plant with a longer flowering
period between July-September, sometimes till Figure 2. Chrysocoma villosa L. in Linnean Herbarium
[Microfiche number: IDC 337.19]
327
The chorology map and details of distribution
of Aster oleifolius are based on collections from
Herbaria: BCHM, BRHM, BUAG, BVHU, CL,
I, IASI, PLHM, SIB, SVHU (according codes
to P.K. Holmgren from Index Herbariorum).
The chorological map of A. oleifolius is based
on the cited sources above plus new records
Figure 3. A. oleifolius on Dobrodjan Colline in “I.
obtained during research, or different databases Todor” Botanical Garden, Bucharest (orig.)
/ scientific publications where this species was
referred. The chorological map of A. oleifolius Aster oleifolius is xeric species with a rare
included in this work was made by taking in distribution in Romania. The image presented
account the principles of the GEOCOD System bellow (Figure 4) is a comparison between A.
(Oltean and Stefanut 2002), which ensures an linosyris (left) and A. oleifolius (right).
exact localization of villages, communes and Though congeneric and sharing the same
towns where this species was found. The main character-the lack of the ligulae-the two species
objective of the present study is to document are not immediate and not even closely related
the geographic distribution of the A. oleifolius in the context of the genus Aster. The
species in Romania using Universal Transverse differences between the two, especially in
Mercator (UTM) system. The chorological red concerning the structure of the capitula
points on the distribution map are represented (Badarau, 2006), leaf nervation and the colour
by data from cited Herbaria and former of plants.
citations from literature, and original data from
the field (Figure 7). The material used for
morphological descriptions was collected from
Alah Bair Hill, Constanta County. The species
was naturalized in “I. Todor” Botanical Garden,
on Dobrodjan Colline in USAMV Bucharest
(Figure 3).

Aster oleifolius is a calcareous species and the
coenotaxonomic framing of this newly
proposed vegetal subassociation is following:
Cl. Puccinellio-Salicornietea Topa 1939, Ord.
Puccinellietalia Soo 1940, Al. Puccinellion
limosae (Klika 1937) Wendelbg, 1943, 1950, Figure 4. Two species of Aster in Alba County (photo
Badarau)
As. Staticeto-Artemisietum santonicae Topa
1939 and subass. asteretosum oleifolii subass.
The species is well-represented in Fantanita-
nova (Stefan et al., 2009) or As. Staticeto-
Murfatlar, Basarabi (Constanta County). It is
Artemisietum monogynae (santonicum) Topa
preserved indirectly due to another rare species
1939 (Lupascu et al, 2005)
of Romania, like Nepeta parviflora, Paeonia
The species was collected from Alah Bair and
peregrina, P. tenuifolia, Adonis vernalis,
transplanted in “I. Todor” Botanical Garden for
Helianthemum salicifolium, Trigonella
acclimatization and naturalization regarding the gladiata, Stipa lessingiana, Crocus pallasii,
morphological and anatomical studies, Euphorbia dobrogensis, Linum borzeanum,
cultivation aspects and interest for Buffonia tenuifolia, Aster oleifolius, Scutellaria
phytodiversity preservation (Figure 3). orientalis (Figures 5 and 6).
328
[MK89] (Oprea, 2005), Pâclele Mari and
Pâclele Mici (Merce, 2011), (BUAG 18412).
Cluj County: Cluj [FS97/97] (Oprea, 2005),
Agârbiciu [FS78] (Dragulescu, 2003), Sic
[GS29] (Merce, 2011), Micesti (Nyárády and
Morariu, 1964).
Constanta County: Basarabi in Fantanita-
Figure 5. A. oleifolius in Fantanita-Murfatlar Reserve, Murfatlar Reserve (Figures 5 and 6) [PJ19]
Constanta County (Padure, 2005) (Padure, 2005) (CL 430995, CL
432191), Agigea (Burduja et al., 1969;
Burduja and Horeanu, 1970; Oprea, 2005;
Nyárády and Morariu, 1964) [PJ28], Cheia
[PK12] (BRHM), Medgidia (Nyárády and
Morariu, 1964), Adamclisi (I 24298), Eforie
[PJ37] (BCHM), Hagieni (CL 661984)
(Cristurean and Ionescu–Teculescu, 1970;
Ionescu-Teculescu and Cristurean, 1967),
Capul Midia (Nyárády and Morariu, 1964) and
Grindul Chituc, Baltagesti [NK92] on Alah-
Bair Hill (Oprea, 2005), (Ciocârlan and Costea,
1996), Horia [NK84] (BRHM), Dobrogea
Figure 6. A. oleifolius in Fantanita-Murfatlar Reserve,
Constanta County (Pĉdure, 2005)
(Brandza, 1898), Coroana [PJ14] (Sârbu et al.,
2009), Vama Veche [PJ24] (SIB), Techirghiol
[PJ27] (PLHM), Vânatori [PJ25] (Sârbu et al.,
The authors were made an important revision 2009), between Vasile Roaita and Eforie
of A. oleifolius herbal specimens from different (BUAG 4770).
Herbaria (data sheets specimens) to realize a Dolj County: Desa [PP65/66] (Merce, 2011).
partial monographic study on genus A. Galati County: Gârboavele (Mititelu et al.,
oleifolius in Romania. We finally realized for 1968; Nyárády and Morariu, 1964) (I 39100),
the first time a chorological map of this species. Foltesti (I 39101) [NL86] (Nyárády and
The partial chorological data are presented in Morariu, 1964), Barbosi (I 39103) [NM74]
following section: (Nyárády and Morariu, 1964), Galati (I 39104)
Alba County: Rosia de Secas [GS20] [NL73] (Nyárády and Morariu, 1964), Vasile
(Badarau, 2006). Roaita [NL36] (BVHU), Radesti (I 55985)
Arad County: Sânmartin [ES24] (Merce, [NM60], Cuca (I 65545) [NL66], Sârbi [NL28]
2011), Pilu [ES25] (Merce, 2011), Varasand (Oprea, 2005).
(Merce, 2011), biclĉu [ES24] (Merce, 2011), Giurgiu County: Comana [MJ39] (Merce,
Graniceri [ES25] (Merce, 2011), Socodor 2011; Nyárády and Morariu, 1964).
[ES35] (Merce, 2011). Ialomita County: Slobozia (I 65547) [NK23],
Bihor County: Cefa [ES59] (Merce, 2011). Amara [NK23/24] (Merce, 2011).
Botosani County: Râsca (I 29490) [NP10], Iasi County: Mârzesti (I 4809, I 76515, IASI
Tataraseni (I 29491) [MP72], Botosani [MN78] 3188, IASI 3191, IASI 3193, IASI 3194. IASI
(Oprea, 2005; Nyárády and Morariu, 1964), 3196, CL 216511, CL 580006) (Nyárády and
Calarasi [NN17/27] (Oprea, 2005), Valea Morariu, 1964), Iasi (I 22637, I 22638, I 45308,
Bahluiului-V. Ilenii (Lupascu et al., 2005), I 58766) [NN41/41], Bratuleni (I 24297)
Frumusica [MN96] (SVHU), btefanesti [NN19] [NN32] (Nyárády and Morariu, 1964), Hodora
(Nyárády and Morariu, 1964). (I 24299) [NN04], Mânzatesti (I 24300, I
Braila County: Jirlau [NL10] (Merce, 2011). 24301) [NN52], Sorogari (I 24302) [NN42],
Buzau County: Râmnicu Sarat [NL02], Boldu Cotnari (I 60702) [MN94] (Nyárády and
(I 65546) (Nyárády and Morariu, 1964), Buzau Morariu, 1964), Valea lui David (Stefan et al.,
2008; Zamfirescu and Zamfirescu, 2008;
329
Merce, 2011; Zamfirescu, 2010) (IASI 3187, Cl Suceava County: Radauti (I 39117, I 39118),
216638), Rediu [NN02], (BUAG 20869), Cîrlig (Tomescu and Chifu, 2009; Nyárády and
(IASI 3190, IASI 3192), (Stefan et al., 2009; Morariu, 1964; Tomescu, 2006), Boldu (I
Nyárády and Morariu, 1964), Aroneanu 39119), Botosana [MN18/28] (Tomescu and
[NN42] (Nyárády and Morariu, 1964), Chifu, 2009), Ciprian Porumbescu [MN27]
Vânatori [NN84] (Nyárády and Morariu, (Tomescu and Chifu, 2009).
1964), Cucuteni (I 24296) [MN93] (Nyárády Tulcea County: Ciucurova [PK17] (Oprea,
and Morariu, 1964), Brazu [NN32] (BUAG), 2005; Nyárády and Morariu, 1964), Sulina
Ԑigĉnasi [NN3] (Nyárády and Morariu, 1964), [QL10] (TMMJ), Greci [NL90] (CL 430994)
Fântânele [NN15] (Nyárády and Morariu, (Marin and Cristurean: Flora din Parcul
1964), Fântânele [NN15] (Nyárády and and Naԕional Munԕii Macinului,
Morariu, 1964), Focuri [NN15] (Nyárády and www.parcmacin.ro/c/document.library;
Morariu, 1964). Nyárády and Morariu, 1964), Macin [NL80]
Ilfov County: Lehliu (I 137312, I 137313) (Oprea, 2005; Nyárády and Morariu, 1964),
[MK82]. Babadag (Dihoru and Doniԑĉ 1970), Sarighiol
Sibiu County: Sura Mare [KL78] (I 33186, CL [PK25] (SVHU), Vasile Alecsandri [PK16]
27881, CL 86933), (Dragulescu, 2003), (SVHU).
Micasasa [KM70] (CL 98798), (Dragulescu, Vaslui County: Sasova (I 69056) [NM49],
2003), Seica Mare (Dragulescu, 2003) [KL79], Bolati (I 69062) [NM48], Ratesu Cuzei (I
Sibiu [KL 77/87] (Oprea, 2005), Rusi [KL79] 77552) [NM48], Bolati (I 77554), Todiereni
(Dragulescu, 2003), Slimnic [KL78] (Oprea, 2005), Oltenesti [NM65] (SVHU).
(Dragulescu, 2003), Târnava [KM81] The chorogical map using GEOCOD
(Dragulescu, 2003), Târnavioara (Dragulescu, coordinates of Aster oleifoius is presented in
2003). Figure 7.
Figure 7. Chorological map of A. oleifolius in Romania using GEOCOD coordinates
330
CONCLUSIONS Ionescu-Teculescu V., Cristurean I., 1967. Cercetari flo-
ristice în rezervatia naturala Padurea Hagieni, Ocrot.
Aster oleifolius is a perennial herb growing in Nat. 11 (1), p. 25-36.
full-sun calcareous soils, drought resistant plant, Lehrer A. Z., Lehrer M., 1990. Cartografierea faunei si
sometimes on halomorphic soils in our country florei României (Coordonate arealografice), Ed.
Ceres, Bucuresti.
(see the map above). There are lots of refe-
Lupascu A., Anitei L.G., Niacsu L., 2005. Caracterizarea
rences from different scientific publications, unor asociatii vegetale halofile din bazinul Bahlui pe
monographic studies and un-reviewed voucher baza indicilor ecologici, Factori si Procese Pedo-
specimens from different Herbaria, which will genetice din Zona Temperata, 4, p. 117-125.
be study in the future. We are going to add new Merce O., 2011. Fisa de prezentare si strategia d econser-
vare a habitatului 1530*-Mlastini si stepe saraturate
and interesting information about A. oleifolius
panonice. Contribuԑii Situl Natura 2000 ROSPA0015.
chorology in Romania. It is necessary to com- Merxmuller H., Schreiber A., 1976. In Tutin T.G.,
plete our partial study with investigations in Heywood V.H., Burges N.A., Moore D.M., Valentine
other regions in Romania. We are going to pro- D.H., Walters S.M., Webb D.A., Flora Europaea, vol.
pose using A. oleifolius as an ornamental plant in IV, Cambridge Univ. Press, cambridge.
gardens due to: morphological aspects of stem Mititelu D., Gociu Z., Patrascu A., Gheorghiu V., 1968.
Flora si vegetatia padurii-parc Gârboavele-Galati,
and leaves (grey-tomentose, short habitus and Analele St. Ale Univ.,,Al. I. Cuza”, Biol. XIV: 163-173.
perennial beauty), high resistance to drought, full- Nyárády E.I., Morariu I., 1964. In: Savulescu T. et al.,
sun growing and long term flowering species. Flora RPR, vol. IX. Edit. Academiei R.P. Române,
1964, Bucuresti, p. 190-192.
ACKNOWLEDGEMENTS Oltean M., Stefanut S. 2002. Atlas Florae Romaniae,
Proceed. Inst. Biol. IV, p. 101-108.
The author warmly thanks to Dr. Sorin Stefanut Oprea A., 2005. Lista critica a plantelor vasculare din
for his great help regarding chorological data România. Edit. Univ. „A.I.Cuza”, Iasi, p. 357.
and chorology map, also to all curators from Padure I. M., 2005. Cercetari monografice asupra spe-
ciilor genului Nepeta L. în România, teza de doctorat,
the mentioned Herbaria for use of Aster
Universitatea din Bucuresti, Facultatea de Biologie,
oleifolius data specimens and original photos of p. 377.
Herbaria sheets to complete our chorological Sârbu A., Sârbu I., Mihai D., 2009. Unprotected gras-
and morphological studies. sland areas from Dobrogea of high botanical value.
Contribuԑii botanice, XLIV, Gradina botanica
REFERENCES „Alexandru Borza”, Cluj-Napoca, p. 67-75.
Stefan N., Sârbu I., Oprea A., 2008. Phytocoenological
Brandza D., 1898. Flora Dobrogei. Inst. De Arte Grafice contributions to the vegetation of Moldavie (Roma-
Carol Gobl, Bucuresti, p. 223. nia). Rom J.Biol. – Plant Biol., 53 (1), p. 39-45.
Burduja C., Horeanu C., 1970. Contribution a la connai- Stefan N., Sarbu I., Oprea A., 2009. Phytocoenological
ssance de la vegetation de la reserve de dunes contributions to the vegetation of Moldavia (Roma-
marines D’Agigea, Anal. St. Univ. Iasi, sect. II, tom nia), Rom. J. Biol., Plant Biol. 53 (1), p. 39-45.
XVI, fasc. 2. Tomescu C.V., 2006. Diversitatea florei si vegetatiei
Burduja C., Volcinschi A., Horeanu C., Bîrca C., 1969. ecosistemelor naturale din bazinul râului Suceava,
Proiect pentru organizarea floristico-fitogeografice a teza de doctorat, Universitatea „Al. I. Cuza” Iasi,
Dobrogei pe teritoriul statiunii de cercetari marine,,I. Facultatea de Biologie.
Borcea” Agigea, Lucr. Stat. Cercet. Marine,, I. Tomescu C.V., Chifu T., 2009. The vascular flora from
Borcea” III, p. 206-213. Suceava river basin (Suceava county). Analele Univ.
Chifu T., Stefan N., Manzu C., Zamfirescu S., 2006. Forest „Stefan cel Mare” Suceava, sect. Silvicultura, serie
communities floristically specific to Eastern Romania, noua nr.1,2009, p. 67-75.
Nature Conservation, Environmental Science and Zamfirescu O., 2010. The analysis of the vascular flora
Engineering, p. 169-180. of the nature reserve From Valea lui David (Iasi),
Ciocârlan V., Costea M., 1996. Flora rezervatiei botanice Tom LVI, fasc. 2, s. II a. Biologie vegetala.
dealul Alah-Bair (jud. Constanta). Acta Botanica Zamfirescu O., Zamfirescu S.R., 2008. Aspects regarding
1994-1995, p. 97-104. the vegetation from the floristic reserve „The secular
Cristurean I., Ionescu–Teculescu V., 1970. Asociatii hayfields from Valea lui David”., J. of international
vegetale din Rezervatia naturala Hagieni, Acta Bot. research publication, Ecology and safety (2), p. 77-84.
Horti Buc. 8, p. 245-279. http://www.floraofromania.transsilvanica.net/flora%20of
Dihoru Gh., Donita N., 1970. Flora si vegetaԑia podisului %20romania/AB/Copy%20%2813%29%20of%20spe
Babadag. Edit. Acad. RSR, Bucuresti. cies.htm (Badarau S. A., 2006)
Dragulescu C., 2003. Cormoflora judetului Sibiu. Edit. http://linnaeus.nrm.se/botany/fbo/c/chrys/chryvil.html.en
Pelecanus, 2003, Brasov, p. 344. - Chrysocoma villosa L. in Linnean herbarium (S-
LINN).
331
STUDY OF APPLYING DIFFERENT TREATMENTS ON CUT
ALSTROEMERIA AND THEIR INFLUENCE ON THE SHELF LIFE
Szidónia KOSZEGHI, Endre KENTELKY
Sapientia University Department of Horticulture, 1/C, Calea Sighisoarei, 540485, Târgu Mures,
Romania
Abstract
The importance of cut flowers and flower arrangements vary according to the standard of living. If the standard
increases, the demand for beautiful, more expensive flower arrangements grows as well. At low standard of living, the
costumers give up on, or reduce the acquisition of flowers considered, in this particular case, a luxury. Thus it is
essential to know how long the flower can be a decoration, for how many days it stays fresh and beautiful, because it
takes time to get the flowers from the grower to the shops and in our vase, which shortens their lifespan considerably.
Another important aspect is the way in which we handle the flowers wilted during transportation and not recovered
even after putting them into fresh water. What does salt, sugar or grandma’s copper penny have to do with?
Objectives: The purpose of my thesis is the prolongation of the lifespan of the cut Alstroemeria. During our experiment
we’ll analyze the effect of some Hungarian and Dutch floral preservatives on the Alstroemeria. The results will then be
compared while monitoring the life processes of the flowers in question.
Key words: cut flowers, Alstroemeria, vase life, Bioplant, Chrysal, Oasis.
INTRODUCTION We can assure the undisturbed life process of

the cut flower by means of floral preservatives
It is vital to consider the prolongation of the
and salts (Klincsek, 1990).
life of cut flowers when harvesting,
Basically any preservative should have the
transporting, storing, handling them in the
following ingredients: nutrients (proteins,
flower shop, during work with flower mainly simple sugars),disinfectants against
arrangements or even putting them in a vase in micro-organisms, growth regulator substances,
our home. For the prolongation of its vase life, surface tension reducing substances (increases
it is essential to know the life conditions and water absorption) (Schmidt, 2001).
the life process relevant to the plant. Inorganic Lack of hygiene causes development of micro-
nutrients, water, light, air – carbon-dioxide and organisms leading to water turbidity and bad
oxygen in particular – and the right temperature smell (The Beauty of Chrysal, 2009).
are absolutely essential to the growth and
development of the plant. MATERIALS AND METHODS
The organic materials thus produced during the
transformation – assimilation-in the leaf, are The experiment took place at the University
partly used for the plant structure, another part Sapientia, the Faculty of Technical and Human
is dissolved during breathing and internal Sciences in Târgu Mures in the laboratory of
energy producing, then eliminated (as water, ornamental plants.
oxygen, carbon-dioxide, ethylene, etc.), or Altroemeria aurantiaca „Virginia” was cut on
stored. From our point of view the stored 30th October 2011 and arrived from the
organic materials are the most important Netherlands on November 4. Following the
(Szabó and Hegyi, 2005). preparation of the solution and the cut, we put
As soon as the cut flower runs out of one of the 10 threads in each vase. They faded on
two substances it starts to fade immediately. November 22, so the experiment lasted 19
First the water is consumed. If put in water in days.
time the flower uses its sugar supplies in order During the experiment we used three of the
to live (Schmidt, 2001). best known solutions used for conservation,
333
control water and a solution developed by own The method shows high sensitivity to
recipes (sucrose and chlorine). The different functional changes of the photosynthetic device
solutions in the vases were carefully labeled. as well as how and where the different physical
Floral preservatives used in the experiment: and chemical factors act (Fodorpataki, 2010).
- Chrysal Clear Rosa-Dutch liquid product, We selected a leaf from each vase, applied the
- Chrysal Clear Lilium & Alstroemeria-Dutch clips and allowed them to stay in dark for 15
granular product, minutes. Meanwhile the process of
- Floralife Fresh Oasis-Dutch granular photosynthesis in the selected samples stopped,
product-contains 94% sugar (dextrose), they had become dark-adapted. After applying
3,8% citric acid, 1,7% of different salts and the measuring device on the clips we read the
0,5% preservation solution, data on the display.
- Bioplant-Hungarian product in granular Fo – minimal level of fluorescence
form containing mineral salts and Fm – temporary maximum fluorescence
disinfectant agents against decay. Fv/Fm – maximum or potential quantum
Content of the other two vases: performance
- Sapientia-own recipe containing 50 ml of Fs – steady state chloro-fluorescence
chloride and 30 g of sugar Fm’ – modulated maximum fluorescence
- Control-tap water. PS II – actual or effective quantum perfor-
The equipment used. mance
1. Phyto-monitoring (PhyTech) system is a 4. GTH 2 device. These parameters were
modern observation tool which recorded the measured twice a day: in the morning at the
following data throughout the experiment: air beginning of the program and in the afternoon
humidity (%) – Inp9 – RHS-2, air at to end of it. We used the GTH 2 device,
temperature (C°) – Inp8 – AT1, temperature of which makes it possible to measure the three
the water in the vase (C°) – Inp7 – ST-22. parameters simultaneously.
We chose a leaf from each vase, put a plastic 5. Ciras 2 – Measuring stomatal conductance.
sensor on them for 9 minutes/day which helped Ciras 2 is a system which measures leaf gas
us measure the temperature of the leaf, so we exchange, evaporation (E) and stomatal
recieved data in every 3 minutes for each given conductance (GS).
solution. (C°) – Inp1 – LT1. Evaporation is a phase transition from liquid to
We used the same procedure for measuring the gas (water vapors) usually occurring on the
quantity of water flowing through the strain: surface. In case of the living organisms this
using a device attached to the strain we phenomenon is called evaporation, transpira-
measured this quantity (units) Inp12 – SF-5. tion. A gas analyzer consists of a digital
2. Digital caliper (Mitutoyo). Diameter monitoring unit and a unit of measurement. The
measurement was carried out daily with a most important part of the unit of measurement
digital caliper (Mitutoyo) taking into account is a particle which can be sealed and measures
the influence of preservatives (in mm) on the evaporation on the leaf surface. This part of
blooming. In case of the hydrangea we chose the analyzer contains sensors which measure
one flower from each vase and measured 3 temperature, humidity inside as well as photon
flowers every day. From the Alstroemeria we flux density on the leaf surface (light intensity).
measured one thread from each vase with all So we chose an adequate leaf from each vase,
the flowers on it (5 paces). placed the particle sensors on the leaf and read
3. Hansatech Fluorescence Monitoring System. the data on the display after the values were
Currently this is one of the most modern stabilized: E (Transpiration Rate) refers to
procedures for real time monitoring which does evaporation, GS refers to stomata conductance
not affect or destroy the plant; the procedure (Fodorpataki, 2010).
can be applied on the plant in its natural 6. Video camera. Using the Sony Steady Shot
environment with a test-retest reliability within Camera DCR VX 2000 PAL we could record
a short period of time and high sensitivity daily, hour by hour the changes occurring in
changes in photosynthesis. alstroemeria the data being processed later. The
video camera is an important part of the
334
experiment because it shows and illustrates the Leaf temperature was recorded and measured
results spectacularly. by the Phyto-monitoring system. The values of
Measurement of water consumption. Each vase the administrated solutions tend to be close. Air
was labeled indicating the type of preservatives temperature ranges from 22,5 – to 24,4°C and
used and also used a scale on the vase, so we leaf temperature gradually approach air
could see the daily water consumption. In order temperature values.
to avoid evaporation respectively to reduce
evaporation to the minimum we wrapped the
vases in a double layer of foil.

The laboratory was monitored by the Phyto-
monitoring system and GTH 2, so the humidity
of the laboratory varied between 13,5 – 46%.
Water temperature shows a close correlation
with the values recorded in air, ranging from 22
– 22,75°C. Leaf temperature started being
lower than the air temperature (0,5°C), but
gradually increased towards the end along the
wilting process.
Figure 3. Water consumption dynamics
We noticed an increased water consumption in

the case of the Alstroemeria as well, especially
with Chrysal and Bioplant. Chrysal consumed
2470 ml of water in 19 days, Bioplant 2290
ml. Oasis consumed 1820 ml, Control 950 ml
and Sapientia 770 ml of water.
Figure 1. Ambient conditions during the experiment
Figure 4. Daily water consumption
We filled the vases on the first day of the

experiment, so we did not register any water
consumption on that day. Bioplant was in the
first place with a daily water consumption of
30-250, the highest daily intake was recorded
on the fourth day (250 ml). It is followed by
Figure 2. Leaf temperature
335
Chrysal where daily consumption ranges from prematurely. Bioplant had difficulties in
110-225 ml. Control consumed between 30-150 blossoming but eventually did bloom.
ml, Sapientia between 10-100 ml and Oasis
between 20-150 ml of water. We noticed a
dramatic increase in water consumption in the
last day before wilting.
By applying Games-Howell test we found
significant differences between Chrysal,
Bioplant, Oasis and Control, Sapientia.
Figure 7. The potential quantum effect of the leaf
Ratio Fv/Fm indicates the maximum degree of

use of light in photosynthesis. Values below
0,75 in this report indicate disturbances in the
use of light. The graphic shows that this ratio
remains constant only in the case of Bioplant
and Chrysal. On day 11 Control drops below
Figure 5. Water quantity in the stem this value, Oasis on the 12th day and Sapientia
on the13th.
The water amount in the stem was measured by Games-Howell test shows significant
the Phyto-monitoring system. Figure 5. refers differences between Chrysal, Bioplant and
to water quantity values and they show Sapientia.
significant variations among the different
solutions.
Figure 8. Vitality index
Vitality index of the photosynthesis is the

Figure 6. Flower diameter measured in Alstroemeria
parameter most sensitive to variations in
We measured flower blooming on a daily basis. environmental factors. Photosynthetic devices
This procedure is to indicate the extent of and stop measuring when close to value 0 (zero).
the pace (speed) of blooming. In case of This happened on day 11 in the case of Control,
Chrysal and Oasis the flowers started then on day 15 in the case of Oasis, and on day
blossoming going through its every stage, 17 in the case of Sapientia. Using the Games-
Control on the other started the wilting process Howell test we found significant differences
336
among all the administrations, except for Oasis Stomatal conductance indicates the operation of
and Bioplant. the stomata. Measurements were made by the
Ciras 2 system.
Values are consistent with water consumption
and the values measured in the strain Bioplant
singles out in this respect followed by Oasis
and Chrysal. Sapientia and Control show weak
results. After applying the Games-Howell test
results show major differences between
Chrysal, Bioplant and Oasis, respectively the
Control and Sapientia solutions.
CONCLUSIONS
From flowering point of view in the case of the,
Alstroemeria we have reached the best results
Figure 9. Basic fluorescence with the help of the Bioplant preservatives,
closely followed by the Chrysal and then Oasis.
Basic florescence shows the degree of The physiological aspect of the flowers in the
organization of the antennae pigments in the Bioplant treatment were better than that of
tilacoide membranes in the chloroplasts of the other flowers. At the end of the experiment
leaves and the degree of energy transfer these flowers were still alive, so their vase life
between the antennae. If there is a deficiency in got 12 days longer. The Chrysal prolonged the
the energy assimilation, the plant tries to vase life with 9 days, and the Oasis with 6
compensate by the growth of rearranging days.
pigments antennae. The phenomenon was
Expenditures for the purchase of these
evident in all three samples: Bioplant, Sapientia
solutions are worth all she money because the
and Oasis. Chrysal and Control showed
effects are clearly visible. Compared to the
balanced behavior.
control, Bioplant and Chrysal solution have
almost doubled durability of cut flowers in a
vase.
REFERENCES
Fodorpataki L.,2010. Növényélettan és ökofiziológiai
laboratóriumi gyakorlatok, UBB, Cluj Napoca.
Horváth Zs., 2001. Virágkötészet. Mezogazdasági
Szaktudás kiadó, Budapest.
Klincsek P., 1990. Virágköto kalauz. Zrínyi Nyomda
kiadó, Budapest.
Szabó J., V.Hegyi I., 2005. Virágköto iskola. Mezogazda
kiadó, Budapest.
Schmidt G., 2001. Növényházi dísznövények
termesztése. Mezogazda kiadó, Budapest.
The Beauty of Chrysal, 2009. CHRYSAL Premium
Figure 10. Stomatal conductance Flower care. SUM és TÁRSA KFT, Budapest.
337
STUDY OF APPLYING DIFFERENT TREATMENTS ON CUT HYDRANGEA

AND THEIR INFLUENCE ON THE SHELF LIFE
Szidónia KOSZEGHI
Sapientia University Department of Horticulture, 1/C, Calea SighiƔoarei, 540485, Târgu MureƔ,
Romania
Abstract
Flowers have an important role in our lives. They have been part of our celebrations since the beginning of time. Being
associated to many occasions and events, they express a range of feelings and atmosphere. Flowers give us joy, they fill
us with a sense of peace and purity, and in time of sorrow they bring comfort and relief. Their beauty can light up our
darkest days. Our ancestors used flowers as the symbol of fertility and renewal. Flowers can be given as a gift almost
any time and to anyone. Most people, women in particular, have a special talent in choosing flowers and offering them
as a gift. In any culture or civilization flowers have always been a comforting presence for mankind. Objectives: The
purpose of my thesis is the prolongation of the lifespan of the cut Hydrangea. During our experiment we’ll analyze the
effect of some Hungarian and Dutch floral preservatives on the Hydrangeas. The results will then be compared, while
monitoring the life processes of the flowers in question.
Key words: cut flowers, Hydrangea, vase life, Bioplant, Chrysal, Oasis.
INTRODUCTION surface tension reducing substances (increases

water absorption) (Schmidt, 2001).
The lifespan of the cut flowers is a genetic
The proper nutrient for cut flowers contains the
endowment, a feature specific to the species
following: water softener, pH regulator, water
(Horváth, 2001). Scientific knowledge offers
absorption increaser, nutrient (The Beauty of
the possibility to prolong the lifespan of the cut
Chrysal, 2009).
flower. We can assure the undisturbed life
Different bacteria and fungi can quickly spread
process of the cut flower by means of floral
in the water of cut flowers. The greatest
preservatives and salts (Klincsek, 1990).
damage caused by them is the clogging of the
Basically any preservative should have the
wood tissue, but they also present other risk
following ingredients: nutrients (proteins,
factors such as the production of toxins and
mainly simple sugars), disinfectants against
ethylene. Most disinfectant products on the
micro-organisms, growth regulator substances,
market contain 8-hydroxy (8-HQ) or its salts.
surface tension reducing substances (increases
Silver salts have also a bactericidal effect.
water absorption) (Schmidt, 2001).
The features of silver thiosulphate (STS) are
The organic materials thus produced during the
more favorable: it successfully prevents the
transformation – assimilation-in the leaf, are formation of ethylene and its bactericidal effect
partly used for the plant structure, another part operates within the tissues. Of all the
is dissolved during breathing and internal compounds, the most often used in floral
energy producing, then eliminated (as water, preservatives are organic acids (citric acid,
oxygen, carbon-dioxide, ethylene, etc.), or ascorbic acid, tartaric acid). Citric acid reduces
stored. From our point of view the stored the pH of water, improves water absorption and
organic materials are the most important reduce, the risk of clogging of wood tissue.
(Szabó and Hegyi, 2005). Floral preservatives contain mineral salts, often
Basically any preservative should have the in the form of KCl, NaCl, Ca (NO3) 2. Na and
following ingredients: nutrients (proteins, Cl have toxic effects on cells, therefore we use
mainly simple sugars), disinfectants against them only in low concentrations. Various metal
micro-organisms, growth regulator substances, salts (Mg, Cu, Al) significantly improve cut
flower longevity. The simplest preservative is a
339
solution known as AKN. Content: potassium- using a device attached to the strain we
ammonium sulfate, or alum (A), potassium (K) measured this quantity (units) Inp12 – SF-5.
and sodium chloride, or table salt (N). 2. Digital caliper (Mitutoyo). Diameter
Preparation: Dissolve in 1 l of water 0.8 g of measurement was carried out daily with a
alum, 0.3 g of 40% potassium and 0.2 g table digital caliper (Mitutoyo) taking into account
salt, add 10 to 15 g of sugar beet (Schmidt, the influence of preservatives (in mm) on
2001). blooming. We chose one flower from each vase
and measured 3 flowers every day.
MATERIALS AND METHODS 3. Hansatech Fluorescence Monitoring System.
The experiment took place at the University The induction of chloro-florescence signals
Sapientia, the Faculty of Technical and Human emitted depends on the vegetative state of the
Sciences in Târgu Mures in the laboratory of plant, so that gives information about the
effects of different environmental factors on
ornamental plants.
plants (Fodorpataki, 2010).
On 18th May 2011 we received 14 pots of
We selected a leaf from each vase, applied the
Hydrangea macrophylla from the local
clips and allowed them to stay in dark for 15
greenhouse. On the same day we cut them.
minutes. Meanwhile the process of
After preparing the solutions we put 7 of the
photosynthesis in the selected samples stopped,
flowers in each vase. They faded on June 2nd,
they had become dark-adapted.
so the experiment lasted 16 days.
After applying the measuring device on the
During the experiment we used three of the
clips we read the data on the display:
best known solutions used for conservation,
-Fo – minimal level of fluorescence,
control water and a solution developed by own
recipes (sucrose and chlorine). The different -Fm – temporary maximum fluorescence,
solutions in the vases were carefully labeled. -Fv/Fm – maximum or potential quantum
Floral preservatives used in the experiment: performance,
-Chrysal Clear Rosa-Dutch liquid product, -Fs – steady state chloro-fluorescence,
-Floralife Fresh Oasis-Dutch granular product- -Fm’ – modulated maximum fluorescence, PS II
contains 94% sugar (dextrose), 3,8% citric acid, – actual or effective quantum performance.
1,7% of different salts and 0,5% preservation 4. GTH 2 device. Carbon-dioxide, relative
solution, humidity, temperature parameters were
-Bioplant-Hungarian product in granular form measured twice a day: in the morning at the
containing mineral salts and disinfectant agents beginning of the program and in the afternoon
against decay. at to end of it. We used the GTH 2 device,
Content of the other two vases: which makes it possible to measure the three
-Sapientia-own recipe containing 50 ml of parameters simultaneously.
chloride and 30 g of sugar, 5. Ciras 2-Measuring stomatal conductance is a
-Control-tap water. system which measures leaf gas exchange,
The equipment used. evaporation (E) and stomatal conductance
1. Phyto-monitoring (PhyTech) system is a (GS). So we chose an adequate leaf from each
modern observation tool which recorded the vase, placed the particle sensors on the leaf and
following data throughout the experiment: air read the data on the display after the values
humidity (%) – Inp9 – RHS-2, air temperature were stabilized: E (Transpiration Rate) refers to
(°C) – Inp8 – AT1, temperature of the water in evaporation, GS refers to stomata conductance
the vase (°C) – Inp7 – ST-22. (Fodorpataki, 2010).
We chose a leaf from each vase, put a plastic 6. Video camera. Using the Sony Steady Shot
sensor on them for 9 minutes/day which helped Camera DCR VX 2000 PAL we could record
us measure the temperature of the leaf, so we daily, hour by hour the changes occurring in
received data in every 3 minutes for each given Hydrangea the data being processed later. The
solution. (°C) – Inp1 – LT1. video camera is an important part of the
We used the same procedure for measuring the experiment because it shows and illustrates the
quantity of water flowing through the strain: results spectacularly.
340
Measurement of water consumption. Each vase Leaf temperature was recorded and measured
was labeled indicating the type of preservatives by the Phyto-monitoring system. There seems
used and also used a scale on the vase, so we to be a similar tendency among the floral
could see the daily water consumption. In order preservatives applied. Nevertheless, we noticed
to avoid evaporation respectively to reduce differences in the order of wilting: first, on the
evaporation to the minimum, we wrapped the 9th day sample Control took ambiental
vases in a double layer of foil. temperature (21°C), then on the 12th day sample
Sapientia and on 13th sample Oasis followed.
RESULTS AND DISCUSSIONS Bioplant withers after 14 days. Only sample
Chrysal maintains its beauty throughout the
Humidity in the lab was monitored by the
experiment.
Phyto-monitoring system and GTH 2, so it
varied between 43-52%. Water temperature
showed a close correlation with the values
recorded in air, ranging from 22 to 25°C. Leaf
temperature started as being lower than air
temperature (by 0,5 to 1,5°C), but gradually
increased towards the end of the experiment as
withering set in.
Figure 3. Water consumption dynamics
The highest water consumption was recorded in

the experiment especially with Chrysal which
consumed 1680 ml of water in 16 days. Then
followed Sapientia and Control with a
consumption of 700 ml of water and finally
Bioplant consumed 650 ml and Oasis 600 ml of
water.
Figure 1. Ambient conditions during the experiment
Figure 4. Daily water consumption

