'

latest B amp e aper

I

Session
2024-25
Biology {Code 044)
Class 12
- I

I '

6eneral Instructions
1. All questions are compulsory. l1 No. of Questions : 33
2. The question paper has five sections and 33 questions. . -------------
3. Section-A has 16 questions of 1 mark each; Section-B has 5 questions of 2 l1 No~ of Sections : 5
I .

marks each; Section-C has 7 questions of 3 marks each; Section-O has 2 -------------
case-based questions of 4 marks each; ·and Section-E has 3 questions of 5 l1 Time Alloted: 3 Hrs.
marks each. -------------
11 Max. Marks : 70
4. There is no overall choice. However, internal choices have been provided in
some questions. A student has to attempt only one of the alternatives in
such questions.
5. Wherever ne~ssary, neat and properly lab~lled diagrams should be draw.

s. r

I •

- , . (

Section A Multiple Choice' f YP~ ciues'tion-~

1. Signals for parturition in h~~ 'fe~al~ J,1 correct sequence of nucleotide in the 5'-3'
originate from --:·· '. • • •• ' . direction.
• • f !' ' I • I '
(a) fully developed foetus only •
(b) both placenta as well as fully developed foetus
(c) placenta only_ . 1.
(d) oxytocinreleased
. . from maternal pituitary.
2. To produce 1600 seeds, the number of meiotic •
divisions required will be '.
(a) 2400 _ (b) 2000 ' '· ;
(c)l600 ,. •• • '' • • (d) 1800 • 1 J !

' l

3. A sample of no~al double-stranded DNA was

fo~d to have thymine content of 27%. What
~ be ~e expected proportion of guanine in
this strand? i •• • •. • • •1' • •

(a)23% (b) 32%

(c)36% (d) 73%

serve the schematic diagram that depicts a

section of nucleic add. The bases in two ,
are paired through hydrogen bonds .(a) GCAT (b) CGTA
shown by the dark lines., ,Identify the
1····•·'
),.,I• l .
(c) TAGC (d)ATCG
 Ill
4
_ i Succeed Biology Class~
. 5
~ utest CBSE Sample Paper
5. Suresh and Rajesh have defective haemoglobin
due to genetic disorders. In Suresh, the 9. Idli - dosa dough rises due to production of
'1 problem is qualitative as he is having which o1 the following gas?
15, j\ssertion (A) A floating cover placed over the 16. Assertion (A) DNA fragments can be isolated
\•.
incorrectly functioning globin molecules while
in Rajesh the problem is quantitative as he is
(a) CO
(c) NO 1
••
(b)CO2
(d) NO2
slurry in a biogas plant keeps on rising.
Reason (R) This cover keeps on rising due to
by gel electrophoresis on the basis of their size.
Reason (R) The larger the fragment size, the
having very few globin molecules. Identify the 10. Adaptive radiation leads to which of the the gas produced in the tank by the microbial faster it m~:,ves.
disorder they are suffering from. following? . activity.
(a) Increased competition among species
Suresh
(a) Thalassemia -
Rajesh (b) Decreased speciation rates .. ~ction B Very Short Answer Type Questions
Sickle cell anaemia - (c) Limited morphological diversity among species
Autosomal dominant Autosomal linked
blood disorder
17. Attempt either option A or B.
recessive trait (d) Rapid divergence of traits among populations mRNA '
(b) Sickle cell anaemia - inhabiting a given geographical area A. (i) A blood test reported negative for hCG. 5'-----------------3'
Thalassemia - Autosomal AGGAGGUAUGAUCUCGUAAAAUAAA
autosomal linked Recessive blood disorder What does negative hCG imply? Name
dominant trail 11. EcoRI cuts the DNA between bases G and A
the tissue which produces hCG? (i) In the above sequence identify the
(c) Sickle Cell anaemia - Thalassemia - only when the sequence of GAAITC is present translational unit in mRNA.
autosomal linked Autosomal Recessive The number of nucleotides present in the • (ii) If a blood test reported positive for hCG
recessive trait blood disorder resultant sticky ends that will be formed in in a person, then which other hormones (ii) Where are UTRs found and what is their
(d) Thalassemia .. Sickle cell anaemia - each of the two strands of DNA after this would also be secreted by the tissue significance?
Autosomal dominant Autosomal linked enzyme cuts the DNA will be: secreting hCG?
blood disorder dominant trait
19. Given below is the relationship between the
I
Or HIV levels in the blood and helper T cell count
6. In E.coli, the lac operon gets switched on when Vector DNA Foreign DNA
B. (i) The human male ejaculates about 200 to in a person detected with AIDS. Study the
lactose is Ja) UrS · .,. 1 5&1 300 million sperm during a coitus, relationship and answer the questions that
(a) present in the medium and it binds to the lb) 2&4 4 &2 however the ovum is fertilised by only follow.
repressoc ~) • 2&5 5&2 one sperm. How d_oes the ovum block the
(b) not present in the medium (d) 3 &4 . 4 &: 3
entry of additional sperms? -0
0
0
binds to the operator (ii) All copulations will not lead to ::0
(c) not present in the medi1 fertilisation. Why? .5
:lt-:;,puring the·secondary treatment of sewage, C:
binds to the operator 0
)Vhlch of the following change in the effluent 18. Attempt either option A or B.
-.c
(d) adive 1actoee present in ,due to floes? . ~
C:
polymerue '--- - t&J'; T • ·,, ..._.
lDI BOD"· \ ....
< 1 , ---~ r
,""ti:·1, f1
',.... l. . f". I • J .•
1
i~ 1 A. The schematic representation given below ~
C
7. Which of the fo1lowill&li shows a DNA strand and two types of 0
u
mechanism of sex, • :! r:': ., ~~ :...~•:· mutations in the DNA strand.
~
.-· J..! i . ,it ,:i t •r Original template • ' time
(i) An offspring formed. Mon~ Yea~
spenn and egg devielopiaa ~ .· ,, : a1J i
(ii) Males have half Chellllllmel:~ :f of two statements - AjujclclAlc\AlclAlulclu\ulAlc A. What kind of relationship is observed in the
Met . Gm Tor Ser Stop virus levels and the immune response after
chromosomes lbanJhat o f ~ Answer these , some days of the initial infection?
(Iii) The males are ~~'having 3$ rmriate option given ,. Mutation I B. Does it completely clear the virus from the
chromosomes. ,... •:; ~:; I ..., f - .,.
A U G A A G A C A U C U U A G body permanently? Give reason for your
Le•.correct •• answer.
(w) AH workers•.. . .· .'I aredipa,id
JI
; ~ . .
ha Met Lys Tor Ser Stop
chromosomes.
-•
J
;;;,
•u".;./
.
.. .,
'
C•) (i) md Cd) (b) (ii) ..ct Cw") Mutation II 20. A culture plate of Lactobacillus shows
blue-coloured colonies and colourless colonies.
Cc) (i) md (iv) (I) Cai) and (iv) • /. ,, A U G A G A C A U C U U A G Explain the principle involved in the formation
I 8. The following diagram shows a fragment of rl J r,11,!,,i
Met • Arg His Leu of such variance in the colour of colonies.
j DNA which is going to be transaibe(t the I i •

