Available Online JOURNAL OF

SCIENTIFIC RESEARCH
Publications J. Sci. Res. 5 (3), 499-513 (2013) www.banglajol.info/index.php/JSR

Heterologous Expression and Purification of β Galactosidase Protein Using

Affinity Chromatography

M. Z. Alam1*, L. Regioneiri2, M. A. S. Santos2, and A. Iqbal1

1
Department of Genetic Engineering and Biotechnology, Shah Jalal University of Science and
Technology, Sylhet-3114, Bangladesh
2
RNA Biology Laboratory, Department of Biology and CESAM, University of Aveiro, Aveiro
3810-193, Portugal

Received 17 February 2013, accepted in final revised form 12 May 2013

Abstract
Enzymes and other protein purification using recombinant DNA technology have become
popular due to scarcity of natural protein. Saccharomyces cerevisiae is a demanding host,
since it facilitates protein expression by its relative simplicity, safe organisms, inexpensive
and has many properties of eukaryotic expression system. As an alternative host we express
E. coli lacZ gene with GST tag in Saccharomyces cerevisiae and successfully purified from
soluble extracts. The concentration of soluble GST-β galactosidase protein was
approximately 0.57 mg/ml of elution buffer yielded from 50 ml yeast cell culture. The β-
galactosidase protein from insoluble extract was low due to the increasing solubility of GST
tag.
Keywords: β-galactosidase; Heterologous expression; GST tag; Affinity chromatography.
© 2013 JSR Publications. ISSN: 2070-0237 (Print); 2070-0245 (Online). All rights reserved.
doi: http://dx.doi.org/10.3329/jsr.v5i3.13820 J. Sci. Res. 5 (3), 499-513 (2013)

1. Introduction

Proteins are complex molecules and therefore synthesis by cell free system is difficult.
One of the alternative ways is to produce protein in heterologous host. Recombinant
DNA technology has opened the door to a new world of biotechnological products for the
production of heterologous proteins in microorganisms, like, for instance, pharmaceutical
products and industrial enzymes. It is now possible to produce large quantities of proteins
in industrial scale at low price and with constant high quality by means of recombinant
DNA technology. In 1982, the first product of recombinant DNA technology was
produced by Lilly [1], namely insulin, a life saving drug for diabetic patients. Since then
many proteins and enzymes have been produced worldwide for food and medical
purposes. In most cases, recombinant genes are expressed in heterologous host. The most
commonly used and well studied organism for the heterologous expression of proteins is

*
Corresponding author: [email protected]
500 Heterologous Expression

E. coli. However, a variety of alternative hosts have been developed as the nature of the
recombinant proteins being expressed became more complex.
In this context, yeasts, Saccharomyces cerevisiae are very useful hosts because they
have several advantages over other microorganisms such as: rapid growth, nonpathogenic,
discrete cells, ability for replica plating, an accommodating DNA transformation system
[2], well defined genetics, cheap and commercially available mutants. Moreover, many
human genes related to disease have orthologs in yeast [3], meaning that the same genes
have been conserved through time in species, maintaining the same or similar function.
Many scientific studies show that nearly 50% of human genes implicated in heritable
diseases have yeast homologs [4] or at least 31% of proteins encoded by yeast genes have
human homologs. Moreover, cell cycle mechanisms, signal transduction, and metabolic
and regulatory mechanisms between yeast and other eukaryotic organisms are conserved.
The close homology to higher order eukaryotes and simplicity of yeast genetics allows the
introduction of mammalian genes into yeast and the analysis of their function [5].
S. cerevisiae was the first eukaryote with the genome completely sequenced, with the
possibility of being transformed with plasmids and to have gene knockouts strains [3].
Yeast has shifted molecular genetics research to a systems level approach of functionally
characterizing parts of the genome. S. cerevisiae has also been used for centuries in food
production, especially in bakery and brewing industries, and is Generally Recognized As
Safe (GRAS) by the American Food and Drug Administration (FDA). By contrast,
mammalian cells may contain oncogene or viral DNA, while other prokaryotic organisms
may have toxic cell wall pyrogens (endotoxins). In addition, yeasts have the ability to
perform eukaryotic processing steps during polypeptides synthesis. Most of the
recombinant proteins produced in S. cerevisiae are intracellular, i.e., they are produced
and retained within cell. These proteins may be produced in a soluble, biologically active
form, or they can be insoluble and precipitate in the cell as inclusion bodies [6]. The
recovery of both forms of proteins requires the disruption of the yeast cells as an initial
step in the extraction and purification of proteins. Some of the examples in which direct
intracellular expression have been successfully used to express heterologous gene
products include the hepatitis B virus surface antigen (HBsAg) [7], human superoxide
dismutase (hSOD) [8], fibroblast growth factor [9], human immunodeficiency virus type-1
(HIV1) env and gag polypeptides [10, 11], surface antigens of malaria parasites [12], rat
cytochrome C [13], α1-antitrypsin proteinase inhibitor [14] and human viral surface
glycoproteins [15]. Considering all the benefits and advantages as like eukaryotic system,
yeast was selected for heterologous expression of protein.
Protein purification is a complex process requiring a high degree of skill and
experience, and most protocols rely on finding particular properties of the protein in
question, which can be used to gradually enrich the protein away from all the other
proteins and components of the cell. Recently, a new range of techniques have come into
general use which can speed up the process by cutting down the number of steps
necessary, and which are broadly applicable to a range of proteins with very different
 M. Z. Alam et al. J. Sci. Res. 5 (3), 499-513 (2013) 501