Figure 2. Leaf temperature
341
As shown in the figure, Chrysal is on the top Instead, those in Control and Sapientia had a
with the highest values indicating daily water slow opening.
consumption: from 80-150 ml. Using the SPSS
statistical program, the Games-Howell post hoc
test showed that water consumption
significantly increased in case of Chrysal in
relation with the other solutions. The highest
amount was recorded on the ninth day, when it
was 170 ml. Control consumed daily from 20
to 100 ml of water, Sapientia between 30 to
110 ml, Bioplant between 20-80 ml, and Oasis
between 20-100 ml.
Figure 7. The potential quantum effect of the leaf
The relation between Fv/Fm stands for the

maximum degree of use of light in
photosynthesis. Values below 0,75 in this
report indicate shortcomings in the use of light.
The graphic shows that the quantity of light
used remains almost constant throughout the
experiment. Only values from sample Control
drop below the average on day 6. In this case
the Games-Howell test does not show
Figure 5. Water quantity in stems
significant differences between solutions.
In this process there is a general tendency
among the solutions applied and the order of
wilt: on the 9th day-Control, on the 12th day-
Sapientia, then after on the 13th day Bioplant
and Oasis.
Figure 8. Vitality index
Comparing Control with the other solutions

applied we found that all of them have higher
vitality indices.
Photosynthetic devices stop when the values
Figure 6. Flower diameter are close to 0 (zero). So it happened on day 10
in the case of Control, then on day 13 in the
Hydrangeas treated with Chrysal, Bioplant and case of Oasis, and on day 15 in the case of
Oasis opened quicker and fully to 8-9 days. Bioplant and Sapientia. Using the Games-
342
Howell test we did not find significant differen- using the Ciras 2 system. Values tend to be
ces between the administrations. consistent with water consumption and the
values measured in the stem. Chrysal stands out
in this respect, followed by Control, but the
latter gives up after the 9th day. Bioplant also
shows potential till day 13. Oasis lasts until day
12. After applying the Games-Howell test the
results show major differences between the
solutions especially with Sapientia, however
Chrysal and Bioplant show similar results.
CONCLUSIONS
From flowering point of view in the case of the,
Hydrangea we have reached the best results
with the help of the Chrysal preservatives,
closely followed by the Bioplant and then
Figure 9. Basic fluorescence Oasis.
The physiological aspect of the flowers in the
On the 6th day Control, on the 8th Oasis, and on Chrysal treatment were better than that of other
the 10th Bioplant values show a sudden flowers. At the end of the experiment these
increase, then fall dramatically. It senses flowers were still alive, so their vase life got 10
deficiency in energy assimilation, thus trying to days longer. The Bioplant prolonged the vase
compensate by increasing the antennae pigment life with 8 days, and the Oasis with 6 days.
organization. Chrysal and Sapientia did not
indicate such a deficiency. This time we Expenditures for the purchase of these
applied the SPSS Tukey test which revealed no solutions are worth all she money because the
differences between doses. effects are clearly visible. Compared to the
control, Chrysal and Bioplant solution have
almost doubled durability of cut flowers in a
vase.
REFERENCES
Fodorpataki L., 2010. Növényélettan és ökofiziológiai
laboratóriumi gyakorlatok, UBB, Cluj Napoca.
Horváth Zs., 2001. Virágkötészet. Mezogazdasági
Szaktudás kiadó, Budapest.
Klincsek P., 1990. Virágköto kalauz. Zrínyi Nyomda
kiadó, Budapest.
Szabó J., V.Hegyi I., 2005. Virágköto iskola. Mezogazda
kiadó, Budapest.
Schmidt G., 2001. Növényházi dísznövények
termesztése. Mezogazda kiadó, Budapest.
The Beauty of Chrysal, 2009. CHRYSAL Premium
Figure 10. Stomatal conductance
Flower care. SUM és TÁRSA KFT, Budapest.
Stomatal conductance indicates the way the

stomata operate. Measurements were made
343
PLANNING A LOW COST LANDSCAPING STUDIO AS A CAREER START

FOR YOUNG PROFESSIONALS
Alexandru Paul LAZAR-BÂRA

Abstract
Despite the market opportunities, dramatically low ratios of the Romanian landscape architecture graduates choose to
start private businesses in their professional field. In an attempt to improve these facts, the present paper provides some
of the start-up data required for any business plan. Following a brief market analysis there are identified the main
design and counseling jobs that a small landscape studio should be able to perform. The personnel requirements, the IT
infrastructure (hardware and software) as well as miscellaneous equipment scheme are configured for minimum start-
up costs. The medium financial indicator of the landscaping specialist work-hour is calculated after integrating the
liquidation period of the studio assets at 1/3 of their usage expectancy and the general benefit ratio at 10%. In
conclusion, the landscape architecture students are advised to gather up the start-up sum for the rewarding business
that they are preparing for.
Key words: business management, landscape venture, residential landscaping, Romanian market, studio infrastructure.
INTRODUCTION with consultancy services targeted at public

administrators or public services contractors
This paper addresses the landscape architecture
that might require landscape marketing
graduates that are looking to develop
expertise (Russel, 2010), mainly for
independent careers in their area of expertise in
commercial or political-aimed manipulation
Romanian market context, in support of their
efficiency (Lazar-Bâra, 2011, 2012).
business plan building effort (Stark, 2003).
The mass group of the residential services
Romanian landscaping market, 10 years after
consumers consist of several market segments
the field professionalization start, still has
(Thilmany, 2008) by demographic and cultural
together the goods and the bads of the new-
considerations, but they share common lifestyle
found niches:
features and buying behaviour. They are
For landscape design, the customers are few
usually people between their 30’s to 50’s,
but generally wealthy these days, as it was the
socially active, living in suburbs, strongly
case 10 years ago;
connected with city life, travelling abroad on a
The landscape architecture and planning
regular basis, having above average self-image
branches target the public sector, but this is
standard, highly vulnerable to marketing
hardly a feasible choice for a start-up venture,
techniques but also relying on their friend’s
since abusive national regulations favour new-
advice, they would rather go for top advertised
comers exclusion from public auctions; private
products than investigate proposals based on
enterprises occasionally require landscape
quality assessments. Their culture concerning
expertise for marketing purposes, but occasions
environmental and landscape substance is not
are few and inexperienced small firms
involvement are rarely accepted; above the general society’s level –
Landscape restoration is a shallow niche to unsustainably low – while their formal
point at, since historic gardens and parks are expectations concerning the gardens they pay
scarce in this country. for are high, since their landscape quality bench
This state of facts leaves the new businesses marks are built mostly on short exotic
with the small to medium sized residential escapades or based upon soft media’s visual
landscaping opportunities, extended at best marketing. They pay for landscape services
rather for social image or property value
345
improvement, since they rarely can appreciate regional planning – still unavailable to most
the intimate garden living. landscape professionals
Unlike the case in western cultures, they are Compared to constructions, real estate,
rarely willing to sacrifice personal comfort or architecture or public services, this is a small
change lifestyle in support of social or sector in economy considering the financial and
environmental sustainability, since they rarely human resource requirements, but the market
pay for anything that fails to provide immediate potential on middle to long term perspective is
benefits. high.
Despite the narrow opportunities it offers these
days to new-comers, landscaping market MATERIALS AND METHODS
generally follows social development, and
In order to plan a sustainable start kit for a
Romania is slowly but steadily going west
small residential landscaping studio, the paper
with consumer behaviours’ changing under the
will rely on a synthetic market analysis –
model’s pressure. In Sweden for example, the
focusing on present state, but also depicting
concern for climate change is increasingly
tendencies.
determining common people counteracting
Based on landscape practitioners’ empirical
attitudes, up to lifestyle changes (van Borgstede
observations, the Romanian landscape
et al., 2013). It can be presumed this is also a
predictable trend for Romania, just as it is right consumer’s buying behaviour will be analyzed
to anticipate civic and social responsibility using the SWOT framework (Russel, 2010)
increases in the following decades. (Table 1).
As a well organized western landscape market The market analysis shows several niche
reference, the USA case is well illustrated in features (Stark, 2003) : the low customer and
the book of Walter Rogers – The Professional subject diversity define an easy targetable
market for residential landscaping, with
Practice of Landscape Architecture: a complete
accessible clients; the business growth potential
guide to starting and running your own firm.
is only restricted by the national economic
The national context presented in the book
should a bench mark for many European backward state – while global perspectives are
countries in terms of professional regulations, quite positive, considering the expertise
prospects, responsibility and revenue as requirements to mitigate at least the
compared to the incomes in other professional environmental threats (Heinberg, 2011); there
fields. In the USA, just as in the other old is no established market leader and the ways
landscaping tradition countries, the private- are open to new comers.
sector clients are more diverse than in To sustainably approach this design and
Romania, ranging between private companies, counseling niche, the landscape architecture
NGO-s and individuals with various social and graduate’s competencies should be solid in the
cultural backgrounds (Rogers, 2011). The fields of landscape composition, environmental
landscape business usually don’t limit to these, sciences, plants and planting design, building
approaching most of the areas that a landscape materials, garden history and design, visual and
computer representations, project management,
architect is prepared to cope with – according
small business marketing and management.
to Walter Rogers, in 2011 there were 12 main
Further knowledge is required for the
categories: sustainability-targeted projects;
entrepreneur to be able to cut costs on
international projects; community development
transportation, IT, legal and accounting
– that used to be a niche in Romania until the
services to fulfill the client’s price expectation:
2008 real estate market collapse; streetscape
driving license, building and ensuring basic
contracts – also a declining market, but owing
maintenance to the IT infrastructure, basic
mostly to the EU financing changes (Lazar-
knowledge of market, environmental, building
Bâra, 2012); parks and leisure; private and urban development regulations, trademark
businesses site developments; urban and issues as well as basic accounting skills.
346
Table 1. Buying behaviour of the Romanian single family residential landscaping customers
Strengths (favouring quality / Weaknesses
Opportunities Threats
competition) (unsustainable)
Economic (property
Personal (species aesthetic Western culture
value investment); Consumerism; General
preference / nostalgia); offensive; middle class
Motivations social status; fashion; and environmental
functional (sanity/ security/ protection and
keeping family busy at culture decline
healthy food/ privacy) development policies
home
Glossy media and Decrease of foreign
Internet; friends; garden fairs books; highway and Foreign fairs and public pressures toward the
Offer and cultural events; university mall advertising; competitions; national opening of the market
prospecting and professional body contractor’s and market transparency would consecrate
recommendations reseller’s increase landscape formalism
recommendations and mediocrity
Tourism promoted
Instinct and logics (rare); landscapes (exotic or
National landscape Exotic holiday
Customer local/ regional aesthetic national); commercial
references – promoted for landscapes; foreign
bench- landmarks; personal brochures and
tourism support; foreign landscaping materials
marks experience; professional advertising induced
reference aids advertising
advice references;
miscellaneous advice
Contractor’s
Service reliability; personal Site events (small preferences; joined
Advertising; graphic
connection; design coherence; disasters, sanitary or commercial proposals of
quality of the designs;
business portfolio – similar phytopathological contractors and
design speed –
Buying tasks, on similar emergencies, various landscape architecture
regardless the subject
decision sites; environmental, social, building phases, offices; the businesses’
complexity; business
urban and cultural occasional functional premises accessibility;
portfolio – public
commitment; price peaks – weddings, seasonal preference
clients; lowest price
justification receptions, new fauna etc) (usually on spring,
before Easter)
The business plan for a starter – especially on a To build the minimum asset list needed in a
niche market – is not facultative (Stark, 2003). residential landscaping studio, the paper
Written in a synthetic manner, it should contain analyses the firm tasks that require most of the
at least the following (Stark, 3003; Bangs Jr., businesses’ resources in Romanian context, as
2005) : a market analysis – structure, requirement drivers:
competition, tendencies; marketing strategy – - Marketing: market identity – management
operable niches, business identity, pricing, decision followed by promotional material’s
promotion plan-client reaching, sales potential; production; advertising and contact
a financial analysis – expenses/earning for one maintenance – web page construction and
year, liabilities/assets’ values; a financial maintenance, paper and social media
strategy – collections, insurances and back-ups presence, public events presence – physical
(fundamental for Romanian starters), cash- presence mobile assets (banners, roll-ups,
flow, investments; a general business strategy; kiosks and business fair stalls, mobile
the technical operations’ planning – contracts multimedia assets); business headquarters
and management, intellectual property (the design of the work spaces and of the
protection, licensure (for connected fields), reception areas, architectural signaling)
project management and work flow, asset’s - Landscape studio work (production) :
maintenance; human resource strategy – skills, documentation, base plan assembly,
tasks and responsibilities need and forecasts, analysis, general proposal – blue-print
labor costs, performance, team management. production and client presentation material
Specific to a small landscaping business is the (Cantrell et al., 2010), opinion
flexibility requirement – since design offices documentation and contractor required blue-
should capitalize on the larger projects’ prints, product specifications and technical
collaboration opportunities. memorandums.
347
- Field work: documentation visits – site 2013), with minimum software investments for
measurements, picture taking / movie CAD and graphics stations:
capturing, soil and plant identification -The 1st station: management, accounting,
and/or sample collection; client interviews – estimating, print server, business archive, back-
command outlines formulation, contract upGNU Linux based Hardware – HP Pro
discussions, proposal blue-print discussions; P3500 MT Sandy Bridge G550 2.6GHz 4GB
set-up assistance – plan picketing / on-site 500GB GMA HD Free Dos + Monitor HP 20
blue-print adaptation, input material quality inch W2072a: 1800 RON (price.ro, 2013)
control, subcontractor’s monitoring – -The 2nd station: CAD, graphic design, 3d
irrigation (Smith et al., 2010), field works presentations, data storage Windows based-
coordination; field monitoring. OS=650 RON, antivirus=400 RONHardware-
To fulfill these tasks, the basic productivity HP Pro 6300 MT Intel Core i5-3570 3.4GHz
assets are computers – hardware and software 4GB 500GB AMD Radeon HD 7450 1 GB:
infrastructure. 3500 RON (ibd.) + monitor LED DELL
A starting venture with the minimum personnel UltraSharp U2713HM 27 inch: 2500 RON
scheme should provide each of its employees (ibd.) Commercial licenses: Brics Cad Pro – all
independent working conditions to maximize in one, v. 12: 600 euro; Corel Graphics Suite
flexibility. X5: 180 RON (ibd.); 3d studio max: 3500 $;
The following IT asset categories were GNU licensed software: Open Office Suite,
identified: Dryad (Plant Generation Software packages,
1. Operating and security systems 2013)
- Linux / Windows + antivirus -The 3rd station: CAD, graphic design, data
2. Productivity tools (office) storageGNU Linux basedHardware-HP Pro
- Text processors, spreadsheet tools, slide- 6300 MT Intel Core i5-3570 3.4GHz 4GB
show editing 500GB AMD Radeon HD 7450 1 GB: 3500
3. Data and management tools RON (ibd.) + monitor LED DELL UltraSharp
- data base tools, encryption and cloud U2713HM 27 inch: 2500 RON (ibd.) GNU
access software: Open Office Suite, Gimp
4. Communication and multimedia tools etcCommercial licenses: Brics Cad Pro linux –
5. Computer aided design (CAD) tools all in one, v. 12: 600 euro-The 4th station –
6. 2d graphics and interactive design tools mobile: field work CAD, graphic design, basic
7. 3d presentation tools 3d presentationsLinux based Hardware-Laptop
8. Project management and field works Asus 17.3'' K73SD-TY047D Core i5 2450M
assistance tools. 2.5GHz 4GB 750GB GeForce GT 610M 1GB:
For each of these categories there were 2500 RON (price.ro, 2013) GNU software:
analyzed the possible options according to the Open Office Suite, Gimp etc Commercial
following criteria: price, real-life licenses: Brics Cad Pro linux – all in one, v. 12:
productiveness (following empirical analysis 600 euroConsidering the general lifetime of the
carried out on professional Romanian equipment at 3 years and the desired liquidation
landscape architects) and flexibility. at 1/3 of this time span, the IT investments
should ideally generate incomes to cover all
RESULTS AND DISCUSSIONS business investments in the first year. The
work-hour fee of a landscape studio could
The work-hour cost estimations following the
therefore be found using the following formula:
IT infrastructure analysis reveals that public-
(IT + I+X+W) / 2320
license software solutions approach is more
-Where IT is the IT total investment –
efficient on the short term, but it lacks
flexibility. equivalent to ˜ 31000 RON in the present case-
Start-up investment estimation for the lowest I represents current office expenses (rent,
budget would basically approach the GNU maintenance, utilities, consumables) -X stands
licensed software (GNU Operating System, for unexpected expenses-W are the company’s
wage expenses-2320 represents the number of
work hours for an employee in one year. To
348
conclude the presented case, with known yearly Landscaping studio infrastructure is the easiest
and unpredicted expenses of 18000 RON and 4 issue, even for a small business. Business
people working – involving 24000 RON / year connections and basic experience are required
wage expenses, the work-hour reference price to minimize start-up risks. Technical
for landscape architecture services reference competence and professional ethics are basic
should be 31.47 RON.Printing and presentation sustainability conditions.
documents as well as transportation and field- The work-hour reference price for landscape
related expenses, just as documentation costs architecture services should stand as a guide-
were not included. They should be counted mark for clients looking for a fair business.
separately in the deals closed by the starting
venture.Despite appearances, landscaping REFERENCES
business is tricky considering the complexity of
*** 2013. GNU Operating System.
the market features, the human and technical http://www.gnu.org/licenses/ (2013/02/28).
issues, the home trade opacity and the hostile *** 2013. Price.ro. http://www.price.ro (2013/02/28).
legal and administrative environment. Previous *** 2013. Plant generation software packages.
experience in the business that graduates are http://vterrain.org/Plants/
venturing into is a way of painlessly Bangs Jr., D. H., 2005. Business Plans Made Easy.
Entrepreneur Media Inc, USA, p. 83-174.
anticipating the specific challenges, know van Borgstede C., Andersson M., Johnsson F., 2013.
competition and build key-connections with Public attitudes to climate change and carbon
potential clients and promoters, lawyers, mitigation – Implications for energy-associated
accountants, even bankers, public behaviours. Energy Policy (in press).
administration, potential partners, contractors, Cantrell B., Michaels W., 2010. Digital Drawing for
Landscape Architecture: Contemporary Techniques
materials purveyors – especially plants and
and Tools for Digital Representation in Site Design.
stone, potential employees, architects, John Willey & Sons.
engineers and various specialists. Branch Heinberg, R., 2011. The End of Growth. New Society
experience as employees before turning into Publishers. www.endofgrowth.com chapter 7: Life
employers is otherwise recommended in after Growth.
King, R., 2005. The Ugly Truth About Small Business:
various industries (King, 2005; Thilmany, 50 things that can go wrong and what you can do
2008), considering that cumulated bankruptcy about it. Sourcebooks, Illinois, p. 55-66.
risks of small business start and that of the Lazar-Bâra A.P., 2011. Round-About by CaƔin Church.
niche market approach. Cluj Napoca.
Lazar-Bâra A.P., 2012. Landscaping for Social
CONCLUSIONS Manipulation. Warsaw.
Lazar-Bâra, A.P., 2012. Landscaping the environmental
The shallow client profile diversity shows the responsibility – village parks and EU money.
deep gap between the Romanian and the Craiova.
Rogers W., 2011. The Professional Practice of
western landscape markets, and the long way
Landscape Architecture: a complete guide to starting
that lays ahead the new ventures. and running your own firm. John Willey & Sons. P.
The complex professional grounding that 53 – 148.
landscaping students acquire in college might Russel E., 2010. Fundamentals of Marketing. Ava
Publishing, Lausanne, p. 140-143.
be considered excessive when the business Smith J.G., Hinze J., 2010. Construction Management.
target is individual private landscaping – the Subcontractor Scopes of Work. CRC Press, Taylor &
prevalent employment niche – but it should Francis Group, Boca Raton, USA. p. 399-401.
provide the graduates enough flexibility Stark J., 2003. Landscape Business Planning Guide.
Cornell Cooperative Extension.
to handle exceptional contracts thus ensuring http://dyson.cornell.edu
business’s sustainability (King, 2005; Stark, Thilmany D., 2008. What are Niche Markets? What
2003). Furthermore, the landscaping market Advantages do they Offer? Colorado State
will hopefully approach the western diversity University.
soon enough, which will make human
resources a major national issue.
349
POLITICAL LANDSCAPES AND URBAN IDENTITY. BUCHAREST’S
DEMOLITIONS AND WORLDWIDE CORRESPONDENCES
Alexandru MEXI, Ioana TUDORA

Landscape Architecture, Biodiversity and Ornamental Horticulture Department,
59 Blvd. MĉrĉƔti Blvd., 011464, Bucharest, Romania
Abstract
A city is made up by its people and by its architectural, urban characteristics. Bucharest lost most of its central
historical sites during the last decade of communism. The shifts of paradigm of those days shift the entire history of a
city, ripping away the historical, cultural and social center of a European capital. Even if the turnovers in Bucharest
are never to be seen elsewhere in the world, the political decisions and expression that lead to a new urban landscape
construction have correspondences in many other cities of the world, most of them marked by a similar history, thus
totalitarian systems. In order to better understand the scale of what J.B. Jackson called the Second Landscape, at its
most extreme expression, our paper will present the effects of totalitarian political systems on various urban landscape
in the modern period, comparing the scale of the communist demolitions in Bucharest and the corresponding urban
tragedies in cities like Berlin, Rome, Paris, or Pyongyang. The study reveals similarities between cities like those
mentioned earlier and Bucharest in terms of political construction of the urban landscape, the landscape as a political
tool, the impact of these politics on historical cities and their “absorption” by the daily life landscape.In order to
understand the scale of the tragedy and its consequences in the future it is important to look for examples similar to the
one given and to search for answers that may solve the problems that the ruins of the late communism era left to the
capital-city of Romania. It is also important to understand how the daily spatial practices (de Certeau) are finally
engulfing and integrating the political landscape from the collective memory.
Key words: demolitions, corresponding urban tragedies, ruins, turnovers, urban identity.
INTRODUCTION Ones of the most aggressive interventions on

the urban tissues were made in various capital-
A city represents a series of layers of people
cities under totalitarian political systems. In the
that lived there. All those layers brought
frame of this article we will try to observe
significant changes in the way the city
similarities and regularities of these totalitarian
transformed over the years, but few of them left
landscapes, the outmost expressions of the
scars as deep as the ones found in Bucharest.
“Landscape Two”, not in terms of aesthetics
Many old tourist guides and historical albums
and order but in terms of imposition on a
show images of buildings or places that you
specific site (Jackson, 1984).
will never find today. Though they don’t exist
We also try to further analyse these integration
anymore, they are part of the city’s collective
of huge urban ruptures in the collective mental
memory. When the generation that has seen
landscapes and memory by daily practices,
those places in reality is gone, those pieces of
tactics and rhetoric (de Certeau M., 1990).
urban history will remain present only in books
and some filmed images, but they will cease to
speak to common city dwellers.
The human memory associates feelings with The research was conducted in the central area
places and this is why everyone remembers a of Bucharest, in the new “civic centre” of the
moment and the place where it took place. communist era and within the places nearby. A
However, if such places disappear, what is to series of short questionnaires are revealing the
happen with both one’s memory and with the variations in the collective memory
urban-collective memory? ofBucharest dwellers and the manner of
collective memory-erasing by time.
351
Also, comparative studies, concerning other a concentration of official buildings (as showed
capitals that submitted under totalitarian by part of the proposal for Bucharest or other
regimes and the modification in the urban cities realised by Sfinԑescu and others), but
landscapes imposed by political systems as slowly evolved towards a civic centre as a
well as similarities and differences of space- political and administrative centre (Rauԑĉ,
scale and style between these projects. The 2012).
study was based on a number of historical
descriptions and plans, some in situ
observations and other previous analyses
concerning the different cities.
BUCHAREST’S DRAMA
The House of the Republic was the result of the
fear that CeauƔescu felt over the 1977
earthquake, or so it is presented in the urban
mythology. Even if related to the 1977 and
subsequent studies on Bucharest, the project is
a prolongation of the old – interwar period – for
the new Senate House on Damboviԑa River (the
ancient Senate Place). The development of the
entire project during the time was exhaustively
presented in an exhibition organized in 1991 at
Dalles Hall.
As any other dictator, hoping to forever be
present in history, he wanted to build
something monumental – a new political centre
capable of holding huge masses of people that
he could control. After a series of seismic and
topographic studies he decided to build his new Figure 1. Sfinԑescu’s drawing about a separate location
centre not on the Damboviԑa benches (as the for the Senate Palace (Rauԑĉ, 2012 p. 24)
old Senate was foreseen) but upwards, on the
safest ground of the capital – Arsenalului Hill, The evolution of the house of the People and
on the southern cornice of the river. the Civic Centre during the 1980es was of such
The project, started with some modernist style kind and scale that offered a good reason for
proposals for the Republic House, developed, CeauƔescu to demolish, in the most chaotically
with the willing participation of some of the manner the most part of the city centre and to
architects involved in the project, towards a erase some of the most important and
huge urban-scale project as a new “civic emblematic buildings and landmarks, counting
centre”. It has to be said that the “civic centre” lot of Bucharest’s old churches, the Mihai Vodĉ
idea is neither a communist one. As was largely Monastery and the State Archives within it, the
demonstrated by Radu Alexandru Rauԑĉ the entire Unirii Place area – the very generator
civic centre originates in the American City centre of the city and many others. The
Beautiful Movement (Rauԑĉ, 2012). Nor in eagerness of these demolishing was explained
Romania it was a communist idea. The first by the awkward relation of the Dictator with
civic centres were proposed in the interwar the city. As “simple peasant, Nicolae
period by architects or planners that studied CeauƔescu admired and hated the capital. The
abroad, as Cincinat Sfinԑescu who studied in city was overwhelming. Though he became
Germany. Sfinԑescu developed the idea of civic absolute leader of Romania, he felt as a
centre and proposed a series of projects for stranger in Bucharest and worthless in the face
Bucharest, including the one on Senate Place of the city, a city he felt somehow hostile. The
on Damboviԑa River (Figure 1 - Sfinԑescu, House of the Republic […] was his revenge
1932). The civic centre was not initially seen as and a fortress for him to hide against a city he
could not understand (Pandele, 2009).
352
Demolitions are usually considered as normal doesn’t give any sign of reweaving in the last
acts, absolutely necessary in any urban society. 20 years.
They are the premises of new, modernising What makes The House of the People and the
urban and architectural development. Although Civic Centre the most dramatic project of the
Françoise Choay presents demolitions as a Romanian communist era is not just its out-of-
necessity, one must well analyse the situation scale dimension but also the different logic
before the demolishing being done. “On the from what was done before. Up to the 1980es
other hand, following another type of logics, the entire city was already transformed by the
but of a similar violence, they [demolitions] communist regime. During the ‘50es, in the
never stopped destroying their own patrimony. Stalinist period, the Soviet model didn’t create
They destroyed it considering it was of no impressive landscapes. Some new, relatively
further use, old, malfunctioning, no longer up- small neighbourhoods were built and the only
to-date, lack progress, lack of comfort, and, in emblematic building that was erected was the
positive terms – standing in the way of Sc‫ں‬nteia House (the centre or the communist
modernization.” (Choay, 2011) press – figure 3), a small Lomonosov
But in Bucharest’s case “many demolitions University-like that somehow succeed to
were conducted without any project, based only integrate in the 19th century urban frame
on hand gestures made by The Great Leader. without any disruption.
His gestures were firm and clear either nervous
and panicked. Projects were made after the
demolitions, only to fill the empty spaces. Their
role was to create a scenario – it did not matter
what was left behind.” (Pandele, 2009)
Figure 3. Sc‫ں‬nteia House 1952–1957 (Google images)
In the next two decades huge avenues and

boulevards were built, thus creating an entirely
new urban landscape. But these interventions
were done mostly along the ancient urban axis,
in the well-known plating manner or the huge
new assemblies were built on almost empty
lands, so, hidden behind the new city, the old,
historical one was still surviving even if in a
somehow scattered way (Figure 4).
Figure 2. The historical city and the area demolished in

order to build the House and Axis (Harhoiu, 1997, p.14)
As a result of this “monumental bricolages” a

quarter of the historical city disappeared and
another part of it rest mutilated (Figure 2). A Figure 4. Griviԑei Avenue and Balta Albĉ Assembly
huge urban fracture was thus created, (Locuinta urbana 1961-1964)
separating the north form the south and
generating a sort of “two cities in one” that So, the massive demolitions of the ‘80es
represented a shock, something that never been
353
done before. Also the speed of the demolishing Unlike CeauƔescu’s demolitions, Haussmann’s
and mostly the lack of any urban logic (that were based on principles. All the buildings that
previously was quite clear) generated a sort of were to disappear were carefully photographed
paralyse and awe. We can consider the building and measured in detail in order not to be
of civic centre project like a Shock and Awe forgotten, while on the area of the new civic
urban strategy, in the perfect logic of Blank is centre, photographing was forbidden. Also,
Beautiful („Shock and Awe are actions that Haussmann had motives for his actions and he
create fears, dangers, and destruction that are began his demolitions by founding specialized
incomprehensible to the people at large...” services at first. Baron Haussmann became,
Klein, 2007). from a destroyer a praised person. “And
worldwide correspondences Haussmann – without question, the greatest
Though the Romanian communist demolitions destroyer of our capital, as, unlike the case that
represent the biggest European urban drama he would have made a “historical centre” avant
since the last world war, this is not unique, and, la lettre and a museum, there was no alternative
in the course of history, many large scale, to this violence – he had to continue Paris as
dramatic demolitions took place in many other Philippe-August, Charles V, Francis I, Louis
countries and in all types of totalitarian political XIV and their contemporaries done before
regimes. The study is to reveal, through the him.” (Choay, 2011)
following examples that, the urban-collective
memory was seriously affected not only in
Romania, but also in other cities and countries
of the world.
Haussmann’s Paris
The 19th century Paris was almost completely
transformed, following the Napoleon III’s
London-like dream and due to the prefect
Baron Haussmann relentless works of
demolition and reconstruction (Figure 5).
Figure 6. The achievement of Boulevard Haussmann

(www.gutenberg.org)
As Françoise Choay presents it, Haussmann’s

demolitions are not singular in Paris. The
previous debatable disencumbering works
destroyed part of picturesque sceneries of the
city in order to reveal some
Figure 5. Demolition of Butte des Moulins for Avenue monuments. However, though Francoise
de l
Choay critics are well funded, the demolished
spaces were rebuilt in a most coherent way and
“The city of lights inherited a medieval they contribute to the heritage of the urban
structure, one that did not faced the needs of memory, representing – back then and today –
the 19th century. Baron Haussmann proposed a one of the most admired urban development
series of principles that were approved by the
models. Napoleon III’s vision, accomplished by
mayors. He founded specialized services that
Haussmann was such a success partly because
were later used with success. Haussmann asked
he proposed a functional urban system, one that
for the measurement and the photographing of
still works (figure 6). “Haussmann’s changes
the buildings that were to be demolished. He
find theirs most complete form in the public
chose the best professionals of each domain
squares, gardens and parks that articulates the
and asked for the pragmatic solutions.”
(Pandele, 2009)
354
old and the new parts of the city.” (Choay,
2011)
The success of Paris’s destruction and
reconstruction is related to the respect due to
major buildings of the city. Although that
Haussmann demolished some 4300 houses and
made major urban surgery, he called his critics
to name “even a single monument worthy of
interest, one building precious for its arts,
curious by its memories.” (apud Kostof, 2005).
Today Paris is considered the most beautiful
city in the world and the old pre-19th century
city is almost completely forgotten. The entire
Figure 7. Via dei Fori Imperiali making (Google images)
urban culture of 19th and beginning of 20th
century Paris replaced the past, creating the
Somehow Il Duce cannot easily be condemned,
new world-wide landmark and generating
at least not in its own time paradigm, for those
entire new layers of urban memory. And
actions because, in the logics of that period of
mostly, Paris proposed a new urban culture: a
time, his actions were justified, and he did
public space, one thus integrating the
nothing else but brought to light what it was
overwhelming Napoleon project in the city life.
seen as heritage by demolishing “unimportant”
Rome – Antiquity and Fascism
and “ordinary” buildings, also in order to
In a city as Rome almost any demolition
highlight Rome’s monuments, continuing,
supposes a destruction of history and heritage.
“The reference western example is the one of among others Michelangelo’s dreams of Spina
the Constantine Basilica of St. Peter in Rome, dei Borghi (Figure 8). If monuments and sacred
the most precious monument of Christianity, buildings were to be considered the expression
demolished in the 16th century by the will of of the past periods of history the common
Pope Leon the 10th and Julius the 2nd.” (Choay, houses were profane, unimportant and almost
“silent” documents so Mussolini states that:
2011)
The example of the Basilica is not singular in “The millennial monuments of our history must
Rome. In the fascist regime of Benito loom gigantic in their necessary solitude”, a
Mussolini, he considers that the true heritage of vision well integrated in the generalised
Rome is its antic city form and structure. disencumbering acts all around the European
Obsessed by his idea that “Rome, will again, big cities of the time (Kostof, 2005)
rule the world!” it was absolutely normal that
he would want to bring Rome to its empire
glory. In order to do this, he had to bring back
to surface the ancient city. All the relics could
now be used as propaganda as well.
Though he destroyed a large part of Rome and
thus affected the collective-urban memory,
ripping out memories and landmarks but also
Renaissance or Baroque period monuments,
Mussolini brought back into the public eye and
memory, the old urban tissue of Rome and did
not left behind an empty area (Figure 7).
Figure 8. Spina dei Borghi before demolitions (Google
images)
On another hand it should be observed that

what was considered as the “liberation” of the
antic area, in order to put forward monuments
355
as Marcellus theatre or Trajan forum was 1950, when he also estimated that he will win
doubled by a real development of Rome as a the war (Figure 9). In the centre, partially over
polycentric city, with new avenues and the river Spree, an impressive dome would
neighbourhoods but without any strong de- have been built, and it would have been named
structuration of the urban organism. It is also Volkshalle, that in an approximate translation
important to mention that all these visions were means The House of the People. The
developed by a commission formed of monumental building, measuring 290 meters
specialists like Manfredi, Giovannoni, high would have made the Reichstag a toy
Piacentini, Gerola and others, thus guarantying house, and it would have been used by Hitler to
the quality of the future city (Vasilescu, 2011). hold his speeches in front of more than 180.000
As a result, today’s Rome, a result of the people.” (Bisky, 2006)
confrontation between Mussolini’s totalitarian The project was however seized in 1943 due to
vision and the Citta Eterna, gained its past Ally bombings. Thus, Berlin escaped from the
while forging its future, both of them melted in “architectural demolition” just in order to be
an emblematic, unitary image (Vasilescu, erased by the heavily bombardments.
2011). Rome cannot be imagined anymore Another wave of demolition was deployed, in
without its antic monuments and noisy Vespas Eastern Berlin, during the communist regime.
running in-between. The emblematic Berlin – Alexanderplatz
Berlin, post-war and post-wall (transformed in an international symbol by
Berlin is a city that, despite its dramatic history, Alfred Döblin’s novel and mostly byRainer
has reborn and despite the destructions he Werner Fassbinder’s film) was one of the most
faced, he became a blooming city, one that is swarming and fashionable urban spaces of the
appreciated both by its inhabitants, and by 19th century Berlin (Figure 10). The day-life,
foreigners. The city’s memory was seriously around the Hermann Teitz commercial centre,
affected, not only once but by several huge and the night life, around the restaurants and
political projects that changed it forever. bars, was equalled only by the Potsdamer Platz
(another space that was wiped off and replaced
with a sort of mall-complex).
Figure 9. The Albert Speer Plan" - Hitler
One of the most important reconstruction

