Instant Access to Transcriptional Regulation Methods and Protocols 1st Edition Xiao-Yong Li ebook Full Chapters

Download the full version of the ebook at
https://ebookultra.com
Transcriptional Regulation Methods and

Protocols 1st Edition Xiao-Yong Li
https://ebookultra.com/download/transcriptional-
regulation-methods-and-protocols-1st-edition-xiao-
yong-li/
Explore and download more ebook at https://ebookultra.com

Recommended digital products (PDF, EPUB, MOBI) that
you can download immediately if you are interested.
Bacterial Transcriptional Control Methods and Protocols

1st Edition Irina Artsimovitch
https://ebookultra.com/download/bacterial-transcriptional-control-
methods-and-protocols-1st-edition-irina-artsimovitch/
ebookultra.com
Genomic Imprinting Methods and Protocols 1st Edition Yong

Cheng
https://ebookultra.com/download/genomic-imprinting-methods-and-
protocols-1st-edition-yong-cheng/
ebookultra.com
Moral Partiality 1st Edition Yong Li
https://ebookultra.com/download/moral-partiality-1st-edition-yong-li/
ebookultra.com
Plant Signalling Networks Methods and Protocols 2012th

Edition Zhi-Yong Wang
https://ebookultra.com/download/plant-signalling-networks-methods-and-
protocols-2012th-edition-zhi-yong-wang/
ebookultra.com
Post Transcriptional Gene Regulation 3rd Edition Erik
Dassi
https://ebookultra.com/download/post-transcriptional-gene-
regulation-3rd-edition-erik-dassi/
ebookultra.com
Bacterial Gene Regulation and Transcriptional Networks 1st

Edition M. Madan Babu
https://ebookultra.com/download/bacterial-gene-regulation-and-
transcriptional-networks-1st-edition-m-madan-babu/
ebookultra.com
Post Transcriptional Gene Regulation 2nd ed. 2016 Edition

Erik Dassi
https://ebookultra.com/download/post-transcriptional-gene-
regulation-2nd-ed-2016-edition-erik-dassi/
ebookultra.com
Polyadenylation Methods and Protocols 1st Edition Joanna

Rorbach
https://ebookultra.com/download/polyadenylation-methods-and-
protocols-1st-edition-joanna-rorbach/
ebookultra.com
Microsatellites Methods and Protocols 1st Edition

Panagiotis Madesis
https://ebookultra.com/download/microsatellites-methods-and-
protocols-1st-edition-panagiotis-madesis/
ebookultra.com
Transcriptional Regulation Methods and Protocols 1st
Edition Xiao-Yong Li Digital Instant Download
Author(s): Xiao-Yong Li, Mark D. Biggin (auth.), Ales Vancura (eds.)
ISBN(s): 9781617793769, 1617793760
Edition: 1
File Details: PDF, 9.81 MB
Year: 2012
Language: english
METHODS IN MOLECULAR BIOLOGY™
Series Editor
John M. Walker
School of Life Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
For further volumes:

http://www.springer.com/series/7651
Transcriptional Regulation
Methods and Protocols
Edited by
Ales Vancura
Department of Biological Sciences, St. John’s University, Queens, NY, USA
Editor
Ales Vancura, Ph.D
Department of Biological Sciences
St. John’s University
Queens, NY, USA
[email protected]
ISSN 1064-3745 e-ISSN 1940-6029

ISBN 978-1-61779-375-2 e-ISBN 978-1-61779-376-9
DOI 10.1007/978-1-61779-376-9
Springer New York Dordrecht Heidelberg London
Library of Congress Control Number: 2011941586
© Springer Science+Business Media, LLC 2012

All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the
publisher (Humana Press, c/o Springer Science+Business Media, LLC, 233 Spring Street, New York, NY 10013, USA),
except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information
storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or
hereafter developed is forbidden.
The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified
as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights.
Printed on acid-free paper
Humana Press is part of Springer Science+Business Media (www.springer.com)