properties. All these techniques involve adding extra amino acids to the protein that give it
a new properties, namely to bind very tightly to a particular substrate. This specific
binding can be used to isolate the protein away from all the other materials in the cell
which do not bind this substance. The method is known as affinity chromatography. A
common example is the use glutathione S- transferase (GST) tags. GST is an abundantly
expressed 26 kDa eukaryotic protein, and GST cloned from Schistosoma japonicum
promotes solubility and permits purification of N-terminal fused proteins using
glutathione sepharose [16]. When applied to the affinity medium, fusion proteins bind to
the ligand and impurities are removed by washing with binding buffer. Fusion proteins are
then eluted from the Glutathione Sepharose under mild, non denaturing conditions that
preserve both protein antigenicity and function. The present study was intended to over
expression of β galactosidase protein (MW 116 kDa) in yeast with glutathione S-
transferase (GST) tag (MW 26 kDa) and optimization of purification condition. The full
length E. coli β-galactosidase was selected as model protein because its presence and
functional activity can be assessed by well known β-gal assay [17] before purification.
Moreover very few information are available regarding larger GST tag protein [>100 kDa]
purification from yeast. So, in this paper we will show a detail protocol for purification of
larger protein from the yeast using affinity chromatography technique.

2. Materials and Method

2.1. Yeast strain, plasmid, media and growth condition

The yeast Saccharomyces cerevisiae was used in this study for the heterologous over
expression of β-galactosidase: the diploid strain CEN.PK2 (MATa/MATα, ura3-52/ura3-
52, trp1-289/trp1-289, leu2-3_112/leu2-3_112, his3Δ1/his3Δ1, MAL2-8C/MAL2-8C,
SUC2/SUC2) and the haploid strain BY4742 (MATα, his3Δ1, leu2Δ0, lys2Δ0 and
ura3Δ0). The yeast strain CEN.PK2 without pGL-C1 plasmid also grown as control. The
multicopy plasmid vector pGL-C1 carrying E. coli lacZ gene, producing β-galactosidase
protein, was transformed in S. cerevisiae in the diploid CEN.PK2 strain under the control
of the GPD promoter as a fusion with glutathione S-transferase (GST- β gal). The
pUKC815 plasmid containing the yeast phosphoglycerate kinase (PGK1) gene promoter
and the N-terminal 33 amino acids fused in-frame to the E. coli lacZ gene coding for β-
galactosidase was expressed in the haploid BY4742 strain. The plasmid pUKC815 was
constructed by cloning a 0.9 kb ClaI-BamHI fragment from pUKC350 [18] into the
plasmid YCp50 [19] digested with ClaI and BamHI, thereby generating pUKC814. A 3.2-
kb BamHI fragment from pUKC350 carrying the lacZ gene was then cloned into
pUKC814 digested with BamHI, thereby generating pUKC815 [20]. All yeast strain were
grown at 30° C in minimal medium (0.67% bacto yeast nitrogen without amino acids, 100
μg/ml of each of the required amino acids, 2% glucose and 2% bacto agar for solid
medium). More specifically the yeast strain CEN.PK2 transformed with plasmid was
502 Heterologous Expression

grown in minimal media lacking tryptophan while haploid strain BY 4742 transformed
with pUKC815 plasmid was grown in minimal medium lacking Uracil, and was preserved
at -80° C in MM with 40% glycerol.

2.2. Sequencing and transformation of β-galactosidase (lacZ gene) protein

In order to confirm the correct sequence of the lacZ gene within constructs, pGL-C1
plasmids were extracted using a miniprep kit (Fermentas) and then sequenced using
specific primers. Whole genome DNA of yeast strain CEN.PK2 was extracted according
to instruction of the Wizard® Genomic DNA Purification Kit (Promega) and Primers were
designed using PerlPrimer v1.1.21 (http://perlprimer.sourceforge.net) and purchased from
STAB VIDA (Portugal).
Primer sequences: 5’→ 3’
Forward 1: TAATACGACTCACTATAGGG [Universal T7 promoter]
Reverse 1: CGGATACTGACGAAACGCCT
Forward 2: GATGAAGATCAGCCGTTTCC
Reverse 2: CCTATTGCTATAACCGCACT
Forward 3: TGGCAATTTAACCGCCAGTC

The lacZ gene was PCR amplified for sequencing using classic Sanger sequencing
methods. For the PCR master mix, 0.125 μl Taq DNA polymerase (1 U/μl), 2.5 μl of 10 X
Buffer (500 mM KCl, 100 mM Tris-HCl (pH 9.0), 1.0% Triton X 100), 0.5 μl of dNTPs
(5 mM) and 0.5 μl of each primer (10 mM) were combined and brought to a final volume
of 25 μl per PCR reaction with sterile distilled water (milli-Q). The PCR protocol
consisted of 30 cycles, of denaturing at 94º C for 60 s, annealing at 55º C for 90 s and
extension at 72º C for 60s in a MyCyclerTM thermal cycler (BIO-RAD). The PCR
products were separated for 30-35 minutes at a constant voltage of 100 V alongside a
DNA ladder (GeneRulerTM 50 bp DNA ladder Plus, Fermentas). For gel preparation 0.70
g (1.4%) of agarose was dissolved in 50 ml TAE 1X buffer with 0.5 μl of ethidium
bromide (EtBr). The sequencing of LacZ gene PCR amplicons was done by commercial
provider STAB VIDA (Portugal).