1ave more than 21. Attempt eitl1er option A or B.

! upper strand with polarity 3' to 5' is the
template strand .
(i) Identify the type of mutation exhibited in I
A. (i) It was estimated that if an evergreen
·, J and II.
3' A1TGCCS' iosis without • forest has a GPP of 400 J/ m 2 /day and 150
• (ii) Which of the above mutation is more
harmful? Give reason.
JI m 2/day worth of carbon dioxide flows
S' TAACGC3' J• ,, ;, ) out of that forest, what is the NPP in that
Or
Alier transcription me mRNA an be represented by forest?
B. Given below is a schematic representation of (ii) Explain why pyramids of energy must
(a) S' AUUGCC 3' (b) 5' AUUGCC3' a mRNA strand • always be upright?
(c) S'UAACGG 3' (d) 5'CGCAAU 3'
 6
i Succeed Biology Class 12 I Paper
~ Latest CBSE Samp e 7
Or B. (i) Assume that, GPP Forest A= GPP Forest
B =GPP Forest C, If Forest A has NPP (ii) Draw an ecological pyramid of number
of the following food chains
=12542
J/ m 2/day; Forest B, NPP = 2157 section D Case Based Questions
JI m 2/day; and Forest C, NPP = 779 (a) Grass-Animal-F.Jeas on the host
animal ~

JI m /day, which one of these forests has

maximum energy loss by respiration? (b) Tree-Insects-Woodpecker Q. N~s. 29 and 30 are cas~-based questions. Each transmitted by mosquitoes. Study the graph
Give reason. question has 3 subparts with internal choice in one and answer the questions that follow:
subpart. 41
29. Assuming that within a population of beetles u 40
Section C Short Answer Type Questions where Hardy Weinberg conditions are met, the
]39
colour black (B) is dominant over the colour red
C! 38
22. The image below shows two germinated seeds (b). 40% of all beetles are red (bb).
111
B. How is the above process modified in a 137
X and Y which belong to the same species. Seed Given chis information, answer the questions below:
retrovirus? Name the process. ~
36
Ii: X is produced by apomixis whereas seed Y is a A. What is the frequency of red beetles?
P

product of sexual reproduction. C. Justify why during the process of

B. Calculate is the percentage of beetles in the 35
transcription only a segment of DNA is 0 1 2 3 4 5 6 7 8 9 10 11 12 13
copied into RNA? population that are heterozygous. • time/days