Preface
In the last 20 years, the methodologies used in the field of transcriptional regulation have
undergone remarkable changes. Perhaps the most significant advancements are the devel-
opment of genome-wide approaches for measuring gene expression, exemplified by gene
chips (chip), and chromatin immunoprecipitation assays (ChIP) for measuring in vivo
protein–DNA interactions at any genomic loci. The combination of genome-wide
approaches and chromatin immunoprecipitation culminated in developing methods for
measuring protein–DNA interactions at a genome-wide scale, such as ChIP–chip and
ChIP–Seq. The regulatory role of chromatin and histone modifications also came to the
forefront during the last 20 years, adding new layers of complexity to our understanding of
transcriptional regulation. In addition, mass spectrometry methods identified an array of
accessory proteins involved in all stages of RNA synthesis and its regulation.
This volume is divided in four parts: (1) Promoter elements, transcription factors, and
preinitiation complex (PIC) assembly, (2) Chromatin structure, (3) Chromatin modifying
complexes, and (4) RNA synthesis and regulation. Strict classification of the described
methods into these four parts, however, is very difficult. For example, ChIP methods are
used for studies of transcription factors binding to promoter elements as well as for the
characterization of chromatin structure and histone modifications.
Most of the protocols presented in this volume have been developed using mammalian,
yeast, or Drosophila cells and tissues, but most methods can be applied across the species
and cell types. The methods in all four parts have been chosen to represent both classic and
cutting-edge techniques to study transcriptional regulation. The reliability of all the proto-
cols has been tested in laboratories around the world. Each chapter is appended by notes
that navigate through the protocol and serves as a troubleshooting guide. It is our hope
that this book will be useful not only to senior researchers and scientists experienced in
transcriptional regulation, but also to graduate students and scientists who want to study
transcriptional regulation for the first time.
I would like to thank all the authors for their enthusiastic help and support in assem-
bling this volume; I fully realize that in the highly competitive environment of academic
research, many scientists are reluctant to commit their time to writing book chapters and
review articles. I also want to thank Dr. Ivana Vancurova for her significant help in editing
this volume. Last, but not least, I would like to express my gratitude to the series editor,
Dr. John Walker, and the outstanding staff of Humana Press for their support, help, and
encouragement.
Queens, NY, USA Ales Vancura
v
Contents
Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi
PART I PROMOTER ELEMENTS, TRANSCRIPTION FACTORS,

AND PRE-INITIATION COMPLEX ASSEMBLY
1 Genome-Wide In Vivo Cross-linking of Sequence-Specific

Transcription Factors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
Xiao-Yong Li and Mark D. Biggin
2 Characterization of Complex Regulatory Networks and Identification
of Promoter Regulatory Elements in Yeast: “In Silico”
and “Wet-Lab” Approaches . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
Nuno P. Mira, Miguel C. Teixeira, and Isabel Sá-Correia
3 Electrophoretic Mobility Shift Assay Analysis of NFκB Transcriptional
Regulation by Nuclear IκBα . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49
Ashish Juvekar, Sitharam Ramaswami, Subrata Manna,
Tzu-Pei Chang, Adeel Zubair, and Ivana Vancurova
4 Probing Endogenous RNA Polymerase II Pre-initiation Complexes
by Electrophoretic Mobility Shift Assay. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63
Emmanuelle Wilhelm, Christopher Takacs, and Brendan Bell
5 Elucidating Protein: DNA Complex by Oligonucleotide DNA
Affinity Purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
Teddy T.C. Yang and Chi-Wing Chow
6 Chromatin Immunoprecipitation Assay as a Tool for Analyzing
Transcription Factor Activity. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85
Padmaja Gade and Dhan V. Kalvakolanu
7 Two-Step Cross-linking for Analysis of Protein–Chromatin Interactions . . . . . . . . . 105
Bing Tian, Jun Yang, and Allan R. Brasier
8 Chromatin Immunoprecipitation Analysis of NFκB Transcriptional
Regulation by Nuclear IkBa in Human Macrophages . . . . . . . . . . . . . . . . . . . . . . . 121
Sitharam Ramaswami, Subrata Manna, Ashish Juvekar,
Steven Kennedy, Ales Vancura, and Ivana Vancurova
9 In Vivo ChIP for the Analysis of Microdissected Tissue Samples . . . . . . . . . . . . . . . 135
Chris Murgatroyd, Anke Hoffmann, and Dietmar Spengler
10 Quantification of Protein–DNA Interactions by In Vivo Chromatin
Immunoprecipitation in Yeast . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 149
Amparo Pascual-Ahuir and Markus Proft
vii
viii Contents
11 Mapping Protein–DNA Interactions Using ChIP-Sequencing . . . . . . . . . . . . . . . . . 157