2.3. PCR product purification

Enzyme contamination of DNA samples can interfere with subsequent downstream

applications. In this study, QIAquick PCR Purification Kit from QIAGEN ® was used to
purify PCR amplicons. The first step of the protocol consisted in adding the binding
buffer (PB; pH 7.5 and containing the chaotropic salt guanidine hydrochloride) to the
samples. Then, the DNA solution was passed through the silica-gel membrane by
centrifugation to bind the DNA, followed by a washing step with an ethanol-containing
 M. Z. Alam et al. J. Sci. Res. 5 (3), 499-513 (2013) 503

buffer (PE buffer) to remove salts. Finally, the DNA was eluted in a low-salt solution (EB
buffer; 10 mM Tris·Cl, pH 8.5).

2.4. Plasmids transformation

Transformation of S. cerevisiae was performed using the lithium acetate (LiAc) method
[21]. Briefly, overnight cultures were diluted in 10mL (for 10 transformation reactions) of
fresh medium at an OD600 of 0.05. The cultures were grown at 30º C with 200 rpm
shaking until they reached to an OD600 of 0.4 – 0.5. Cells were then harvested by
centrifugation for 5 minutes at 4000 rpm. After washing with 5mL of sterile milli-Q
water, the pellet was resuspended in 500 μL of 0.1M LiAc solution. Around 50μL of cell
suspension were transferred onto 1.5 mL eppendorf tubes and cells were pelleted by
centrifugation at maximum speed for 15 seconds. The supernatant was discarded and the
transformation reagents were added to the pellet in the following order: 240 μL 50%
(w/w) PEG, 36 μL 1.0 M LiAc, 25μL single-stranded carrier DNA (2mg/mL) previously
denatured and 50μL of an aqueous solution of the plasmid of interest (containing 0.1 –
1μg of plasmid). The tubes were vortexed until a homogeneous suspension was obtained.
The cells were then heat shocked in a water bath at 42º C for 30 to 40 minutes. Cells were
then harvested by centrifugation at 5000 rpm for 1 minute. The supernatant was discarded
and the pellet was carefully resuspended in 100 μL of sterile milli-Q water. Each
suspension was plated in selective media plates and incubated at 30º C, until transformant
colonies were visible (about 3 – 4 days).

2.5. Growth pattern of yeast transformed with lacZ gene

The yeast strains transformed with the plasmid carrying the lacZ gene was grown at 30° C
with 180 rpm until late exponential phase (between 0.6 and 0.8 OD 600). The growth curves
were obtained by inoculating the yeast coming from the same pre-inoculum at exponential
phase (OD 0.5-0.7) into media to an initial OD600 of 0.02 cultured in 50 ml Erlenmeyer
flasks. The cultures were allowed to grow for the first 8 hours and then every hour
aliquots of cultures were collected and the OD600 was measured with micro plate reader
during the first day (around 20 hours) to fourth days (around 96 hours) until the cultures
reached to stationary phase (OD600 ~ 2.5). Finally, the growth rate corresponding to the
growth of yeast cells in exponential phase was calculated.

2.6. β-galactosidase assay

β-galactosidase activity was monitored as described by Sambrook and coworkers [17]

with small modifications. Briefly, 10 ml of pre - culture were inoculated with a distinct
yeast colony grown in solid agar and the cultures were grown over night at 30° C with 180
rpm. The cultures were then inoculated with 3 replicate. Yeast cells expressing the
504 Heterologous Expression