Figure 10. Alexanderplatz in 1906, foto: Max Missmann
projects for Berlin, in order to transform it in a
symbol of power, was lead by Hitler, together
During the 1960es Alexanderplatz was rebuilt in
with his “personal architect” Albert Speer. the new, modern but socialist-realist style. Thus
Hitler wanted the destruction of a vast part of it was transformed in a huge – out of scale –
the historical Berlin in order to build his centre.
pedestrian area, seen by the communist regime
“Hitler never appreciated Berlin, he saw the as the new, modern, ideologically adapted city
city as dirty and too liberal, and he was heart (Figure 11).
disgusted by the political orientation of its After the unification a new reconfiguration of
inhabitants. In consequence, trough Speer, the the space was proposed. Some skyscrapers are
fuehrer wanted to transform the capital in his still waiting for the construction while a new
vision and he estimated that he will finish by
356
commercial centre was built, knowingly an for the communist memory comprehension.
electronics megastore (Figure 12). And while we are just finishing this paper
another Berlin tragically demolition is taking
place: the Berlin wall, the historical, collective
city-scar is removed in order to give place to
commercial, private “beautification”.
But, despite the destructions, Berlin demon-
strates an incomparable aptitude to integrate its
scars and transform them in new life-generator
places. Thus it still stays as the cultural capital
of 21th century Europe.
Moscow and the stylistic indecisions
In “Project Russia – Architecture after com-
munism” we found a very interesting, although
exaggerated, quote that describes most of the
Figure 11. Berlin-Mitte, Alexanderplatz, 1966, Dick- Russian cities as being totally synonym with
Foto-Verlag
soviet or communist cities: “Russian city =
soviet city. There are huge differences between
Russian cities and European cities. Excepting
Sankt Petersburg, the Russian cities of the 19th
century were mostly made out of wooden
houses and only a handful of houses, govern-
ment buildings, churches and monasteries were
made out of stone. This meant that, in time,
very few traces of the past will survive, even in
cities with a history of over a thousand years
old. But while communism first appeared in
Figure 12. Berlin-Mitte, Alexanderplatz, 2006 Russia before entering Europe, so did the in-
http://www.stadtentwicklung.berlin.de
dustrialization began in Europe and then
extended to Russia. During the civil war, while
At the other end of the former East-Berlin the middle class stated in Central Europe, Ru-
centre a new step in the city’s demolishing took ssia was evolving in the form of dictatorial pro-
place: the intensively debated destruction of the letarian. This means that the industrialization
Palast der Republik, the communist parliament process in Russia took place exclusively during
(Figure 13). the soviet regime. The Russian city is thus the
soviet city.” (Goldhoorn, 2002)
Figure 13. Palast der Republik last traces Figure 14. Development plans for Moscow proposed by
(Google images) Le Corbusier and E. May (Quilici, 1976, p. 269)
This late demolition raised huge protest of the Moscow development, much older than the
younger and older generations that were asking communist era, was marked, during the totalita-
357
rian regime, by huge contradictions between for the party members would have been taller
two main trends in architecture and planning. than the Empire State Building and it would
On one hand the raise of the Soviet Union was have had a statue of Lenin on top. Only the
marked by the modernist avant-garde, on statue was taller than the Statue of Liberty.
another, retrograde visions were seeking for
more monumental expressions, paradoxically
inspired by the European classic architecture
(Figures 14, 15).
In 1931 the Direction of the Office for Moscow
Plan created the Project Brigades in order to
define the future development plans for the
city. Three of the Brigades were formatted by
foreigner technicians (E. May, H.Meyer and K.
Meyer) but the rest of them were soviet asso-
ciations. The projects were considered insu-
fficiently adapted to the Party’s directives being
not-realistically or not enough revolutionary
(figure 14), mostly May’s project that tried to
keep the central historical structure of the city Figure 16. Proposals for the Soviet Palace - the wining,
(Quilici, 1976). Jofan’s project proposed a 50-70m tall Lenin statue in the
In the same time classicising forms of urban top of the building (Quilici, 1976, pp. 258-259)
spaces were chosen to express the new Soviet
power and the Red Square (Figure 15) became The most impressive classic architecture was
the prime model of the Socialist square. also used for the Moscow subway while the
entire city was wiped off in order to make place
to huge neighbourhoods and huge official
buildings (Figure 18).
Figure 15. Red Square plan - 1932 (Quilici, 1976, p. 265) Figure 17. Komsomolskaya station, New Arbat Street,
Lomonosov University (Google images)
At architecture abject level the same struggle
between modernist and classicist form is to be But the new, capitalist Moscow, even if is still
observed. While some of the architects were facing totalitarian politics, became one of the
seeking for simple, modern forms, not most dynamic cities of the world and now tries,
belonging to any passed times; the politicians, with the help of Jan Gehl’s methods, to re-
as Šēusev did in 1933, were asking for more humanise its gigantic scaled spaces.
classicising forms as “indicated solution, better Beijing and the Chinese urban landscape
solution for the form and the idea, solution that Beijing, the last imperial capital of China is a
express the ideology in the most adapted form” city with a fascinating history. However, the
(apud Quilici, 1976) city went through a series of successive waves
Stalin wanted, alike CeauƔescu, to create mega of demolitions and reconstructions. With the
structures. He decided to destroy the Cathedral proclamation of The Democratic Republic of
China in 1949, the city suffers numerous
of Jesus the Saviour, in order to build a future
mutilations that can be even seen today. One of
administrative and political centre of the
the most controversial destructions was of the
country - the “House of the People” or the
Legation historical district (1856) and of
“House of the Soviets”. The House of the
several nearby districts in order to re-plan the
People was never realized. This incredible host
358
huge square Tiananmen. In order to transform
The Tiananmen square event the Gate of China
was demolished in order to enlarge the plaza
(and afterward replaced by the Mao’s
mausoleum in 1976). During the 50es the
expansion of the place continued, following
Mao Zedong’s vision who wanted to make
place for huge and enthusiastic popular mani-
festation of some half of million people. New
symbols are scattered around the place as the
Monument of the People’s Heroes, the Great
Hall of People or the National Museum of
China. “In 1958-1959, the square was expanded Figure 19. Beijing demolitions (Google images)
from 29 to 98 acres (11 to 40 hectares). The
great Hall of the People occupied the west side, In an article by Octavian Ciupitu in Curierul
a building one quarter of a mile (400 m.) long; Rom‫ں‬nesc, the author asks: “who will benefit
the Historical Museum occupied the east side. from all those concrete and glass structures that
The Monument of the People’s Heroes is now seem to continuously rise from the earth. At
overshadowed by Mao’s tomb.” (Kostof, 2005). their feet, you can still be able to see remains of
the old city, now on the edge of extinction.”
(Ciupitu, 2006)
Somehow Beijing succeed in illustrating an
apparent “harmless” political system and to put
capitalism (in its wilder but, paradoxically,
extremely state-controlled form) in the list of
political systems that are mutilating cities and
history in order to express its own power.
Chaotic demolitions occur in all Chinese cities;
traditions and culture are lost in the new urban
landscape. The population thus loses its identi-
ties and landmarks. Françoise Choay askes her-
self if these new cities, without a past will they
Figure 18. Tiananmen Square (Google images) ever became cities? “They rather risk ending up
at the museum under the 20th century heritage
After Mao’s death the plaza was further label to illustrate a moment of decisive rupture,
enlarged in order to gain a perfect shape but although no responsibility was assumed, with
also to increase the number of public the urban tradition. […] For the urban, today so
manifestations participants. Thus Tiananmen
largely used, is no longer something more than
became the absolute symbol of the communist
a place in a state of general confusion, waiting
power, practically erasing the hole (glorious)
for the “post-urban” term, yet absent from the
Chinese (un-communist) past and staying as a
dictionary to take its place and be recognized.”
vainglorious, overwhelming space (Figure 19).
(Choay, 2011)
Tiananmen Square is not a singular example; it
The new Beijing, still growing fastly, already
is known that Beijing is facing a series of
shows its failures but it is also developing new
frequent demolitions of historical buildings and
social and environmental politics. It is so
neighbourhoods in order to make room for
difficult to say now how its public space will be
unrealistic constructions such as highways,
huge block of flats, office buildings and malls. lived in the comming years. Today it’s public
Just these new demolitions are not made in the life still rest confined in the old, traditional
name of the communist ideology but in the neighbourhoods, but new landscape and urban
name of the new development toward an design projects are indicating another possible
original social-democracy (Figure 20). future for the city.
359
Pyongyang, the hidden city nues are connecting the historical centre with
The capital of the North Korean Republic is a the Moranbong hill, while the new Kim Il Sung
city that suffered a series of important destruc- Square is built to became the political centre
tions and a city that has lost its past in favour of and emblem of the city (Figure 22).
its present, a past that was abandoned by the no- During the 1950-60es the rebuilding of Pyong-
wadays society. The city was seriously damaged yang was mostly focused on new monumental
during the Korean War, being estimated that plazas and official buildings while the whole
90% of the city was destroyed (Joinau, 2012). city was forming from little shacks scattered
From this point of view the new established along the avenues.
regime found the urban past already obliterated.
Figure 22. Pyongyang avenue and the reality behind

(google images)
Figure 20. The Triumph Arch in Moranbong Place
(Google images) Afterword new blocks of flats, or, it is said, just
block facades were built along the un-scaled
The civic centre model seems to be used by the large avenues, hiding the ever-unfinished
Korean architect. Moranbong hill (legendary neighbourhoods, lacking streets or any other
place of the city) became the favourite site for public amenities (Figure 23). These huge ave-
most of the new, emblematic buildings: the first nues plated with dull structures, specific to
History Museum, Kim Il Sung University, most communist cities, cannot hide the im-
Liberation Tower, the Moranbong Theatre, the provisation and dummy-air of the buildings as
Kim Il Sung Stadium and the Triumph Arch “you don’t have to stand very close to buildings
(Figure 21). to see that balconies, tiling, vertical and hori-
zontal joints often depart from the plumb-line.
Interesting concave and convex patterns appear
in prefabricated, hand-finished concrete walls.
Windows panes have bubbles, bands, fish-eye
and bottle-glass effects. Spaces exist under
doors and their frames.” (Willoughby, 2008)
This plating logic seems to be the inspiration
for CeauƔescu’s dreams for Bucharest, or so it
stays in our urban mythology. It is still believed
that CeauƔescu’s visit, in 1971, was the trigger
for the further development of Romania,
Bucharest as well as his own personality cult.
necessarily successfully done neither. Among
Figure 21. 22 Kim Il Sung Place, dominated by his huge them the emblematic Ryugyong Hotel (Figure
statue (Google images) 24), was erected between 1987 and 1992 when
Following the new monumental axis are the financial difficulties put the construction at
developed – the Yonggwang and Sungri ave- a halt. It was planned to be finished in 1989 and
360
to be the tallest building in the world, but when On another hand the obliteration of an “emba-
it was finally done (on the outside), in 2012 but rrassing” past was hidden under the new
now it is only the 47th tallest one. monumentality. In order to create this new spa-
ces the old cities’ cores, layered expressions of
the previous political periods and social values,
were wiped out. It was not only imposing a
new political landscape but also it was all about
erasing the old ones. It is like all the dictators
were trying to stay as unique, solitary figures of
their national histories. It was an entire history
rewriting in stone.
Also it is quite similar that it was one person’s
vision that was imposed over the city. Even
though sometimes specialists were consulted,
the vision was clearly imposed by the political
leader(s) and the technical advice was nece-
ssary just in order to find the best solutions for
Figure 23. Ryugyong Hotel (Google images)
that visions mise-en-place.
What differ the political landscape is the archi-
Meanwhile the city, as the entire country
tectural language that was chosen in order to
struggle with the famine, but Pyongyang is
express the political new values. Even if we can
maybe the outmost political landscape. As
find a strong penchant for the classical expre-
Philipp Meuser describes Pyongyang, the North
ssion, modernism was also part of the game.
Korean psycho regime’s capital, as “arguably
We can witness a subtle balance between the
the world’s best-preserved open-air museum of
ruptures with the past, sustained by the new
socialist architecture” (Meuser, 2102) architectural expressions, and the need of
historical quotations as legitimation tools. Also
RESULTS AND DISCUSSIONS the classical architecture seem to be more fitted
As we stated in the previous chapters, cities all for the monumental expressions while the
over the world have lost or have never had a modernist forms are staying insufficiently rich
kind of urban memory. Either it’s about demo- in expression means and less sumptuous and
litions, reconstructions, wars or any other kind impressive. And impression is all it is about the
of events that triggered urban traumas, many political landscapes. Out of this balance bet-
cities have lost parts of their culture, traditions ween modernity and classic result the origi-
and memory. “All cultures and all societies nality (or the lack of it) in the analysed urban
have built and developed themselves through totalitarian landscapes. Also it is their historical
demolitions.” (Choay, 2011) and aesthetical value. If Napoleon III’s urban
But what are the similarities or the differences order, the Russian modernist avant-garde and
of this destruction and rebuilding cycling acts? Mussolini’s fascism have their unchallenged
The most clear and common feature of all this places in the architecture and arts history it is
reconfiguration of historical cities in order to difficult to imagine the Romanian, Chinese or
became political statements is the “bigness”. Korean edifications entering the aesthetical
We don’t refer only the impressive dimensions history but as sort of freak expressions of
and richness in decoration of the buildings, but political regimes, sort of power-story-tellers
also the inhuman scale of the urban spaces – architectural Disneylands.
plazas and avenues – that were created. What Another difference to be noticed is the balance
between monumental buildings erecting and the
stays as the common tool for the totalitarian
more social-oriented projects. Thus, in
landscapes is the presence of huge urban voids,
Haussmann’s project the rebuilding of Paris
conceived as parade spaces and calculated to
contain impressive parades and popular, more took in charge equally the monumental
or less enthusiastic, gatherings. buildings, boulevards and places but the entire
coherence of the project was realised using
361
“ordinary” buildings as the general background After 20 years of democracy we still wander
of the new political scenery. Mussolini’s what to do about the city, still expect for one’s
projects were more clearly separated – the alone idea instead to try, as Germans did for an
centre was the ground of the new example, to take the space in our own hands.
monumentality while the new, modern The political projects are clearly oriented
neighbourhoods, without lacking their own towards further destructions and while we are
monumental places, were more peripheral. In fighting to save what is still standing we forget
Romanian and Korean case we can witness a about our scares. As a result we risk facing, in
time-splitting between monumental and regular some time, a totally mutilated city that we are
buildings. While Bucharest was submitted first no more able to cope with. Or, as it started to
to a social revision as huge new residential happen, if we will let it go, the nature will
assemblies were built and while the outmost succeed to bring the life back in the forgotten
expression of the communist era was also its fractured spaces. But nature is so “unmodern”...
last project, in Korean case the timeline was
inversed. The social projects were started just REFERENCES
after the accomplishment of the new “sacred Bisky J., 2006. Berlin-a profile, ed. Berlinei Zeitung,
places” of the city. Berlin.
De Certeau M., 1990. L’invention du quotidien, Vol.1.
CONCLUSIONS Arts de faire, Gallimard, Paris.
Choay F., 2011, Pentru o antropologie a spaԕiului, ed.
Bucharest case is neither new and neither Biblioteca Urbanismul, Bucharest.
unique if we look at the destructions that it Ciupitu O., 2006. Arhitectura veche din Beijing I,
Curierul Romanesc.
suffered. On another hand some features of
Goldhoorn B., 2002. Project Russia – architecture after
these destructions are strikingly different. communism, ed. A-fond Publishers, Amsterdam.
On one hand is the further continuation of Harhoiu D., 1997. BucureƔti, un oraƔ între Orient Ɣi
demolishing after the fall of the communist Occident, ed. Simetria, Bucharest.
regime. If we could expect a revalorisation of Jackson J.B., 1984. Discovering the Vernacular
the old city after 1990, this change of Landscape, Yale University Press, New Haven.
Joinau B., 2012. La Flèche et le Soleil. Topo-
perspective never came. The only noticeable
mythanalyse de Pyongyang, Croisements 2 « Ville
act of promoting the past is the skin-deep réelle, ville rêvée », Paris : Atelier des Cahiers p. 66-
refurbish of the Lipscani area. But it was done 95.
just in order to transform it in a tourists-trap, a Klein N., 2007. The Shock Doctrine. The Rise of
historical Disneyland out-door mall that is not Disaster Capitalism, Penguin Group, London, p. 3.
appealing neither to locals nor to foreigners. Kostof S., 2005. The City Assembled, Thames & Hudson,
New York.
On another hand, even if we somehow accept Meuser P, 2012. Architectural and Cultural Guide:
now the House of the People, or at least the Pyongyang, DOM Publishers, Berlin.
idea that it can’t be demolishes, but what can Pandele A., 2009. Casa Poporului- Un sf‫ۄ‬rƔit în
strike one visiting the city is the incapacity of marmurĉ, ed. Compania, Bucharest.
reweaving it, of occupying and transform its Quilici V., 1976. Cita russa e citta sovietica, Gabriele
Mazzorra editore, Milano.
scars. It is like, behind the huge boulevards’ Rauԑĉ R.A., 2012. Negotiating the Civic Center.
facades, the time stopped. We are neither able Architects and Politicians in 20th Century Romania,
to recover the past of the city, as the harm done Dissertation submitted in partial fulfillment of the
is way too big, neither to integrate its present requirements for the for the title of Doctor in
and to recover the urban space. Engineering at the Katholieke Universiteit Leuven
Arenberg Doctoral School.
Though the city fascinated due to its particular Sfinԑescu C., 1932. Estetica BucureƔtiului, (in
culture, traditions and heritage, the modern Urbanismul 9-12/1932), Institutul de Arte Grafice
project (although heavily imposed by the Bucovina, Bucharest.
communist era and strongly refused at that Vasilescu S., 2011. Arhitectura Italiei fasciste, ed.
time) still haunts Bucharest. It seems that we Arhitext Design, Bucharest.
Willoughby R., 2008. North Korea 2nd Bradt travel
are not able to learn neither form our own, past
guide, The Globe Pequot Press Inc. Guilford,
mistakes nor form the others’. Connecticut.
362
RESTAURATION OF THE ROMANIAN WRITER’S

ROTUNDA – CISMIGIU GARDEN
Alexandru MEXI, Maria BRATU, Violeta RĂDUCAN

59 Mărăúti Blvd., District 1, 011464, Bucharest, Romania
Abstract
Cismigiu Garden is a part of our national heritage and it is almost lost in favour of kitsch and ugliness. As a
consequence of the lack of experience and professionalism of interest and as well of public income, this garden becomes
a shadow of its old glory.One of the most important architectural and landscaping compositions in Cismigiu Historical
Garden is the Writers’ Rotunda. Focusing only on the Rotunda, the study was based on “in situ” research and on
historical documents research. The study revealed a series of inconsistencies and discrepancies between historical text
description and historical images as well. Also, our paper lead to showing different patterns on which the Rotunda was
designed and it also reveals patrimony objects that seemed to be lost.The aim of this case study is to emphasise the
Rotunda image created by FriedrichRebhun and how should it look like after a much-needed restoration. In order for a
city that lost most of its history and patrimony, attention should be accorded to the built heritage including historical
gardens and parks and especially to their most important features. One of them is the Writer’s Rotunda.
Key words: heritage, history, patterns, patrimony, restoration.
INTRODUCTION Special attention was accorded to details,

planning sequences, and to the grade of
A city’s patrimony consists in buildings and
deterioration. Our study was based on historical
monuments, as well as in gardens and parks.
descriptions, images and plans. Most of our
One such part of Bucharest’s patrimony is the work was to compare text descriptions with
Cismigiu Garden. Designed by Karl Friedrich images and plans because there were a lot of
Wilhelm Meyer in 1845, the garden was inconsistencies and discrepancies between
designed over an old puddle flooded frequently them. The study reveals how the Rotunda was
by the Dambovita River crossing Bucharest mainly designed and how it should be restored.
(Panoiu A., 2011). Cismigiu was a romantic - Cismigiu Garden – Short History
garden, designed according to the 19th century’s Cismigiu garden respresents, chronologically,
citizens of Bucharest personal desires and way the second public garden of Romania. Designed
of life. The garden went through a series of after Karl Friedrich Wilhelm Meyer’s plans,
successive changes that brought new zones of
Cismigiu garden was designed as a romantic
interest in the garden. One such newly created
green space, but it was also designed according
zone of interest is the Writer’s Rotunda. This to the desires and to the way of life of the
rotunda is part of this garden’s history and also citizens of Bucharest of the XIXth century.
it is part of Bucharest patrimony. The actual The garden went through a series of successive
state of preservation of this part of history is changes, the last of them being the most
very low and special assistance is needed in important. This way, Cismigiu was redesigned
order for the Rotunda to be conserved in the by Wilhelm Knetchel in 1882-1883 and by
future. Friedrich Rebhun in 1910-1943.
Along with the new transformations, newly
MATERIALS AND METHODS added zones contributed to the improvement of
The research was led in the Romanian’s the garden, and, despite its low surface, it
Writer’s Rotunda during a period of several became a complex garden, all of the three
months, in seasons of autumn and winter. stages of design bringing new valuable ele-
ments to the garden.
363
- The Writer’s Rotunda The description made by Rica Marcus is one
“The construction of the Gheorghe Lazar high that presents numerous elements that made up
school in 1890, meant that the main entrance to the Writer’s Rotunda. However, a few discre-
the garden had to be moved on to the Queen pancies appear between the text descriptions
Elisabeth boulevard and it also meant giving up and the images posted in the same book.
the elm round-point. Those works preceded the Though being described as having 16 statues,
drastic redesign by the German architect, photographs posted in the book to emphasize
Friedrich Rebhun in the years 1899-1910, when the description show that there were actually 12
a new, classical style, opposite to Meyer’s statues, three on each quarter of the rotunda.
concept was imposed. This transformation can The text description mentions two entries with
be seen in many of the garden’s subspaces(the columns while the plan shows that all four
roses terrace, the alley with pergolas, the entries had columns, and one image that reveals
Romanian Round). The decommissioning of the fact that the entrance from the main axis
the Music and the Semicircular pavilions meant had no columns at all. Though the description
a radical change of the aspect on the Schitu made by Rica Marcus is one of the oldest and
Magureanu street side of the garden. By most trustful, the discrepancies between text
creating the Romanian Round and the nearby and images do not reveal how the Rotunda was
spaces, easy terms of accessing those spaces originally designed by Rebhun.
and the garden as well, were created.” (El-
Shamali S., 2011).
Rica Marcus, in “Parks and Gardens of
Romania” is offering a series of information
about this newly created space: “it is placed
over what used to be a restaurant that left
behind a circular platform with a diameter of
about 20 m. According to the English
traditions, this forms a bulingrin from all four
access points, that descends on a few steps to
the circular alley paved with stone that stands
between the central round and the surrounding
plantation. On the rounds perimeter there were
planted cone-shaped yews, and groups of
Forsythia in between, in contrast of color and
form. On the bordure were perennials such as
Sedum, Stochis, Cerasium, Campanula etc.
Parallel to the alley a similar bordure can be Figure 1. Plan of the Rotunda – 16 statues a 8 columns
appearing on the plan (Marcus R., 1958)
found, followed by a lawn with 16 statues of
the most valuable Romanian writers. The
Another description of the Rotunda and of its
silhouettes of the statues of white marble,
components appears in “Bucharest’s gardens”:
placed on high stone pedestal were in contrast
with the green background of the compact “[…] the marble columns from the Rotunda
vegetation. The bulingrin was separated by the were taken from the Royal Palace during a fire.
rest of the garden through a a row of niches The iron pergolas, […] were initially placed in
formed by walls of vegetation that stand to the palace garden, placed by Carol I while
represent the lodges from where you can Queen Elisabeth was in a foreign visit, to make
admire the center of the composition: the yew the queen a surprise. When the palace garden
round. The niches are formed by iron grids and was disbanded, Rebhun asked for them and
are climbed by lianas and forsythias. At two of brought them in Cismigiu. The pavement is
the entrances in this garden were placed part of the pavement that was disbanded from
columns with pedestals surrounded by groups the Rondul I de la Sosea.” (Lancuzov Al.,
of Cotoneaster horizontalis.” (Marcus R., 2007). Though interesting details were offered
1958).
364
by this description, those information could not sculptors: Mihai Eminescu, Al. Odobescu, Titu
be yet verified. Maiorescu, I.L. Caragiale, G. Cosbuc, St. O.
Iosif, Ion Creanga, Al. Vlahuta, Duliu
Zamfirescu, M. Onofrei, C. Baraschi, Th.
Burca, B.P. Hasdeu, N. Balcescu and V.
Alecsandri are the work of Ion Jalea, Militia
Patrascu, D. Barlad, Oscar Spaethe, Iona
Popovici, Cornel Medrea, I.G. Jinga, Oscar
Han and Al. Calinescu.” (Raducan V.) The text
refers to 16 statues but enumerates only 15.
However, out of those 15 statues, only 12 really
exists, while the rest of the three statues (M.
Onofrei, C. Baraschi and Th. Burca) are only
mentioned in documents but do not appear in
Figure 2. Entrace from the main axis – sequence of 3 any visual documents.
statues on a quarter (Marcus R., 1958)
In situ observations and old document research
made us get an idea of how the Rotunda must
have been designed. We started focusing on
each component of the Rotunda and we
discovered elements that seemed to be lost,
planning sequences that were altered in time
and evidences that supported parts of the old
text or image descriptions.
Vegetation
The Writer’s Rotunda vegetal design is made
Figure 3. Entrace from the main axis – entrances and up by a handful of plants that are described in
columns – columns do not appear at the entrance from historical documents and also, partially appear
the main axis (Marcus R., 1958)
in old images as well.
Yew trees are the most common trees in the
One more interesting description helped us to
rotunda, and they were placed in sequences,
make an impression of what used to be The
according to the symmetrical design that
Writer’s Rotunda: “But the most interesting
characterizes the entire composition. Those
intervention that Rebhun had in this part of the
trees are mostly in a advanced state of
garden was the so-called Romanian Round,
deterioration, having lost their original cone-
designed in 1942-1943 over an old restaurant.
shaped form. According to the Florence Charta
A scientifically distribution of trees, shrubs and
(Charte de Florence, 1981), we decided to keep
flowers make up, on a circular platform of over
the original image of the Rotunda, this way
20 m length diameter, a spatial framework
being obliged to eliminate all the yews and
rhythm by the 16th statues of the most
plant new ones. The new yews have to be cone-
important Romanian writers and by coned-
shaped and have approximately 2.5 m high and
shaped yews, placed along a circular stone
1.2 to 1.5 m in diameter. Those dimensions
brick paved alley. Coned-shaped yews are
were approximated after scaling several
planted on the perimeter on the round as well.
historical images.
The space is separated from the garden through
a series of niches made up by walls of
shrubs(lianas and forsythias), placed on metal
grills and with a circular row of regular pruned
linden tree in behind. The statues were made by
some of the most important Romanian
365
Figure 4. Vegetation plan
Regarding other species of trees such as Tilia,

Acer or Quercus, we decided to keep them in
their actual status considering that they are not Figure 6. Vegetation data sheet, yew no. 9
major elements of design in the Rotunda, and
that they are, generally in a good state of In what concerns low vegetation such as
preservation. shrubs, lianas or erennials we considered
replanting roses, in groups of two, in between
pergolas, such as texts and images suggested
and replanting Wisteria sinensis nearby
columns, mentioning that this liana must be
kept under control in order not to fully cover
the columns. Though historical texts mention
Forsythia, Sedum, Campanula, Stochis,
Crasium etc. we weren’t able to pinpoint their
exact planting location. Neither plans nor old
images show those plants appearing in the
Rotunda, so we decided to fully give up on
planting those plants.
Architectural components
- Statues
Although text descriptions mention more than
12 statues, we found no evidence that there
really used to be more that 12 statues in the
Rotunda. We recommend that the actual statues
be preserved and no additional changes are to
be made.
Figure 5. Vegetation data sheet, yew no. 2
366
Figure 7. Statues
- Columns
We came to the conclusion that the northern
and southern entrances to the Rotunda have
columns with Corinthian capitals, while only
the western entrance had two columns with
Ionic capitals. The entrance from the main axis
had no columns, as it can be seen on old images
as well. However two out of six columns are
covered by lianas and one is represented only
by its pedestal. Thus we propose to restore the
ones that are left and to make two copies of the
columns with the ionic capitals in order to
place them at the east entrance, following Rica
Marcus’s plans and the Rotunda’s logics of Figure 8. Columns
symmetry.
- Benches
The Rotunda was designed with 4 stone
benches. All of those benches are in a advanced
state of deterioration, thus we advice that all of
them be restored, if possible, if not, than they
must be replicated and placed according to their
original location.
367
Figure 9. Benches
Vases
There are 4 kinds of vases, that were originally
placed in sequences according to a logic of
symmetry that characterizes the entire Round.
The largest type of vase is made out of
reinforced concrete and it is placed in the
center of the composition.
Another kind of vase is a plate-like
concrete vase that it is placed in sequences and
in between pergolas. The other two kinds of
vases are made out of stone and are placed in
sequences in between statues and yews and on
both sides of the circular alley. Most of the
vases are in a advanced stage of deterioration. Figure 10. Vases
We propose that the vases be restored or
replicated and placed replaced according to
their original position.
368
The pergolas are preserved in a relatively good
condition and they have not been moved or
replaced. We propose that the pergolas be
conserved in the future and only minor repairs
be conducted at this moment.
On both sides of the circular alley are placed 2
kind of stone slabs, also arranged in sequences
according to the symmetry design of the
Rotunda. Alike pergolas, the stone slabs are in
a good condition so we consider that only
minor repairs are to be conducted at this
moment and conservation over time is needed. Figure 12. Please protect the Rotunda!
- Wrought iron pergolas and stone slabs
Figure 13. Framing damages
CONCLUSIONS
Our research revealed the way the Rotunda was
designed by Friedrich Rebhun and how it
presents itself today. Lack of interest and of
experience, combined with uninspired
Figure 11. Pergolas and stone slabs measures taken inside the Rotunda badly
deteriorated most of this composition.
Damages/Deteriorations However, the fact that there are still numerous
Either it came to damages or deteriorations, elements that have not yet been damaged
lack of experience and lack of concern made beyond repair give a chance for specialists to
the Rotunda to degrade over time. New restore the Writer’s Rotunda.
installations were added without approval from Immediate actions are needed in order to save
specialists and thus they destroyed the image of not only this composition, but the entire
the composition. While new elements were Cismigiu Garden.
added, old ones were left to deteriorate and
Our own restoration proposal is based on a
panels with messages for preserving the garden
minimum of actions, but all of them are
were just placed to hide the true nature of the
necessary in order to bring back the old image
damages, as shown in the pictures below.
and atmosphere in this part of the garden.
Beside the proposals we made for every
element of the Rotunda we emphasize that it is
totally necessary to remove all the new
elements that do not belong to the original
design, and we recommend, according to the
Florence Charta, that the entire garden to
benefit from a special visiting program.
369
REFERENCES
Panoiu A., 2011, Evolutia orasului Bucuresti, ed.
Arhitext Design, Bucharest, p. 81.
El-Shamali S., 2011. Contribuԑii privind studiul creaԑiilor
din România ale peisagistului Carl Friederich Meyer
Ɣi punerea acestora în valoare în contemporaneitate,
Bucharest, p. 17-18.
Marcus R., 1958. Parcuri si gradini din Romania, ed.
Tehnica, p. 173.
Marcus R., 1958. Parcuri si gradini din Romania, ed.
Tehnica, p. 169.
Lancuzov Al., 2007. Gradinile Bucurestiului, ed.
Caligraf, Bucharest, p. 31
Raducan V., Puz Cismigiu, p. 10.
Charte de Florence, 1981. Jardins Historiques.
Figure 14. Proposed plan for restoration
370
PHENOLOGICAL STUDIES ON SOME VARIETIES
OF ROSES FROM THE COLLECTION IN THE "DIMITRIE BRANDZA"
BOTANICAL GARDEN IN BUCHAREST
Eduard Marius NEGULICI

59 Mărăúti, District 1, 011464, Bucharest, Romania
Abstract
The study shows the influence of climate changes, which are more and more present, especially on the differences of
temperatures recorded in short periods of time as well as similar periods of time throughout the years, in the
development of roses. This study of the influence of temperatures on roses was conducted in the Bucharest area.This
particular research was done by observing the behaviour of 10 varieties of roses from “Dimitrie Brandza” Botanical
Garden’s rose collection, between the years of 2011 and 2012. The main aspects of the study were: the growth rate and
phenological phases, in correlation with the changes in the atmospheric temperature.
Key words: roses, phenological phases, climate changes.
INTRODUCTION temperature fluctuations. Data collected from

this study is part of the PhD thesis.
Climate changes are more and more evident,
which affect all living creatures in different
ways, causing behavior changes. On roses,
these changes determine a change in growth The biological material that was used for
rhythm, an offset in phenological phases and determination came from 10 varieties planted
are a big influence on the lifespan of open during 2008 to 2009 in the 'Dimitrie Brandza'
flowers Botanical Garden Rose Collection (‘Abraham
A study on the effect of negative temperatures Darby’, ‘Acapella’, ‘Angela’, ‘Caprice de
on roses from the Botanical Garden collection Meilland’, ‘Christoph Columbus’, ‘Forever
in Iasi was made by Ostaciuc in 1987. He Young’, ‘Heritage’, ‘Ingrid Bergman’, ‘Rapsody
followed, during the winters of 1981 to 1986, in Blue’, ‘Red Berlin’).
rose varieties from the following groups: Temperature data was taken from the NIMH-
hybrid tea, polyantha, polyantha hybrids, Bucharest Centre and recorded in tables.
floribunda, floribunda grandiflora, climbers and The culture technology was used under normal
park roses. The research showed that the conditions, with cuts during the spring and in
polyantha, polyantha hybrids and floribunda the growing seasons, to stimulate a new wave
have their biological threshold at 10°C, hybrid of blooming.
tea at 8°C and climbers and park ones at-15°C Hydric regime was also similar in the two
(Ostaciuc I., 1987). The present study aims to years, without performing additional irrigation.
conduct collection on ten varieties from the Biodynamic growth rate was determined at an
Botanical Garden 'Dimitrie Brandza' in interval of 4 weeks by measuring and
Bucharest, during their growing season, calculating the average growth of shoots during
between the months of May and November May to November in each of the two years.
2011 and 2012. In the two growing seasons, the Important phenophases (budding, leafing and
study followed and compared growth rhythm, blooming) were determined visually when at
the phonological phases and power of growth least 80% of the plants showed characteristic
(the length of the shoots) in correlation with phenological aspects.
371
RESULTS AND DISCUSSIONS Table 3. Growth rate in 2011 and 2012
Results of the phenophases. Variety Group May June July Aug Sept Oct Nov
Angela
Regarding phenophases, there were significant 2011
park rose 37,5 79,3 80 101 132 130,7 135
differences in blooming for up to 3 weeks Angela
between the two years, for the 'Rhapsody in park rose 46,7 44 68 53,3 77,3 128,6 122,7
2012
Blue' variety, which in 2011 was the most tardy Abraham
English
of all, at the opposite pole being the ‘Forever Darby
rose
36,6 48,2 73 43,4 20,6 25,1 69
2011
Young’ variety which has even shown earliness Abraham
in blooming in 2012. English
Darby 50 55,5 19 27,9 47 60,5 67,2
rose
Also, in the case of leaves, between the two 2012
years there were differences of up to a week in Heritage English
14,7 45,7 79 117 99,1 37,6 97,6
most varieties. (Table 1, 2) 2011 rose
Heritage English
43,2 63,8 69 65,1 83 84,9 91,4
2012 rose
Table 1. Phenological phases for researched varieties in
Forever
2011
Young floribunda 27,1 35,9 38 10,1 5,3 16 22,4
Variety Budding Leafing Blooming 2011
Abraham Darby March 15 March 29 May 24 Forever
Acapella March 15 March 29 May 30 Young floribunda 18 26,4 6,2 5,6 7,9 7,8 11,5
Angela March 15 March 29 May 23 2012
Caprice de Meilland March 14 March 29 May 24 Rhapsody
Christoph Columbus March 16 March 31 May 30 In Blue floribunda 34,4 80,3 85 85 96,7 49,7 80,7
Forever Young March 15 March 29 May 19 2011
Heritage March 15 March 29 May 25 Rhapsody
Ingrid Bergman March 15 March 29 May 26 In Blue floribunda 35,7 38,2 27 15,7 25,9 21,3 41,3
Red Berlin March 15 March 31 May 26 2012
Rhapsody In Blue March 15 March 31 June 7 Acapella
hybrid tea 38,5 45,4 54 76,7 72,2 20,8 111
2011
Acapella
hybrid tea 47,3 54,2 74 22,8 61,6 79,2 76,5
2012
Table 2. Phenological phases for researched varieties in Caprice de
2012 Meilland hybrid tea 22,6 45 67 28,1 72,2 39,6 81,7
Variety Budding Leafing Blooming 2011
Abraham Darby March 26 April 5 May 13 Caprice de
Acapella March 26 April 5 May 18 Meilland hybrid tea 36,4 60,8 77 22,5 68,5 84,5 81,5
Angela March 24 April 4 May 13 2012
Caprice de Meilland March 26 April 5 May 14 Christoph
Christoph Columbus March 26 April 5 May 20 Columbus hybrid tea 26,5 55 83 41,2 33,4 19,5 93,8
Forever Young March 24 April 5 May 5 2011
Heritage March 26 April 5 May 15 Christoph
Columbus hybrid tea 33,6 74,7 62 37,5 38,8 116,1 122,2
Ingrid Bergman March 25 April 5 May 16
2012
Red Berlin March 24 April 4 May 13
Ingrid
Rhapsody In Blue March 24 April 4 May 13
Bergman hybrid tea 22,8 50,8 58 23,2 19,8 9,7 79,6
2011
Results of the growth rate study exhibit Ingrid
growth averaged during the months of May to Bergman hybrid tea 32,8 45,4 14 16,3 30,7 24,3 36,8
November. 2012
Red Berlin
The majority of the varieties showed hybrid tea 21 45,1 50 29,4 19,9 11,2 60,6
2011
differences in growth between the two years, Red Berlin
with some similarities during the spring, when hybrid tea 65,4 65,6 20 48,7 59,2 59,3 31,8
2012
a more intense growth rate was recorded.
This growth rate was correlated with On the 'Angela' variety, significant growth
temperatures recorded during the months of differences were registered between July and
April and December. (Table 3, Figure 1-11) October (Figure 1).
372
Figure 3. Average growth rate of ‘Heritage’ variety from
Figure 1. Average growth rate of ‘Angela’ variety from the English rose group
the park rose group
‘Forever Young ' was the variety who showed
an uneven growth rate between June and
In the English roses group, major differences in October, in the floribunda group (Figure 4),
the two years of study were present only in the
month of July on the ‘Abraham Darby’ variety
(Figure 2).
Figure 4. Average growth rate of ‘Forever Young’ variety

from the floribunda group
Figure 2. Average growth rate of ‘Abraham Darby’ ‘Rhapsody in Blue’ presented the highest
variety from the English rose group growth rate in 2011, with a maximum
recording in September and with the month of
The ‘Heritage’ variety showed an even growth November showing significant increased rates
rate in 2011, but in 2012 it presented important for 2012 (Figure 5).
differences in growth, with a maximum
recording in August, followed by a minimum
one in October (Figure 3).
373
Figure 5. Average growth rate of ‘Rhapsody in Blue’
variety from the floribunda group Figure 7. Average growth rate of ‘Caprice de Meilland’
from the hybrid tea group
In 2011, the ‘Acapella’ variety presented the
best growth rate in growing seasons, between November was accounted for significant
the 2 years of study, with a maximum recording increases in the 'Christoph Columbus' variety in
in November (Figure 6). the two years of study (Figure 8).
Figure 6. Average growth rate of ‘Acapella’ variety from Figure 8. Average growth rate of ‘Christoph Columbus’
the hybrid tea group variety from the hybrid tea group
The growth rate for the ‘Caprice de Meilland’ The ‘Ingrid Bergman’ variety showed a
was relatively even during the 2 years of study, maximum recording in November for 2011 and
with a significant difference recorded in the in June for 2012 (Figure 9).
month of October (Figure 7).
374
the high temperatures recorded during the
summer, being a determinate factor in the
decrease of growth rate (Figure 11).
The evolution of average temperatures recorded
was relatively even between the 2 years of
study, with differences of only 5 degrees being
recorded in similar timeframes of the year.
Figure 9. Average growth rate of ‘Ingrid Bergman’

variety from the hybrid tea group
“Red Berlin’s” growth was uneven during the

growing season in the two years of study, with
a peak in 2012 during May-June and a
minimum in July; as for 2011, the maximum Figure 11. Average temperature recorded at 14.00 during
was recorded in November and the minimum in the growth season in 2011 and 2012
October (Figure 10).
CONCLUSIONS
The majority of the varieties studied showed
significant differences in growth rate during the
growing seasons of the 2 years of study, the
only exception being the ‘Caprice de Meilland’
variety which showed growth rate differences
in the month of October.
Climatic conditions in spring resulted in the
earliness of blooming in 2012, in comparison to
the same period of 2011.
Differences in growth were not affected by
Figure 10. Average growth rate of ‘Red Berlin’ variety maintenance cuts, but with the advent of high
from the hybrid tea group temperatures during the summer, it caused a
reduction in growth rate, which only returned
All of these differences in growth rate are to normal once the drop in temperatures
correlated with the average temperatures appeared along with the autumn season.
recorded during the months of April and The variety with the most significant increase
December, between the years of 2011 and was 'Angela', which is a park variety and has
2012. In 2011 we can clearly see how shown an average increase of 135 cm
temperature uniformity caused a stable increase maximum in November 2011. At the opposite
in the growing season for the majority of pole is the variety with the lowest growth,
varieties studied. The graphs presented above which is 'Forever Young’ from the floribunda
show how the cuts performed after the first group with a maximum of 35.9 cm in July
wave of blooming, which were different every 2011.
year, did not influence the growth rhythm on
the majority of the varieties studied, with only
375
In 2012 there were higher onset temperatures REFERENCES
during the spring, which caused a greater Wagner S., 2002. The rose – from myth to the third
increase in shoots length in the month of May. millennium, Cluj Napoca, p. 46-48; 89-95.
Burzo I., Delian Elena, Hoza D., 2005. The physiology
ACKNOWLEDGEMENTS of crop plants, vol IV,Elisavados Publishing House,
Bucharest, p. 60-67; 90-98; 158-204; 346-363.
This research represents the objective of the Burzo I, Amariutei A., Zamfir D., 2005. The physiology
PhD theses in the POS-DRU project: of crop plants, vol VI, Elisavaros Publishing House,
POSDRU/107/1.5/S/76888 p. 89-120.
Ostaciuc I., 1987. Low temperature effect against rose
from the collection in the Botanical Garden in Iasi.
Culegere de stud. si artic. de biol., Univ. “Al. I.
Cuza” (Grad. Botanica) Iasi 3, p. 65-72.
376
WINTERING RESISTANCE OF ORNAMENTAL WOODY PLANTS
IN CONTAINERIZED CULTURE
Ion RO‫܇‬CA
Botanical Garden (Institute) Academy of Sciences of Moldova,