Charles E. Massie and Ian G. Mills
12 ChIP and Re-ChIP Assays: Investigating Interactions Between
Regulatory Proteins, Histone Modifications, and the DNA Sequences
to Which They Bind . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 175
Agnieszka D. Truax and Susanna F. Greer
13 Transcriptional Regulation of Genes via Hypoxia-Inducible Factor . . . . . . . . . . . . . 189
Olga Roche and Michael Ohh
14 Exchange Protein Directly Activated by Cyclic AMP-1-Regulated
Recruitment of CCAAT/Enhancer-Binding Proteins to the Suppressor
of Cytokine Signaling-3 Promoter. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 201
William A. Sands, Hayley D. Woolson, Stephen J. Yarwood,
and Timothy M. Palmer
PART II CHROMATIN STRUCTURE
15 Computational Analysis of Promoter Elements and Chromatin

Features in Yeast . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 217
John J. Wyrick
16 Chromatin Affinity Purification. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 237
Ryoko Harada and Alain Nepveu
17 Determination of Histone Acetylation Status by Chromatin
Immunoprecipitation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 255
Luciano Galdieri, John Moon, and Ales Vancura
18 Immunostaining of Drosophila Polytene Chromosomes to Investigate
Recruitment of Chromatin-Binding Proteins. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 267
Magdalena Murawska and Alexander Brehm
19 Detection of Transcriptional Activators, Co-activators,
and Chromatin Remodeling by Chromatin Immunoprecipitation
Coupled with Real-Time PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 279
Tamara Y. Erkina and Alexandre M. Erkine
20 Chromatin Endogenous Cleavage and Psoralen Crosslinking
Assays to Analyze rRNA Gene Chromatin In Vivo . . . . . . . . . . . . . . . . . . . . . . . . . 291
Joachim Griesenbeck, Manuel Wittner, Romain Charton,
and Antonio Conconi
21 UV-Induced DNA Damage and DNA Repair in Ribosomal
Genes Chromatin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 303
Julie Pelloux, Maxime Tremblay, Raymund J. Wellinger,
and Antonio Conconi
22 Analysis of SUC2 Promoter Structure by Nucleosome Scanning . . . . . . . . . . . . . . . 321
Jennifer Chang and Ales Vancura
23 Chromatin Immunoprecipitation of Mouse Embryos . . . . . . . . . . . . . . . . . . . . . . . 335
Anne K. Voss, Mathew P. Dixon, Tamara McLennan,
Andrew J. Kueh, and Tim Thomas
Contents ix
24 Chromatin Immunoprecipitation in Mouse Hippocampal

Cells and Tissues. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 353
Badi Sri Sailaja, Takumi Takizawa, and Eran Meshorer
PART III CHROMATIN MODIFYING COMPLEXES
25 Approaches for Studying Nucleosome Movement by ATP-Dependent

Chromatin Remodeling Complexes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 367
Swetansu K. Hota and Blaine Bartholomew
26 Mapping Protein–DNA and Protein–Protein Interactions
of ATP-Dependent Chromatin Remodelers. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 381
Swetansu K. Hota, Mekonnen Lemma Dechassa, Punit Prasad,
and Blaine Bartholomew
27 Evaluation of Histone-Modifying Enzymes in Stem Cell Populations . . . . . . . . . . . 411
Leanne Stalker and Christopher Wynder
28 Purification of Multiprotein Histone Acetyltransferase Complexes. . . . . . . . . . . . . . 427
Yuan-Liang Wang, Francesco Faiola, and Ernest Martinez
29 Reconstitution of Active and Stoichiometric Multisubunit
Lysine Acetyltransferase Complexes in Insect Cells . . . . . . . . . . . . . . . . . . . . . . . . . 445
Kezhi Yan, Chao-Jung Wu, Nadine Pelletier, and Xiang-Jiao Yang
30 Affinity Purification of MLL3/MLL4 Histone H3K4
Methyltransferase Complex. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 465
Young-Wook Cho, SunHwa Hong, and Kai Ge
31 Methods for Analyzing Histone Citrullination in Chromatin
Structure and Gene Regulation. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 473
Pingxin Li, Jing Hu, and Yanming Wang
PART IV RNA SYNTHESIS AND REGULATION
32 Analysis of mRNA Abundance and Stability by Ribonuclease