plasmids were selected on minimal medium (lacking tryptophan) and inoculated with
starting OD600 ~ 0.02. Cells were then collected when the cultures reached OD600 ~ 1.5,
chilled on ice and span down at 4000 rpm for 5 minutes. Then the cells were washed twice
with 1 ml of PBS and finally resuspended in 250 µL of PBS and frozen immediately at -
80°C and assayed later. Cell suspensions were thawed on ice and resuspended with 300 µl
PBS, 1/3 volume of glass beads, 1mM PMSF and tablets of protease inhibitors (ROCHE)
were added and vortexed 1 minute for 5 times using Precellys® 24 bead-beating
homogenizer and chilled on ice for 1 minute between bursts. The supernatant was then
removed carefully avoiding foam and transferred to a new previously refrigerated
Eppendorf tube. The protein extract was clarified by centrifugation for 15 minutes at
13000 rpm at 4° C. A 2.5 μl extract was transferred to another microtube and adjusted the
total volume to 0.5 ml with Z buffer (16.1g Na2HPO4-7H2O, 5.5g NaH2PO4-H2O, 0.75g
KCl, 0.246g MgSO4-7H2O, H2O to 1 liter and add 2.7ml β-mercaptoethanol 270ul/100ml
but only before use). β -mercaptoethanol was added just before use at the rate of 270
µl/100 ml. For thermal inactivation the mixture was incubated at 54°C for different test
times (0, 2, 4, 6, 10 and 15 min) and then left on ice for 30 minute. The reaction tube was
incubated at 37° C for 5 min and the reaction initiated by adding 0.1 mL of ONPG stock
solution. The time lapse between two tubes was 10 seconds. Each reaction was then
allowed to proceed for 5 minute. Finally the reaction was terminated by adding 0.25 ml of
Na2CO3 stock solution (again 10 sec time lapse between tubes). The optical density was
measured at 420 nm using a Microplate Absorbance Reader (iMark, BIO-RAD). A 200
µL of reaction sample was loaded in 96 well plates and Z buffer was used as blank. The
protein concentration was measured using Pierce® BCA Protein Assay Kit (Thermo
scientific) following Microplate procedure. The protein mixture, whenever necessary, was
diluted in 1X PBS at 1: 5 ratios and the absorbance was measured at 575 nm on a plate
reader. The activity of the β-galactosidase was expressed according to the following
expression:

(OD420 × 0.085)/ (0.0045 × Protein × Extract volume × Time)

OD420 is the value of optical density of ο-nitrophenol measured at 420 nm. The factor
0.85 corrects for the reaction volume. The factor 0.0045 is the optical density of a 1
nmole/ml solution of ο-nitrophenol. Protein concentration is expressed as mg/ml. Extract
volume is the volume assayed in milliliters. Time is in minutes. Specific activity was
expressed as nmoles/minute/mg protein.

2.7. Protein extraction

Yeasts cells were cultured in 500 ml Erlenmeyer flask and around 50 ml of cells were
collected in each falcon tube when the cultures reached OD600 ~ 1.5, chilled on ice and
span down at 4000 rpm for 5 minutes. Then the cells were washed twice with 5 ml of 1X
 M. Z. Alam et al. J. Sci. Res. 5 (3), 499-513 (2013) 505

PBS and finally resuspended in 250 µL of 1X PBS and frozen immediately at -80°C. For
the extraction of protein (soluble and insoluble) from S. cerevisiae strain CEN.PK2
carrying pGL-C1 plasmids, frozen cells were defrosted on ice and 5 mL of 1X PBS (8.2 g
NaCl, 0. 2 g KCl, 1.41 g Na2HPO4; 0.24 g KH2PO4; Volume adjusted to 1000 mL of
distilled water and pH was adjusted to 7.4 with HCl and sterilized by autoclaving) was
added and the pellets re-suspended by vortexing. Then 1mM PMSF and a Roche Protease
inhibitor cocktail were added. Around ~ 1/3 volume of glass beads (0.1mm) were added to
the mixture and cells were lysed by vortexing at high speed, 8 times for 30 seconds, with
cooling on ice for 1 minute between each vortexing step. Then the cells were centrifuged
at 3000 rpm for 5 minutes at 4° C. Supernatants (whole cell lysates) were transferred to a
new falcon tube and further fractioned by centrifugation at 11000 rpm for 20 min at 4° C.
The supernatants were collected and filtered with a 0.45 µm filter into a new 15 mL falcon
tube (“total soluble” protein) and a small fraction (100 µL) was saved for SDS-PAGE and
western blot analysis. The pellets (insoluble under native condition) were re-suspended in
5 mL denaturing buffer (1X PBS with 8M urea) and centrifuged at 11000 rpm for 20 min
at 4° C. The supernatants were collected and filtered with a 0.45 µm filter to a new 50 mL
falcon tube (“total insoluble” protein) and a small fraction (100 µL) was saved for SDS-
PAGE and western blot analysis.

2.8. Purification of GST tagged β galactosidase protein from yeast extract

Affinity chromatography is commonly used to purify a protein of interest from total

protein preparations. For this, affinity tags are cloned into recombinant proteins for
affinity purification and to improve protein solubility. A large number of tags have been
developed for protein production. In the present study a GST tag was fused with the lacZ
gene in plasmid pGL-C1 for expression in CEN.PK2 yeast strain. This allowed for
purification of β-galactosidase protein with glutathione sepharose beads.