18 Padurii Street, MD 2002, Chisinau, Republic of Moldova
Abstract
The target of the experience consists in establishing the level critical temperatures and the mode preservation during
cold period of the year for the species and cultivars of conifers in containerized culture. Because of at the plants are
fortified in container conditions, frequently occurs the phenomenon of spiraling root system, standing at the periphery
of the substrate, endangered by frost and, proceeding from the need of protection during the winter, we suggest the
following objectives: * the comparative comportment of the species and cultivars during the cold season, depending on
the way of storage; * the species and cultivars resistance at low temperatures, depending on the ecological
requirements of plants. For containerized culture of ornamental species and cultivars were established following
conservation cold season: V1 – protected plants displayed in greenhouse; V2 – protected plants and exposed outdoor
but covered with protective acrylic cloth; V3 – plants unprotected and exposed outdoors throughout the cold period. As
a result of the study it was found that the species and cultivars of conifers remarked the highest coefficient – 100%
resistance at low temperatures, where all three variants of wintering (V1, V2, V3), at the end of the cold period the plants
were started in vegetation and there were no damages caused by the frost.
Key words: resistance wintering, containerized culture, preservation variants and cultivars.
INTRODUCTION vulnerable to the injuries caused by the low

temperatures. In that case, the container
Roots of the plants in the open field are
thickness of the wall performs the duties of the
protected from the soil mass and penetrates
protector of roots to lethal temperatures. If the
deeper, thus preserving it from the excess of
temperatures, fall below the critical point for
high and reduced temperatures. At the fall of
some time, the roots, coming in contact with
frost, the temperature sometimes decreases
the interior surface of the container, freezes. In
more than a few degrees below the critical
such cases, the roots regenerate from the
point, except the portion from the soil surface.
remaining who survived inside the culture
Different behaviors have the plants roots in
substrate and from the base of the plant.
containerized culture from the temperate and
Therefore, if the temperature persists at or
sub temperate zone, where the freezing point is
below the lethal point then the temperature of
not lethal, comparatively with the temperate-
the culture substratum integral mass also
continental climate in the Republic of Moldova.
reaches the lethal temperatures, thus
In temperate zone, the aerial part of the
completely destroying the root system. The
majority of species possesses the ability of
degree of deterioration of the root system is
increasing their resistance to wintering, from
difficult to determine until start the vegetation
the moment of reducing the duration of the day
season and only when takes place the
and the decreasing of fall temperatures. On the
desiccation we can establish the full effect of
contrary, the containerized plant roots in local
the damage state (Rosca, 2003). From a
conditions have a reduced capacity for
technological point of view is recommended
resistance to wintering or even are missing. At
the transferring of suspicious moderately
the plants grown in the cylindrical shape
affected plants in greenhouses heated (Gouin,
containers is often the phenomenon of spiraling
1973; Rosca, 2003). More authors attest the
of the roots, so the young roots are much more
377
fact that root injuries is the major factor which Juniperus
limits the containerized culture in the northern communi 20 20 20 20 20 20
s 'Meyer'.
countries and was established that Taxus x
Picea
media 'Hatfieldi' young white roots freezes at glauca 20 20 20 20 20 20
the temperature of – 3°C, those secondary red- 'Conica'
maroon at – 7°C and the mature stem from the Picea
base does not freeze until – 19oC (Mityga et al., pungens
f. glauca 20 20 20 20 20 20
1971; Rosca, 2009). (Reg.)
Beissn.
Taxus
MATERIALS AND METHODS baccata 20 20 20 20 20 20
L.
For containerized culture of ornamental Taxus
coniferous species and cultivars such as: Abies x media.
20 20 20 20 20 20
concolor Lindl. et Gord., Abies nordmanniana 'Hatfieldii
'
(Stev.) Spach., Juniperus communis 'Meyer',
Taxus
Picea glauca 'Conica', Picea pungens f. glauca x media 20 20 20 20 20 20
(Reg.) Beissn, Taxus baccata L., Taxus x 'Wojtec'
media 'Hatfieldii', Taxus x media 'Wojtec', Thuja
Thuja occidentalis 'Danica', Thuja occidentalis occidenta
20 20 20 20 20 20
'Fastigiata', Thuja occidentalis 'Holmstrup', lis
'Danica'
Thuja occidentalis 'Smaragd', Thuja orientalis Thuja
'Aurea Nana' following variants of preservation occidenta
for the cold period of year have been lis 20 20 20 20 20 20
established: V1 – protected plants displayed in 'Fastigiat
greenhouse; V2 – protected plants and exposed a'
Thuja
outdoor but covered with protective acrylic occidenta
cloth; V3 –unprotected plants and exposed lis 20 20 20 20 20 20
outdoors throughout the cold period. In the 'Holmstru
experience were involved by 20 units / cultivar p'
Thuja
for each variant of preservation and was carried
occidenta
out between 1.XI.2007-15.IV.2008. Meteoro- 20 20 20 20 20 20
lis
logical data on the period XI.2007-IV.2008 'Smaragd'
were registered in Chisinau and taken from Thuja
State Hydrometeorological Service (Table 1). orientalis
20 20 20 20 20 20
'Aurea
Nana'
Table 1. Containerized plant resistance at low

temperatures.
Number of plants exposed Number of plants RESULTS AND DISCUSSIONS
on 15.11.07., preserved on
Species units 15.04.08., The plants experimented concerning the
and to = +11oC;-4,9o C units resistance to low temperatures, depending on
cultivars Wintering variants the three types of wintering it consists of
greenho protec unprote greenho protec unprote
uses ted cted uses ted cted species and cultivars of conifers. The obtained
Abies results on wintering containerized conifer yield
concolor are shown in Figures 1-5, Table 1.
20 20 20 20 20 20
Lindl. et On the basis of investigations regarding the
Gord. behavior of species and cultivars under the
Abies
nordman
conditions of containerized culture, their
niana 20 20 20 20 20 20 resistance to low temperatures, depending on
(Stev.) the mode of conservation, we obtained the
Spach. following results:
378
Figure 1. Number of plants preserved after wintering at
the species Abies concolor Lindl. et Gord.

the species Picea pungens f. glauca (Reg.) Beissn.
the species Abies nordmanniana (Stev.) Spach.
Figure 5. Outdoor wintering mode.

the cultivar Juniperus communis
Figure 6. Plants coated with protective acrylic cloth.
379
We recommend that the species and cultivars of
ornamental woody plants in conditions of
containerized culture must be maintained
during the cold season of the year, with the fast
rhythm of growing – in conditions of
greenhouses – V1, those with slowrhythm of
growth, protected with acrylic cloth, and
exposed outdoors – V2.
REFERENCES
Gouin F.R., 1973. Winter protection of container plants.
Proc. Int’l Plant Prop. Soc., 23, p. 255-258.
Figure 7. Plants placed in the greenhouse for wintering. Mityga H.G., Lanphear F.O. 1971. Factors affecting the
cold hardiness of Taxus cuspidata roots. Jour. Amer.
Soc. Hort. Sci., 96, p. 83-87.
Rosca I., 2003. Caracteristicile recipientelor pentru
CONCLUSIONS culturile în containere. In: Tezele conf. tinerilor
savanti ai Academiei de Stiinte a Moldovei.
As a result of the study it was established that Chisinau, p. 77.
the species and cultivars of conifers have Rosca I., 2003. Cultura plantelor lemnoase în containere
remarked the highest ratio-100% of resistance – tehnologie noua de crestere si dezvoltare. In:
Buletinul A.S.M., ser. Stiinte Biologice, Chimice si
at low temperatures, in all three types of Agricole. Chisinau, nr. 2 (291), p. 163-164.
wintering (V1, V2, V3), which started at the end Roshka I., 2009. Aspecte caracteristice rezistentei la
of the cold vegetation and there were does not temperaturi critice ale plantelor decorative cultivate
injuries caused by the frost. în conditii de container. International Conference of
Young Researches. November 5-6, Chisinau,
Moldova. In: Scientific abstracts. p. 56.
380
QUALITY PARAMETERS OF URBAN GREEN SPACES
Anca STĂNESCU

Abstract
The study approaches the problem of urban green space quality by relating the classic functional-aesthetic binomial
with the ecological aspects of quality; the work analyzes the implication of ecological factors in the ensemble of urban
green quality, considering that the green space is a fundamental component of the urban ecosystem and vegetation is
one of the components of this interactive system which includes the socio-economic system with all its functional and
spatial structures, urban biotope and biocenosis.
Key words: aesthetic functions, quality, urban green space.
INTRODUCTION ecological, having unchallenged effects in the

ensemble of life quality.
The urban green space can be defined as the
The environmental factors which affect the
part of the urban territory which is composed of
urban space (climate, soil, landscape, biological
organized (and unorganized) vegetal mass, and
and anthropical) also influence the quality of
which’s character results from the interaction of
the green spaces, through a multitude of
several factors: human, socio-economical,
components (social, physical-chemical,
cultural and environmental. Starting from this
inorganic and organic) which affect the state of
definition, one can assert that the quality of the
balance of the urban ecosystem and thus the
urban green space is the ensemble of positive
quality of the green infrastructure from the city.
response effects to the biological and socio-
There can be made the assertion that the
economical needs of urban existence, but also
ecological field related to the quality of urban
to the need of urban ambience defined by the
green is far more ample in proportion to the
psyche-social needs of spatial identity and
classical approach – through the functional-
affiliation to the cultural landscape.
aesthetic binomial – and that it presumes
interdependency relations between the fields of
spatial-functional, aesthetic and ecological. The
The quality of urban green space is assigned classical approach of quality by means of the
the meaning of quality-value as a positive functional-aesthetical binomial and the
characteristic which results from two types of implication of the ecological factor conduce to
measurable and immeasurable characteristics: the idea that the parameters of functionality
1. Primary qualities which respond to represent criteria for evaluating the quality of
biological and socio-economical needs by urban green spaces, having as the result the
direct effects in the general state of health, of efficiency in using the planted areas of the city
the environment and of micro-climate. (by enhancing the degree of socialization).
2. Secondary qualities which respond to the
psyche-social needs through indirect effects on RESULTS AND DISCUSSIONS
the psychological plan
The synthesis of the criteria and determinant
The quality of the urban green is directly and
factors of the urban green quality (Table 1) will
mandatory involved in the quality state of the
take into consideration 4 levels of approach:
urban environment through its positive and
physical, functional, aesthetical and ecological.
effects in the different areas of interest: spatial
Each of these approach levels is determined by
planning, functional, aesthetic-ambient and
a series of components, significance, criteria
381
and parameters of quality. The physical -spatial-functional structure defined by the
approach level primarily includes components location inside the city and the relationship
which relate to the emplacement inside the city, with it, dimensioning, shape, character and
localization through the relation green space – profile of functionality; all these have
site, dimensioning, mean and duration of usage, quantitative determinations and qualitative
shape. The functional approach level includes expression through effects: superior
the following components: the functional exploitation of the natural potential,
character and the functional profile. The percentages and proportions of the green
aesthetic approach level includes three texture and of the built texture, orientation,
components: stylistic composition, principles information, significance, accessibility, comfort
of composition and composition elements. The in usage, multi-functionality through the
level of ecological approach takes into recreational links, complexity and efficiency
consideration the fact that the urban green through spatial-functional diversity (Figure 1)
system is an essential component of the urban -the aesthetic approach defines the qualitative
ecosystem and also the ecological impact components which can be expressed through
generated by the urban green system on the significance, semantics, aesthetical diversity,
city. All these components, along with the participation in the creation of urban ambiance
significances, criteria, parameters and and contribution to the forming of the cultural
quantitative and qualitative determinations are landscape (Figure 2)
integrated in the table 1.
-the ecologic approach includes components
and features of quality which are expressed
CONCLUSIONS
through efficiency in social and human plan:
The features and components of the overall urban comfort, life quality, efficiency in the
urban green space quality are determined by the micro-climate plan, with positive effects in the
different types of approach: improvement of urban environment conditions
(Figure 3).
Table 1. Factors of the urban green quality

QUALITY – CRITERIA, PARAMETERS, FACTORS
LEVEL OF SIGNIFICANCE
COMPONENTS QUANTITATIVE QUALITATIVE
APPROACH ASSIGNED STATEMENT
DETERMINATION DETERMINATION
- compared to the
residence areas
EMPLACEMENT
- compared to the
- inside the city as - zonation (areas, - urban comfort
working areas
an urban ensemble - distances bands, points) - exploitation of
- compared to
- the relation city - - direction natural potential
endowments
green structure
- compared to
traffic
- in proportion to
- positioning inside
the same type of - orientation
the urban GS - personalization
GS units (guiding marks)
system - distances element of the green
PHYSICAL - in proportion to - information
- relation GS – ensemble
LEVEL OF different types of - significance
system of GS
APPROACH GS units
- in proportion to - accordance with the - decrease in time
the proximities natural character of and distances to
- localization: - in proportion to the site cover

relation GS – site natural elements - harmony - accessibility
- in proportion to - contrast - major influence
built areas - neutrality on proximities
- surfaces
DIMENSIONING - ha (m2) of GS - accessibility
- time for
- influence range - minutes (hours) - comfort
transiting
- serviced - users - indexes m2 of - facility of usage

population - number of GS/user - accessibility
382
inhabitants from - m2 GS/inhabitant
the serviced area - m2 GS/ha (urban
- surface serviced surface)
- organized
- individual - social
- means of usage - number of users
- unorganized
- group efficiency
- mixed
SIGNIFICANCE
ASSIGNED STATEMENT
- usage mean (hours)
- mean period of - maximum and - differential usage on
- usage span - comfort degree
usage minimum period of categories of users
usage
- major influence
- point-like
- surface (m2/ha) - diversification on proximities
(spots)
- accessibility
- decrease in
- direction physical
- linear - length (m, km)
- orientation discomfort on
urban arteries
- creation of
- contribution to urban green
SHAPE
- bands - surface (m2, ha) physical structure of corridors
urban areas - chain of
recreational links
-
beneficial effects
- surface (m2, ha) - repartition and in the urban
- plasmatic
- perimeters (m, km) diffusive form microclimate
- variety of the
urban texture
- number of unites of
GS
- inclusion in other
- types of
urban functions - mono-
endowments
- integrated (residence, functionality
- equipment,
commerce, culture, - specialization
installations
traffic, industry)
- functioning
capacities
FUNCTIONALITY
CHARACTER SIGNIFICANCE
QUANTITATIVE QUALITATIVE
COMPONENTS ASSIGNED STATEMENT
FUNCTIONALITY
CHARACTER - balance of GS - multi-
functions in functionality
proportion to other - variety
FUNCTIONAL integrated urban - complexity of - complexity
LEVEL OF - integrator functions integrated functions - superior
APPROACH (percentages) - functional hierarchy functional
- types of GS specific integration at
and complex urban level
endowments - socialization
- profile specific
- specialization
endowments - specificity of
- increased
- equipment, arrangements in
activity for
- mono-functional installations proportion to users
distinct
- arranged spaces profiles and
FUNCTIONAL categories of
(plantations and categories
PROFILE users
constructions)
- complex - balance of - functional
endowments, functional elements efficiency
- multi-functional
equipments, in relation to: - functional
installations and - importance diversity
383
arrangements - users (percentages) - increased
- plantation surfaces degree of activity
(m2, ha) for all users
- proportions, categories
percentages - socialization
- usage of style in
- architectural- - unit - contribution to
different proportions
STYLISTIC geometric - variety defining the
(total, partial)
COMPOSITION - free-landscape - conformism cultural
- proportions,
- mixed - nonconformism landscape
percentages
SIGNIFICANCE
ASSIGNED STATEMENT
- symmetry,
- compositional
asymmetry
character and - semantic
- axis
anticipated effects: significance:
- perspective
- dynamic - grandeur
- dominant
- static - monumental
- compositional - proportion of usage
COMPOSITION - exuberant, sad - uniformity
centre in the compositional
PRINCIPLES - order, equilibrium - variety
- focal point ensemble
- stringency - variety
- rhythm
- hierarchy - illustrative
- harmony
- cohesion - eloquence
- contrast
- diffuse - plasticity
- accent
- highlighting
- graduation
AESTHETICAL
- creation of
LEVEL OF
specific and
APPROACH
- landscape - volume general ambiance
- texture - aesthetic
- proportion vegetal- diversity
- waters mineral - surface
- vegetation - shape, contour - species
- symbolic language - construction
- traffics elements and decorative
materials
- decorative
COMPOSITION
objects
ELEMENTS
- significance:
- different rates and - base colours symbol of the
- colour proportions in the (primary and physical or
colour spectrum secondary) functional
character
- opportunity of
- brightness, character
penumbra, shade - natural expression
- light and shade
(rates and - artificial - visual and
percentages) functional variety
- comfort
LEVEL OF SIGNIFICANCE
APPROACH ASSIGNED STATEMENT
- presence in the - amelioration of - diversity of
THE URBAN - positioning
urban area: urban environmental urban texture
GREEN SPACE - distances
- zoning conditions in grounds - urban comfort
SYSTEM – - influence range
- disseminated of: - life quality
COMPONENT OF - plantations density
- concentrated - sanitary - biodiversity
ECOLOGICAL THE URBAN - dominant species
- linear - psychological - cultural
ECOSYSTEM (percentages)
- punctual - microclimatic landscape
- square - amelioration - influence on - efficiency in
ECOLOGICAL
- garden indexes of noxae and proximities: socio-human
IMPACT
- park pollution (air, water, - maximum plan:
384
- street bands and soil, dust, noise) - medium - diversification
alignments - state of vegetation - minimum of recreational
(percentages of activities
ageing) - culture
- resistant/non- - education
resistant species - efficiency in
microclimate
plan
Figure 1. Expo 2002 – Swiss National Expo – Yverdon-les-Bains, Switzerland. Image from inside the exhibition.
Figure 2. Image from Foggy Bottom, Norfolk, England. The vegetal element dominates through the composition of
herbs and conifers.
Figure 3. Image from Tineretului Park, Bucharest.
385
REFERENCES Bass B., 2002. Greening of Cities. Encyclopaedia of
Global Environmental Change. vol. 3. John Wiley &
Archibugi F., 1997. The Ecological City and the City Sons Ltd., Chicester., p. 93-95.
Effect. Ashgate Publishing Ltd., Aldershot, England, Turner T., 1996. City as Landscape. A post-modern view
p. 58-59. of design and planning. E& FN Spon, London.
386
DENDROLOGIC SPECIES IN STREET PLANTATIONS

WITH SOUND-INSULATING ROLE
Anca STĂNESCU, Elisabeta DOBRESCU
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Blvd, District
1, 011464, Bucharest, Romania
Abstract
The study analyses the capacity of different dendrologic species to diminish noise and also considers optimum varieties
of urban street plantations composition with the scope of noise reduction. Optimization restrictions will be analyzed –
especially extreme restrictions – along with optimization factors which depend on the dendrologic species assortment
and the quality of the architectural-landscape composition of the plantation; these aspects concord with some spatial
decree restrictions which the landscape specialist must provide for when completing the sound-insulating street
plantations.
Key words: arbours, scrubs, sound-insulating, street plantation.
INTRODUCTION Noise attenuation differs according to species:

Acer pseudoplatanus reduces noise by 10-12
Street plantations are urban green spaces of
dB, Tilia platyphilos and Viburnum lantana
general usage which accompany (border) the
reduce noise by 8-10 dB, while Carpinus
traffic arteries of the city; these plantations are
betulus, Quercus robur, Ilex aquifolium and
subjected to pollution aggression and noxae
Syringa vulgaris reduce noise by 6-8 dB.
generated by traffic. Phonic pollution is one of
Considering that noise is reduced by
the aspects of urban environmental pollution,
propagation (at the distance d) with 5 dB in the
which leads to the necessity of studying
absence of plantations, the same noise (with the
optimization versions of noise reduction.
value of N dB) will be reduced by 5 dB at half
The capacity of alignment plantations to
the distance (d/2) when plantations are
decrease sound depends on the dendrological
encountered; in the case of an optimized
species assortment, but also on their means of
plantation with dense leafage, the decrease in
arrangement by composition manner and
noise at the distance d/2 is even greater: NdB –
spatial-volumetric association of the species.
5dB – (10+6) dB (Figure 1).
MATERIALS AND METHODS Distribution manner and spatial-volumetric
association of species from street plantations
The optimization of street alignments may be accomplished by complex composition
compositions for noise reduction purposes is of alignments; the composition of complex
based on extreme conditions: dense and small alignments may include deciduous or
leafage, dense ramifications and small intervals rasineferous arbors and scrubs and hedges.
between leaf nodes.
387
Figure 1. Optimized version of complex alignments
RESULTS AND DISCUSSIONS height registries (on foreground the short or

medium vegetation and on background the tall
Analyzing some solution versions (Figure 2, 3,
vegetation) has as aesthetic role as well as an
4) for some complex alignments, one can
utilitarian one – noise and noxae reduction,
understand the aesthetic diversity given by
rhythm elements (1-4 individuals which form achieving an optimal effect of encapsulation
the cadence of the rhythm), the alternation of from noise, dust and noxae. Therefore, a
deciduous species (as repeatability elements) qualitative-cumulative effects are obtained
with the rasineferous species (as rhythm through the simultaneous presence of qualities
elements), or the alternation of arbor species and aesthetical effects, and also of those with
with scrub species (hedges or un-pared scrubs). protection roles against noise and various
The arrangement of these samples on several noxae.
388
Figure 2. Version 1 of complex alignments
389
CONCLUSIONS In order to create optimum street alignments,
the aesthetic aspect must also be taken account
The optimized version (Figure 1) of completing
(Figure 2, 3, 4), which is realized through the
complex alignments has a series of
combination of deciduous and rasineferous
optimization restrictions: extremal conditions
species of arbors and scrubs.
(dense leafage, small leafs, dense ramifications
and small intervals between leaf nodes), spatial
REFERENCES
restrictions which refer to distances and
available spaces for planting great numbers of ARCHIBUGI, F. 1997. The Ecological City and the City
arbors and scrubs, and alternative distribution Effect. Ashgate Publishing Ltd., Aldershot, England,
p. 63-65.
of species. ILIESCU ANA-FELICIA, 2003. Arhitecturĉ peisagerĉ.
In conclusion, optimization is achieved through Editura Ceres, Bucureƕti, p. 128-131.
quantity (large number of plants) and quality ST NESCU ANCA, 2011. Peisagisticĉ urbanĉ vol. II.
(adequate species according to the stated Editura Printech, Bucureƕti, p. 91-103.
criteria).
390
MISCELLANEOUS
THE INFLUENCE OF CLIMATIC CONDITIONS ON THE GRAPE

QUALITY IN THE WINE CENTER OF MURFATLAR IN 2012
Victoria ARTEM, Arina Oana ANTOCE

59 Marasti Ave., District 1, 011464, Bucharest, Romania
Abstract
The overall climatic conditions, through the main three factors (temperature, sunlight and humidity), exert a major
influence on the quality and quantity of the grapes produced during a particular year. For this work, studies were
performed on several white and black grape varieties authorized for culture in the vineyards of Murfatlar, by following
the parameters that define the grape maturation (evolution of sugar accumulation, decrease of acids concentration and
evolution of berry weight) and the grape quality at the harvest time. The studies showed that the year 2012 was a hot
one, with a period of sunshine recorded during the grapevine vegetation exceeding normal value (average of 50 years)
by 173.4 hours. The quantity of precipitations was similar to the level recorded as the multiannual average, but the rain
distribution was not uniform during the vegetation period. These particularities led to an unsatisfactory development of
the berries and lower yield. Due to the longer period with higher temperatures the ripening was premature, with a
certain benefit in favour of sugar accumulation, while the must acidity was insufficient, due to a more intense
catabolism at these temperatures. The harvest time started earlier for all the varieties, the recorded yields were much
lower, but the grapes were not affected by rot or other diseases. Due to the fact that the grape ripening depends on the
climate parameters of the year and on the region, in order to decide the optimum harvest period for a certain type of
wine the evolution of the grape maturity parameters should be determined each year and the change in climatic
influences should be systematically recorded.
Key words: climatic, grape, Murfatlar.
INTRODUCTION grapevine passes through the various

phenological phases faster, reaching
The influence of climate on agriculture and
technological maturity sooner and
especially on viticulture and wine production
accumulating higher concentrations of sugars in
has never been more obvious than today. What
the berries. While the grower or the winemaker
remains to be argued is the critical aspect
awaits for the grapes to gather aroma
regarding the optimal maturation time of
compounds, the acidity is lost by respiration
grapes, so that the wine obtained could acquire
and the resulted wines lack balance and need
the characteristics of a quality wine (Tate,
corrections in the cellar. As a result of the
2001; Bisson et al., 2002; Schultz and Jones,
warming of climate, in various regions a higher
2010).
concentration of alcohol in wines was observed
History has shown that winegrape growing
(Jones, 2007).
regions developed when the climate was most
conducive and that shifts in viable wine-
producing regions have occurred due to climate
changes in the past (Le Roy Ladurie, 1971; The study was carried out in the Murfatlar
Pfister, 1988; Jones, 2006). viticultural center and was aimed at both
For example, in any viticultural region, the renowned grape varieties for white and red
accumulation of sugars in grapes in optimal wines (Chardonnay, Riesling Italian,
concentrations now happens in a shorter time Sauvignon blanc, Feteasca regala, Cabernet
than before. Same is true about total acidity and Sauvignon, Pinot noir, Merlot, Feteasca neagra)
the aromatic profile optimal for winemaking. In as well as varieties obtained by researchers
a warmer-than-normal environment, the
393
from SCDVV Murfatlar (Columna and of base solution used during the titration, the
Mamaia) from the 2012 harvest. total acidity of the must can be calculated.
The data regarding climate were recorded using The total acidity was expressed in g/l H2SO4.
the weather station of the research station, The determination of the weight of the berries
model Weather Master 2000. was done using a laboratory technical scale,
The dynamics of grape maturation for the taking data on the weight of 100 berries.
studied varieties was monitored by following
the accumulation of sugars and the decrease of RESULTS AND DISCUSSIONS
acidity. At the same time, the evolution of the
The climatic conditions of the year, namely the
weight of the berries was also monitored.
main three factors (heat, light, humidity)
The determinations were made every 7 days, on
exercise an important influence on the process
dates established in advance. A number of 5
of grape maturation. This influence can actually
berries were harvested from each grape, as
decide the yield and the quality of that year’s
follows: one berry from the left side, one from
crop. In Table 1, the data on the three climate
the right side, one from center-front, one from
factors of 2012 are compared to the multi-year
center-back and one from the basis of the
averages recorded during the last 50 years in
grape. The 5 berries each were harvested from
the viticultural center of Murfatlar, which are
60 grapes (thus giving a total of 300 berries to
analyze). The 60 grapes were made of 10 considered “normal”.
grapes chosen from each of the 6 rows selected The sum of temperature degrees in the period
at random, and the location of each grape on of vegetation of 2012 was 4100.8°C, compared
the rows was chosen in zig-zag. The harvested to the average value of 3449°C. That is 651.8°C
berries were put in labeled plastic bags and more than what is considered the normal value.
transported to the laboratory in a cooler box, The maximum temperature recorded in this
avoiding their crushing and heating. period was 39.8ºC (in August), and the lowest
The determination of sugars was done using a temperature recorded was-2ºC (in April).
Smart electronic refractometer, on the basis of Regarding the precipitations, the sum of rainfall
the percentage of dry matter in the grapes. The was 246.4 mm, compared to the average value
read values were adjusted for temperature and of 245.7 mm. So the difference was very small,
the value of the sugar content of the must was but the distribution in time of the rainfall was
derived using data tables. not uniform.
The acidity of the must was measured by The total sunshine time was 1780.6 hours,
titrimetry by neutralizing the acids in a compared to the average of 1587.2 hours (see
determined amount of must using a solution of Table 1).
NaOH of known factor. Based on the amount
Table 1. Evolution of air temperature, precipitations and sunshine time during the growth season 2012, compared to the
multi-year averages
Air temperature Precipitations Duration of sunshine
Month T avg (50 years T avg Average T min Average T max Multi-year Multi-year
(mm) hours
average) (oC) (oC) (oC) average average
April 10.2 14.5 -2.0 28.6 33.5 44.5 160.7 210.1
May 16.2 19.8 8.4 31.0 50.2 145 261.8 281.1
June 20.4 21.2 12.6 37.2 53.2 7.4 314.5 314.0
July 22.6 28.0 13.1 38.2 35.6 33.2 323.7 341.6
August 22.6 26.1 10.7 39.8 31.6 8.8 305.5 345.6
September 17.6 20.7 7.8 36.0 41.6 5.6 221.0 288.2
The accumulation of sugars in the berries, first 2-4 weeks at the beginning of the process,
between the beginning of ripening and full and later slows down and even stagnates for a
maturity, happens quickly and in large period of 3-5 days (Cotea, 1985).
concentrations. The increase is faster in the The concentration of accumulated sugars in the
white varieties at full maturity (Figure 1) was
394
between 182-212 g/l, the lowest value being In case of the varieties for red wines the
measured for the variety Feteasca regala and maximum weight of 100 berries was reached
the highest value been seen in Italian Riesling. by the grapes of Mamaia variety, which
weighed 220 g at September 10 (Figure 4).
From the beginning of ripening to full maturity
the 100 berries gained 64 g, and after that, until
the harvesting date (September 18) they lost a
mere 2 g.
Figure 1. Evolution of the concentration of sugar for the

varieties for white wines
In case of the red varieties (Figure 2) the

concentration of sugars at full maturity varied
between 192 and 219 g/l, the lowest value Figure 4. Evolution of the weight of 100 berries for the
being seen in Cabernet Sauvignon and the varieties for red wines
highest value measured for Merlot and Pinot
noir. Under the conditions of the Murfatlar
viticultural center the fastest decrease of acidity
(the steepest slope on the graph) was observed
at the white varieties for the variety Italian
Riesling – from 23.7 g/l to 5.2 g/l (Figure 5).
The mildest slope (the slowest decrease) was
recorded for the variety Feteasca regala, from
14.0 g/l to 5.0 g/l.
Figure 2. Evolution of the concentration of sugar in the

varieties for red wines
The maximum weight of 100 berries of white

varieties (Figure 3) was attained in grapes of
Columna variety (163 g on September 10).
That means that from the beginning of ripening
to full maturity the weight of 100 berries Figure 5. Evolution of total acidity for the varieties for
white wines
increased with 94 g. Afterwards, until
harvesting, the grapes lost some weight so that
In case of the varieties for red wines (Figure 6),
100 berries weighed 7 g less than at full
the steeps slope of the graph of acidity was
maturity.
observed for Cabernet Sauvignon, from 20.3 g/l
to 5.5 g/l, and the mildest slope was recorded
for the Mamaia variety, from 8.5 g/l to 5.6 g/l.
Figure 3. Evolution of the weight of 100 berries for the

varieties for white wines
395
The rate of decrease of total acidity for the
varieties for white wines was between 0.83 and
1.03 g/day, with the lowest value observed for
Columna variety and the highest rate in Italian
Riesling. As regards the varieties for red wines,
the highest rate of decrease in total acidity was
observed for the variety Pinot noir (0.80 g/day)
and the lowest rate of decrease was seen in
Figure 6. Evolution of total acidity for the varieties for Cabernet Sauvignon and Mamaia (0.66 g/day,
red wines
Table 3).
The rate of accumulation of sugar in the Table 3. Rate of decrease in total acidity
varieties for white wines was between 1.96 and
Variety Metabolisation of acids (g/l/day)
3.12 g/day, with the lowest value in case of
-for white wines
Chardonnay and the highest value for Italian Chardonnay 0.84
Riesling. As for the varieties for red wines, the Columna 0.83
rate of accumulation of sugars was between Feteasca regala 0.97
2.13 g/day (Cabernet Sauvignon) and 1.42 Riesling Italian 1.03
g/day (Mamaia) (see Table 2). Sauvignon blanc 0.97
-for red wines
Table 2. Rate of accumulation of sugars Cabernet Sauvignon 0.66
Merlot 0.71
Variety Sugar (g/day) Feteasca neagra 0.67
-for white wines Mamaia 0.66
Chardonnay 1.96 Pinot noir 0.80
Columna 2.66
Feteasca regala 2.22
All the grape varieties registered sugar
Italian Riesling 3.12
Sauvignon blanc 2.53 concentrations between 195 and 234 g/l which
-for red wines alows them to be used for the production of
Cabernet Sauvignon 2.13 wines with controlled denomination of origin,
Merlot 1.60 with the exception of the variety Feteasca
Feteasca neagra 1.72 regala which met the conditions for the
Mamaia 1.42 Geographical Indication “Colinele Dobrogei”
Pinot noir 1.56
(Table 4.)
Table 4. Physico-chemical characteristics of the grapes obtained in the Murfatlar viticultural center, 2012 harvest
Physico-chemical characteristics Quality level*
Table Wines with Wines with Controlled
Variety Date Sugar Acidity (g/l Weight 100 wines Geographical Indication Denomination of Origin
(g/l) ac. tartric) grains (g) 144.6-
178.6-187.0 > 187.1
178.5
Varieties for white wines
Chardonnay 14.09.2012 216 6.12 106 x
Columna 19.09.2012 195 5.05 156 x
Feteasca regala 15.09.2012 187 6.43 119 x
Riesling Italian 20.09.2012 228 5.20 106 x
Sauvignon
21.09.2012 219 4.28 139 x
blanc
Varieties for red wines
Cabernet
25.09.2012 211 5.51 95 x
Sauvignon
Merlot 17.09.2012 221 6.12 109 x
Feteasca neagra 13.09.2012 208 6.89 118 x
Mamaia 18.09.2012 209 5.66 218 x
Pinot noir 24.09.2012 234 5.20 133 x
396
CONCLUSIONS The harvesting of the grapes is a very important
operation which must be done at the right time,
This study showed that 2012 was a hot year,
since it has a major influence on the yield and
with a total sunshine duration in the vegetation
quality of the harvest.
period that was 173.4 hours longer than normal.
The level of precipitations in the same period
REFERENCES
remained similar to the multi-year average, but
rainfall was not distributed uniformly. These Bisson L.F., Waterhouse A.L., Ebler S.E., Walker M.A.
factors led to an early development of the grape and Lapsley J.T., 2002. The present and future of
international wine industry, Nature, Vol 418, p. 496-
berries, the rise in temperature having a 699.
positive impact on the accumulation of sugars Cotea D. Valeriu, 1985. Tratat de oenologie, Vol 1, p.
in the grapes. The acidity of must at harvest 48.
time showed lower than optimal values, due to Jones, G.V. 2006. Climate and terroir: impacts of climate
the early arrival of the ripening phase and to a variability and change on wine, in Fine Wine and
Terroir – The Geoscience Perspective, Macqueen,
highest rate of metabolisation of organic acids R.W. and Meinert, L. D. (Eds.): Geoscience Canada
at higher temperatures. Reprint Series Number 9, Geological Association of
The unusual aspect of the 2012 harvest was that Canada, St. John’s, Newfoundland, p. 247.
some of the varieties for red wines reached full Jones G.V., 2007. Climate change and the global wine
industry, Procedings from the 13-th Australian Wine
maturity at the same time with certain varieties Industry Technical Conference, Adelaide, Australia.
for white wines. This phenomenon occurs only Ladurie E., Bray B., 1971. Times of Feast, Times of
in dry years with hot summers, when the Famine: A History of Climate Since the Year 1000,
maturation of grapes is forced and most Doubleday, Garden City, New York.
varieties mature at the same time. Pfister, C., 1988. ‘Variations in the spring-summer
climate of central Europe from the high middleages
The ripening of grapes differs from one year to to 1850, Wanner, H. and Siegenthaler, U. (Eds.) :
another and from one vineyard to another, Long and Short Term Variability of Climate Berlin,
according to climate conditions, and therefore Springer-Verlag, p. 57–82.
every year every grower must carefully monitor Schultz H. R. and Jones G.V., 2010. Climate induce
historic and future changes in viticulture, Journal of
the ripening of each variety. Wine Research, Vol 21, No 2, p 137-145.
Tate A. B., 2001. Global warming’s impact on wine,
Journal Wine Research, Vol 12, p 95-109.
397
RESEARCHES REGARDING THE INFLUENCE OF APPLE FRUIT