Protection Assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 491
Cristina Romero-López, Alicia Barroso-delJesus, Pablo Menendez,
and Alfredo Berzal-Herranz
33 Array-Based Nuclear Run-On Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 505
Jinshui Fan, Yu-Chi Chen, Tonya Watkins, Chi V. Dang,
Myriam Gorospe, and Chris Cheadle
34 In Vivo Run-On Assays to Monitor Nascent Precursor RNA Transcripts . . . . . . . . . 519
Piergiorgio Percipalle and Emilie Louvet
35 Genome Wide Full-Length Transcript Analysis Using 5¢ and 3¢
Paired-End-Tag Next Generation Sequencing (RNA-PET) . . . . . . . . . . . . . . . . . . . 535
Xiaoan Ruan and Yijun Ruan
36 Analysis of Co-transcriptional RNA Processing by RNA-ChIP Assay . . . . . . . . . . . . 563
Danielle Bittencourt and Didier Auboeuf
x Contents
37 Quantitative Analysis of Transcription Elongation by RNA

Polymerase I In Vitro . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 579
David Alan Schneider
38 Detection and Characterization of Transcription Termination . . . . . . . . . . . . . . . . . 593
Ghada Ghazal, Jules Gagnon, and Sherif Abou Elela
39 Promoter-Associated Noncoding RNA from the CCND1 Promoter . . . . . . . . . . . . 609
Xiaoyuan Song, Xiangting Wang, Shigeki Arai, and Riki Kurokawa
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 623
Contributors
SHIGEKI ARAI • Division of Gene Structure and Function, Research Center

for Genomic Medicine, Saitama Medical University, Saitama-Ken, Japan
DIDIER AUBOEUF • INSERM, Lyon, France
ALICIA BARROSO-DELJESUS • Genomics Facility, Instituto de Parasitología y Biomedicina
“López-Neyra”, IPBLN-CSIC, Parque Tecnológico de Ciencias de la Salud, Av del
Conocimiento s/n, Granada, Spain
BLAINE BARTHOLOMEW • Southern Illinois University School of Medicine,
Carbondale, IL, USA
BRENDAN BELL • RNA Group, Département de microbiologie et d’infectiologie,
Faculté de médecine et sciences de la santé, Université de Sherbrooke,
Sherbrooke, QC, Canada
ALFREDO BERZAL-HERRANZ • Instituto de Parasitología y Biomedicina “López-Neyra”,
IPBLN-CSIC, Parque Tecnológico de Ciencias de la Salud, Av del Conocimiento s/n,
Granada, Spain
MARK D. BIGGIN • Genomics Division, Lawrence Berkeley National Laboratory,
Berkeley, CA, USA
DANIELLE BITTENCOURT • Department of Biochemistry and Molecular Biology,
Keck School of Medicine, University of Southern California, Los Angeles, CA, USA
ALLAN R. BRASIER • Department of Internal Medicine, Institute for Translational
Sciences, and Sealy Center for Molecular Medicine, University of Texas Medical
Branch, Galveston, TX, USA
ALEXANDER BREHM • Institut für Molekularbiologie und Tumorforschung (IMT),
Philipps-Universität Marburg, Marburg, Germany
JENNIFER CHANG • Department of Cell Biology, New York University
School of Medicine, New York, NY, USA
TZU-PEI CHANG • Department of Biological Sciences, St. John’s University,
Queens, NY, USA
ROMAIN CHARTON • Département de Microbiologie et Infectiologie,
Faculté de Médecine, Université de Sherbrooke, Sherbrooke, QC, Canada
CHRIS CHEADLE • Lowe Family Genomics Core, Division of Allergy
and Clinical Immunology, Department of Medicine, The Johns Hopkins University
School of Medicine, Baltimore, MD, USA
YU-CHI CHEN • Lowe Family Genomics Core, Division of Allergy and Clinical
Immunology, Department of Medicine, The Johns Hopkins University
YOUNG-WOOK CHO • Nuclear Receptor Biology Section, NIDDK, NIH,
Bethesda, MD, USA
CHI-WING CHOW • Department of Molecular Pharmacology, Albert Einstein
College of Medicine, Bronx, NY, USA
xi
xii Contributors
ANTONIO CONCONI • Département de Microbiologie et Infectiologie,