2.9. Protein purification by affinity chromatography

In the present study the GST-β galactosidase protein was purified using Glutathione
Sepharose 4B (GE Healthcare, Bio-Sciences AB, Sweden) medium. After the fusion
protein is bound to the resin, it was eluted under rather mild conditions using free reduced
glutathione (between 10–40 mM) at neutral pH.
The Glutathione Sepharose medium was prepared according to manufacturer protocol.
About 400 µL of prepared Sepharose 4B resin (50% slurry) was incubated overnight with
total soluble protein with gentle slurry mixing. The day after a Poly-Prep®
Chromatography Column (Bio-rad) was washed with one column volume of milli-Q water
and then equilibrated with one column volume of binding buffer (1X PBS). Then, the
proteins were mixed overnight with Sepharose beads and poured into the column and the
flow through was collected in a 15 mL falcon tube. The column was then washed with one
506 Heterologous Expression

column volume of 1X PBS (washing buffer) and the flow through was collected in
another 15 mL falcon tube. The bound protein was then eluted with 5 ml of elution buffer
[for 100 mL preparation 0.61 g Tris-Base (50 mM), 0.31 g Reduced Glutathione (10 mM),
adjust volume and PH at 8 with HCl and then sterilized by filtration (0.20 µm)]. The eluted
protein fraction was collected into 5 Eppendorf tubes (1.5 ml each fraction) in order to
identify the fraction which contained the higher amount of purified protein. Finally all
eluted protein merge together in a single falcon tube. The protein was then ready for SDS-
PAGE and western blotting analysis.

2.10. Protein purification profile

The purification profile was monitored by Sodium Dodecyl Sulfate-Poly Acrylamide Sel
Electrophoresis (SDS-PAGE). Each SDS-PAGE gel is composed by a resolving gel with a
percentage of acrylamide adapted to the size of the target protein. To improve the
resolution, proteins first pass through a stacking gel polymerized on the top of the
resolving gel. The stacking gel has lower pH and acrylamide concentration (4%) as well
as different ionic strength, which allows the proteins to be concentrated during the first
minutes (~30 min) of electrophoresis, before entering the resolving portion of the gel.
Since the GST- β galactosidase protein has a MW of ~ 142 kDa, 10% resolving gels were
used successfully after several trials. During gel preparation Tris-HCl was used as buffer
to absorbs counter ions (H+ and OH-) keeping the solution in a stable pH level. For gel
polymerization, APS (ammonium persulfate at 10 mg/100 ml), a source of free radicals
was used as initiator of gel formation and TEMED (N, N, N', N'-tetramethylethylene
diamine), a stabilizer of free radicals, was used to improve polymerization. The recipe of
2 SDS-PAGE gels was for stacking gel (4%) [milli-Q water 3.465 ml, SDS (10% w/v) 50
μl, Tris-HCl 1.0 ml (0.625M, pH 6.8), Acrilamide/ Bis acrilamide (40% stock) 0.5 ml,
APS (10mg/100 μl) 25 μl, TEMED 20 μl ] and for resolving gel (10%) [Water (milli-Q)
3.6 ml, SDS (10% w/v) 100 μl, Tris-HCl 3.75 ml (1.0 M pH 8.0), Acrilamide/ Bis
acrilamide (40% stock) 2.5 ml, APS (10mg/100 μl) 50 μl, TEMED 20 μl] and Bio-Rad®
SDS-PAGE gel apparatus were used. The Protein samples for SDS-PAGE were prepared
by adding 6X loading buffer (for 10 ml buffer composition was 6 ml Glyercol, 0.5M 1.2
ml EDTA, 2.8 ml ddH2O and a pinch of bromophenol blue and xylene cyanol) in a ratio
of 1:6, followed by denaturing the samples for seven minute at 95º C. Around 15 µL of
protein preparation were loaded into the gel pockets along with a pre-stained protein
marker and the gels were run with 1X SDS running buffer ( for 1 L Tris 6.05 g, 8.76 g
NaCl with pH adjusted to 7.5 ) at 80 V for the first 30 minutes until the samples reached
to the stacking gel. Then, the voltage was increased to 130 V and the gels were run for 2
hours until the dye front reached the bottom of the gel. The gel was then carefully
removed and stained with Coomassie Brilliant Blue dye for 1-2 hours and destained
overnight with destain solution.
 M. Z. Alam et al. J. Sci. Res. 5 (3), 499-513 (2013) 507

2.11. Western blot analysis

Western blotting confirms the presence of desired protein in yeast lysates. In the present
study, after electrophoresis, proteins were electro blotted onto nitrocellulose membranes
(Amersham Hybond ECL) prior to immunodetection. Soluble and insoluble protein
fractions were analyzed under reducing conditions using 10% SDS-PAGE, as described
above, and blotted onto a nitrocellulose membrane. For this, six sheets of 3MM paper
(Whatman) and blotting membranes were cut to gel dimensions. Membranes were
prehydrated in distilled water and 3 sheets of 3 MM paper and hydrated in 1X TGM
buffer [25mM Tris-Base (3.03 g/L), 193 mM Glycine (14.4g/L), 20 % Methanol (200 mL)
and volume adjusted to 1000 mL of distilled water]. Then papers were placed above pads
on the anode of the transfer system, and a “sandwich” was assembled by laying down the
gel on top of the paper sheets. The blot was run for 100 min at 100V at 4°C in TGM
buffer using a BIO-RAD® wet transferring system (assembled according to manufacturer‟s
instructions). The membranes were removed carefully and washed 2 times with 1X TBS
and blocked in 1X TBS (for 1 L Tris 6.05 g, 8.76 g NaCl with pH adjusted to 7.5) with
3% non-fat milk for 30 minutes at room temperature with gentle agitation. After removing
blocking agent, the membranes were washed two times for 5 minutes with 1X TBS.
Following the blocking and washing, the primary antibody (anti β-galactosidase IgG
fraction A-11132 raised in rabbit, Molecular probes) was added (1:5000) to the
membranes in a solution of 3% non-fat dry milk in 1X TBS. For this, the membranes were
placed in heat sealable plastic bags, and each membrane was incubated overnight at 4ºC
with agitation. After the overnight incubation, the membranes were washed twice for 5
minutes with 1X TBS to remove unbound primary antibody.
The membranes were incubated with the secondary antibody, a mouse anti-rabbit
antibody reactive against the primary antibody and coupled to a fluorochrome that allows
subsequent visualization. A 1:10,000 dilution of mouse anti-rabbit antibody was prepared
in 1X TBS and 3% non-fat dry milk. Again, incubations were performed in a plastic tray,
which were then wrapped in aluminium foil (to avoid fluorochrome degradation by light)
at room temperature for 2 hours with gentle agitation. Following, three washes were
performed with 1X TBS-Tween (1 ml of Tween-20 in 1L of 1X TBS buffer), for 15
minutes each time. The membranes were then washed with distilled water and analyzed at
700 nm (anti rabbit) using an Odyssey Li-COR fluorescence imager (Bioscience).