SORTING UPON THE ECONOMIC EFFICIENCY
IN THE COMMERCIALISATION PROCESS
Adrian CHIRA, LenuĠa CHIRA, Elena STOIAN

Abstract
Very often, the fruit tree- growing exploitations sell their gross production directly from the unit immediately after
harvesting, without storing it. The present paper aims at printing out the economic differences in apple within the fruit
tree-growing area of Voinesti –Dambivita country, comparing the gross selling of the quality – classified harvest. The
higher economic efficiency, calculated for the Redix and Ariwa varieties in comparison with the Jonathan and Golden
Delicious varieties is also due to the fact that for the first two varieties the production costs were lower, thanks to the
smaller number of phytosanitary treatments, since these have genetic endurance to the scab disease.
Key words: average quality coefficient, quality variation index.
INTRODUCTION More, this commercialisation method may

derive the producer of an important share of the
In Romania, agricultural exploitations more
profit which is transferred to the commercial
and more market-oriented, becoming
link. Fruit quality influences the valorization
increasingly commercial. In the traditionally
price directly (Stoian et al., 2002). The large
fruit tree-, grapevine – and vegetable – growing
fruit supply compared with the reduced demand
areas, the commercial feature is even more
results is unique – price selling, neglecting the
obvious, as production always exceeds
advantages of previous merchandise
consumption and the surplus is destined to
classification according to quality.
market. Nevertheless, the economic results of
The present paper aims at printing out the
the production activities are influenced by
economic differences in apple within the fruit
several factors such as: the exploitation size,
tree-growing area of Voinesti, Dâmbovita,
average productions, product quality, available
comparing the gross selling for a unique price
financial resources, the exploitation manager’s
per kilogram with the retail selling of the
experience, pedoclimatic factors, etc.
quality – classified harvest.
Production commercialisation also plays an
important part. Very often, the furuit tree-
growing exploitations sell their gross
production directly from the unit immediately The data resulted from the actual results of
after harvesting, without storing it. This apple production in a family exploitation
commercialisation method is determined by located in the fruit-tree growing area of
various factors, among which: insufficient or Voinesti, Dâmbovita. The varieties grown were
improper storage space; the need to obtain Jonathan, Golden Delicious, Redix, Ariwa.
immediate financial resources for starting the The data analysis was performed by calculating
production cycle again; difficulties in the retail some technical and economic indicators
selling system (particularly the reduced time (income, expenses, profit), while the variety
budget of the producer – the only of the quality assessment was made by determining
producer – the only or the main working force the quality variation indices and the average
of the exploitation, additional expenses quality coefficient of the variety and the group
resulting from going to the market, etc). of varieties (Pana et al., 1983).
399
RESULTS AND DISCUSSIONS various quality classes in the variety structure
indicates that the first and second quality class
For this purpose, the production results refer to
fruit exceed the Extra quality and industrial
the average production per hectare in the four
processing fruit.
varieties, out of which two (Redix and Ariwa)
The production expenses were higher in the
are genetically resistant to scab and powdery
Jonathan and Golden Delicious varieties,
mildew, while the others are considered the
compared with the Redix and Ariwa, as the
standard for the winter – stored varieties.
latter recorded less expense for phytosanitary
The fruit quality classification was based on the
protection due to their genetic resistance to
standard diameter: 66 mm – Extra quality, 60 scab and powdery mildew (Table 2).
mm – first quality, 55 mm – second quality; the Moreover, when production is aimed at
fruit has fallen prematurely from the trees commercialisation according to quality class,
improper for consumption were used for the production unit cost increases by 0,2 lei/kg
distillation. The prices of the area in 2001 were as a result of fruit classification.
different, according to quality class: 1,8 Lei/kg The profit was calculated as difference between
– Extra quality; 1,5Lei/kg – first quality; the selling income and the total expenses, and
1,1Lei/kg second quality; 0,4 Lei/kg for varied from one variety to another. The
industrial processing. For the gross selling, the analysis of the profit obtained from the two
price in the area was 1 Leu/kg. Table 1 presents commercialisation methods pointed out to the
the production results obtained and the income following:
from the two commercialisation methods. -the producer would be more economically
The average production per hectare and its advantaged if selling occurred according to
structure according to quality classes were quality criteria;
different from one variety to another, according -the additional profit per hectare might vary
to the variety potential and the weather between 272 lei (Jonathan) and 2766 lei
conditions of the year. (Redix), which means an increase in the profit
The production selling according to quality of 6,2-43,5%, compared with the gross selling;
classes may result in an income increase -the additional profits per hectare were almost
varying according to variety from 2850 Lei/ha from 4-7 times higher in the genetically –
to 5066 Lei/ha, which corresponds to an resistant varieties, compared with the standard
increase of 21,9%-41,3%, compared with the ones (Jonathan, Golden, etc).
retail commercialisation. The share of the
Table 1. Production and income obtained from gross and quality – class apple selling
Production Income from Selling income
Average Income from
according to quality Price valorisation according difference according to
Variety production gross valori-
class Lei/t to quality class quality class
t/ha zation Lei/ha
tons % Lei % Lei %
E 1,80 13,1 1800 3240 19,4
I 5,12 37,4 1500 7680 45,9
13,7 13700 +3012 +21,9
Jonathan II 4,40 32,1 1100 4840 29,0
Ind 2,38 17,4 400 952 5,7
Total 13,70 100 (1220) 16712 100 +22,6
E 2,20 17,5 1800 3960 25,6
I 3,80 30,1 1500 5700 12600 +2850 36,9
Golden 12,6
II 4,50 35,7 1100 4950 32,0
delicious
Ind 2,1 16,7 400 840 5,5
Total 12,6 100 (1226) 15450 100 +44,0
E 2,90 25,2 1800 5220 31,5
I 5,45 47,4 1500 8175 11500 +5066 49,3
11,5
Redix II 2,73 23,7 1100 3003 18,1
Ind 0,42 3,7 400 168 1,1
Total 11,5 100 (1441) 16566 100 10600 +4382 +41,3
400
E 2,45 23,1 1800 4410 29,4
I 5,12 48,3 1500 7680 51,3
10,6
Ariwa II 2,40 22,6 1100 2640 17,6
Ind 0,63 6,0 400 252 1,7
Total 10,6 100 (1413) 14982 100
Table 2. Profit from gross and quality – class selling

Profit
Gross selling Quality – class selling
difference
Variety Profit
Production expenses Income Production expenses Profit
Income lei/ha lei lei/ha %
lei/ha lei/ha lei/ha lei/ha
/ha
E 3240 1579,3 1660,7
I 7680 4508,9 3171,1
Jonathan 13700 9316 4384 II 4840 3869,9 970,1 272 6,2
-
Ind 952 2097,9
1145,9
Total 13700 9316 4384 16712 12056 4656
E 3960 2072,7 1887,3
Golden I 5700 3565,0 2135
12600 9324 3276 330 10,1
Delicious II 4950 4228,3 721,7
Ind 840 1978,0 -1138
Total 12600 9324 3276 15450 11844 3606
E 5220 1874,9 3345,1
I 8175 3526,5 4648,5
Redix 11500 5140 6360 2766 43,5
II 3003 1763,3 1239,7
Ind 168 275,3 -107,3
Total 11500 5140 6360 16566 7440,0 9126
E 4410 1714,0 2696
I 7680 3583,9 4096,1
Ariwa 10600 5300 5300 2262 42,6
II 2640 1676,9 963,1
Ind 252 445,2 -193,2
Total 10600 5300 5300 14982 7420 7562
The following emphases the influence of fruit than the second – quality and industrial
quality in the two groups – standard and processing. Nevertheless, per total, the
genetically – resistant upon the economic production of genetically – resistant varieties,
results obtained from commercialisation even if lower, has higher quality compared with
according the quality class. the standard group, particularly as a result in
The Iq variation index of quality according to the increase in the Extra and first – quality
variety groups was calculated by the formula: categories. The same is illustrated by the
average quality coefficient Kri, calculated for
each variety and
each group, according to the formula:
Where: Q1 = average production of genetically

– resistant varieties according to quality
classQ0 = average production of standard
varieties according to quality classThe values
obtained were Iq Extra = 1.34; Iq I-st quality = Where: qi = product quality according to
1.18; Iq II quality = 0.57; Iq ind = quality class; gi = production share according
0.23.Calculated for variety groups, the same to quality class; Ri = quality group
index was Iq = 0.84. The values of the variation coefficientThe average quality coefficient
index show that, in both variety groups, the measures the quality of a product or group of
Extra and first quality fruit number was higher products when production is delivered
401
according to quality class.The calculated values This results in profit loss which can reach more
were: Kri Jonathan = 2.54; Kri Golden = 2.51; than 40% of the total.
Kri Redix = 2.06; Kri Ariwa =2.11.The value It is necessary for the producers to become
of the coefficient is inversely related to the familiar with the advantages and to turn them
variety quality; therefore, the order of the to better account.
varieties from the view-point of quality is:
The establishment of some associative forms of
Ariwa, Redix, Jonathan, Golden Delicious (also
commercialisation (cooperatives) would
see their correspondence with total and
facilitate quality – class selling.
additional profits from quality-class
selling).The calculation of Kri for variety The apple varieties which are genetically
groups resulted in the value of 2.08 for the resistant to some diseases have superior
genetically-resistant varieties, and 2.52 for the productions of average quality compared with
standard varieties. This shows that the former the standard varieties, and their
record productions of superior average quality, commercialisation according to quality class
compared with the latter, while the deviation of can increase profits for the producers.
2.52-2.08=0.44 is the expression of this
difference. REFERENCES
Pana I., Perca V., Manoiu I, 1983. Methods of economic
CONCLUSIONS assessment of agricultural products quality. Ceres
Publishing House, Bucharest.
The current practice of production valorization Stoian E., Chira A., Chira L., Popescu Ghe., 2002.
in gross system is economically Economic efficiency of apple production
disadvantageous for the fruit producers. valorization according to quality. Lucrari stiintifice
U.S.A.M.V., Seria B, vol. XLV, p. 72-76.
402
STUDIES REGARDING THE E.U. STRATEGY IN THE FIELD

OF AGRO-FOOD PRODUCT’ S QUALITY
Lenu‫܊‬a CHIRA1, Adrian CHIRA1, Elena DELIAN1, ConstanĠa ALEXE2

1
59 MĉrĉƔti Blvd, Sector 1, 011464, Bucharest, Romania
2
Institutul de Cercetare Dezvoltare pentru Industrializarea Ɣi Marketingul Produselor Horticole
Horting, Intrarea Binelui nr. 1 A, sector 4, Bucharest, Romania
Abstract
Both basic agricultural products and those with an added value are confronted with an ever increasing competition on
the E.U. market due to the pressure carried out by the products originated in non- E.U. countries, where production
charges are lower. Therefore, this being the case, the main success recipe for farmers and processors remains the
promotion of quality. The E.U.’s agricultural policy aims at bear up their efforts through community systems and
regulations along two main guidelines: basic standards and measures for quality promotion. Over the last years the
consumers’ demand for ecological products has increased. To this effect since 1991 the E.U. has been applying a
standard which provides laws regarding the ecological agriculture both for European producers and processors and
for the exporters which come from non-E.U. countries and who want to commercialize ecological products on the E.U.
market. The basic principles of the ecological agro-food production have to comply with the requirements of the
834/2007 E.U Regulation which also makes mention of the method of labeling and certifying used for ecological
products. Obtaining qualitative products which also correspond to the requirements of the retail chains presupposes the
conformation to a set of standards, known worldwide under the name of Global G.A.P. rules, according to which
farmers and processors can become certified , thus obtaining the statute of the market’s preferred provider.
Key words: certification, farmers, labelling, quality, requirements.
INTRODUCTION minimal standards and labeling requirements

for customers’ information for a large number
Taking into consideration the fact that at the
of agricultural products and for some finite
moment Earth’s population consists of over 7
food products. Their aim is that of helping
billion inhabitants and in the near future a more
farmers deliver qualitative products that meet
substantial increase is foreseen it can be
the consumers’ expectations, avoid
inferred that the demand for agro-food products
disappointing the latter and facilitate the
will raise rapidly. Vegetables, fruit, grapes,
comparison of prices regarding different classes
wine and all the other horticultural by-products
of product quality (Banu et al., 2007).
have always been highly valued by consumers
Merchandising standards have been adopted in
all over the globe, playing an important role in
order to replace the various national standards
nutrition (Dejeu et al., 1997). The considerable
and to thus facilitate the commercial trades on
increase of the horticultural production has to
the exclusive market.
comply with the ever rising standards and
demands imposed by the consumers. Consumers’ request for ecological food
The E.U.’s agricultural policy has to bear up the products has risen constantly over the last
years, demand exceeding supply. The
farmers’ efforts in occupying the first positions
community market of agro-food ecological
in the quest for quality. The first steps for that
products continues to be fragmented at a
purpose have already been taken through
national level.
community systems and regulations along two
Since 1991 the E.U. has been applying a
main guidelines: basic standards and measures
standard that implies rules concerning
for quality promotion.
ecological agriculture for European producers
E.U’s merchandising standards are regulations
and processors and for the exporters from the
which imply definitions of products, basic/
403
third party countries who wish to bring world. Among other things, these relate to
ecological products into the community market. environmental protection, animal welfare and
The community standard strictly observes the the use of pesticides and veterinary products.
rules regarding ecological agriculture which Beyond these basic requirements, farmers and
have been established within the international food producers use their expertise and
standard adopted through Codex Alimentarius, imagination to give their products other,
which facilitates the recognition of community individual qualities valued by consumers.
ecological products that are exported to other
countries. MATERIALS AND METHODS
The goals of strategy and policy for the branch
In order to be able to perform this study
of the ecological agriculture were established in
concerning the E.U. strategy regarding the
2004 and defined in ‘’The European Action
quality increase of the agri food products we
Plan for Food Products and Ecological
have used a series of present-day standards,
Agriculture’’. The most important legislative
norms and legal requirements as our source of
process consisted of the framing of a new
information, among which I mention:
regulation regarding ecological agriculture,
- The E.U. Regulation 834/2007 regarding the
enacted in June 2007.
obtainment, labeling and certification of
The certification systems can enable retailers to
ecologic products,
assure or to impose conformation to certain
- The GlobalGAP Standard regarding the
production and delivery constraints. The
implementation of good agricultural
emergence of these systems along the years is
practices for the obtainment of the farm
the result of the assessments performed by the
certification according to the norms,
retailers which have highlighted the consumers’
- The Green Paper on agricultural product
wish of knowing more details about the food
quality.
products they are purchasing. The main aspects
As a result of these materials and of some
the consumers are concerned of are hygiene
research papers or specialized publications we
(sanitation), safety and the price.
have carried out a synthesis which shows the
Agricultural product qualities includes both
current situation and the E.U. tendencies
product characteristics (physical, chemical,
regarding the production and
microbiological and organoleptic features – commercialization of quality agri food
size, appearance, taste, look, ingredients, etc.) products.
and farming attributes (production method,
type of animal husbandry, use of processing RESULTS AND DISCUSSIONS
techniques, place of farming and of production,
etc.). The results of the study which was carried out
The quest for quality is a vital part of the EU were structured in such a manner so as to
agro-food sector’s strategy in the global enable the presentation of the aspects regarding
marketplace. The EU remains an important the production, labeling and certification of the
producer of basic agricultural products. ecologic products, of the geographical
Buying food and drink produced in the EU indications products and of that of traditional
means buying quality, chosen from a rich products.
diversity of products reflecting the different THE CURRENT STATE WITH
traditions and regions in the Community. REFERENCE TO THE LABELING AND
Consumers around the world know this: the THE CERTIFICATION OF AGRO-FOOD
EU’s agro-food sector has a reputation for high PRODUCTS
quality thanks to decades or even centuries of An essential goal of agricultural quality policy
hard work, investment, innovation and attention is to inform buyers and consumers
to excellence. about product characteristics and farming
This tradition of high quality operates in attributes. Unless buyers and consumers have
several ways. At a basic level, all farmers in the accurate, useful and guaranteed information
EU are legally bound to respect some of the about these characteristics and attributes, they
most stringent farming requirements in the cannot be expected to pay a fair price.
404
Agricultural quality policy has evolved over the schemes for geographical indications for
time. However, this evolution has taken place agricultural products and foodstuffs and for
on a piecemeal basis — instrument by traditional specialities guaranteed. This work
instrument, sector by sector. Combining the culminated in the Green Paper consultation and
various instruments into a more coherent whole the High Level Conference on Agricultural
and developing the overall policy would help it Product Quality held in Prague on 12-13
to deliver even stronger results. This further March 2009 (Green Paper on agricultural
development must be sufficiently flexible, take product quality-COM 2008 641).
account of the private and national schemes The main messages from stakeholders included
that dominate the market and ensure strong support for the E.U’s main quality
innovation. The full picture is shown in Figure schemes (geographical indications and organic
1. farming) and marketing standards, but also
Schemes can be either ‘certification-type’ or called for simplification and streamlining.
‘labelling-type’. Certification is best when the Farmers, producers and consumers urged
undertakings made are complex; these are greater use of place of farming labelling. On
usually laid down in a detailed specification the other hand, processors and retailers warned
and checked periodically (e.g. annually), for that it can be difficult to track the farming
example by a certifying body. Labelling origins of ingredients in processed foodstuffs.
measures are best for relatively straightforward As a result of these consultations and
claims that are normally self-declared by examination of the current measures, the
producers and subject to official controls. Commission has identified three main issues to
Both certification and labelling can show that a be addressed in developing agricultural product
product meets baseline standards. They can quality policy, namely:
also both be used to indicate value-adding – Information:to improve communication
qualities beyond baseline standards — either between farmers, buyers and consumers about
product characteristics or farming attributes. agricultural product qualities;
– Coherence: to increase the coherence of EU
agricultural product quality policy instruments;
– Complexity: to make it easier for farmers,
producers and consumers to use and understand
the various schemes and labelling terms.
Agricultural product quality policy should
contribute to achievement of the objectives of
the CAP. In particular, sustainability of farming
systems should be further enhanced through
quality policy, and the farming attributes of
products of such systems should be better
known and communicated to citizens and
consumers.
Against this background, it is proposed to
develop agricultural product quality policy
through a structured approach, comprising:
Figure 1. Quality and assurance certification schemes – For certification-type schemes, the
and marketing standards (http://ec.eur-lex.europa.eu/.) development of guidelines for good functioning
of certification schemes, and ensuring
Consultations on the development of coherence of any new E.U. schemes.
agricultural product quality policy began in – For labelling-type measures, development of
2006 with a stakeholder hearing, followed by a E.U.marketing standards within the single
conference in Brussels on 5-6 February 2007 Common Market Organisation.
(Codex Alimentarius Commission and the UN In addition, existing EU schemes and
Economic Commission for Europe). The marketing standards should be simplified and
Commission also launched policy reviews of clarified wherever possible.
405
Stakeholder comments concerned notably the In their responses to the Green Paper, farmers
introduction of the Ecolabel and its potential and producers, processors, traders and retailers
overlap with the existing organic scheme. supported marketing standards, saying they are
AIMS REGARDING THE PROMOTION needed for sellers to demonstrate the quality of
OF AGRO-FOOD PRODUCTS’ QUALITY product they offer, and for purchasers to know
E.U. farming requirements what they are buying. However, there were also
The Green Paper asked how farmers can best calls for simplification. EU marketing
show that they have complied with basic EU standards were criticised for being too detailed,
requirements, such as environmental rules, too prescriptive — relying on compulsory rules
animal welfare standards, and strict controls on when voluntary rules would suffice — and for
use of pesticides and animal health products. being too cumbersome to adapt quickly to
Two possibilities were raised: an ‘EU changing market circumstances.
requirements’ label or logo, or obligatory place- Many respondents to the Green Paper also
of-farming labelling. An ‘E.U. requirements’ wanted „optional reserved terms” to be
label would be shown on all products (EU or developed, for example to define what can be
imported) that had been farmed in line with EU called „mountain product” and „low carbon”.
minimum requirements. In the Green Paper „Optional” reserved terms do not have to be
responses, the overwhelming view from used to describe product in commerce or on
consumers, farmers, processors and retailers labels, but if they are used, the product must
and others, was opposed to such a label. On the correspond to the definition laid down.
other hand, many respondents supported In addition, consumers and farmers called for
greater use of place-of-farming labelling as greater use of „place of farming” labelling
giving useful basic information about (Table 2).
agricultural products. The Commission intends to address the
Marketing standards following aspects of marketing standards:
Marketing standards and product directives – need for general basic standard:
contain technical descriptions of agricultural Compulsory rules could be laid out in a general
products, their composition, characteristics and basic marketing standard. This would cover
the production methods used. Fisheries those matters where a voluntary approach
products are also covered by a specific might distort the single market or compulsory
marketing regime. They have been adopted not labelling is necessary to provide consumers
only by the EU, but also by multilateral bodies with basic information about products.
(Food Quality Schemes). There are four types – place-of-farming labelling:
of information contained in marketing To respond to many consumers’ and farmers’
standards (Table 1). preferences for labelling that identifies the
place where agricultural product was farmed,
Table 1. Types of marketing standard (http://ec.eur-
lex.europa.eu/.). the Commission will consider appropriate
labelling within marketing standards for
Examples: „free range, eggs:
agricultural products, while taking into account
„barn” egs, „first cold pressed”,
RESERVED TERMS extra virgin and virgin olive oil, the specificities of some sectors, in particular
„traditional method”, sparkling concerning processed agricultural products.
wine
Examples: friut: extra, class 1, Table 2. Demand for place of farming labelling
PRODUCT (http://ec.eur-lex.europa.eu/.).
class 2
CLASSIFICATION
Eggs: large, medium, small
Obligatory country of origin labelling
Examples: definition of butter,
and/or place of farming labelling has been
PRODUCT IDENTITY fruit juice, chocolate, wine,
introduced in Australia (all agricultural
extra virgin olive oil Place products and foodstuffs) and the US
Examples:fruit and vegetables: of farming (selected agricultural product sectors),
ORIGIN OR PLACE
place of harvest labelling among other countries. In the EU,
OF FARMING
Olive oil: place of harvest and obligatory place of farming labelling
LABELLING
of presiing applies to beef and veal, fruit and
vegetables, eggs, poultry meat, wine,
406
honey, olive oil (from 2009) and EU Geographical indications
organic products (from 2010). Origin Geographical indications are names that
labelling also applies to aquaculture
products.
identify products as originating in a territory
„Place of farming” in the context of where a given quality, reputation or other
marketing standards refers to the place of characteristic of the product is essentially
harvest of crop products, birth and raising attributable to its geographical origin
of livestock, the place of milking for dairy (ec.europa.eu). The geographical indications
cows, and so on. schemes provide protection of intellectual
„Origin” may refer, in the case of a
processed product, to the place of last
property rights for products described by
substantial transformation, and therefore registered geographical indications; and
not necessarily to the „place of farming” of marketing assistance, primarily by conveying
the agricultural product. information as to compliance with the
geographical indication system. The schemes
Optional reserved terms enhance the credibility of products in the eyes
Optional reserved terms should be used where of consumers and enable fair competition
it is necessary to define information about between producers.
product qualities for consumers (e.g. „first cold Representatives of producers of geographical
pressed” extra virgin and virgin olive oil). As a indication products have called for greater
possible alternative to EU legislation, the rights and control over their use — for
Commission will investigate further the option example, to control production (using quotas),
of using CEN, the European Committee for and to control the use of geographical
Standardisation, for detailed rules of this type. indication names on the packaging of processed
In addition, the Commission will examine the products.
feasibility of laying down specific optional In the international context, the geographical
reserved terms for „product of mountain indications system is well established in the EU
farming” and „traditional product”. and in many non-EU countries. However, in
One way of setting more appropriate marketing some trading partners, specific legislation does
standards could be to ask stakeholders to not exist or EU names are not widely protected
develop the rules themselves. This is already within the non-EU-country systems.
done for the development of industrial Organic farming
standards under CEN (Table 3). Since 1991, the E.U. organic farming
regulation has protected the identity and the
Table 3. CEN (http://ec.eur-lex.europa.eu/.). added value of the „organic”, „biologica”’,
CEN is a private entity with 30 „ecologica”’, „eco” and „bio” labels. Organic
national members, from EU farming is defined in EU legislation and at
Member States, and EFTA international level in a Codex Alimentarius
countries. CEN activities are the guideline. This means consumers can be
result of collective activities of
stakeholders, manufacturers, users,
confident of the quality of organic products and
The European it facilitates trade in the single market and with
research organizations, government
Committee for
departments, and consumers. non-EU countries.
Standardisation
(CEN)
CEN develops voluntary European In order to foster trade in organic products, the
Standards (ENs). These become the Commission will seek mutual recognition of
single common standard in all 30
countries. ENs help build a
organic standards with non-EU countries and
European Internal Market for goods will contribute to the development of the Codex
and services and assist international Alimentarius organic guideline.
trade. Beginning with 2010, the label of the organic
products obtained in E.U. feature the new eco-
– international standards: leaf logo, as shown in Figure 2.
The Commission will continue to refer to and
contribute actively to the development
of international standards.
407
-obtaining ecological products;
-promoting products with geographical
indications;
-certifying the production systems according to
the ISO, quality and food product safety
standards.
The certifying of producers and processors of
agro-food products according to the standards
(example Global G.A.P etc) determines their
Figure 2. The „Eco-leaf” logo of E.U statute as the market’s preferred provider.
The raise of the level of the consumers’
Traditional specialities education determines their purchasing of the
The EU scheme for registration of „traditional agro-cultural products according to the relation
specialities guaranteed” was intended to between quality and price, which favors those
identify and protect the names of traditional producers and processors which have been
products. certified according certain laws and standards
The Commission proposes to investigate the (for example Codex Alimentarius, etc).
feasibility of introducing the term „traditional
product” as a reserved term defined within REFERENCES
marketing standards and abolishing the current Banu C. et al., 2007. Calitatea si analiza senzoriala a
scheme. produselor alimentare. Editura AGIR, Bucuresti.
Dejeu L., Petrescu C., Chira A., 1997. Hortiviticultura si
CONCLUSIONS protectia mediului inconjurator, Editura Didactica si
Pedagogica, Bucuresti.
Practical steps should improve communication Codex Alimentarius Commission and the UN Economic
between farmers, buyers and consumers on the Commission for Europe (UN/ECE).
Green Paper on agricultural product quality: product
quality of agricultural products, unify rules on standards, farming requirements and quality schemes
agricultural products quality, and simplify – COM (2008) 641.
schemes and labels. http://register.consilium.europa.eu/pdf/en/
The main aims the E.U. farmers should be in http://foodqualityschemes.jrc.ec.europa.eu/en/documents
/ReportSTKHHearing_final.pdf
route for in order to obtain higher-ranking http://ec.eur-lex.europa.eu/.
product exploitation and a raise of the income http://ec.europa.eu/agriculture/organic/home
are:
408
A PRACTICAL APPROACH OF TRACEABILITY
IN THE WINE INDUSTRY
George A. COJOCARU, Arina Oana ANTOCE

Abstract
Traceability in the wine industry has an undeniable role in a quality assurance management system. It ensures that all
manipulations of raw materials, ingredients and final products are recorded on specific documents, created especially
to allow a rapid retrieval of the product history. The wine supply chain requires traceability from grape production to
processing and wine distribution. Maintaining traceability records on specific documents has many benefits for both
producers and consumers. A practical traceability system ensures: efficient process logistics, rapid decision making by
the producers, but also provides the consumer confidence in the authenticity of wines and proper usage of approved
oenological practices and safety procedures during production. In spite of the legal requirements for traceability
systems, they are not widely applied in our wine industry and the documents involved are difficult to be maintained and
updated. This paper proposes a series of specific documents to be used for a more efficient and practical system of
traceability in the wine industry.
Key words: traceability, wine, quality assurance management system.
INTRODUCTION However, “traceability means the ability to

trace and follow a food, feed, food-producing
Traceability is regulated by national law no.
animal or substance intended to be, or expected
150/2004 on food safety and feed, modified
to be incorporated into a food or feed, through
and completed by law no. 412/2004 and by
all stages of production, processing and
Regulation (EC) no. 178/2002 of the European
Parliament and of the Council of 28 January distribution” (Legea nr 150/2004 si Legea
2002, laying down the general principles and 412/2004). Article 18 of Regulation (EC) no.
requirements of food law, establishing the 178/2002 refers explicitly to tasks of operators
European Food Safety Authority and laying regarding traceability. According to Article 18
down the procedures regarding food safety. In of Regulation (EC) no. 178/2002, winemaking
accordance to legislation, operators must apply operators must comply with the following
the food legal regulation at all stages of the rules:-traceability shall be established at all
wine supply chain, from the production and stages of production, processing and
processing to transportation and distribution distribution.-winemaking operators shall be
stages. Thus, operators are responsible by law able to identify any person from whom they
for ensuring the traceability of products at all have been supplied with grapes, must, wine, or
stages of the production, processing and any oenological substance intended to be, or
distribution, including raw and auxiliary expected to be, incorporated into grapes, must
materials packaging materials and operating or wines. -winemaking operators shall have in
materials. Moreover, materials and oenological place systems and procedures which allow for
practices are specified by Commission this information to be made available to the
Regulation (EC) no. 606/2009 of 10 July 2009 competent authorities on demand.-winemaking
laying down certain detailed rules for operators shall have in place systems and
implementing Council Regulation (EC) no. procedures to identify the other businesses to
479/2008 as regards the categories of grapevine which their products have been supplied. This
products, oenological practices and the information shall be made available to the
applicable restrictions. competent authorities on demand.-winemaking
products shall be adequately labeled or
409
identified to facilitate its traceability, through - Auxiliary materials used, referring to
relevant documentation or information in fertilizers, pesticides and herbicides;
accordance with the relevant requirements of - Dose, referring to dose of the treatment
more specific provisions. material used;
- Responsible, who is the person who
MATERIALS AND METHODS performed the work;
- Observations, another notes.
Implementation of traceability in wine industry
Grape Maturation Report. Necessary to
implies the existence of correlated registration
record grape maturation evolution data from
documents for each stage of production and
vineyard parcels, this document is helping to
distribution. For this reason all processes and
determine the optimal time to harvest; is the
technological operations must be recorded in
most critical decision of the grower and
specified documents, corresponding to each
winemaker. Good quality of the grapes at
product stage.
harvest allows for a maximum potential in wine
Based on the specific technology of grape
quality. Incomplete ripen grapes contain less
production to distribution it was considered
sugar, very high acidity, harsh tannins and
necessary to create specific documents to
'green' aromas. Overripen grapes may also lead
achieve total traceability.
to uncharacteristic flavor and low acidity. If the
This tracking system was developed for a
assessment is not done properly and harvest
winery located in southern Romania, in the
decision is not appropriate, wine quality may
wine region 'Terasele Dunarii' where 500
be affected (Zoecklein B.W., 2001).
tonnes of grapes of various varieties are
Unfortunately, grape maturity assessment is
processed yearly.
difficult to perform, due to the involvement of
In order to implement a traceability system, the
several factors and the necessity to measure
first issue to be resolved concerns the division
several physico-chemical parameters, that are
of the entire surface in farms, physical blocks
not always directly correlated (Coombe B.G.,
and parcels. It is also necessary that the
1992; Robinson S.P. and Davies C., 2000).
division of the total area takes into account the
This document is kept for each parcel and
grape varieties grown and specific climatic and
contains the following identification elements:
edaphic conditions because the grapes are
- Variety;
harvested and wine batches are formed based
- Vintage;
on the grape quality and characteristics. If the
- Farm / Physical Block / Parcel, a code
surfaces are not divided properly, the quality of
which is linked with Vineyard Record
the final products may be affected.
Keeping and Harvest Delivery records.
The specific documents deemed necessary to
In addition to the identification elements, this
maintain a robust traceability system are
document contains sets of analyzes of grapes
hereafter presented.
from that parcel (Date; Sugars, in g/l; Total
Vineyard Record Keeping File. Necessary to
Acidity, in g/100 ml tartaric acid, pH, Brix,
record data from vineyard parcels, this
document is a table that contains the following Brix*pH² index, Brix/TA index and% v/v
columns: estimated alcohol).
- Date; Harvest Delivery Note. It is a document that
- Farm / Physical Block / Parcel (F/PB/P) , must contain the following identification
same with batch of grapes and containing elements: Document number; Variety; Farm
the number of a parcel from specified / Physical Block / Parcel; Estimated quantity
physical block and farm (eg. 1/221/4, which (kg) ; Real quantity (kg) . This document
means F/PB/P); this is the most important accompanies the grapes to the wine cellar and
key link for history retrieval; used for tracking and accounting records. The
- Area (ha) , referring to parcel; estimated quantity is evaluated at the flowering
- Preformed works, a column where specific stage and is used for planning in the cellar
operations performed in the vineyard are ahead of harvest.
described; Quantitative Grape Receiving Report. It is a
tracking document used to link the small grape
410
batches delivered to the winery with full - Outputs;
batches of grapes resulted from several small - Differences;
grape baches and used for a batch of wine. The - Measurement unit;
report contains the following columns: - Initial tank no.;
- Date/Time; - Final tank no.;
- No. of Delivery note; - Lees tank no.;
- Variety; - Oenological materials used,
- Harvest mode; concentrations, parameters, analyses, etc.
- Grape batches (F/ PB/P); This document shows the history of any wine
- Variety purity (%) ; and allows the oenologist to find at any
- Sanitary state of the grapes (% of the sane moment each stage of the applied technology.
and affected grapes); Blending Report. It is a document that is
- Quantity of small batch (kg); drawn when the oenologist wants to make a
- Total amount per full batch (kg); blend. This document serves both as tracking
- Full batch code. It is used to determine the sheet and a file for the accounting department.
quantity of grapes used per batch of It includes the following identification
must/wine. elements:
Qualitative Grape Receiving Report. It is a - No. of document / date;
quality control document for full batches. It - New batch code;
contains the following identification elements: - Variety / Assortment;
- No. of document / Date; - Initial Quantities and Batches from which
- Variety / Assortment; the blend was formed.
- Vintage; Additional information may be tank numbers
- Full batch code; of the used batches and alcohol concentration
- Total amount of grapes (kg) ; (v/v) of the blend.
- Variety purity (%) ; Bottling Report. This documents is filled
- Sanitary state of grapes (%) ; when wine is ready for bottling. It contains the
- Harvest method; following identification elements:
This document is drawn up after cold settling - Internal batch number;
occurs and should contain almost all analyses - External batch:No. of document / date;
which can be made. Basic analyses are grouped - Variety / Assortment;
as following: - Vintage.
- Sensory analysis of must (Appearance; Contains two tables. First table contains: Input
Color; Odor; Taste;). quantity (liters); Effective quantity (liters);
- Physico-chemical analysis of must (Yeast Loss (liters); Bottling recipient capacity (litri);
Assimilable Nitrogen; Total acidity, g/l No. of bottling recipients used; No. of Samples;
tartaric acid (pH=7); Sugars; Density; pH; The second table contain: Materials used; Ma-
Brix; Index Brix*pH²; Index Brix/Ta; nufacturer; Batches; Quantity of materials (in
Turbidity;). pieces); Outgoing finished products (pieces);
- Analysis performed after corrections Loss (pieces); Samples materials (pieces).
(Acidification; Enrichment of sugar; Total This report may contain a section for
acidity, g/l tartaric acid (pH=7); Sugars, comments.
refractometrically; Density; pH; Brix; Index Declaration of conformity. It is the document
Brix*pH²; Index Brix/Ta;). that accompanies the delivered goods Manda-
Winemaking Batch Sheet. This is the main tory information which appears on this
document that includes the process document is:
interventions performed during all stages of - No. of document / date;
winemaking. The document contains the full - Beneficiary;
batch code and the following columns: - Invoice / Delivery note no. / date;
- Process / Technological operation; - Brand / Class of quality / Variety /
- Date and time; Assortment;
- Inputs; - Batches of wines delivered;
411
- Analysis reports;
This document may contain a text by the RESULTS AND DISCUSSIONS
manufacturer assumes the responsibility that
The result of wine traceability chain is drawn
the products comply with the law.
through a flow chart in figure 1.
Delivery Note or/ with Invoice. Proof of sales
and purchases of goods.
Figure 1. Flow chart of traceability at all stages of the production, processing and distribution.
CONCLUSIONS consumer. In case of identifying any safety or

quality issue during the process of winemaking,
A traceability system for a medium-size cellar
storage or bottling, based on these easy-to-use
was proposed and the system documents were
documents we can quickly and surely withdraw
drawn and presented. The system improves the
from the market that particular batches, with
management in vineyards and cellars, by
minimal financial effort.
retrieval history of a parcel and / or a product.
This model has the advantage against tracking
The usage of these system documents to
computer programs, that enables centralized
maintain traceability in wine production units
view of history on winemaking batch sheet
improves the quality management, by ensuring
which is displayed directly on the wine contai-
that the raw and auxiliary materials are of
ner. So the oenologists can find out at any time
quality, the practices are also recorded and
the wine history.
controlled, so that the resulted wines are safe
and of the expected level of the designed Another advantage is that the operations per-
quality. formed are written in winemaking batch sheet
by the cellar foremen at the moment of opera-
Also, traceability documents are and important
tion performing and thus is not possible to
part of the product recall procedure. They
forget to update the winemaking batch sheet. In
contain information which allows us to detect
the case of a software, updates can be forgotten
certain deviations from the normal process
with major consequences.
which may make the final product unsafe or of
a lower quality than the one expected by the Also, these winemaking sheets posted on the
tanks provide quick information and allow for
412
an efficient decision making. Viewing the re- REFERENCES
sults of regular analyses on these records gives Coombe B.G., 1992. Research on development
the oenologists valuable information regarding andripening of the grape berry. American Journal of
the stability of wine, for example, or what Enology and Viticulture 43, p. 101-110.
wines to take for more detailed tests in the view Robinson S.P., Davies C., 2000. Molecular biology of
of creating commercial blends. grape berry ripening. Austral. J. Grape Wine Res. 6,
p. 175-188.
These documents can also be maintained and Zoecklein B.W., 2001. Grape sampling and maturity
updated by using software programs that works evaluation for growers. Wine East. 29, p. 12-21.
with sheets and can create databases (i.e. Excel Legea nr. 150 din 14 mai 2004 privind siguranƜa
software). Such documents can be updated in alimentelor ƕi a hranei pentru animale;
Legea nr. 412 din 18 octombrie 2004 pentru modificarea
real time or weekly, so that, all the information ƕi completarea Legii nr. 150/2004 privind siguranƜa
appearing on tanks, can also be maintained on alimentelor ƕi a hranei pentru animale;
computer. Regulation (EC) no. 178/2002 of the
This type of tracking also provides information EuropeanParliament and of the Council of 28 January
2002, laying down the general principles and
to be used to establish the cost of wine and the requirements of food law, establishing the European
price. Accountants can use these data to Food Safety Authority and and laying down
calculate prices and to classify in accordance to procedures in matters of food safety;
the price each batch of wine. Commission Regulation (EC) no. 606/2009 of 10 July
2009 laying down certain detailed rules for
Last but not least, the fact that the team leaders implementing Council Regulation (EC) no.479/2008
is required to write down all the technological as regards the categories of grapevine products,
operations performed, makes them more oenological practices and the applicable restrictions
quality oriented and responsible for the work
done.
413
SAMPLING PROCEDURES APPLICABLE FOR THE QUALITY

ASSURANCE SYSTEMS IN THE STARCH INDUSTRY
Georgiana DECIU, Arina Oana ANTOCE

59 Mărăúti Blvd, District 1, 011464, Bucharest, Romania
Abstract
Sampling is one of the most important factors influencing the analysis results. When the results of several analyses are
used to develop and implement a monitoring system which must assure the product quality and food-safety, this
becomes a primary element. As an analysis result can be used in the development of such system, the sampling should
be as accurate as possible. The sampling methods are various and depend in principal by the sampled material, the
material state of aggregation, physical and chemical properties and last but not least, by the presentation mode. At this
moment, the sampling procedures applicable in the starch industry are presented in several standards and have a
general description based on product categories (e.g.: ISO 24333:2009 Cereals and cereal products – Sampling). For
the industry, however, these general guidelines are sometimes difficult to apply as such. This paper aims to review the
sampling procedures applicable in the starch industry and to create specific sampling method guidelines developed for
a starch factory in order to create an optimal monitoring system capable to assure the quality and food-safety for
products and by-products.
Key words: food-safety, quality, sampling, starch.