CHI V. DANG • Division of Hematology, Departments of Medicine, Cell Biology,
Oncology, and Pathology, The Johns Hopkins University School of Medicine,
Baltimore, MD, USA
MEKONNEN LEMMA DECHASSA • Southern Illinois University School of Medicine,
Carbondale, IL, USA
MATHEW P. DIXON • The Walter and Eliza Hall Institute of Medical Research,
Melbourne, VIC, Australia
SHERIF ABOU ELELA • RNA Group/Groupe ARN, Département de Microbiologie
& Infectiologie, Faculté de médecine et des sciences de la santé,
Université de Sherbrooke, Sherbrooke, QC, Canada
TAMARA Y. ERKINA • College of Pharmacy and Health Sciences, Butler University,
Indianapolis, IN, USA
ALEXANDRE M. ERKINE • College of Pharmacy and Health Sciences, Butler University,
Indianapolis, IN, USA
FRANCESCO FAIOLA • Department of Biochemistry, University of California,
Riverside, CA, USA
JINSHUI FAN • Lowe Family Genomics Core, Division of Allergy and Clinical Immunology,
Department of Medicine, The Johns Hopkins University School of Medicine,
Baltimore, MD, USA
PADMAJA GADE • Department of Microbiology & Immunology, Greenebaum Cancer
Center, University of Maryland School of Medicine, Baltimore, MD, USA
JULES GAGNON • RNA Group/Groupe ARN, Département de Microbiologie
LUCIANO GALDIERI • Department of Biological Sciences, St. John’s University,
Queens, NY, USA
KAI GE • Nuclear Receptor Biology Section, NIDDK, NIH, Bethesda, MD, USA
GHADA GHAZAL • RNA Group/Groupe ARN, Département de Microbiologie
MYRIAM GOROSPE • Laboratory of Cellular and Molecular Biology,
National Institute on Aging-Intramural Research Program, NIH,
Baltimore, MD, USA
SUSANNA F. GREER • Division of Cellular and Molecular Biology and Physiology,
Department of Biology, Georgia State University, Atlanta, GA, USA
JOACHIM GRIESENBECK • Naturwissenschaftliche Fakultät III,
Institut für Biochemie III, Universität Regensburg, Regensburg, Germany
RYOKO HARADA • The Rosalind and Morris Goodman Cancer Research Centre,
McGill University, Montreal, QC, Canada
ANKE HOFFMANN • Max Planck Institute for Psychiatry, Munich, Germany
SUNHWA HONG • Nuclear Receptor Biology Section, NIDDK, NIH,
Bethesda, MD, USA
SWETANSU K. HOTA • Southern Illinois University School of Medicine,
Carbondale, IL, USA
Contributors xiii
JING HU • Center for Eukaryotic Gene Regulation, and Genetics Graduate Program,
Pennsylvania State University, University Park, PA, USA
ASHISH JUVEKAR • Department of Biological Sciences, St. John’s University,
Queens, NY, USA
DHAN V. KALVAKOLANU • Department of Microbiology & Immunology,
Greenebaum Cancer Center, University of Maryland School of Medicine,
Baltimore, MD, USA
STEVEN KENNEDY • Department of Biological Sciences, St. John’s University,
Queens, NY, USA
ANDREW J. KUEH • The Walter and Eliza Hall Institute of Medical Research,
RIKI KUROKAWA • Division of Gene Structure and Function, Research Center
for Genomic Medicine, Saitama Medical University, Saitama-Ken, Japan
PINGXIN LI • Center for Eukaryotic Gene Regulation, University Park, PA, USA;
Department of Biochemistry and Molecular Biology, Pennsylvania State University,
University Park, PA, USA; Genetics Graduate Program, Pennsylvania State
University, University Park, PA, USA
XIAO-YONG LI • Genomics Division, Lawrence Berkeley National Laboratory,
Berkeley, CA, USA
EMILIE LOUVET • Department of Cell and Molecular Biology, Karolinska Institutet,
Stockholm, Sweden
SUBRATA MANNA • Department of Biological Sciences, St. John’s University,
Queens, NY, USA
ERNEST MARTINEZ • Department of Biochemistry, University of California,
Riverside, CA, USA
CHARLES E. MASSIE • CRUK Cambridge Research Institute, Cambridge, UK;
Department of Haematology, Cambridge Institute for Medical Research,
Cambridge, UK
TAMARA MCLENNAN • The Walter and Eliza Hall Institute of Medical Research,
PABLO MENENDEZ • Stem Cells, Development & Cancer Laboratory GENyO: Centre
for Genomics and Oncology Pfizer-University of Granada-Andalusian Govermment,
Parque Tecnológico de Ciencias de la Ilustración, Granada, Spain
ERAN MESHORER • Department of Genetics, Institute of Life Sciences,
The Hebrew University of Jerusalem, Jerusalem, Israel
IAN G. MILLS • CRUK Cambridge Research Institute, Cambridge, UK;
Centre for Molecular Medicine Norway, Nordic European Molecular Biology
Laboratory Partnership, University of Oslo, Oslo, Norway
NUNO P. MIRA • Institute for Biotechnology and Bioengineering,
Technical University of Lisbon, Lisbon, Portugal
JOHN MOON • Department of Biological Sciences, St. John’s University,
Queens, NY, USA
MAGDALENA MURAWSKA • Institut für Molekularbiologie und Tumorforschung (IMT),
Philipps-Universität Marburg, Marburg, Germany
xiv Contributors
CHRIS MURGATROYD • Max Planck Institute for Psychiatry, Munich, Germany