3. Results and Discussion

3.1. Growth of the yeast carrying plasmid transformed recombinant GST-Lac Z gene

The growth of S. cerevisiae strains CEN.PK2 and BY4742, transformed with plasmid
pGL-C1 and pUKC815 respectively and the control strain CEN.PK2 without transformed
plasmid was monitored by measuring the optical density at different time points at wave
length 595 nm (Table 1). All the yeast strains showed a similar pattern of growth curve
508 Heterologous Expression

(Fig. 1) and the statistical analysis revealed that there is no significant difference of
growth rate between yeast strains.

Table 1. Optical density (OD 595nm) of yeast strain at different hours of incubation.

OD 595 nm at different hours of incubation

Time Statistical analysis
CEN.PK2 CEN.PK2 BY4742
h
control (T1) (T2) (T3)

0 0.021 0.021 0.021

8 0.950 1.000 0.949
9 1.221 1.276 1.234
10 1.575 1.637 1.613
11 1.806 1.896 1.857
12 2.187 2.153 1.991
13 2.517 2.374 2.128 Statistical analysis was done using unpaired
„t‟ test of growth rate per hour from 9 to 20
14 2.416 2.305 2.205 hours :
15 2.474 2.309 2.180 SED (T1,T2) 0.0249
T test (T1, T2) calculated : 0.803
16 2.522 2.340 2.224 SED (T2,T3) = 0.0235
17 2.596 2.442 2.234 T test (T2,T3) calculated : 0.805
18 2.683 2.467 2.302
By comparing calculated 't' value with table
19 2.688 2.431 2.171 't' value for 22 d.f {(12-1)+(12-1)} at 5%
20 2.723 2.533 2.255 probability (table 't' value = 2.074)
tcal < ttab at 22 d.f
32 2.876 2.845 2.236
40 3.446 3.126 2.263 As calculated „t‟ is smaller than tabulated‘t‟.
We conclude that the difference in growth
64 3.180 2.909 2.545 rate of yeast is not significant.
106 3.709 3.457 2.691

Fig. 1. Growth curves of Saccharomyces cerevisiae strain CEN.PK2 carrying pGL-C1 plasmid
compared to control strain CEN.PK2 without plasmid and strain BY4742 carrying pUKC815
plasmid without GST tag.
 M. Z. Alam et al. J. Sci. Res. 5 (3), 499-513 (2013) 509

3.2. β-galactosidase assay

The β-galactosidase (β-gal) reporter system was used previously to test on the fidelity of
protein synthesis. This test is based on the fact that if misincorporation of amino acids
occurs in the β-gal protein then the thermostability of the enzyme will decrease. In the
present study we observed a decrease in activity of the β-galactosidase over heat
inactivation time, the strongest decrease of enzymatic activity was observed after 6
minutes of heat inactivation (Fig. 2). The enzyme β–galactosidase (β-gal) has an active
quaternary structure and it is an efficient reporter protein for sense codon misreading due
to the negative effects of the misincorporation on the thermostability of the enzyme [22].
In the present study β gal shows positive result for both strain and β galactosidase from
yeast cells did not show visible effects on the heat stability of the expressed enzyme.
Otherwise, the number of amino acids misincorporations in GST-β gal was not sufficient
or absent to cause a pronounced heat stability difference. However, further mass
spectrometry based peptide analysis are necessary to confirm these results.

Fig. 2. Relative β-galactosidase activity of yeast strain CEN.PK2 carrying pGL-C1 plasmid and
BY4742 strain carrying pUKC815 plasmid.