Sampling is one of the most important factors In order to establish a specific optimal
influencing the analysis results (Alexander et sampling procedure for the starch industry, we
al. 2007; Thomas et al., 2012). The sample has identified the main international sampling
to be big enough and representative for whole instructions included in various standards and
batch. The sample size is proportional to the regulations as follows: SR EN ISO 24333:2009
batch size and depends, in principal on the Cereals and cereal products – Sampling,
material type and analysis type (Paakkunainen Commission regulation (EC) No 401/2006 of
et al., 2009; Tokman N., 2007). 23 February 2006 laying down the methods of
For the development of a monitoring system sampling and analysis for the official control of
capable to assure the product quality and food the levels of mycotoxins in foodstuffs,
safety the most important step is fixing the Commission Regulation (EU) No 836/2011 of
optimal and specific sampling procedure. 19 August 2011 amending Regulation (EC) No
For the starch industry, excepting intermediary 333/2007 laying down the methods of sampling
products, there are three types of materials: and analysis for the official control of the levels
grains (corn and corn germs), milled products of lead, cadmium, mercury, inorganic tin, 3-
(starch, corn gluten feed and corn gluten meal) MCPD and benzo (a) pyrene in foodstuffs,
and viscous liquids (glucose syrups). Commission Regulation (EC) No 152/2009 of
Taking into account all these aspects, this paper 27 January 2009 laying down the methods of
presents and compares all the international sampling and analysis for the official control of
sampling instructions applicable for the cereals feed, Commission Directive 2002/63/EC of 11
and cereals products in order to establish the July 2002 establishing Community methods of
specific optimal sampling procedure for the sampling for the official control of pesticide
final products in a starch factory. residues in and on products of plant and animal
origin and repealing Directive 79/700/EEC,
Decree ANSVSA No. 27 of 06.06.2011
regarding the approval of hygiene and
415
microbiological criteria for foodstuffs other different for mycotoxins, heavy metals and
than those mentioned in Regulation (EC) no. pesticides.
2.073/2005 of 15 November 2005 on In Table 1, we present the documents where
microbiological criteria for foodstuffs, sampling instruction can be found. It can be
Commission Regulation (EU) No 619/2011 of seen that for specific quality analysis the only
24 June 2011 laying down the methods of harmonized and internationally recognized
sampling and analysis for the official control of sampling procedure is SR EN ISO 24333:2009.
feed as regards the presence of genetically This standard indicates a single sample size (1
modified material for which an authorisation to 3 kg) depending on various criteria like the
procedure is pending or the authorisation of batch size, the minimum number of elementary
which has expired. samples and its size, the sampling method
The international standard SR EN ISO (mechanical or manual) or the packaged unit
24333:2009 Cereals and cereal products – weight.
Sampling was the starting point and it was The minimum sample size is indicated also for
adapted by other relevant sampling documents contaminants like ochratoxin A (10 kg),
to be found in EU-regulation or specific pesticides, heavy metals, dioxin (1 kg), other
literature. SR EN ISO 24333:2009 is applicable contaminants (3 kg). To complete these values,
“for the dynamic or static sampling, by manual the EU regulations establish the sample size
or mechanical means, of cereals and cereal depending on the batch size and packaging
products, for assessment of their quality and mode (bulk or packed).
condition” (SR EN ISO 24333:2009). It is not Taking into account the product categories
appropriate for the determination of the presented in these documents, we split starch
presence of adventitious genetically modified products as follows:
material in non-GM products and for - Grains:
microbiological criteria. These omissions - in bulk:
would be dealt with only the EU-regulation and - corn
specific literature. - corn germs
The information contained in these documents - packed:
were interpreted, adapted for the intended use - corn germs:
and transposed into a centralised, specific and - in big-bags
optimal sampling procedure. - Milled products:
- in bulk:
RESULTS AND DISCUSSIONS - corn starch
- corn gluten feed
For cereals and cereal products we identified - corn gluten meal
seven referential documents which are - packed:
applicable for the starch industry. - corn starch:
Taking into account the instructions mentioned - in paper bags of 25 kilos
in these documents and the specific of the - in big-bags
starch factory took for example, we centralized - corn gluten feed:
the information and issued a single sampling - in big-bags
procedure for raw material and final products. - corn gluten meal:
There were identified four categories of - in big-bags
analyses: specific for product quality - Liquid products:
determination, for contaminants identification - in bulk:
and determination, microbiological analyses - glucose syrup
and analyses for non-GMO products. - packed:
For contaminants the sampling procedures - glucose syrup:
depend on the type of the contaminant, being - in recipients of 45 and 150 kilos
- in recipients of 1100 kilos
416
Table 1. Sampling procedures applicable for starch industry
Sampling procedures applicable
Product category Analysis category
International standards Legislation (EU / RO) in force
Specific for quality SR EN ISO 24333:2009 -
Contaminants
mycotoxins SR EN ISO 24333:2009 Commission Regulation (EC) No 401/2006
Food products heavy metals SR EN ISO 24333:2009 Regulation (EC) No 333/2007
pesticides SR EN ISO 24333:2009 Commission Directive 2002/63/EC
Microbiological - Decree ANSVSA 27/2011
non-GMO - 2004/787/EC: Commission Recommendation
Specific for quality SR EN ISO 24333:2009 -
Contaminants
mycotoxins SR EN ISO 24333:2009 Commission Regulation (EC) No 152/2009
heavy metals SR EN ISO 24333:2009 Commission Regulation (EC) No 152/2009
pesticides SR EN ISO 24333:2009 Commission Directive 2002/63/EC
Feed products
dioxine SR EN ISO 24333:2009 Commission Directive 2002/70/EC
Commission Regulation (EC) No 152/2009;
other contaminants SR EN ISO 24333:2009
Commission Directive 2002/63/EC
Microbiological - -
non-GMO - 2004/787/EC: Commission Recommendation
The analysis categories were split in six presence of genetically modified organisms
categories: were grouped and included in Tables 3 and 5.
- specific for quality In all these tables the abbreviations mean:
- mycotoxins -parameters measured for all types of sampling
- heavy metals procedures except those involving
- pesticides microbiological analyses:
- microbiological - CP: product code
- non-GMO - DA: packed unit weight (kg)
For each product and analysis category we - DP: number of packed units in a pallet
established the specific sampling procedure, - DL: batch size (kg)
taking into account the batch size, the - NP: number of pallets in a batch
minimum number of elementary samples and - NA: number of packed units in a batch
quantity of the total sample. - FA: sampling frequency / packed unit
For an easier application of this procedure we - FP: sampling frequency / pallet unit
used an excel file which calculated the - NPE: number of incremental samples
sampling frequency depending on the number - MPE: size of incremental sample (kg)
of packaging units and pallets. - PG: size of global sample (kg)
An example for a batch of an approx. 25000 - PL: size of laboratory sample (kg)
kilos is presented in Tables 2 and 3 for food -parameters measured for microbiological
products and in Tables 4 and 5 for feed analyses:
products. - FP: sampling frequency / pallet unit
The types of analyses performed were grouped - NPT: number of tested samples
in accordance to the sampling procedure - MPT: tested samples weight
similarities, so that the analyses specific for -type of food product:
quality and those for mycotoxins and heavy - PB: corn
metals were presented together (Tables 2 and - AV: bulk starch
4), while the analyses for the detection of - AS: starch packed in 25 kg bags
pesticides, microbial contamination and the - AB: starch packed in big-bags
- GV: bulk glucose syrup
417
- G45: glucose syrup packed in 45 kg
recipients
- G15: glucose syrup packed in 150 kg
recipients For all packed products, food and feed, the
- G11: glucose packed in 1100 kg recipients sampling frequency for all analyses types,
- GrV: bulk germs except non-GMO and microbiological analyses,
- GB: germs packed in big-bags was calculated following the recommendations
-type of feed product: given by SR EN ISO 24333:2009, taking into
- TV: bulk corn gluten feed account the possibilities of the starch factory
- TB: corn gluten feed packed in big-bags (e.g.: only manual static sampling) and
- FV – bulk corn gluten meal considering that there are no significant
- FB – corn gluten meal packed in big-bags differences between the sampling methods used
The values in the table that are marked with for its (Knight and Wilkin, 2010).
yellow colour and font italic are fixed values For bulk products, food and feed the sampling
established according to EU regulation and procedure is applied as shown in Table 2 and
taking into account the factory possibilities. using the rules shown in figure 1.
These values should not be changed. These rules follows the examples presented in
The values coloured in green should be SR EN ISO 24333:2009 for products located in
introduced by the operator in order to identify trucks: 3, 5, 8 and 10 sampling points.
the correct values from the white cells.For For quality analyses, in order to determine the
example, to identify the sampling procedure for sampling frequency / packed unit (FA), the
a batch of starch packed to bags of 25 kilos it parameters DL (batch size), MPE (size of
was established according to SR EN ISO incremental sample), PG (size of total sample)
24333:2009 that the size of incremental sample and DA (packed unit weight) should be known;
(MPE) should be 0.1 kg, the size of global for the calculation of FA the formula was used:
sample (PG) and the size of laboratory sample
should be 1 kg for each one.
As it is known that a bag has 25 kg and a pallet
has 30 bags, it was easy to identify that for a
batch of 24750 kg, the number of pallets in a The sampling frequency / pallet unit (FP) was
batch (NP) is 33 and the number of packed after that calculated by using the following
units in a batch (NA) is 990, using the formula:
following formulas:
Then it was identified that the sampling For the packed products, the number of
frequency / packed unit (FA) should be 99, the incremental samples, NPE value, can be also
sampling frequency / pallet unit (FP) should be calculated, based on the number of pallets in a
3.3 and the number of incremental samples batch (NP) and the above calculated FP value,
(NPE) should be 10, using the following as follows:
formulas:
418
Table 2. Example of sampling procedure for a 25000 kilos batch of food products for which analyses of quality,
mycotoxins and heavy metals are performed
FOOD PRODUCTS
DL NP NA QUALITY MYCOTOXINS HEAVY METALS
CP DA DP FA FP NPE MPE PG PL FA FP NPE MPE PG PL FA FP NPE MPE PG PL
PB - - 25000 - - - - 8 0.4 1 1 - - 8 1.3 10 10 - - 8 0.4 1 1
AV - - 25000 - - - - 3 0.4 1 1 - - 3 0.4 1 1 - - 3 0.33 1 1
AS 25 30 24750 33 990 99.0 3.3 10 0.1 1 1 9.9 0.3 100 0.1 10 10 330.0 11.0 3 0.33 1 1
AB 1000 1 25000 25 25 2.5 2.5 10 0.1 1 1 0.3 0.3 100 0.1 10 10 8.3 8.3 3 0.33 1 1
GV - - 25000 - - - - 3 0.4 1 1 - - 3 0.4 1 1 - - 3 0.33 1 1
G45 45 12 24840 46 552 110.4 9.2 5 0.2 1 1 5.5 0.5 100 0.1 10 10 184.0 15.3 3 0.33 1 1
G15 150 4 24600 41 164 32.8 8.2 5 0.2 1 1 1.6 0.4 100 0.1 10 10 54.7 13.7 3 0.33 1 1
G11 1100 1 24200 22 22 2.2 2.2 10 0.1 1 1 0.2 0.2 100 0.1 10 10 7.3 7.3 3 0.33 1 1
GrV - - 25000 - - - - 8 0.4 1 1 - - 8 0.4 3 3 - - 3 0.33 1 1
GB 800 1 12000 15 15 1.5 1.5 10 0.1 1 1 0.2 0.2 100 0.1 10 10 5.0 5.0 3 0.33 1 1
Table 3. Example of sampling procedure for a 25000 kilos batch of food products for which analyses of pesticides,
microbiological contamination and non-GMO content are performed
FOOD PRODUCTS
DL NP NA PESTICIDES MICROB. non-GMO
CP DA DP FA FP NPE MPE PG PL FP NPT MPT FA FP NPE MPE PG PL
PB - - 25000 - - - - 8 0.4 1 1 - - - - - 10 0,5 5 2,5
AV - - 25000 - - - - 3 0.33 1 1 - 3 0.5 - - 10 0,5 5 2,5
AS 25 30 24750 33 990 330.0 11.0 3 0.33 1 1 6.6 5 0.5 31 1 31 0,2 5 2,5
AB 1000 1 25000 25 25 8.3 8.3 3 0.33 1 1 5.0 5 0.5 5 5 5 1,0 5 2,5
GV - - 25000 - - - - 3 0.33 1 1 - 3 0.5 - - 10 0,5 5 2,5
G45 45 12 24840 46 552 184.0 15.3 3 0.33 1 1 9.2 5 0.5 23 2 23 0,2 5 2,5
G15 150 4 24600 41 164 54.7 13.7 3 0.33 1 1 8.2 5 0.5 13 3 13 0,4 5 2,5
G11 1100 1 24200 22 22 7.3 7.3 3 0.33 1 1 4.4 5 0.5 5 5 5 1,1 5 2,5
GrV - - 25000 - - - - 3 0.33 1 1 - 5 0.5 - - 10 0,5 5 2,5
GB 800 1 12000 15 15 5.0 5.0 3 0.33 1 1 3.0 5 0.5 4 4 4 1,3 5 2,5
For the determination of mycotoxins level the requires to release into a recipient a quantity of
rules imposed by the EU regulations are 50 to 100 kilos and to take the sample in a
stricter, therefore the number of fixed values, representative way from this 50-100 kilos
marked in the table with font italic and yellow (meaning five incremental samples of 2 kilos to
colour is bigger than for the other analyses. In obtain a global sample of 10 kilos), then for a
corn, as it is known that there is very 5000 tonnes batch the sampling procedure may
heterogeneous distribution of the grains, the require to release into a recipient a quantity of
Commission Regulation (EC) No 401/2006 25 tonnes and to take the sample according to
recommends a Guidance document for the SR EN ISO 24333:2009 (meaning 8
sampling of cereals for mycotoxins, which incremental samples of approx. 1.3 kilos to
specifies the impossibility of static sampling obtain a total sample of 10 kilos) from this
for very large batches stored in closed quantity located in a truck (Figure 1). The
cylindrical silos (Malone et al., 2008). The corn calculation was made by using the rule of three
used for the starch production in the factory, and the real result was between 10 and 20
taken as reference, is stored in closed tones. For this adaptation we consider also the
cylindrical silos of 5000 tonnes capacity. As a literature. Hallier et al. showed in 2011 that the
solution to apply sampling rules to specific principal source of variability in the mycotoxin
possibilities, we adapted the instruction analysis result is the grain sampling, due to the
presented in the same Guidance for batches heterogeneous repartition in the grain lots. It
with reasonable size, as follows: if for a 25 can decrease with the sample size increasing
tonnes batch of grains the sampling procedure and can increase proportional with mycotoxin
419
concentration (Whitaker, 2003; 2006). For the ISO 24333:2009, considering the minimum
cereal products, food and feed, although the sample size specified by Regulation (EC) No
heterogeneity is lower than in the case of 333/2007 (1 kilo comprising 3 incremental
grains, it is also very important to collect a samples). The formula used is:
representative sample (Duarte et al., 2010;
Stroka et al., 2004). For bulk products (starch,
glucose syrup, germs, corn gluten feed and corn
gluten meal) we consider only SR EN ISO For heavy metals in feed it was applied the
24333:2009, but for packed products we take same sampling procedure as for mycotoxins in
into consideration both Commission Regulation feed and in addition MPE was calculated as for
(EC) No 401/2006 (for food products) and heavy metals in food.
Commission Regulation (EC) No 152/2009 (for The sampling procedure for pesticides was
feed products) regarding the number of issued considering the sample size and the
elementary samples and the sample size and, number of elementary samples specified by
according to that, we calculate the sampling Commission Directive 2002/63/EC for bulk
frequency given by SR EN ISO 24333:2009 and packed batches lower than 50 tonnes and
and the number of incremental samples by calculating the sampling frequency according
using the formula: to SR EN ISO 24333:200 and MPE according
to the formula used for heavy metals in food.
For heavy metals in food the sampling

frequency was established according to SR EN
Table 4. Example of sampling procedure for a 25000 kilos batch of feed products for which analyses of quality,
mycotoxins and heavy metals are performed
FEED PRODUCTS
DL NP NA QUALITY MYCOTOXINS HEAVY METALS
CP DA DP FA FP NPE MPE PG PL FA FP NPE MPE PG PL FA FP NPE MPE PG PL
TV - - 25000 - - - - 3 0.4 1 1 - - 8 0.5 4 1 - - 8 0.5 4 1
TB 900 1 24300 27 27 2.7 2.7 10 0.1 1 1 0.7 0.7 5.2 0.1 4 1 5.2 5.2 5 0.8 4 1
FV - - 25000 - - - - 3 0.2 1 1 - - 8 0.5 4 1 - - 8 0.5 4 1
FB 1000 1 4000 4 4 0.8 0.8 5 0.2 1 1 0.1 0.1 4 0.1 4 1 1.0 1.0 4 1 4 1
Table 5. Example of sampling procedure for a 25000 kilos batch of feed products for which analyses of pesticides,
microbiological contamination and non-GMO content are performed
FEED PRODUCTS
DL NP NA PESTICIDES MICROB. non-GMO
CP DA DP FA FP NPE MPE PG PL FP NPT MPT FA FP NPE MPE PG PL
TV - - 25000 - - - - 3 0.33 1 1 - - - - - 10 0,5 5 2,5
TB 900 1 24300 27 27 9.0 9.0 3 0.33 1 1 27.0 1 0.5 5 5 5 1,0 5 2,5
FV - - 25000 - - - - 3 0.33 1 1 - - - - - 10 0,5 5 2,5
FB 1000 1 4000 4 4 4.0 4.0 1 1.00 1 1 4.0 1 0.5 2 2 2 2,5 5 2,5
As for microbiology criteria of starch the only

reference document is Decree ANSVSA
27/2011 we applied it as sampling instruction
for all the products (food and feed) to be For non-GMO analysis we identified the specific
applied when required. For the packed products sampling procedure taking into account the
the sampling frequency / pallet unit was Commission Recommendation 2004/787/EC
calculated with the following equation: which specifies that “In case of lots smaller
than 50 tonnes, the size of the bulk sample
420
should be 5 kg.” According to this instruction, considering the global sample to be 5 kg as it is
we calculate the number of the incremental indicated in the Commission Recommendation
samples which should be taken from bulk 2004/787/EC, the values of NPE, MPE, FA, FP
products, as follows: were calculated as follows:
For packed products CEN/TS 15568:2006

contains relevant information about sampling
strategies and it was easy to use, because of the
For both, bulk and packed products, the
number of incremental samples is given by the
laboratory sample (PL) is half of PG.
square root of total number of packages (Sisea,
2009). According to this indication and
Figure 1. Examples of sampling distribution points
CONCLUSIONS packed products of food and feed are similar.

However, differences appear when the analyses
The development of a specific sampling
of mycotoxin presence should be performed,
procedure in the starch industry depends on the
the rules for sampling for these types of
factory’s specificity, including infrastructure
analyses being more strict.
possibilities, activities and analysis type.
For food and feed bulk products the rules from
Although the standards and legislation offer a
regulations and standards are more specific
general description of the sampling instruc-
and, that for the sampling procedure is simpler
tions, they can be applied in a harmonized way,
than for packed products.
on condition that the production process and
products characteristics are known very well. ACKNOWLEDGEMENTS
The sampling procedures to be applied for the
analyses of pesticides, microbiological conta- This research work was carried out with the
mination and GMO-presence detection for support of a corn starch factory located in the
south-eastern of Romania.
421
REFERENCES Uncertainty in dissolution test of drug release.
Chemometrics and Intelligent Laboratory Systems,
Alexander T., Reuter T., Aulrich K., Sharma R., Okine 97, p. 82–90.
E., Dixon W., McAllister T., 2007. A review of the Sisea C., Pamfil D., 2009. GMO Testing. Bioflux, Cluj-
detection and fate of novel plant molecules derived Napoca.
from biotechnology in livestock production. Animal Stroka J., Spanjer M., Buechler S., Barel S., Kos G.,
Feed Science and Technology, 133, p. 31–62. Anklama E., 2004. Novel sampling methods for the
Duarte S.C., Pena A., Lino C.M., 2010. A review on analysis of mycotoxins and the combination with
ochratoxin A occurrence and effects of processing of spectroscopic methods for the rapid evaluation of
cereal and cereal derived food products. Food deoxynivalenol contamination. Toxicology Letters,
Microbiology, 27, p. 187–198. 153, p. 99–107.
Hallier A., Celette F., David C., 2011. Effects of Thomas T., Gilbert J., Meyer F., 2012. Metagenomics-a
sampling and extraction on deoxynivalenol guide from sampling to data analysis. Microbial
quantification. Food Chemistry, 127, p. 303–307. Informatics and Experimentation, 2:3, p. 1–12.
Knight J.D., Wilkin D.R., 2010. Development and Tokman N., 2007. The use of slurry sampling for the
validation of on-farm sampling methods for the determination of manganese and copper in various
collection of marketing (quality) samples at harvest. samples by electrothermal atomic absorption
Journal of Stored Products Research, 46, p. 221–227. spectrometry. Journal of Hazardous Materials, 143, p.
Malone R., Malone B., Bond K., 2008. Determination of 87–94.
Deoxynivalenol and Zearalenone in Single Kernels Whitaker T. B., 2003. Standardisation of mycotoxin
From a Highly Contaminated Corn Sample. sampling procedures: An urgent necessity. Food
Available at Control, 14, p. 233–237.
http://www.trilogylab.com/uploads/Single_Kernel_P Whitaker T. B., 2006. Sampling Foods for Mycotoxins.
oster_2008.pdf. Food Additives and Contaminants, 23, p. 50-61.
Paakkunainen M., Matero S., Ketolainen J., Lahtela-
Kakkonen M., Poso A., Reinikainen S.-P., 2009.
422
A BRIEF OVERVIEW OF ETHYLENE MANAGEMENT TO EXTEND
THE SHELF LIFE OF TOMATOES
Elena DELIAN, Adrian CHIRA, Liliana BĂDULESCU, LenuĠa CHIRA

59 Mără‫܈‬ti Blvd., District 1, 011464, Bucharest, Romania
Abstract
Tomato (Lycopersicon esculentum Mill.) is one of the most important vegetable cropsin the world of horticultural
economy, being commercially valuable worldwide, both for fresh and for processing markets. In addition, tomato
represent a major research plant material, thus results obtained from its study can be applied to other plants of the
Solanaceae family. It is a climacteric fruit, with a respiratory peak during their ripening process. Ethylene is one of the
most important natural plant hormonethat regulates fruit ripening. Thus, ethylene biosynthesis management, especially
during postharvest period allow producers more time for shipment and increase the shelf life of tomato fruit for
consumers. Maximum tomato loss in quality and quantity occurs from harvesting to consumption. The problem of loss
can be controlled by adapting suitable scientific methods of packing and storage and by establishment properly
postharvest management. One of the first and simplest conditions to influence the postharvest production of ethylene
refers to the handling practices and storage temperature. Some classical treatments as for instance, postharvest
application of 1-methylcyclopropene (1-MCP) as one of ethylene action inhibitor is also successfully used. There are
also recent functional genomic studies in tomato. Integrating molecular approaches with conventional breeding may
enhance fruit quality and could significantly improve the postharvest shelf life of tomato.
Key words: Lycopersicon esculentum, postharvest, ripening, shelf life.
INTRODUCTION plants such as potato, eggplant, peppers,