ALAIN NEPVEU • Departments of Biochemistry, Oncology, and Medicine,
The Rosalind and Morris Goodman Cancer Research Centre, McGill University,
Montreal, QC, Canada
MICHAEL OHH • Department of Laboratory Medicine and Pathobiology,
University of Toronto, Toronto, ON, Canada
TIMOTHY M. PALMER • Institute for Cardiovascular and Medical Sciences,
College of Medical, Veterinary and Life Sciences, University of Glasgow,
Glasgow, Scotland, UK
AMPARO PASCUAL-AHUIR • Instituto de Biología Molecular y Celular de Plantas,
CSIC-Universidad Politécnica de Valencia, Valencia, Spain
NADINE PELLETIER • Department of Medicine, The Rosalind and Morris Goodman
Cancer Research Centre, McGill University Health Center, Montréal, Québec,
Canada
JULIE PELLOUX • Département de Microbiologie et Infectiologie, Faculté de Médecine,
PIERGIORGIO PERCIPALLE • Department of Cell and Molecular Biology,
Karolinska Institutet, Stockholm, Sweden
PUNIT PRASAD • Southern Illinois University School of Medicine, Carbondale, IL, USA
MARKUS PROFT • Instituto de Biología Molecular y Celular de Plantas,
CSIC-Universidad Politécnica de Valencia, Valencia, Spain
SITHARAM RAMASWAMI • Department of Biological Sciences, St. John’s University,
Queens, NY, USA
OLGA ROCHE • Department of Laboratory Medicine and Pathobiology,
University of Toronto, Toronto, ON, Canada
CRISTINA ROMERO-LÓPEZ • Instituto de Parasitología y Biomedicina “López-Neyra”,
IPBLN-CSIC, Parque Tecnológico de Ciencias de la Salud, Av del Conocimiento s/n,
Granada, Spain
XIAOAN RUAN • Genome Institute of Singapore, Singapore, Singapore
YIJUN RUAN • Genome Institute of Singapore, Singapore, Singapore
ISABEL SÁ-CORREIA • Institute for Biotechnology and Bioengineering,
BADI SRI SAILAJA • Department of Genetics, Institute of Life Sciences,
The Hebrew University of Jerusalem, Jerusalem, Israel
WILLIAM A. SANDS • Institute for Cardiovascular and Medical Sciences,
DAVID ALAN SCHNEIDER • Department of Biochemistry and Molecular Genetics,
University of Alabama at Birmingham, Birmingham, AL, USA
XIAOYUAN SONG • Department of Medicine, University of California,
San Diego School of Medicine, La Jolla, CA, USA
DIETMAR SPENGLER • Max Planck Institute for Psychiatry, Munich, Germany
LEANNE STALKER • Department of Biochemistry, McMaster University,
Hamilton, ON, Canada
CHRISTOPHER TAKACS • RNA Group, Département de microbiologie et d’infectiologie,
Contributors xv
TAKUMI TAKIZAWA • Graduate School of Biological Sciences, Nara Institute of Science