3.3. SDS-PAGE and western blot of β-galactosidase

After SDS-PAGE (Fig. 3A) analysis, intense bands in soluble protein were observed in
the strain CEN.PK2 carrying pGL-C1 plasmid only. Other strain does not contain GST
tag, so the affinity purification did not work. The intensity of bands in insoluble fraction
was much weaker. The presence of GST- β galactosidase protein was confirmed by
western blotting and immuno detection (Fig. 3B) with a rabbit monoclonal antibody raised
against E. coli β-galactosidase. The protein was detected both in the soluble and insoluble
fractions. However, the intensity of bands in insoluble fraction was very weak.
510 Heterologous Expression

Fig. 3. SDS-PAGE (A) and Western blot (B) analysis showing of whole protein extract from yeast
strain CEN.PK2 carrying plasmid pGL-C1. 1st lane indicates M- marker, 2nd lane – soluble and 3rd
lane - insoluble protein extract respectively. The rectangle in figure B indicates the position of GST-
β galactosidase protein confirmed by western blotting.

3.4. Purification of β-galactosidase protein from saccharomyces cerevisiae

The β-galactosidase protein produced from lacZ gene has a molecular weight of ~116 kDa
and the fusion with GST increase the molecular weight to ~ 142 kDa. The GST binds to
resin immobilized glutathione, and this property was successfully used for affinity
purification of GST tagged proteins. The fusion protein bound to the glutathione -
sepharose beads, was eluted under mild conditions using free reduced glutathione (10
mM) at neutral pH. Most of the GST-β galactosidase protein was soluble (Fig. 4B), the

Fig. 4. A) SDS-PAGE showing purified GST–β galactosidase protein from Saccharomyces

cerevisiae strain CEN.PK2. Lanes (from left to right) showing : M- protein marker, WE – Whole
extract, FT- Flow through, W- Wash with PBS and Elution fraction 1, 2, 3, 4 and 5. The red
rectangle shows the band of GST- β galactosidase protein in the soluble eluted fraction. B) SDS-
PAGE showing the concentrated protein centrifuged for 90 minutes (lane 1, 3) and 150 minutes
(lane 2, 4 respectively). 15 µl of sample was loaded in 10% PAGE gel whereas lane 1& 2 indicate
β-galactosidase protein from soluble and lane 3 & 4 indicate from insoluble extract.
 M. Z. Alam et al. J. Sci. Res. 5 (3), 499-513 (2013) 511

amount of protein extracted from the inclusion bodies was very little. The purified GST-β
galactosidase protein from the yeast strain CEN.PK2 was successively filtered and
concentrated using Amicon® Ultra centrifugal (15 mL) 3000 MWCO devices (Millipore).
A small fraction of the protein was loaded on a SDS-PAGE to check the protein purity.
SDS-PAGE analysis (Fig. 4B) shows the presence of β galactosidase protein in solution.
The concentration of GST-β galactosidase protein was quantified using NanoDropTM
spectrophotometer and was recorded 0.57 mg/ml.
One of the objectives of this study was to optimize the GST- β gal purification
protocol. The 26-kD GST tag is short (218 aa) [23] and is frequently used as a fusion in
molecular biology research. The study from Pawel and co-workers [24] defined soluble
protein as the fraction that stayed in solution, did not oligomerize strongly and was stable
(did not precipitate or aggregate), while insoluble proteins are defined as those that cannot
stay in solution without denaturing agents like urea. Our β-galactosidase protein was
successfully purified from the soluble protein extracts of yeast strain CEN.PK2 lysates.
However, the GST-β galactosidase protein purified from the insoluble fraction was not
sufficient for SDS-PAGE gel and western blotting analysis. Several trials following
different protocols [15, 25] to solubilize and purify the GST-β gal from inclusion bodies
were carried out using lysis buffers containing DTT, Triton-X (1%), N-lauroylsarcosine
sodium salt (sarkosyl) or NaCl (1M), but they were not successful. A likely reason for
these results is that the GST tag increases solubility of β-galactosidase. Indeed, a study
from Kim and Lee [26] showed that GST can act as a solubility tag. Another study [27]
suggests that the GST tag has to be folded properly in order to bind glutathione and should
be purified under non denaturing conditions. In the present study a very faint band was
observed in the insoluble fraction β-galactosidase treated with 8M urea. Therefore, the
GST tag may solubilize β-galactosidase and urea may prevent its purification by
denaturing GST.

4. Conclusion

In conclusion, this work showed a simple and standard protocol to perform recombinant
large GST fusion protein (>100kDa) from yeast using affinity chromatography technique.
This protocol also suggests that the growth of the yeast and the enzymatic activity does
not alter due to GST tag and could be applied to a large variety of GST-fused proteins
from yeast. Further studies would be necessary with other recombinant protein in order to
get more consistent result.

Acknowledgements

This work was supported by the RNA Biology Laboratory, Department of Biology,
University of Aveiro, Portugal. MZ Alam was involved in all aspects of the experimental
design, works, data collection, analysis and interpretation. MS initiated the study,
participated in its design and coordination. LR participated in expression work,
512 Heterologous Expression

coordinated the purification experiments and analyzed the data. AI drafted the manuscript
and checked statistical analysis. All authors contributed to the final version of the
manuscript.