25. Describe the steps involved in Southern blot 1\ttempt either subpart C or D. A. Explain the factor(s) responsible for this
hybridisation using radiolabeled VNTR as a C. What is the frequency of homozygous pattern of temperature.
•• probe. dominant individuals? B. How does this pathogen multiply in the
. r . Or human body?
26•.Bio-fertilisers are organisms that enrich the
D. Assuming that Hardy Weinberg conditions Attempt either subpart C or D.
• ;1 nutrient quality in the soil. Explain the role of
are met in the beetle population consisting C. How is this infection transmitted to
three main sources of bio-fertilisers., of 1500 beetles. How many beetles would humans?
27. Explain how PCR technique can be used for you expect to be black and red in colour
amplification of a small amount of DNA respectively? Or
~plate?
,_ ,. 30. Given below is the pattern of temperature in a
D. Which stages of the life cycle of this
I
A. Write lhe DI pathogen are completed in the mosquito's
given below depicts different , person suffering from a non-viral disease
&at'(s)and gut?
~--, of Warbler birds feeding on different
B. How multiples emhq ,ICI
1.A>n a.Spruce tree. Expl~ the
mots? which he~ps ffiem !o co-exist.
CWhatad·
Section E Long Answer Type Qu_estions
~&eed-Yha· ' .
- .,, .4 31. Attempt either option A or B. which the sperm/semen is used to assist
23. Namelhe A. Cryptorchidism is a condition in which the fertilisation.
meioticdi testes fail to descend into the scrotum. It can (iv) Name and explain the assisted
Whatme also lead to compromised Sertoli cell reproductive technology that should be
'.anches
c:hmmo. functio~ and has an impact on leydig cell used to complete the development of
involftd in the function. embryos I and II shown in the figure
(i) Identify at least 3 parameters of male given below.
24. The &dlematic •Ef.JE. . _II fertility which get affected due to
shows lhe aNIUpl.Jf ~ cryptorchidism.
RepHrwtinn (ellow-Rumped Warbler
C DNA Tr_____ _ Feeds in the lower part
of the tree and at the
(ii) Which process ~ill be affected if mature
spermatids are not released from Sertoli
bases of the mlddlt; . ) cells?
<:entnlclogma Branches •' '
(iii) Name and explain one assisted Embryo I EmbryoD
A During the process of repliattion and lusion principle state? reproductive technology (ART process) in
transaiption the pairing of nitrogenous
1se shown above?
.: -
bases is not similar. Explain.

>
• I
. .
i ~ ,
-
8
i Suc cee d Biology Class\

Or Or
B. (i) Exp lain the significance of eac h of B. In the futu re, gen etic ther apie ~ ~ay
the b~ u~d
foll owi ng feat ure s pre sen t in plan ts give to pre ven t, trea t, or cur e c~r tam inh ente
n d
belo w. • diso rde rs in hum ans . Jus tify the statem
ent
. (a) In rose-bay plan t the stam ens ripe wit h a suit able exa mp le.
n
befo re the stigma. 33. Attempt either option A or B.
(b) In cer ta~ species of primrose, the A. (i) Wh y is the re a nee d to con serv e
flowers hav e sho rt stam en and lon g • bio div ersi ty? (An y two reas ons )
style. (ii) Nam e and exp lain any two _ca~ses
(c) The bisexual flower of mus tard exhibits ~ta re
resp ons ible for the loss of b1odivers1ty.
• rejection of self-pollen grain.
• Or
(ii) Exp lain how auto gam y is pre ven ted
in B. (i) Nam e the two typ es of des irab le
cas tor and pap aya pla nt respectively? •
app roa che s to con serv e biod iver sity ?
Attempt either option A or B.. Exp lain wit h exa mp les brin gin g out the
. Exp lain how adv ent of biotechnology has diff eren ce bet wee n the two typ es.
hel ped in pre ven ting infestation by
(ii) Sta te the fea ture s of a stab le biologic
nem atod es and ~er eby increasing crop • al
yield? com mun ity.
• . .. _ J .

F ,