tobacco, and petunias. Knowledge obtained
The postharvest losses of fruits and vegetables
from its studies can be easily applied to these
in the developing countries account for almost
plants, which makes tomato important research
50% of the production (Meli et al., 2010).
material. So, tomato serves as a model
Tomato (Lycopersicon esculentum Mill.) is one
organism for the family Solanaceae, also a
of the most important vegetable crop in the
model system for studying many aspects of
world of horticultural economy (Upendra et al.,
fruit biology, including development and
2003), being commercially valuable worldwide
metabolism (Kimura and Sinha, 2008; Okabe et
(Kimura and Sinha, 2008), both for fresh and
al., 2011; Xu et al., 2012), in part due to the
for processing markets (Opiyo and Ying,
availability of well characterized ripening
2005), not only because of its volume, but also
because of its overall contribution to nutrition, mutants (Zhang et al., 2009). Tomato is a
and its important role in human health (Agraval climacteric, perishable vegetable fruit, with a
and Rao, 2000; Martinez-Madrid et al., 2007; very short life span, usually 2-3 weeks An
Me et al., 2007). The nutrient value of tomato increase in the storage life and improvement of
fruit is related to its composition in tomato fruit quality is really desirable (Sammi
carbohydrates, organic acids, minerals, and Masud, 2007). Ethylene synthesized by all
vitamins and pigments (Helyes, 1999; Nasrin et higher plants tissues is involved in regulating
al., 2008; Mutari and Debbie, 2011). It is the many growth and developmental processes in
second most widely grown vegetable crop in plants (Yang, 1985; Abeles et al., 1992) and
the world other than the white potato (Hanson constitute an important regulator of fruit
et al., 2001; Panthee and Chen, 2010). ripening (Behboodian et al., 2012). Delaying
In addition, the tomato belongs to the the fruit ripening process would allow
extremely large family Solanaceae and is producers more time for shipment and increase
closely related to many commercially important
423
the shelf life of the fruit for consumers (Opiyo ethylene production as is the case of mature
and Ying, 2005). climacteric fruits, too (Oetiker and Yang,
Even if in the past appearance quality has been 1995). Fruit ripening and the role of ethylene in
emphasized, consumers buy tomatoes on the its regulation is complex. Therefore,
basis of appearance and firmness, their understanding what controls these processes in
satisfaction and repeat purchases depend upon non climacteric ripening may prove pertinent to
good flavor quality (Kader, 1986). gaining full understanding of climacteric fruit
ripening and vice versa (Alexander and
MATERIALS AND METHODS Grierson, 2002).
Recently, Yokotani et al. (2009) proposed a
A literature search strategy was used, mainly
model to explain the transition from system 1
on the most recent scientific papers on the
to system 2. System 1 is produced via
relationship between ethylene and fruit quality
LeACS1A and LeACS6, which are regulated by
of tomato, especially during post harvest, using
a negative feedback system, in the case of
online database Science Direct.
absence of exogenous ethylene and stress, via
the limited expression of LeACS2 and LeACS4,
thus registering a limited increase of ethylene
GENERAL ASPECTS OF ETHYLENE biosynthesis. In a such situation, limited
BIOSYNTHESIS MANAGEMENT ethylene would play a role as a trigger to
DURING FRUIT RIPENING stimulate an ethylene burst due to the ethylene-
Fruit ripening has received considerable dependent expression of LeACS2 and LeACS4,
attention due to its commercial importance inducing fruit ripening. System 1 decreases
(Yokotani et al., 2009).The control of fruits with the onset of system 2, as LeACS6 is
ripening is often achieved through early regulated by a negative feedback system;
harvest, by controlling the postharvest storage therefore, system 2 in tomato fruit consists of
atmosphere and by genetic selection for slow or both ethylene-dependent (autocatalytic) and
late ripening varieties (Oms-Oliu et al., 2011). ethylene-independent (non-autocatalytic)
It is know that ethylene function to promote systems. Even when the effect of system 1
many aspects of ripening of many climacteric ethylene is eliminated, fruit can initiate system
fruits, including tomato (Abeles et al., 1992; 2, leading to fruit ripening.
Yokotani et al., 2009; Barry and Giovannoni, Moreover, responses to this hormone is realized
2007) and modulating its levels in the by a signal transduction pathway in which
transgenic plants, as regard as many biotic or Ethylene Responsive Element Binding Proteins
abiotic stress factor is readily attainable for a (EREBPs) are transcription factors that help
variety of plants [(Stearns and Glick, 2003). regulate the ethylene response by regulating
Ethylene biosynthesis starts from methionine transcription and gene expression. For example,
via S-adenosyl-L-methionine (AdoMet) having Zhang et al. (2012) have cloned the gene
as an intermediate the non-protein amino acid Tomato LeERF1, indicated its location at the
1-aminocyclopropane-1-carboxylic acid (ACC) cellular level in the nucleus, nucleolus and
(Adams and Yang, 1979). The conversion of plastids, and little signal was detected in the
AdoMet to ACC and of ACC to ethylene is cell wall and vacuole. They have established
assured by ACC synthase and ACC oxidase, relationship of LeERF1 with the ripening of
respectively (Kende, 1993). tomato fruit.
Ethylene regulation in climacteric and non- MEANS TO EXTEND TOMATO SHELF
climacteric fruits is under control of two LIFE
distinct ethylene producing system defined by Maximum loss in quality and quantity of
McMurchie et al. (1972): system1 tomato occurs from harvesting to consumption
(autoinhibitory) and system 2 (autocatalytic). (Kader, 1986), so, the problem of loss can be
System 1 control the low ethylene production controlled by adapting suitable scientific
rate and represent basal ethylene in unripe fruit methods of packing and storage and by
and vegetative tissues, while system 2 is establishment proper post harvest management
associated with the autocatalytic rise in (Rahman et al., 2010).
424
One of the first and simplest conditions to application causes increased jasmonates con-
influence ethylene production refers to the centration, which regulate LOX activity asso-
handling practices and storage temperature. ciated with the production of superoxide anion,
When matter plants in general are subjected to which has an impact on ethylene production
physical or biological stress the result may be a (Yu et al., 2009). JA-ethylene cross-talk in the
tissue damage, which implies the production of ethylene synthesis pathways is based on their
the ethylene, either as a defense response or to synergistic interaction, as for example the JA-
repair the damage tissues. So, an increase of ethylene responsive antifungal defensin
respiration and softening are registered (Mutari PDF1.2 (Spoel et al., 2003) regulation by the
and Debbie, 2011). Tomato sealed in plastic simultaneously activation of JA and ethylene
films had an extended marketable life and it response pathways (Abeles et al., 1992). Kim et
affects the gaseous atmosphere around the fruit. al. (2013) obtained contradictory results. They
The use of KMnO4 contributed to the noticed that JA has also an inhibitory effect on
production of CO2 and water in the package ethylene signaling, which may involve an EIN2
atmosphere which helped in lowering the (a key protein in ethylene signaling)-indepen-
respiration and ripening processes (Sammi and dent pathway. JA antagonistic and ethylene
Masud, 2007). Post-harvest packing methods, independently function was also registered
such as storage in perforated (0.25%) polythene during lycopene biosynthesis in tomato fruits
bags under ambient conditions (temperature of (Liu et al., 2012).
20 0-250 C and relative humidity of 70-90%) Respiration rate may be also controlled by
extended up to 17 days tomato shelf life influence its proper molecular mechanism.
without excessive quality decay (Nasrin et al., Alternative oxidase (AOX) and ethylene me-
2008). The use of black perforated polythene diate fruit ripening of tomato. Xu et al. (2012)
bags (Rahman et al., 2010), treating fruits with used tomato plants with reduced LeAOX (Le
chloride and calcium chloride, and treatment of alternative oxidase) levels and results were
0.1% gibberellic acid and 0.4 nM salicylic acid retarded ripening; reduced carotenoids, respira-
(Pila et al., 2010) have been shown to decrease tion, and ethylene production; and the down-
fruit decay and weight loss. regulation of ripening-associated genes. On the
There are also used some treatments in relation other hand, the fruit that over expressed
to ethylene management. For instance, post- LeAOX1a accumulated more lycopene, and
harvest application of 1-methylcyclopropene they displayed a similar pattern of ripening to
(1-MCP) as one of ethylene action inhibitor wild-type fruit.
(Sisler, 2006) delayed tomato fruit ripening in Zhang et al. (2009) described a relationship
relation to the used concentration (Moretti et between ABA and ethylene during tomato fruit
al., 2002). Response of various climacteric spe- ripening and senescence as followings: (i) the
cies, including tomato is variable and depends expression of the ABA biosynthetic gene
also on internal levels of ethylene (Zhang et al., (LeNCED1) (which encode 9-cis-epoxy carote-
2009; Zhang et al., 2010). It should be con- noid dioxygenase (NCED) as a key enzyme in
sidered that ingress and accumulation in tomato ABA biosynthesis) occurs before that of
fruit of gaseous 1-MCP applied as gaseous or ethylene biosynthesis genes; (ii) ABA content
aqueous formulation is rapidly. The post-expo- also preceded the climacteric increase in
sure fate is due in relation to multiple factors: ethylene production; (iii) ABA may induce
inherent sorption-capacity, surface properties ethylene biosynthesis via the regulation of ACS
(e.g., waxes, stoma), volume and continuity of and ACO gene expression; (iv) exogenous
gas-filled intercellular spaces, and tissue hydra- ABA accelerates fruit ripening, and fluridone
tion (Dong et al., 2013). In addition, Su and or nordihydroguaiaretic acid treatment delayed
Gubler (2012) showed that reducing post-har- fruit ripening by inhibition of ABA; and (v)
vest decay by 1-MCP is also associated with a ethylene plays a key role in the later stages of
reduction of economic loss caused by diseases. fruit ripening.
There is also a positive interaction between Delaying ripening and enhancing resistance to
jasmonates resulting from treatment with a post-harvest fungal pathogens can be also
methyl jasmonate (MeJA) and ethylene. MeJA assure by NO treatments (Lai et al., 2011)
425
which suppress ethylene biosynthesis, stimulate mannosidase (a-Man) and ß-D-N-acetylhexosa-
the activity of antioxidant enzymes and regu- minidase (ß-Hex) and also demonstrated that
late the expression of age-related genes. genetic manipulation of N-glycan processing
Tomato is a suitable system for studying can be of strategic importance to enhance fruit
unique biological phenomena not harbored by shelf life, without any negative effect on
Arabidopsis (Okabe et al., 2011). As Me et al. phenotype, including yield.
(2007) noticed, in molecular technologies, To accelerate functional genomic research in
using molecular markers in plants breeding tomato, Okabe et al. (2011) developed a Micro-
programs is a common procedure. Unfortuna- Tom TILLING (Targeting Induced Local
tely, gene modification techniques introduced Lesions In Genomes) platform and to be used
into tomato crop improvement, greatly altered for efficient mutant isolation, six ethylene re-
tomato variety characteristics. Studies perfor- ceptor genes in tomato (SlETR1–SlETR6) were
med by Rodríguez et al. (2011) emphasized that screened. The identification of two novel Sletr1
polymorphic polipeptides from fruit pericarp mutant alleles that are distinguished by the
associated with quality fruits traits and fruit level of ethylene sensitivity and the characte-
shelf life can be such useful tomato breeding rization of their associated phenotypes could
programs, as protein molecular markers. provide insight into the ethylene-mediated fruit
The tomato genome was entirely sequenced by ripening mechanism in tomato.
The International Solanaceae Genomics Project Behboodian et al. (2012) were employed RNA
(SOL), and many of the gene sequences can be interference (RNAi) technology to silence the
retrieved from databases (Mueller et al., 2009). genes involved in ethylene biosynthetic
Also, recently (2012) The Tomato Genome pathway, by blocking the expression of specific
Consortium presented a high-quality genome gene encoding the ACC oxidase. The obtained
sequence of domesticated tomato, a draft results has successfully demonstrated that seve-
sequence of its closest wild relative, Solanum- ral transgenic lines of lowland tomato cv. MT1,
pimpinellifolium, and compared them to each harboring an hpRNA-ACO1 (ACC oxidase)
other and to the potato genome (Solanum- construct, showed lower ethylene production
tuberosum). Although the tomato is completed because the transgenic fruits displayed delayed
sequenced, its genomic resources have not been post-harvest life with no phenotypic changes
fully exploited. Few studies have reported the and similar amounts of soluble solids content,
detection of quantitative trait loci (QTLs) using titratable acidity and ascorbic acid as compared
simple sequence repeat (SSR) markers for fruit to wild type fruits. They proposed that,
quality traits in tomato, in the recent studies hpRNAi ACO1 could effectively be used to
carried out by Yogendra and Gowda (2013). delay post-harvest damage, especially in
Xu et al. (2013) presented a complete analysis climacteric fruits.
of the RNA helicases (a class of molecular Research carried out by Xie et al. (2006) em-
motor proteins) gene family, including the phasized that Virus-induced gene silencing
chromosomal locations, phylogenetic tree, and (VIGS) technology combined with vacuum
gene structure analysis and expression profile infiltration can silence LeACS2 gene function
under various growth conditions. for a certain time and is an efficient way to
Twenty years ago Klee (1993) noticed that postpone the post-harvest senescence of tomato
biochemical analysis of transgenic tomato fruits fruit. In the same time, vacuum infiltration is an
line expressing 1-aminocyclopropane-1-carbo- easy and inexpensive method at room tem-
xylic acid (ACC) deaminase enzyme empha- perature, so, a potential method to maintain the
sized no significant differences from controls in quality of detached tomato fruit. The syringe
the levels of ACC oxidase or polygalactu- infiltration method of VIGS [tobacco rattle
ronase. Also, transgenic fruit were significantly virus (TRV)-LeRIN: the transcription factor
firmer than the control, so, the author con- RIN (Ripening Inhibitor) belongs to the MADS
clusion was that other enzymes may have a box family and regulates tomato ripening] was
significant role in fruit softening. Meli et al. successfully applied to silence the LeRIN,
(2010) identified and targeted two ripening- LeACS2, LeACS4 and LeACO1 genes in tomato
specific N-glycoprotein modifying enzymes (a- fruits. There were identified also, the target genes
426
of RIN transcription factor in ethylene biosyn- Scientific World Journal, Article ID 439870, 9 pages,
thesis in tomato fruit (Li et al., 2011). doi:10.1100/2012/439870 Research Article.
Dong X., Ramírez-Sánchez M., Huber D.J., Rao J.,
Integrating molecular approaches with conven- Zhang Y., Choi S.T., Lee J.H., 2013. Postharvest
tional breeding to enhance fruit quality could Biology and Technology, 78, p. 40–47.
significantly improve the post-harvest shelf life Hanson P., Chen J.T., Cou C.G., Morris R., Opena R.T.,
of tomato. Recently, tomato hybrids with en- 2001. Tomato production. Asian Vegetable Research
hanced shelf life were developed using ripening Development Center.
mutants and agronomically superior Indian Helyes L., 1999. A paradicsom és termesztése. Syca
Szakkönyvsolgálat, Budapest, Hungary.
cultivars, and hybrids from all possible line x Kader A.A., 1986. Effects of postharvest handling proce-
tester crosses were screened for shelf life, yield, dures on tomato quality. Acta Hort. 190, p.209-221.
and other fruit qualities (Yogendra and Gowda, Kende, H., 1993. Ethylene biosynthesis. Annu. Rev.
2013). Plant Physiol. Plant. Mol. Biol., 44, p. 283-307.
Kimura S., Sinha N., 2008. Tomato (Solanum lycoper-
sicum) : A Model Fruit-Bearing Crop. Cold Spring
CONCLUSIONS Harb Protoc; doi:10.1101/pdb.emo 105.
Tomatoes are one of the most important vege- Kim J., Patterson S.E., Binder B.M., 2013. Reducing
jasmonic acid levels causes ein2 mutants to become
tables worldwide and are used both for fresh ethylene responsive. FEBS Letters, 587, p. 226–230.
consumption, as well as processed, considering Klee H.J.. 1993. Ripening physiology of fruit from
their nutritional value and health benefits to transgenic tomato (Lycopersicon esculentum) plants
people. with reduced ethylene synthesis. Plant Physiology,
Always, there have been major concerns for the 102, p. 911-916.
Klee H.J., Tieman D.M., 2013. Genetic challenges of flavor
improvement of tomato characteristics feature,
improvement in tomato. Trends in Genetics xx 1–6.
including those regarding the ripening dyna- Lai T., Wang Y., Li B., Qin G., Tian S., 2011. Defence
mics, with a view to reduce the post-harvest response of tomato fruit to exogenous nitric oxide
loss and to extend shelf life. during postharvest storage. Postharvest Biology and
Ethylene is one of the most important plant Technology, 62, p. 127-133.
hormone, which regulates tomato ripening. So, Li L., Zhu B., Fu D., Luo Y., 2011. RIN transcription
factor plays an important role in ethylene
ethylene management by integrating molecular biosynthesis of tomato fruit ripening. J. Sci Food
approaches with conventional breeding could Agric., 91, p. 2308-2314.
significantly improve the post-harvest shelf life Liu L., Wei J., Zhang M., Li C., Wang Q., 2012. Ethy-
of tomato. lene independent induction of lycopene biosynthesis
In addition to breeders focus to increase tomato in tomato fruits by jasmonates. J. Exp. Bot. doi:
10.1093/jxb/ers224.
production and to extend the fruits shelf life, Martinez-Madrid M.C., Egea M.I., Sánchez-Bel P.,
flavor improvement still remains one of the 2007. Effect of combined 1-MCP and cold storage on
major challenges (Klee and Tieman, 2013). the shelf life and postharvest quality of tomato. In
Advances in Plant Ethylene Research.
REFERENCES McMurchie E.J., McGlasson W.B., Eaks I.L., 1972.
Treatment of fruit with propylene gives information
Abeles F.B., Morgan P.W., Salveit Jr. M.E., 1992. about the biogenesis of ethylene. Nature, 237, p.
Ethylene in plant biology. New York: Academic 235–236.
Press. Adams, D.O., Yang, S.F. 1979. Ethylene Me B.B., Be L.K., Be J.J., Ying T.Y., 2007. Fruit quality
biosynthesis: identification of 1-aminocyclopropane- of transgenic tomatoes with suppressed expression of
1-carboxylic acid as an intermediate in the LeETR1 and LeETR2 genes. Asia Pac. J. Clin. Nutr.,
conversion of methionine to ethylene. Proc. Nat. Vol. 16, p.122-126.
Acad. Sci, USA, 76, p. 170-174. Meli V.S., Ghosh S., Prabha T.N., Chakraborty N.,
Agarwal S., Rao A.V., 2000. Tomato lycopene and its Chakraborty S., Datta A., 2010. Enhancement of fruit
role in human health and chronic diseases. Canadian shelf life by suppressing N-glycan processing
Medical Association, 163, p. 739-744. enzyms. PNAS, 107, p. 2413-2418.
Alexander L., Grierson D., 2002. Ethylene biosynthesis Mueller L.A., Lankhorst R.K., Tanksley S.D., Giova-
and action in tomato: a model for climacteric fruit nnoni J.J., White R., Vrebalov J., 2009. A snapshot of
ripening. J. Exp. Bot., 53, p. 2039-2055. the emerging tomato genome sequence. Plant
Barry C.S., Giovannoni J.J., 2007. Ethylene and fruit Genome, 2, p.78-92.
ripening. J. Plant Growth Regul. 26, p.143-159. Moretti C.L., Araújo A.L., Maurouelli W.A., Silca
Behboodian B., Ali Z.M., Ismail I., Zainal Z., 2012. W.L.C., 2002. 1-Methylcyclopropene delays tomato
Postharvest Analysis of Lowland Transgenic Tomato fruit ripening. Horticultura Brasiliera, 20, p. 65-663.
Fruits Harboring hpRNAi-ACO1 Construct. The
427
Mutari A., Debbie R., 2011. The effects of postharvest Spoel S.H. et al., 2003. NPR1 modulates cross-talk
handling and storage temperature on the quality and between salicylate-and jasmonate-dependent defense
shelf life of tomato. African Journal of Food Scinece, pathways through a novel function in the cytosol.
5, p. 446-452. Plant Cell, 15, p. 760–770.
Nasrin T.A.A., Molla M.M., Hossaen M.A., Alam M.S., Stearns J.C., Glick, B.R., 2003. Transgenic plants with
Yasmin L., 2008. Effect of postharvest treatments on altered ethylene biosynthesis or perception.
shelf life and quality of tomato. Bangldesh J. Agri. Biotechnology Advances, 21, p. 193-210.
Res., 33, p. 579-585. Su H., Gubler W.G., 2012. Postharvest Biology and
Oetiker J.H., Yang S.F., 1995. The role of ethylene in Technology, Vol. 64, p.133–137.
fruit ripening. Acta Horticulturae, 398, p.167–178. Upendra M.S., Dris R., Bharat S., 2003. Mineral
Okabe Y., Saito T., Matsukura C., Ariizumi T., Bres C., nutrition of tomato. Journal of Food Agriculture and
Rothan C., Mizoguchi T., Ezura H., 2011. Tomato Environment, 1, p.176-183.
TILLING Technology: Development of a Reverse Xie Y.H., Zhu B.Z., Yang X.L., Zhang H.X., Fu D.Q.,
Genetics Tool for the Efficient Isolation of Mutants Zhu H.L., Shao Y., Gao H.Y., Luo Y., 2006. Delay of
from Micro-Tom Mutant Libraries. Plant Cell postharvest ripening and senescence of tomato fruit
Physiology, 52, p. 1994-2005. through virus-induced LeACS2 gene silencing.
Oms-Oliu G., Hertog M.L.A.T.M., Vande Poel B., Postharvest Biology and Technology, 42, p. 8-15.
Ampofo-Asiama J., Geeraerd A.H., Nicolai B.M., 2011. Xu F., Yuan S., Zhang D.W., Lv X., Lin H.H., 2012. The
metabolic characterization of tomato fruit during role of alternative oxidase in tomato fruit ripening
preharvest development, ripening, and postharvest and its regulatory interaction with ethylene. J. Exp.
shelf-life. Postharvest Biology and Technology, Bot. doi: 10.1093/jxb/ers226.
Vol.62, p.7-16. Xu R., Zhang S., Lu L., Cao H., Zheng C., 2013. A
Opiyo A.M., Ying T.J., 2005. The effects of 1-methyl- genome-wide analysis of the RNA helicase gene family
cyclopropane treatment on the shelf life and quality in Solanum lycopersicum. Gene, 513, p. 128-140.
of cherry tomato (Lycopersicon esculentum var, Yang S.F., 1985. Biosynthesis and action of ethylene.
cerasiforme) fruit. International Journal of Food HortScience, 20, p. 41.45.
Science and Technology, 40, p. 665-673. Yogendra K.N., Gowda P.H.R., 2013. Phenotypic and
Panthee D.R., Chen F., 2010.Genomics of Fungal molecular characterisation of a tomato (Solanum
Disease Resistance in Tomato. Curr Genomics, 11, p. lycopersiocon L.) F2 population segregation for
30–39. improved shelf life. Gen. Mol.Res.
Pila N., Gol N.B., Rao T.V.R., 2010. Effect of post Yokotani N.,Nakano R., Imanishi S., Nagata M., Inaba
harvest treatments on physicochemical characteristics A., Kubo Y., 2009. Ripening-associated ethylene
and shelf life of tomato (Lycopersicon esculentum biosynthesis in tomato fruit is autocatalytically and
Mill.) fruits during storage. American-Eurasian J. developmentally regulated. J Exp Bot., 60, p.3433–
Agric. & Environ. Sci., 9, p. 470-479. 3442.
Rahman M.M., Islam M.N., Wazed M.A., Arfin M.S., Yu M., Shen L., Fan B., Zhao D., Zheng Y., Sheng J.,
Hossain F.B., 2010. Determination of post harvest 2009. The effect of MeJA on ethylene biosynthesis
losses and shelf life of tomato as influenced by and induced disease resistance to Botrytis cinerea in
different types of polythene at refrigerated condition tomato. Postharvest Biology and Technology, 54, p.
(100 C). Int. J. Sustain., Crop Prod., 5, p. 62-65. 153–158.
Rodríguez G.R., da Costa J.H.P., Tomat D.D., Pratta Zhang M., Yuan B., Leng P., 2009. The role of ABA in
G.R., Zorzoli R., Picardi L.A., 2011. Pericarp total triggering ethylene biosynthesis and ripening of
protein profiles as molecular markers of tomato fruit tomato fruit. J Exp Bot., 60, p. 1579–1588.
quality traits in two segregating populations. Scientia Zhang Z., Huber D.J.,Hurr B.M., Rao J., 2009. Delay of
Horticulturae, 130, p. 60–66. tomato fruit ripening in response to 1-methylcy-
Sammi S., Masud T., 2007. Effect od different packing clopropene is influenced by internal ethylene levels.
systems on storage life and quality of tomato Postharvest Biology and Technology, 54, p.1–8.
(Lycopersicon esculentum var, Rio Grande) during Zhang Z., Huber D.J., Rao J., 2010. Short-term hypoxic
different ripening stages. Internet Journal of Food hypobaria transiently decreases internal ethylene
Safety, p. 37-44. levels and increases sensitivity of tomato fruit to
Sisler E.C., 2006. The discovery and development of subsequent 1-methylcyclopropene treatments. Post-
compounds counteracting ethylene at the receptor harvest Biology and Technology, 56, p.131–137.
level. Biotechnolog Adv., 24, p. 357-367. Zhang H., Zhu B., Luo Y., Xie Y., 2012. The research of
Spoel S.H., Koornneef A., Claessens S.M.C., Korzelius subcellular localization of ethylene response factor
J., Van Pelt J.A., Mueller M.J., Buchala A.J., LeERF1 in tomato fruit. Procedia Environmental
Métraux J.P., Brown R., Kazan K., Van Loon L.C., Sciences, 12, p.1187 – 1196.
Dong X., Pieterse C.M.J., 2003. NPR1 modulates The Tomato Genome Consortium. 2012. The tomato
cross talk between salicylate-and jasmonate- genome sequence provides insights into fleshy fruit
dependent defense pathways through a novel function evolution. Nature, 485, p.635–641
in the cytosol. Plant Cell, p. 760–770.
428
PRELIMINARY STUDY RELATED HIGHLIGHTING THE INHIBITORY

EFFECT OF IN VITRO FUNGUS GROWTH MYCOSPHAERELLA
GROSSULARIAE (AUERS.) LIND. BY SAPROPHYTIC FUNGI
Eugenia PETRESCU1, Tatiana-Eugenia ùESAN2, Florica CONSTANTINESCU3,

Maria OPREA3, Traian MANOLE3, Irina IONESCU-MĂLĂNCUù4
1
Carol Davila School, 161-163, Viitorului Street, 020609, Bucharest, Romania
2
University of Bucharest, Biology Faculty, 1-3 Aleea Portocalilor Street, Bucharest, Romania
3
Research-Development Institute for Plant Protection Bucharest,
8 Ion Ionescu de la Brad Street, 013813, Bucharest, Romania
4
Faculty of Biotechnology-USAMV, 59 Mără‫܈‬ti Blvd., 011464, Bucharest, Romania
Abstract
Mycosphaerella grossulariae (Auers.) Lind., one of the most important pathogenic fungi which affect the black currant
ecological crops cultivated for alimentary supplements and phytotherapeutics drugs production. The present study
brings the new data related to the possibility of „in vitro” vegetative growth inhibition of fungus mycelium using
saprophytic fungi species. The species of fungi used for experimental trials was Trichoderma viride, Trichothecium
roseum Link, Epicoccum nigrum Link. and Gliocladium roseum Bainier. The fungus was growth on several culture
media for comparative testing and establishment of the most efficient medium for vegetative growth of the fungi. In the
study we also follow the comparative approach doing by biometric measurements of the colonies in which work variant
the pathogenic fungi had the high rate of growing. After the testing was made the PDA medium was selected for
experimentation of inhibitory effect of the saprophytes. The method used for trials was the double cultures technique on
the medium of agar which consists in inoculation of one media fragment of mycelium carrier separated from the agar
medium of saprophytic fungi on some distance from pathogenic fungi. The study carried out had allowed the highlight
of the fact that in all experimental variant used the saprophytic fungi had inhibits the Mycosphaerella grossulariae
pathogen growing. The detailed analysis of the results we could reveal that the most inhibitory effect was done by T.
viride followed by T. roseum and E.nigrum.
Key words: blackcurrant crop, inhibitory effect, Mycosphaerella grossulariae, saprophytic fungi.
INTRODUCTION sion of ecological crops of this species are

imposed the deeply acknowledgement of the
The biological resources and the sustainable
pathogens in the purpose of finding rapidly and
exploit potential of aromatic and medicinal
efficiently ways to biological control.
plants from our country are immense and repre-
Mycosphaerella grossulariae (Auers.) Lind. is
sent an important sustainable component of Ro-
one of the most important pathogenic fungi
manian agriculture (Manole, 2008). Romania
which affect the black currant ecological crops
has in his flora up to 3,600 species of plants
cultivated for alimentary supplements and phy-
and more than 1.000 are considered medicinal
totherapeutics drugs production. In plantation
plants, spontaneous and cultivated (Alexan et
of blackcurrant cultivated as medicinal plant in
al, 1988; Ardelean and Mohan, 2008; Bojor,
the south of Romania, Mycosphaerella gros-
2003; Pĉun, 1995). In the classification of
sulariae produces spots with picnidia on the
pharmacological industry are under different
blackcurrant’s leaves (Petrescu and Oprea, 2012).
forms included – tea, medicinal and cosmetics
The present study brings the new data related to
products – almost 160 medicinal and aromatic
the possibility of „in vitro” vegetative growth
species, among 110 are spontaneous collected
inhibition of fungus mycelium using sapro-
and up 50 species are cultivated (Pĉun, 1995). phytic fungi species. The fungal saprophytic
One of the species introduced in the cropping species used for experimentation are already
system, the blackcurrant crop (Ribes nigrum L.) cited as antagonists of various pathogens of
are extremely economic important. The exten-
429
cultivated plants (besan, 1997, besan and were then placed on the water-agar media for
Oprea, 1995). The in vitro antagonistic activity sporulating stimulation and also on CGA media
of some fungi against other fungal pathogens of and incubated at the room temperature. The
blackcurrant was previously investigated spores of different saprophytic fungi were
(Petrescu and besan, 2012; Petrescu et al., 2012). observed and studied at the optical microscope.
Biological control with antagonistic strains of The saprophytic fungi spores or a little piece of
fungi is an alternative and non polluting method fungi mycelium were being transferred on the
for control the plant diseases produced by fungal culture media in sterile conditions. The culture
pathogens (Fokkema, 1996). media used for fungi growth and multiplication
Related to environmentally friendly alternative were PDA and MEA. The pathogenic strain of
control methods of fungal pathogens of black- Mycosphaerella grossulariae was inoculated
currant, a recent study analyzes the effect of on different media and the colony diameter and
some plant extracts on the development of the colony characteristics were registereded. Four
blackcurrant’s pathogen Sphaerotheca mors- culture media were used, PDA (potato dextrose
uvae that produces American mildew, and on agar, MEA (malt extract agar) Czapek-Dox and
the pathogenic fungi isolated from phylloplane Czapek). Each variant had 3 repetitions.
of blackcurrant in the South Eastern part of The saprophytic fungi and the pathogen were
Romania, such as Botrytis cinerea, Alternaria grown on PDA medium. On the specified time
tenuissima and Fusarium oxysporum (Enache intervals biometrics measurements of the
et al., 2011). reverse side of the diameter of the colonies
The field experimental plots were located in the were performed in view to establish and
blackcurrant crops of S.C. Export-Import compare the growing rate of the pathogenic
Hofigal S.A., which are playing the role of co- fungus Mycosphaerella grossulariae with
financing partner in the research consortium. those of the saprophytic fungi. Looking for in
The mentioned firm is a promoter of the vitro testing of the antagonic effect of the four
systems for ecological agriculture in the case of saprophytic fungi against the strain of
some shrubs crops for alimentary supplements Mycosphaerellagrossulariae the double culture
production. method were performed which mean the
inoculation of both pathogen and saprophytic
MATERIALS AND METHODS fungi on the same Petri dish at the same
distance for the dish centre and the same
We are using for our study the biological distance one for another (Juan, 1964, besan and
material provided from reference isolate of the
Oprea, 1995). The experimental design consists
Mycosphaerella grossulariae (Auers.) Lind.
in 5 variant on 3 replicates each. The control
CBS 235.37 pathogen, which was purchased
medium culture had inoculated only with the
from CBS culture collection of microorga-
saprophytic fungi. The Petri dishes selected for
nisms, Utrecht, the Netherlands, and another 4
the experiment had a small diameter (60 mm)
own isolates of saprophytes fungi obtained in
because of the length rhythm of pathogen
2010 from blackcurrant’s phylloplan, which growing. The medium used for testing was
were tested for their in vitro effect on the PDA. The diameter of the fungal inoculum,
pathogen. These isolates are four strains of the both pathogenic and saprophytic was of 3 mm
fungi Trichothecium roseum, Trichoderma and the distance between Petri dish centre and
viride, Gliocladiumroseum and Epicoccum- inoculum was of 10 mm, respectively. The
nigrum. distance between the pathogen inoculum and
In order to saprophytic fungi isolation the saprophytic one was of 20 mm. The sapro-
blackcurrant leaves were collected and phytic fungus was inoculated later, at the 5
introduced in plastic bags and brings to the days after pathogen inoculation in the moment
RDIPP (Research Development Institute for when the colony characteristics of Mycos-
Plant Protection) laboratory of Mycology for phaerella grossulariae are ready formed. The
processing and analysis. In laboratory the incubation was performed at room temperature
leaves were divided into the small pieces with (±24°C). The periodical measurements of
the help of sterile scissors. The leaves pieces
internal radius of pathogen colony (the radius
430
oriented towards the centre of the Petri dish) on colonies. Photos were taken after 7, 10 and 45
a period of 45 days were made and the values days.
of these measurements were expressed by the
media value of each variant. In the control case RESULTS AND DISCUSSIONS
the internal radius which measures the colony
On the four media tested the colonies were
growth was also the media of the periodical
circular, with hairy aspect, white colour and
measurements values. On the basis of these
back view light brown (Figure 1).
media values of each variant, an inhibition
degree were calculated after the follow relation,
adapted and modified after Zivkovici et al.
(2010):
Where:
I% = percent of growth inhibition;
IC = internal radius of the colony of the fungus
Mycosphaerellagrossulariae in control;
IV = internal radius of the fungus Mycos- Figure 1. Macroscopic in vitro aspect of the colony of the
phaerellagrossulariae in variant tested; fungus M. grossulariae CBS 235.37 on MEA medium
The inhibition scale used for values mea-
surements and comparison between variants After 45 days the colonies gets a more dark hue
were adapted and modified after Zivkovici et and the reverse side became dark brown. This
al. (2010). This scale has 11 levels which result of the length vegetative growth of the
permit to appreciate the inhibition degree colony was comparable with the observations
(Table 1). of Stroe (1988) on the strains of another Myco-
Periodically observation connected with colour sphaerella species, such as species Mycosphae-
of the colonies, back view of the colonies, rella mori, the pathogen which causes the
contact line aspect and inhibition zone were antracnosis of Morus alba.
made. Where I% <1 was considered 0 Among the four media tested, on the PDA
inhibition. medium Mycosphaerella grossulariae had a
significant favorable growth. At 16 days after
Table 1. Inhibition coefficient values and the inoculation, the media value of colony diameter
corresponding inhibition level
was of 19.3 mm, and the values are decreasing
Inhibition level I% for MEA medium (19 mm), Czapek Dox (16.6
0 0-1 mm), and 15 mm on Czapek, respectively. At
1 1-10
24 day Mycosphaerella grossulariae had a better
2 11-20
3 21-30 vegetative growth on PDA medium between the
4 31-40 other media tested (Figure 2, Table 2).
5 41-50
6 51-60 Table 2. Diameters of the colonies of the fungus
7 61-70 Mycosphaerella grossulariae (Auers.) Lind.CBS 235.37
8 71-80 on different culture media
9 81-90
Colony diameter (mm)
10 91-100 Culture
variant after 16 after 24 after 45
medium
days days days
Macroscopically, the relationship between the
two fungal strains, a pathogenic one and a 1. PDA 19.3 28.0 38.6
saprophytic one was made by the method 2. Czapek-Dox 16.6 26.0 33.6
described by Ana Hulea (1973) by observing 3. Czapek 15.0 21.6 30.3
the aspect of the contact line between the two 4. MEA (Control) 19.0 26.3 32.3
431
Table 3. The vegetative growth of the fungus
Mycosphaerella grossulariae (Auers.) Lind.CBS 235.37
and the saprophytic fungi Trichoderma viride,
Epicoccum nigrum, Gliocladium roseum and
Trichothecium roseum grown on PDA medium
Colony diameter (mm)
Variant
after 3 days after 6 days
Trichoderma viride 61.6 68.0
Epicoccumnigrum 31.0 63.0
Gliocladiumroseum 13.6 31.3
Trichothecium roseum 26.3 55.0
M. grossulariae 5.0 7.3
On the whole period of experimentation, in the

control variant, fungus
Mycosphaerellagrossulariae had a constantly
growing rate and reaching a medium value of
5.91 mm after 7 days after inoculation of the
saprophytic fungus in variant (Figure 1a), 7.3
Figure 2. Vegetative growth of the colonies of the fungus mm after 10 days (Figure 1b), 15.8 mm after 30
Mycosphaerella grossulariae (Auers.) Lind.CBS 235.37 days, 17.9 mm after 40 days and finally 18.7
on different culture media
mm after 45 days (Figure 1c). The shape of
colonies was circular. The colour was white
Among the five fungi grown on PDA medium, with the reverse of light brown (Figure 4).
pathogenic fungi showed a significantly lower
growth rate than saprophytic fungus Tricho-
derma viride. The other saprophytic fungi
showed also significantly higher growth rates,
but lower than Trichoderma viride (Figure 3,
Table 3).
Figure 4. Macroscopic view of the colony of
on PDA medium after 7 days (a), after 10 days (b) and
after 45 days (c ) from pathogen inoculation in variants
The strain of Trichothecium roseum had a fast

growth to the pathogen strain of Mycos-
phaerellagrossulariae. After 6 days from its
inoculation, the mycelia of Trichothecium
roseum began to cover all the area around the
pathogen and blocked its expansion by the
inhibitory effect under the internal radius which
pointed the value of 3.95 mm read on the
reverse side. After 7 days the Trichothecium
roseum pink mycelium had developed around
the white Mycosphaerellagrossulariae colony
(Figure 5a). The division line had his concavity
to pathogen fungi oriented who had a low rate
Figure 3. Diameter of the colonies of the strains of the of growing. The external radius continuosly
fungi Trichoderma viride (Td), Epicoccum nigrum(E.n.), growing against internal radius, the value
Gliocladium roseum (G.r.), Trichothecium roseum (T.r.) registered being of 4.4 mm. After 10 days the
and the strain of the pathogenic fungus Mycosphaerella mycelium of T. roseum had completely covered
grossulariae (Auers.) Lind.CBS 235.37 (M.g.) on PDA
medium
the pathogen colony which being totally
inhibited (Figure 5b, Figure5c).
432
pathogenic fungus was partially surrounded by
the colony of the saprophytic fungus and
continued to grow only by external radius
(Figure 7b.). At the end of the experiment,
phytopathogenic colony was covered by that of
Figure 5. Macroscopic view of the colony of the antagonistic (Figure 7c).
on PDA medium after 7 days (a), after 10 days (b) and
after 45 days (c ) from inoculation of the strain of
Trichothecium roseum
After 7 days from inoculation of the antago-

nistic fungus Gliocladiumroseum, internal
Figure 7. Macroscopic view of the colony of
radius of its colony became in the neighbor- Mycosphaerella grossulariae (Auers.) Lind.CBS 235.37
hoods the phytopathogenic fungus colony on PDA medium after 7 days (a), after 10 days and after
(Figure 6a). After 10 days the contact line 45 days (c ) from inoculation of the strain of Epicoccum
appeared as an obviously curve with the nigrum
concavity oriented to the pathogen; this is
characteristic of the relationship between the Trichoderma viride fungus grew very quickly
two fungal colonies among which there are over phytopathogenic fungus colony, so that at
differences in growth rate (Figure 5b). Between 7 days after inoculation antagonistic fungus
the two colonies being in the same Petri dish invaded the colony, entirely covering the Petri
appeared a small area of sparse mycelium, dish and determine to cease growth both
which persisted throughout the 45 days of internal and external radius (Figure 8a, Figure
experimentation and it marked a inhibition of 8b). Between the two colonies, pathogen’s and
the pathogen exercises by saprophytic fungus antagonist’s, the mycelium of fungus Tricho-
(Figure 5b, Figure 5c). From this moment, the derma viride was sparse, sign that phytopa-
internal radius of the pathogen was inhibited in thogenic fungus present in the vicinity may
its growth and remained at the value of 5.35 have an inhibitory effect on the fungus . At the
mm, while the outer radius continued to grow end of the experiment, the Petri dish appeared
until the colony of Mycosphaerellagrossulariae totally covered by mycelium of the fungus T.
was completely surrounded by saprophytic viride, except for those inhibition zones that
fungus colony and the pathogen growth was formed in the right of the two colonies that
completely inhibited (Figure 6c). interacted (Figure 8c).
Figure 6. Macroscopic view of the colony of Figure 8. Macroscopic view of the colony of
Mycosphaerella grossulariae (Auers.) Lind.CBS 235.37 Mycosphaerella grossulariae (Auers.) Lind.CBS 235.37
on PDA medium after 7 days (a), after 10 days and after on PDA medium after 7 days (a), after 10 days and after
45 days (c ) from inoculation of the strain of Gliocladium 45 days (c ) from inoculation of the strain of
roseum Trichoderma viride
After 7 days the contact zone between colony The average values of the percent of growth
of the fungus Epicoccumnigrum and Mycos- inhibition calculated after 7 days allowed asses-
phaerellagrossulariae colony became a curve sment of inhibition as in the categories 4 for
with the concavity oriented towards pathogen Trichoderma viride, 3 level for Trichothecium
fungus which had a slower growth, and the roseum and Epicoccumnigrum and only 1 level
inner radius was ceased growing (Figure 7a). for the strain of Gliocladiumroseum (Table 4,
After 10 days, the white mycelium of the Table 9, Figure 10).
433
Table 4. The in vitro effect exercised by some case of Trichoderma viride, inhibition coe was
saprophytic fungi on M. grossulariae on PDA medium, 77.91, followed by Trichothecium roseum with
expressed by inhibition percent (I%) and inhibition level
(0-10), after 7 days
77.21 Epicoccumnigrum. Gliocladiumroseum
showed the lowest coefficient of inhibition of
Variant I% level 71.33 (Table 7, Table 8, Figure 9).
M. grossulariae/ T. roseum 27,91 3
M. grossulariae/ G. roseum 9,47 1
Table 7. The in vitro relationships between M.
M. grossulariae/ E. nigrum 24,53 3
grossulariae and some saprophytic fungi on PDA
M. grossulariae/ T. viride 30,11 4
medium, expressed by inhibition percent (I%) and
Control (M. grossulariae) 0 0 inhibition level (0-10), after 45 days
At 10 days after inoculation, inhibition coef- Variant I% level

ficient values increased, reaching category 5 for M. grossulariae/ G. roseum 71,33 8
Trichoderma viride and Trichothecium roseum, M. grossulariae/ E. nigrum 76,14 8
4 for Epicoccumnigrum and 3 for Gliocla- M. grossulariae/ T. viride 77,91 8
diumroseum (Table 5, Table 9, Figure 10). Control (M. grossulariae) 0 0
Table 5. The in vitro relationships between M. Table 8. Inhibition percent (I%) exercited by saprophytic
grossulariae and some saprophytic fungi on PDA fungi on M. grossulariae in experimentally variants
medium, expressed by inhibition percent (I%) and
inhibition level (0-10), after 10 days after after
Variant (saprophytic after 7 After
30 45
strain fungus) days 10 days
Variant I% level days days
M. grossulariae/ T. roseum 41,64 5 Trichothecium roseum 27,91 41,64 73,03 77,21
M. grossulariae/ G. roseum 26,57 3 Gliocladium roseum 9,47 26,57 66,07 71,33
M. grossulariae/ E. nigrum 38,9 4 Epicoccum nigrum 24,53 38,9 71,77 76,14
M. grossulariae/ T. viride 43,42 5 Trichoderma viride 30,11 43,42 73,86 77,91
Control (M. grossulariae) 0 0 Control (M. grossulariae) 0 0 0 0
After 30 days from the inoculation, the inhi- Related to degree of inhibition, however, for all
bition values were significantly increased for all saprophytic fungi tested for their inhibitory
tested saprophytic fungi, being 73.86% in case of effect against the strain of phytopathogenic
Trichoderma viride, 73.03 in case of Tricho- fungus Mycosphaerella grossulariae, the inhi-
thecium roseum, 71.77 in case of the strain of bition level was placed in category 8 (Table 7,
Epicoccumnigrum and only 66.07% in case of Table 9, Figure 10).
Gliocladiumroseum (Table 6, Table 8, Figure 9).
Inhibition level was 8 on our scale for three
saprophytic fungal strains (Trichoderma viride,
Trichothecium roseum, Epicoccumnigrum) and
for one strain (strain of the fungus Gliocladium-
roseum) the level of inhibition was a little lower,
7 respectively (Table 6, Table 9, Figure 10).
Table 6. The in vitro effect exercised by some

saprophytic fungi on M. grossulariae on PDA medium,
expressed by inhibition percent (I%) and inhibition level
(0-10), after 30 days
Variant I% level
M. grossulariae/ G. roseum 66,07 7
M. grossulariae/ E. nigrum 71,77 8
M. grossulariae/ T. viride 73,86 8
Control (M. grossulariae) 0 0
At the end of the experimentation, after 45 days Figure 9. Evolution of inhibition percent (I%) in
of the antagonist inoculation we found that in experimentally variants
434
Related to the process of the evolution of the CONCLUSIONS
inhibition percent values we observed that this
The best vegetative growth of Mycosphaerella-
is correlated with growth rate of the
grossulariae (Auers.) Lind. CBS 235.37
saprophytic fungi.
mycelia was registered on PDA medium, this
The fact the fungus Trichothecium roseum
type of medium being selected for growth fungi
showed a higher inhibition than the fungus E.
estimation used in this study and for inhibition
nigrum that had a faster growth, is probably
effect of saprophytic fungi evaluation.
due to the capacity of the species T. roseum to
grow over and hyperparasitize the hyphae of Among the 5 species incubated on PDA
the pathogens, while colony of the fungus medium, the fast growing was observed in the
E. nigrum was slowly surrounding the colony case of the strain of Trichoderma viride,
of Mycosphaerella grossulariae. closely followed by the isolates of
Epicoccumnigrum and Trichothecium roseum.
Table 9. Inhibition level exercited by saprophytic fungi Among saprophytic fungi the length growth
on M. grossulariae in experimentally variants was observed in the case of Gliocladiumroseum
Inhibition level isolate.
Variant after 7 After 10 after 30 after 45 The strain of Mycosphaerellagrossulariae had
days days days days the lowest rate of growing, reaching a medium
M. grossulariae/ T.
roseum
3 5 8 8 value of 7.3 mm of colony diameter after 6
M. grossulariae/ G. days in comparison with the saprophytic fungi
1 3 7 8 Trichoderma viride which totally covered the
roseum
M. grossulariae/ E.
3 4 8 8
Petri dish surface.
nigrum
M. grossulariae/ T.
All fungi tested related to their inhibitory
4 5 8 8 capacity were influenced significantly the
viride
Control (M. pathogenic fungus growth, but the stronger
0 0 0 0
grossulariae) inhibitory effect was observed in the case of the
strain of Trichoderma viride, followed by those
of Trichothecium roseum and Epicoccu-
mnigrum. The lowest inhibitory effect in the
first 10 days after inoculation was observed in
the case of Gliocladiumroseum strain, but after
45 days the inhibition value (I%) was closely to
the other variants.
The inhibitory effect was direct proportional
with the growth rate of both fungi: pathogenic
one and the antagonistic with the exception of
Trichothecium roseum and Epicoccumnigrum.
Although Trichothecium roseum had a more
length growth rate in comparison with
Epicoccumnigrum it expresses a stronger
inhibitory effect.
ACKNOWLEDGEMENTS
The present study was performed according
with the objectives of the project PN-II-62-
079/2008 SIMAECO (CNMP-UEFISCDI).
Figure 10. Evolution of inhibition level (0-10) in
experimentally variants
435
REFERENCES Pĉun E., 1995. Sĉnĉtatea Carpaԑilor (Farmacia din
cĉmarĉ), Ed. Arta Graficĉ, BucureƔti.
Alexan M., Bojor O., Crĉciun F., 1988. Flora medicinalĉ Petrescu Eugenia, besan Tatiana-Eugenia, 2012. In vitro
a României, vol.I, Ed. Ceres, BucureƔti. relationships between fungi isolated from
Ardelean A., Mohan Gh., 2008. Flora medicinalĉ a Ribesnigrum L. plants, Lucrĉri Ɣtiinԑifice, Seria
României, Ed. All, BucureƔti. Horticulturĉ, anul LV, vol. 55, nr.1, p. 573-578.
Bojor O., 2003. Ghidul plantelor medicinale Ɣi aromatice Petrescu Eugenia, Oprea Maria, 2012. Diversity of fungi
de la A la Z, Ed. Fiat Lux, BucureƔti. associated with Ribes nigrum L. crop in the South of
Bojor O., Popescu O., 2009. Fitoterapie tradiԑionalĉ Ɣi Romania, Lucrĉri Ɣtiinԑifice, Seria Horticulturĉ, anul
modernĉ, Ed. Fiat Lux, BucureƔti, ediԑia a V a. LV, vol. 55, nr.2, p. 521-526.
Enache Elena, Ionescu Daniela, Oprea Maria, 2011. The Petrescu Eugenia, besan Tatiana-Eugenia, Oprea Maria,
biological action of some plant extracts in the currant 2012. „In vitro evaluation of the relationships
phylloplan pathogens growth used as a medicinal between some fungal pathogens of black currant crop
plant, Analele Universitĉԑii din Craiova, seria and some saprophytic fungi”, Scientific Bulletin,
Agriculturĉ-Montanologie-Cadastru, vol.XLI 2011/2, Series F, Biotechnologies, vol. XVI, BucureƔti, p.
p. 149-153. 175-178.
Fokkema N.J., 1996, Biological control of fungal plant Stroe Elena, 1988. Aspecte privind biologia „in vitro” a
diseases, Entomophaga 41 (3/4), p. 333-342. ciupercii Mycosphaerella mori (Fuckel)Lindau,
Hulea Ana, 1973. Relations établies in vitro et in vivo agentul patogen al antracnozei dudului, Bul. Prot.
entre différentes espèces de champignons vivants in Plant. nr.3/1988, p. 13-17.
association dans les tiges de maïs et produisant le besan Tatiana Eugenia, Oprea Maria, 1995.
stalk-rot, Rev. Roum. Biol. Botanique 18 (1), p. 47- Epicoccumpurpurascens.II. In vitro relationships
53. with phytophathogenic fungi, Rev. Roum. Biol.
Jouan B., Lemaire J.M., Arnoux, J., 1964. Elements Veget., 41(2), p. 145-151.
d’appreciation des interactions entre champignons Živkoviđ Svetlana, Stojanoviđ S., Ivanoviđ Ž., Gavriloviđ
cultives invitro, Phytiatrie-phytopharmacie 13 (2), V., Popoviđ Tatŧana, Jelica Balaz, 2010. Screening of
p. 185-195. antagonistic activity of microorganisms against
Manole T., 2008. Raport cercetare contract PN II 62.079, Colletotrichum acutatum and Colletotrichum
unpublished, p. 10. gloeosporioides, Arch. Biol. Sci., Belgrade, 62 (3), p.
611-623.
436
THE QUALITY TEST OF THE BURNT VETIVER (VETIVERIA
ZIZANIOIDES) WASTE UTILIZATION AS AN ECO-FRIENDLY
MATERIAL POT
Meylinda Nur PUSPITA, Pristi SUKMASETYA, Selma Siti LUTFIAH
Undergraduate School of Department of Computer Science, Bogor Agricultural University,