References

1. See, G. Walsh, Biopharmaceuticals, Trends Biotechnol. 23, 553 (2005).

2. J. R. Broach, E. W. Jones, and J. R. Pringle (Eds.), The Molecular and Cellular Biology of the
yeast Saccharomyces, Vol. 1. Genome Dynamics, Protein Synthesis, and Energetics (Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1991).
3. S. L. Forsburg, Nature Review Genetics 2, 659 (2001). http://dx.doi.org/10.1038/35088500
4. L. H. Hartwell, Bioscience Reports 24, 523 (2004).
http://dx.doi.org/10.1007/s10540-005-2743-6
5. F. Sherman, Methods Enzymology 350, 3 (2002).
http://dx.doi.org/10.1016/S0076-6879(02)50954-X
6. F. Garrido, U. C. Banerjee, Y. Chisti, and M. Moo-Young, Bioseparation 4, 319 (1994).
PMid:7765495
7. P. Valenzuela, A. Medina, W. J. Rutter, G. Ammerer, and B. D. Hall, Nature 298, 347 (1982).
http://dx.doi.org/10.1038/298347a0
8. R. A. Hallewell, R. Mills, P. T. Olson, R. Blacher, S. Rosenberg, F. Otting, F. R. Masiarz, and
C. J. Scandella, Biotechnology 5, 363 (1987). http://dx.doi.org/10.1038/nbt0487-363
9. P. J. Barr, L. S. Cousens, C. T. Lee-Ng, A. Medina-Selby, F. R. Masiarz, R. A. Hallewell, S. H.
Chamberlain, J. D. Bradley, D. Lee, and K. S. Steimer, J. Biol. Chem. 263, 16471 (1988).
PMid:2460449
10. I. C. Bathurst, N. Chester, H. L. Gibson, A. F. Dennis, K. S. Steimer, and P. J. Barr, J. Virol. 63
(7), 3176 (1989). PMid:2657103 PMCid:250878
11. P. J. Barr, K. S. Steimer, E. A. Sabin, D. Parkes, C. George-Nascimento, J. C. Stephans, M. A.
Powers, A. Gyenes, G. A. Van Nest, and E. T Miller, Vaccine 5 (2) 90 (1987).
http://dx.doi.org/10.1016/0264-410X(87)90053-3
12. P. J. Barr, H. L. Gibson, V. Enea, D. E. Arnot, M. R. Hollingdale, and V. J. Nussenzweig, Exp.
Med. 165, 1160 (1987). http://dx.doi.org/10.1084/jem.165.4.1160
13. J. M. Clements, L. I. O‟Connell, S. Tsunasawa, and F. Sherman, Gene 83, 1 (1989).
http://dx.doi.org/10.1016/0378-1119(89)90398-3
14. X. H. Hu, M. H. Wang, T. Tan, J. R. Li, H. Yang, L. Leach, R. M. Zhang, and Z. W. Luo,
Genetics 175, 1479 (2007). http://dx.doi.org/10.1534/genetics.106.065292
15. E. Ciplys, D. Samuel, M. Juozapaitis, K. Sasnauskas, and R. Slibinskas, Microb Cell Fact. 10,
37 (2011). http://dx.doi.org/10.1186/1475-2859-10-37
16. D. B. Smith, and K. S. Johnson, Gene 67, 31 (1988).
http://dx.doi.org/10.1016/0378-1119(88)90005-4
17. J. Sambrook, E. F. Fritsch, and T. Maniatis, Molecular cloning: a laboratory manual, 2nd ed.
(Cold Spring Harbor Laboratory Press, NY, 2008). PMCid:2689524
18. M. Firoozan, C. M. Grant, J. A. B. Duarte, and M. F. Tuite, Yeast 7, 173 (1991).
http://dx.doi.org/10.1002/yea.320070211
19. M. D Rose, R. Novick, J. H. Thomas, D. Botstein, and G. R Fink, Gene 60, 237 (1987).
http://dx.doi.org/10.1016/0378-1119(87)90232-0
20. I. Stansfield, Akhmaloka, and M. F. Tuite, Current genetics 27, 417 (1995).
http://dx.doi.org/10.1007/BF00311210
21. R. D. Gietz and R. A. Woods, Methods in Enzymology 350, 87 (2002).
http://dx.doi.org/10.1016/S0076-6879(02)50957-5
22. E. W. Branscomb and D. J. Galas, Nature 254, 161 (1975).
http://dx.doi.org/10.1038/254161a0
 M. Z. Alam et al. J. Sci. Res. 5 (3), 499-513 (2013) 513

23. J. Jordan Lichty, L. J. Malecki, D. H. Agnew, D. J. Michelson-Horowitz, and S. Tan, Protein

Expression and Purification 41, 98 (2005). http://dx.doi.org/10.1016/j.pep.2005.01.019
24. P. Smialowski, J. Antonio, Martin-Galiano, A. Mikolajka, T. Girschick, T. A. Holak, and D.
Frishman, Bioinformatics 23 (19), 2536 (2007).
http://dx.doi.org/10.1093/bioinformatics/btl623
25. D. Park, S. Kim, M. Nam, G. Kim, J. Kim, and H. Rhim, BMB reports 44 (4), 279 (2011).
26. S. Kim and S. B Lee, Protein Expr. Purif. 62, 116 (2008).
http://dx.doi.org/10.1016/j.pep.2008.06.015
27. A. Malhotra, Methods in enzymology 463, 239 (2011).
http://dx.doi.org/10.1016/S0076-6879(09)63016-0