and Technology, Nara, Japan
MIGUEL C. TEIXEIRA • Institute for Biotechnology and Bioengineering,
TIM THOMAS • The Walter and Eliza Hall Institute of Medical Research,
BING TIAN • Department of Internal Medicine, University of Texas Medical Branch,
Galveston, TX, USA
MAXIME TREMBLAY • Département de Microbiologie et Infectiologie,
AGNIESZKA D. TRUAX • Division of Cellular and Molecular Biology and Physiology,
Department of Biology, Georgia State University, Atlanta, GA, USA
ALES VANCURA • Department of Biological Sciences, St. John’s University,
Queens, NY, USA
IVANA VANCUROVA • Department of Biological Sciences, St. John’s University,
Queens, NY, USA
ANNE K. VOSS • The Walter and Eliza Hall Institute of Medical Research,
XIANGTING WANG • Department of Medicine, University of California, San Diego
School of Medicine, La Jolla, CA, USA
YANMING WANG • Center for Eukaryotic Gene Regulation, University Park, PA, USA;
Department of Biochemistry and Molecular Biology, Pennsylvania State University,
University Park, PA, USA; Genetics Graduate Program, Pennsylvania State
University, University Park, PA, USA
YUAN-LIANG WANG • Department of Biochemistry, University of California,
Riverside, CA, USA
TONYA WATKINS • MS Lowe Family Genomics Core, Division of Allergy
and Clinical Immunology, Department of Medicine, The Johns Hopkins University
RAYMUND J. WELLINGER • Département de Microbiologie et Infectiologie,
EMMANUELLE WILHELM • RNA Group, Département de microbiologie et d’infectiologie,
MANUEL WITTNER • Naturwissenschaftliche Fakultät III, Institut für Biochemie III,
Universität Regensburg, Regensburg, Germany
HAYLEY D. WOOLSON • Institute for Cardiovascular and Medical Sciences,
CHAO-JUNG WU • Department of Biochemistry, The Rosalind and Morris Goodman
Cancer Research Centre, McGill University, Montréal, Québec, Canada;
Department of Medicine, The Rosalind and Morris Goodman Cancer
Research Centre, McGill University, Montréal, Québec, Canada
CHRISTOPHER WYNDER • Department of Biochemistry, Schulich School of Medicine
and Dentistry, The University of Western Ontario, London, ON, Canada
JOHN J. WYRICK • School of Molecular Biosciences and Center for Reproductive Biology,
Washington State University, Pullman, WA, USA
xvi Contributors
KEZHI YAN • Department of Biochemistry, The Rosalind and Morris Goodman Cancer
JUN YANG • Department of Internal Medicine, University of Texas Medical Branch,
Galveston, TX, USA
TEDDY T. C. YANG • Department of Molecular Pharmacology, Albert Einstein College
of Medicine, Bronx, NY, USA
XIANG-JIAO YANG • Department of Biochemistry, The Rosalind and Morris Goodman
Cancer Research Centre, McGill University, Montréal, Québec, Canada;
Department of Medicine, The Rosalind and Morris Goodman Cancer
STEPHEN J. YARWOOD • Institute for Molecular, Cell and Systems Biology,
ADEEL ZUBAIR • Department of Biological Sciences, St. John’s University,
Queens, NY, USA
Part I
Promoter Elements, Transcription Factors,

and Pre-initiation Complex Assembly
Chapter 1
Genome-Wide In Vivo Cross-linking of Sequence-Specific