Jl. Raya Darmaga Kampus IPB Darmaga Bogor 16680, West Java, Indonesia
Abstract
Essential oils of vetiver is an industrial and trading commodities in the international market that plays an important
role for the perfume, medicine, and cosmetic industries. But the distillery for 12 hours from 1 ton vetiver produced only
4 liters of essential oil and of course a lot of waste that has accumulated. The purpose of this research are to overcome
the industrial waste of vetiver treatment without the continues pollutant, to get the view about the mix pot from the
vetiver waste technically and to know the quality of the pot made from vetiver waste. Making the sample is started with
the selection between the burnt vetiver waste, cement and sand. Then making sample with the form like a pot that has
the up diameter (31,3 cm), the bottom diameter (20,3 cm), highty (30 cm), and the mass of vetiver waste pot (5,52 kg)
and the mass of reguler pot (5,36 kg). From the research that has been done, it can to get the conclusion that the vetiver
waste pot has better quality than the reguler pot (cement pot). It reviewed from the power of the vetiver waste pot has a
power until (583,78 kgf), while the reguler pot has just (410,34 kgf). Besides, this pot can save up to 30% of the cost of
production and exactly it eco-friendly.
Key words: Vetiver waste, pot, commodities, eco-friendly, saved cost.
INTRODUCTION So many essential oil in Indonesia, such as

patchouli oil, clove oil, vetiver oil, lemongrass
Nowadays, West Java agribusiness and agro-
scented oil, eucalyptus oil, ylang oil and many
industry has not treated optimally, but actually
more. One of the efforts to further develop the
based on natural characteristics and the
potential of essential oils, especially vetiver oil
diversity of natural resources are very
in Garut Regency, this time in the ‘Uras’
supportive. It is not surprising if it is used as a
Cooperation in Bayongbong District, Garut
target in the strategic plan of the future
Regency, has tried to build centers of
development in of West Java province, with the
production and oil refining vetiver. Product
agricultural sector (agribusiness and agro-
value of Garut Regency vetiver oil. Annually,
industry), which became the leading sectors of
reach Rp22, 5 billion under management 1508
West Java, especially in increasing revenue. It
farmers from an area of 1850 ha with a volume
also wants to be a mainstay of the local
product vetiver 31,450 tons per year and 25
government in improving Indonesia
tons of oil per year (Between West Java
Development Index (HDI), especially in
Magazine March 24, 2009, the value of vetiver
overcoming the impact of the prolonged
oil product in Garut Regency is Rp 22.5 billion,
economic crisis today (Kastaman 2003).
Johny Dody Hidayat). While the distillation
Essential oil is a commodity industry and trade
process each ton of vetiver for 12 hours only
in the international market plays an important
produce 4 liters of oil at a price of Rp 900
role, especially as industrial raw materials that
thousand per liter and production costs Rp 2, 25
can reach billions of U.S. dollars. For instance,
million, making it the benefit of farmers at
the price of 1 ounce of vetiver oil could reach
about Rp 1, 4 million (Haeruman, Head
25.4 U.S. dollars. If the value is in the
Plantation Office Garut).
exchange rate of the rupiah in it, so for 1 ounce
However, the processing of waste volume
oil it can be range on Rp.228.600,-or USD
certainly gained considerable refining. Indeed,
2,286,000.00 per kilogram of material
there are several ways of processing done by
(Kastaman, 2003).
437
the community, but still very simple. The with material characteristic analysis and press
community make the waste to make the testing in Material Test Laboratory Department
compost mixture, but in the process the waste of Mechanical and Biosystem, and seepage
piled up in advance amounted to much. The testing in Cikabayan Green House Laboratory.
impact is make the bad view, and in the Department of Agronomi and Horticulture
accumulation of the highly pungent smell due Department, Bogor Agricultural University
to the persistence of the essential oils that are (IPB).
not perfectly distils that interfere with the
surrounding air. Later, due to of the other RESULTS AND DISCUSSIONS
accumulation is the water accumulation.
Waste handling that conducted in the field is
Possibly, due to rain water that seeps in
still inadequate and still cause pollution, in
landfills vetiver it can seep into the soil and
connection with the burning of waste after the
disrupt the existing groundwater conditions
distillation process is often done by many
which in the beneath. Following the
farmers (Figure 1). Smoke produced still
accumulation, the people burn it. Following
contains essential oils so smell of smoke more
hoarding, the people and then burn it. Here the
pung ent. (Kastaman, 2003).
problem arises again, the smoke produced
disturb the surrounding air and can cause
respiratory infection. Therefore, further
research is needed to solve these problems with
eco-friendly principles.
The purpose of this activity are to overcome the
industrial waste of vetiver treatment without
the continues pollutant, to get the view about
the mix pot from the vetiver waste technically, Figure 1. The Vetiver Waste Management by Burning
and know the quality pot that made from waste that Caused a Lot of Negative Impact
vetiver
Based on empirical observation we get the The negative impact by (Kastaman, 2003) is
information that vetiver waste is still a problem that currently felt by the public about waste
for the environment around them because of the management with burning among others: air
bad smell and bad view. The most simple and pollution, water pollution by residual materials
quickly done by the most farmers in agro- / waste, plants in around the pile of waste
industrial centers vetiver to handling of vetiver experiencing barriers to growth, need extensive
waste is by burning so the smoke that produced burning land so that the land is less productive.
make the pollution impact. The Production of Vetiver Waste Pot
One alternative solution to overcome this The first step in the manufacture of vetiver
problem is with analyze the waste material that waste pot is cut the vetiver into small pieces,
is used as a raw flower pot material. It is The materials that is specified the mixture
necessary to look at the possibility of waste stirring until evenly (for the composition, the
utilization so that it can overcome the main dough: vetiver waste, cement and sand,
significant environmental issues surrounding while the coating dough: white cement, traso,
the vetiver oil refining industry. In addition, it and mil) then Prepare the pot mold and lid the
is expected to add the value of vetiver waste as flower pot mold, used motorcycles oil (grease)
an additional income for farmers and to lubricate the pot mold that that will be used
industrialists vetiver. to make the pot. This is to facilitate the
separation of pot from from the mold, the
MATERIALS AND METHODS original pot is not sticky Then, put the dough
This research were conducted in the centra of into the mold and trim while holding and
vetiver waste production which is manage by rubbing to get a solid pot and a surface flat. The
Vetiver Uras Cooperation Bayongbong District, coating dough that contains of mixture water
Garut Regency during February until May lubricated to the surface of the pot mold, this is
2012. This research use descriptive method to give color to the outer surface of the pot
438
before it is printed using the main dough The mold, then the pot is placed in the shade to
bottom of the mold pot gived the main dough. avoid the direct sunlight.
After the coating dough is evenly, then covered The Maintenance ProcessMove the vetiver
again with the main dough that it mixed with waste pot that printed to the protected place
the water as the main ingredient pot. After it from the sunfor for 12 to 24 hours, until the
spread evenly, sprinkle the main dough without flower pot come tobe hard.
water, to strengthen those pot. When the main The placement of flower pot in the shelter
dough is evenly distributed on the mold, we should be up and squeezed between the head
sprinkle again with coating dough to give color and the head, so do the leg and the leg of
to the inside of the pot. flower pot, so that the surface are ot broken and
After everything is evenly distributed, the the placement of the bottom side of the vetiver
inside of the pot must be be smooth using waste waste should be given as the base. The
smoother scoop. So do with the mouth of the room should be covered and kept holding the
pot, it also must be smooth using smoother air circulation so that the pot does not stricken
scoop. The thickness of the pot that will be direct of the sunlight. The cooling process
produced is about 5cm. The pot mold left for should be performed by air drying or rather
about 5minutes, then the pot mold reversed dried. This Drying is carried out for three days
slowly to remove the pot from the mold. The o rperceived vetiver waste pot is dry.
bond rubbers is removed one by one from the
Figure 2. Manufacture of vetiver waste process (1) Vetiver waste is cut in to small pieces (2) Vetiver waste is mixed
with cement and sand (3) Stir it so that the dough distribute evenly (5) The printing dan (5) And that is teh eco-friendly
vetiver waste pot.
The Results of Seepage Test and Pressing the seepage test, the pot with normal
Test material and the vetiver waste pot are
1. The Results of Seepage TestThe seepage fulfilled with the same water during 24
test is did on the pot by putting water into hours. Start at 08.00 a.m on May 5th 2012
the pot until it full during 24 hours. When until 08.00 a.m on May 6th 2012.
Table 1. The Seepage Test Result of Vetiver Waste Pot and the Normal Pot
The Reducing Water (cm)
The Repetition
Vetiver Waste Pot Normal Pot
1 3,50 7,50
2 3,50 3,50
3 3,50 3,50
4 3,75 3,50
5 3,50 4,50
6 3,50 3,50
7 3,50 3,50
The Average 3,54 4,21
The vetiver waste can absorb the water 3.54 cm waste pot and normal pot able to meet one of
in average and the normal pot can absorb the the requirements of good pots that can absorb
water 4.21 cm. This indicates both vetiver the water.
439
2. The Result of Pressing Test
Table 2. The Data of the Pressing Test Result of Vetiver Waste Pot
Vetiver Waste Pot Normal Pot
The Repetition
Massa (Kg) The compressive strength (Kgf) Massa (Kg) The compressive strength (Kg)
00 Position
1 5,030 430,0 5,867 675,0
2 5,040 307,5 5,420 530,0
3 5,595 497,5 4,957 266,5
4 5,700 515,0 5,250 381,3
5 5,625 502,5 5,625 350,0
6 5,270 745,0 5,200 177,0
7 5,265 500,0 5,130 247,5
8 5,420 425,0 4,945 230,0
9 5,235 447,5 5,630 165,0
10 5,350 725,0 5,050 560,0
11 5,165 442,5 5,670 257,5
12 5,750 327,5 4,680 127,5
Rata-rata 5,370 530,4 5,285 330,6
Posisi 1800
1 5,180 400,0 5,290 376,0
2 5,685 807,5 4,935 275,0
3 5,830 1015,0 5,025 457,5
4 6,090 632,5 5,495 227,5
5 6,060 1015,0 5,020 352,5
6 5,395 325,0 6,190 1312,5
7 5,435 397,5 4,880 127,5
8 4,945 650,0 6,295 847,5
9 5,280 552,5 5,415 105,5
10 5,395 1251,5 5,620 885,0
11 5,520 501,5 4.410 395,0
12 5,585 826,5 5,591 605,0
Rata-rata 5,533 697,9 5,347 497,2
Rata-Rata Total 5,452 614,2 5,316 413,9
The waste vetiver flower pot crushed when the when given load average 410.34 kg of 25
weighted average 583.78 kg of experiments. It can be seen from the graph the
25 experiments. While the normal pot crushed test results.
Figure 3. Exponential curve vetiver waste pot endurance per-ten seconds and maximum durability point
440
Imposition of the pot is done every 10 seconds phase that states the force pot threshold and the
and the load mass increases (see figure 2) every death phase of pot declared maximum power
10 seconds too. On the curve is seen that and started to crack.
exponential phase happen followed by a lag
Figure 4. The Durability Comparison Curve against Discounter Mass between Vetiver Pot and Regular Pot at Emphasis
on Testing in 0o position
Figure 5. The Durability Comparison Curve against Discounter Mass between Vetiver Pot and Regular Pot at Emphasis
on Testing in 180o position
Based on the results of power pot test generated vetiver pot serves as a frame. From the data
the different crack pot. When the waste vetiver analisis can conclused that waste vetiver pot
pot given maximum load, pot indirectly stronger than regular pot. Another advantage of
cracked. This is caused by the waste burnt pots made from waste burnt vetiver is to reduce
vetiver fibers that hold pots. The fibers from the use of sand. The two doughs that is given
waste vetiver dough stronger bond. Unlike the same proportion of the cement and the sand,
regular pots. When the regular pot was given while the other dough is added with the burnt
by the maximum load it will instantly crack vetiver waste that is used to make two pots
pot. This is due to there are whereas the dough just for one pot. In addition,
nothing material that can resist the crack pot the mixing of waste burnt vetiver as a pot can
like waste fibers. The fibers in the waste burnt reduce environmental pollution.
441
Figure 6. Comparison of Results with Regulat Pot and The Waste Vetiver Pot
Figure 7. The Seepage Test of Waste Vetiver Pot
442
Figure 8. Test of Strength Vetiver Waste Pot
Figure 9. The Pot Condition After Pressing Test
443
CONCLUSIONS M.Si, M.Kom who has given full support so
that the paper can be completed then for all
Manufacturing the burnt vetiver waste pot same
who have helped. Hopefully from this paper the
with manufacturing the normal pot (cement
author can make a real contribution to the
pot).
advancement of Indonesia country and it can be
The comparison of the burnt vetiver waste pot useful to the progress of Indonesia country.
is 3:3:2, that is the burnt vetiver waste: sand :
cement. REFERENCES
Through the seepage test result between the Hartoyo J dan Roliandi H, 1978. Percobaan pembuatan
burnt vetiver waste with the normal pot alike Briket Arang dari Lima Jenis Kayu Indonesia.
can absorb the water. Laporan Penelitian. Lembaga Hasil Hutan. Bogor.
Karch G.E., Boutette M. 1983. Charcoal Small Scale
The quality of the burnt vetiver waste pot has Production and Use. Germany. Appropriate
much better quality than regular pot, it is seen Technology Exchange. Germany.
from the press test results of that the burnt Kastaman R., 2003. Analisis Kelayakan Teknis
vetiver waste pot is stronger than regular Pemanfaatan Limbah Akar Wangi.
pot.Moreover, it can minimize the production Majalah Antara Jawa Barat, 24 Maret 2009. NILAI
PRODUK MINYAK AKAR WANGI GARUT Rp 22,5
cost and certainly eco-friendly. MILIAR, Johny Dody Hidayat.
Paul A. Tipler, Bahasa A., Prasetio L., Rahmad W. Aidi,
ACKNOWLEDGEMENTS 1998. editor, Joko Sutrisno, Ed.3, Cet.1., Jakarta:
Erlangga.
Authors say thanks to all those who have Porges J., 1976. Hanbook of Hatchery Ventilating and
assisted in the preparation of scientific papers. Air Conditions. News Autter Worty and Vincy
Thanks to: our lecture, Mr. Dr. Ir.Agus Buono, England.
444
TUBER YIELD AND QUALITY OF NINE GENOTYPES YAM BEAN

(PACHYRHIZUS SPP.) DUE TO SINK-REPRODUCTIVE PRUNING
Wieny H. RIZKY1, Sofiya HASANI2, Agung KARUNIAWAN3

1
Agronomy Department of Agriculture Faculty, Universitas Padjadjaran, Sumedang, Indonesia
2
Graduate Student of Agriculture Faculty, Universitas Padjadjaran, Sumedang, Indonesia
3
Plant Breeding Department of Agriculture Faculty, Universitas Padjadjara, Sumedang, Indonesia
Abstract
Yam bean tuber starch extract has been widely used for traditional cosmetics material in Indonesia. This experiment
was aimed to acquire yam bean tuber with high yield and starch content. Materials used were 9 yam bean genotypes
collection of Agung Karuniawan (Plant Breeding Laboratory, Universitas Padjadjaran ) consisted of three genotypes of
P. erosus, one genotype of P. ahipa, two genotypes of P. erosus intraspecific crossing and three genotypes resulted from
interspecific crossing between P. erosus and P. ahipa. The field trial was conducted at experimental field of Faculty of
Agriculture, Universitas Padjadjaran Jatinangor from August 2009 until March 2010. The experiment was arranged in
split plot design repeated twice. The main plot consisted of two treatments namely without sink-reproductive pruning
and with sink-reproductive pruning. The main plot was divided into nine subplots based on genotypes. Pruning and
genotype independently affected tuber fresh weight. The heaviest tuber produced by P. erosus B-1 / EC 033. Genotypes
affected on tuber dry matter and tuber starch content. The highest dry matter was contained in interspesific crossing
between P. erosus x. P. ahipa EC 550 x AC 208-72h. The highest tuber starch content was resulted by P. ahipa AC 216-
139d. Sink-reproductive pruning and genotype interacted in tuber dry matter trait.
Key words: Sink-reproductive Pruning, Starch, Yam bean, Yield.
INTRODUCTION diversity and increase the amount of dry matter,

Plant Breeding Laboratory, Universitas
Yam bean or bengkuang in Indonesian is
Padjadjaran did intraspecific and interspecific
actually benefited not only for food but also for
hybridization between P. erosus and P. ahipa.
medication or cosmetic functions. This crops is
Besides plant breeding, the potential of yam
widely cultivated in Sumatra, Java, Southeast
can be improved by developing appropriate
Nusa, Sulawesi, Bali and Kalimantan
cultivation techniques. One of the frequent
(Karuniawan, 2004). At current time, the tuber
cultivation techniques is sink-reproductive
starch extract used both as traditional and
pruning (Sorensen). This technique is done by
modern cosmetics for brightening skin
cutting off reproductive parts of plants, which
naturally. In fact, some of modern cosmetics
is begun at the first flower bud emergence.
with yam bean starch extract based have won
Sink-reproductive pruning aimed to reduce
several national and international awards (Ratu,
competition of photosynthates distribution
2012). Therefore the development of yam bean
between the reproductive and tuber sink parts.
tuber starch production is actually needed.
Flower bud pruning on the yam bean can
From the analysis of 100 g of fresh yam bean,
increase 30%-70% of tuber fresh weight [6].
starch content is at 2.1 g - 10.7 g (Sorensen,
Therefore, sink-reproductive pruning will shift
1996), even in Indonesia the starch content for
assimilate to tuber.
P. erosus is averaged only around 1% (UTP,
This study aimed to test the simultaneous effect
2011) The highest dry matter content enclosed
of sink-reproductive pruning on yam bean yield
in P. ahipa that is equal to 26% - 24% then P. and tuber quality traits namely starch content
erosus by 6% - 22%. One disadvantage of and dry matter content. Further, expectantly
starch yam bean tuber use is the high water there will be genotypes with high starch content
content, so that although the tuber has great as potential yam bean genotypes especially for
size but still has low starch level due to the low cosmetics raw material.
dry matter content. To broaden genetic
445
MATERIALS AND METHODS interacted on tuber dry matter trait in highly
significant difference.
Materials used in this experiment were nine
yam bean genotypes collection of Agung Table 1. Analysis of Variance for Tuber Fresh Weight,
Karuniawan (Plant Breeding Laboratory, Tuber Dry Matter, Tuber Starch Content of Nine
Genotypes Yam Bean
Universitas Padjadjaran ). It consisted of three
P. erosus, one P. ahipa, two intraspecific F
crossing of P. erosus and three interspecific Variables Interaction
Pruning Genotype
PxG
crossing of P. erosus and P. ahipa.
TFW (g) 2.51 * 11.7 ** 1.9
The field trial was conducted at experimental TDM (%) 1.15 4.90 * 18.05 **
field of Faculty of Agriculture, Universitas TSC (%) 0.01 20.30 ** 2.02
Padjadjaran Jatinangor located at an altitude of TFW=Tuber Fresh Weight; TDM=Tuber Dry Matter;
753 m above sea level with Inceptisols soil type TSC= Tuber Starch Content; *=significant on ɲ
and type C rainfall according to Schmidt- 0,05; **= significant on ɲ 0,01
Fergusson. The experiment was conducted
from August 2009 until March 2010. Table 2 shows least significant difference
The experiment was arranged in split plot (LSD) test on tuber fresh weight affected by
design repeated twice. The main plot consisted pruning and genotype In this study, sink-
of two treatments: without sink-reproductive reproductive pruning generated higher tuber
pruning and with sink-reproductive pruning. fresh weight trait. Non pruning treatment only
The main plot was divided into nine subplots resulted 122.35 g, whereas, sink-reproductive
based on genotypes. Each subplot size was 2 m pruning 371.61 g. Sink-reproductive pruning of
x 3 m with spacing 50 cm x 50 cm between flower bud removal diverts assimilate distribu-
plants and 100 cm between subplots. Fertilizer tion into tuber storage sinks. The increased
recommendation given referred to the sweet flow of assimilate to the tuber, consequential
potato cultivation in dry land. on the change in dimensions. In addition, the
Sink-reproductive application treatment was increased of assimilate flow also affect tuber
carried out after 50% of plants per plot had fresh weight.
entered the flowering phase (R5) (Zanklan, The smallest yield result for genotype showed
2003), it was done once a week until the har- by P. ahipa AC 216-139 d that was 86,45 g per
vest time. Harvesting of tuber was appro- tuber, however the other genotypes were in
ximately 180 days (six months) after planting. same group ranged from 205,76 g- 342,95 g per
Characters observed were tuber fresh weight tuber. It is mean that even the elder was P.
(g), tuber dry matter content (%) and tuber ahipa but the crossing with P. erosus will
starch content (% WB). Yam bean tuber starch increase the yield.
content was analyzed using Luff Schoorl Table 2. Analysis of Variance for Tuber Fresh Weight,
method conducted at Yield Physiology Labo- Tuber Dry Matter, Tuber Starch Content of Nine
ratory, Vegetable Research Institute, Lembang Genotypes Yam Bean
West Bandung. Treatments Tuber fresh weight (g)
Data were analyzed using statistical analysis of Sink-reproductive pruning
variance (anova) using Statistix 8 program. Without 122,35 b
Comparison of the mean value was done using With 371,61 a
the least significant difference test (LSD) on Genotypes
B-10 / EC 550 254,32 a
the real level 5%. B-1 / EC 033 342,95 a
B-56 / CJ 297,88 a
RESULTS AND DISCUSSIONS AC 216-139 d 86,45 b
B-10 / EC 550 x AC 216-139 d 205,76 a
Based on analysis of variance (Table 1), B-1 / EC 033 x B-56 / CJ 184,99 a
pruning and genotype treatments independently AC 216-139 d x B-56 / CJ 308,46 a
gave significant different on tuber fresh weight B-10 / EC 550 x B-56 / CJ 308,27 a
character. Genotypes as the subplot factor, gave B-10 / EC 550 x AC 208-72h 233,76 a
significant different on all tuber traits observed. Numbers followed by the same letters are not
significantly different on alpha 0.05 LSD test
Sink-reproductive pruning and genotypes
446
Table 3 defines LSD test for genotypes effect seen in the character of dry matter and starch.
on tuber dry matter and tuber starch content. Tuber dry matter content is a parameter that
EC 550 x AC 208-72h had the highest value on reflected the extent of how far photosynthesis
dry matter content. Otherwise, on tuber starch product is distributed to the tuber. Efficiency of
content character the best result was showed by the photosynthetic process is shown in the rate
AC 216-139 d, then followed by EC 550 x AC of accumulation of dry matter content (Gardner
208-72h. The average tuber starch content of et al., 2008).
yam bean produced in Indonesia is about 1%,
therefore the new genotype resulted from Table 4. Interaction between Genotypes x Sink-
interspesific crossing between P. erosus and P. Reproductive Pruning on Tuber Dry Matter
ahipa (EC 550 x AC 208-72h) could be Tuber Dry Matter
considered for further development for Genotypes Without With
cosmetics raw material. Pruning Pruning
8,51 abc 3,71 B
B-10 / EC 550 A B
Table 3. Effect of genotypes on yam bean tuber dry
6,04 bcd 4,68 B
matter and total starch content
A A
B-1 / EC 033
Tuber Dry Tuber Starch 7,65 abcd 7,01 B

Genotypes Matter Content A A
B-56 / CJ
% % 1,38 d 16,34 A

B-10 / EC 550 B A
AC 216-139 d
B-1 / EC 033 8,78 abc 6,22 B
6,11 de 1,07 c
B-56 / CJ A A
5,36 e 1,20 c B-10 / EC 550 x AC 216-
AC 216-139 d 10,42 ab 7,23 B
7,33 bcde 1,63 c 139 d
B-10 / EC 550 x AC A A
9,39 abcd 6,71 a B-1 / EC 033 x B-56 / CJ
216-139 d 9,70 abc 3,50 B
AC 216-139 d x B-56 / CJ A B
B-1 / EC 033 x B-56 / B-10 / EC 550 x B-56 / CJ
7,50 abcde 1,34 c 8,34 abc 8,37 Ab
CJ B-10 / EC 550 x AC 208-
8,82 ab 1,68 bc A A
AC 216-139 d x B-56 / 72h
6,60 cde 1,45 c 11,71 a 8,84 Ab
CJ
8,35 abc 1,76 bc A A
B-10 / EC 550 x B-56 /
CJ Numbers followed by the same letters are not
B-10 / EC 550 x AC 10,27 a 2,66 b significantly different on alpha 0.05 LSD test Small
208-72h letter read vertically; Capital letter read horizontally
Numbers followed by the same letters are not
significantly different on alpha 0.05 LSD test P. erosus is the most stable species in pro-
duction, also it produces the prime number for
There was interaction between genotypes x yield (Kale, 2006). P. ahipa is known as spe-
sink-reproductive pruning on tuber dry matter cies with smaller tuber, but higher in dry matter
content, it is shown on Table 4. On non- and starch content. Therefore, hybridization
pruning treatment, only P. ahipa AC 216-139 d using those species is expected to gain the new
gave smallest mean value for tuber dry matter genotype in high production amount with better
character. While, contrast result was shown on quality especially starch content. This study
sink-reproductive pruning, AC 216-139 d noted that intraspesific and interpesific crosses
genotype had the highest value than other produced a new genotype with higher pro-
genotypes, then followed by interspesific duction yield with better quality character for
hybrid genotype EC 550 x AC 208-72h. dry matter and starch than the elders.
In this study, pruning did not affect
thequalitative traits such dry matter and starch CONCLUSIONS
content of tuber. Yam bean production
increased as the result of pruning, but this Pruning and genotype independently affected
practice did not affect the percentage of soluble tuber fresh weight. The heaviest tuber produced
sugar content and dry matter percentage. by P. erosus B-1 / EC 033.
However, there are variations of these traits on Genotypes affected in tuber dry matter and
genotypes were evaluated caused by genetic tuber starch content. The highest dry matter
factors (Zanklan, 2003). This variation can be was contained in interspesific crossing between
447
P. erosus x. P. ahipa EC 550 x AC 208-72h. vexillata) Species. (Disertation) Cuvillier Verlag
The highest tuber starch content was resulted Goettingen, Universitaet of Goettingen, Germany.
Karuniawan A., 2004. Cultivation Status and Genetic
by P. ahipa AC 216-139d. Diversity of Yam Bean (Pachyrhizus erosus) in
Sink-reproductive pruning and genotype Indonesia. (Disertation) Cuvillier Verlag Goettingen,
interacted in tuber dry matter trait. Universitaet of Goettingen, Germany.
Mustika Ratu, Consumer Products Corporation. Awards.
Available online at http://www.mustika-ratu.co.id.
ACKNOWLEDGEMENTS [23-01-2012].
Nusifera S and Karuniawan A, 2007. Stability of 16
Authors would like to thanks to IMHERE Genotypes Yam Bean (Pachyrhizus erosus L. Urban)
Granted Program for financial support. Also, Tuber Dry Matter Content in Jatinangor West Java
thanks to Sinta Prestiana Beza for cooperative Based AMMI Model. Zuriat, Vol. 18 No. 1.
work on this study. Sørensen M., 1996. Yam Bean Pachyrhizus DC.
Promoting the Conservation and Use of
Underutilized and Neglected Crops. IPGRI. Rome.
REFERENCES
UPT BPPTK-LIPI Yogyakarta. Pati Bengkuang untuk
De Melo E.P., Krieger N., and Stamford T.L.M, 1994. Produk Kecantikan. Available online on
Physchochemical properties of Jacatupe (Pachyrhizus http/bpptk.lipi.go.id. [15-01-2011]
erosus L. Urban) starch. Starch 46, p. 245- 247. Zanklan A.S., 2003. Agronomic Performance and
Gardner F.P., Pearce R.B., Dan R.L. Mitchell, 2008. Genetic Diversity of The Root Crop Yam Bean
Crops Physiology. Translation of H. Susilo. Jakarta: (Pachyrhizus Spp.) under West African Conditions.
Universitas Indonesia Perss. (Dissertation). Cuvillier Verlag Gottingen,
Kale P., 2006. Studies on Nutritional and Processing Uniersitaet of GoettingenGermany.
Properties of Storage Roots of Different Yam Bean
(Pachyrhizus spp) and Wild Mung Bean (Vigna
448

ScientificPapers_SeriesB_Horticulture_Vol_LVII_2013

Uploaded by

Document Informationclick to expand document informationhorticultura

Document Informationclick to expand document information

Copyright:

Available Formats

ScientificPapers_SeriesB_Horticulture_Vol_LVII_2013

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

ScientificPapers_SeriesB_Horticulture_Vol_LVII_2013

Uploaded by

Copyright:

Available Formats

SCIENTIFIC PAPERS

CERES Publishing House

ISSN 2285-5653, ISSN-L 2285-5653

HORTICULTURAL BIODIVERSITY AND GENETIC RESOURCES

ORNAMENTAL PLANTS, DESIGN

BEHAVIOUR OF DELTA CULTIVAR NECTARINES DURING THE VALORIZATION

ConstanƜa ALEXE1, Marian VINTIL 1, Simona POPESCU1, Liana-Melania DUMITRU2,

Corresponding author email: [email protected]

Key words: firmness, qualitative losses, storage capacity.

INTRODUCTION process, from the moment they are harvested

Georgeta BELENIUC1, Constantin Baduca CÂMPEANU2, Claudia ‫܇‬TEFAN3, Jose PARDO4

Corresponding author email: [email protected]

INTRODUCTION acid and CO2, according to the reaction:

IV. In our researchs, we selected 10 strains of

Gheorghe CÂMPEANU, Florin Constantin IACOB, Nicolae ATANASIU, Elena CATANĂ,

University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Blvd.,

Corresponding author email: [email protected]

Key words: Cucumis sativus L., fertilization, fruits, number, quantity.

INTRODUCTION tunnels, cultivated with five pickling cucum-

With increased density of fruits on terminal

Table 2. Total production type cornichon cucumber in

ORGANIC WEED CONTROL MEASURES APPLIED IN ORGANIC

Elena CATANĂ1, Gheorghe CÂMPEANU1, Nicolae ATANASIU1, Gabriela NEA‫܉‬Ă1,

Corresponding author email: [email protected]; [email protected]

INTRODUCTION cereals. Root systems of many weed species

RESEARCHES ON THE INFLUENCE OF SOME BIOLOGICAL

University of Agronomic Sciences and Veterinary Medicine of Bucharest,

Corresponding author email: [email protected]

Key words: biologically stimulators, dwarf french bean, seed production.

INTRODUCTION Among the most efficient measures to increase

Adriana COSTESCU1, Liviu DEJEU1, Camelia POPA2

Corresponding author email: [email protected]

Key words: table grapes, fertility, productivity, resistance.

INTRODUCTION zone with Campia Romana. The viticultural

Dates on the ratio of the diameter of the

THE INFLUENCE OF TECHNOLOGICAL FACTORS

Simona Elena DIMACHE (BOBOC), Nicolae ATANASIU, Gheorghe CÂMPEANU,

University of Agronomic Sciences and Veterinary Medicine of Bucharest,

Corresponding author email: [email protected]

Key words: Commercial quality, cultivars, field peppers, food quality.

INTRODUCTION Pepper has twice as much vitamin C than

Table 1. Experimental variants. Peppers for fresh consumption,

Table 4. The pericarp thickness. Silistraru Braila, Berceni Ilfov, 2012

Table 5. Vitamin C content. Silistraru Braila, Berceni Ilfov, 2012

RESEARCH CONCERNING EFFECTS OF PERLITE SUBSTRATE

Elena Maria DRĂGHICI, Maria PELE, Elena DOBRIN

University of Agronomic Sciences and Veterinary Medicine of Bucharest,

Corresponding author email: [email protected]

Key words: perlite substrate, tomatoes, size grain.

INTRODUCTION In the global horticultural production, vegetable

Culture was established in unheated solarium.

INFLUENCE O THEPEST CONTROL METHODS OVER THE USEFUL

Ioan ENOIU1, Lidia FÎCIU2, Sonia DROSU3

Corresponding author email: [email protected]

Key words: methods of pest control, viticulture, useful entomofauna.

INTRODUCTION useful and harmful entomofauna existing in a

To be noted that all versions include Orthoptera

Corresponding author email: [email protected]