Transcription Factors
Xiao-Yong Li and Mark D. Biggin
Abstract
Immunoprecipitation of cross-linked chromatin in combination with microarrays (ChIP-chip) or ultra
high-throughput sequencing (ChIP-seq) is widely used to map genome-wide in vivo transcription factor
binding. Both methods employ initial steps of in vivo cross-linking, chromatin isolation, DNA fragmentation,
and immunoprecipitation. For ChIP-chip, the immunoprecipitated DNA samples are then amplified,
labeled, and hybridized to DNA microarrays. For ChIP-seq, the immunoprecipitated DNA is prepared for
a sequencing library, and then the library DNA fragments are sequenced using ultra high-throughput
sequencing platform. The protocols described here have been developed for ChIP-chip and ChIP-seq
analysis of sequence-specific transcription factor binding in Drosophila embryos. A series of controls establish
that these protocols have high sensitivity and reproducibility and provide a quantitative measure of relative
transcription factor occupancy. The quantitative nature of the assay is important because regulatory transcrip-
tion factors bind to highly overlapping sets of thousands of genomic regions and the unique regulatory
specificity of each factor is determined by relative moderate differences in occupancy between factors at
commonly bound regions.
Key words: In vivo cross-linking, Sequence-specific transcription factors, ChIP-chip, Chip-seq
1. Introduction
Sequence-specific transcription factors control the differential

expression of genes in response to various physiological and patho-
logical stimuli and during pattern formation and differentiation in
animals and plants. To understand how these important biological
events occur, it is critical to know where and at what level tran-
scription factors bind throughout the genome (1). In vivo cross-
linking followed by chromatin immunoprecipitation and either
southern blot or PCR has long been used to detect direct binding
Ales Vancura (ed.), Transcriptional Regulation: Methods and Protocols, Methods in Molecular Biology, vol. 809,
DOI 10.1007/978-1-61779-376-9_1, © Springer Science+Business Media, LLC 2012
3
4 X.-Y. Li and M.D. Biggin
of transcription factors in vivo at a sample of genomic regions and

has provided critical lessons in the distribution of factor binding
(2–4). In the last decade, however, the advent of DNA microarray
technology has allowed mapping of in vivo cross-linking to many
more regions throughout the genome by the so-called ChIP-chip
(5, 6), opening the way for computational/statistical analysis of
the patterns of transcription factor binding and its relationship to
other large-scale data sets for gene function and expression and
chromatin structure. More recently, ultra high-throughput next
generation DNA sequencing technologies, such as Roche 454,
Illumina genome analyzer, the ABI SOLiD, and Helicos HeliScope
(see ref. 7 for review), have become the predominant method for
genome-wide mapping of in vivo cross-linking (8–10). This new
ChIP-seq method has several advantages. It allows full genome
coverage, regardless of the size of the genome and can be applied
to any organism as long as the genome sequence is known, without
the additional startup cost of building a microarray. It also has
better dynamic range and higher resolution. For more very large
genomes, ChIP-chip results tend to be noisy, presumably due to
probe cross-hybridization, though this does not seem to be problem
for genomes of the size of Drosophila (~180 Mb).
The ChIP-chip and ChIP-seq protocols used by different
groups vary considerably. The protocols described here are designed
for Drosophila embryos and have been optimized for high repro-
ducibility and to provide a quantitative measure of relative levels of
factor occupancy by seeking to minimize and control for any system-
atic experimental biases. The major steps described are shown in
Fig. 1. The first difference between our protocol and others is
specific to Drosophila embryos, which are surrounded by a hydro-
phobic vitelline membrane that must be permeabilized to allow
entry of formaldehyde. In our protocol, this is accomplished by
treating embryos with isopropanol followed by a hexane formalde-
hyde solution (11), whereas protocols for intact yeast or tissue
culture cells readily accomplish fixation by treatment with aqueous
formaldehyde. The second difference is more significant. Most
groups isolate chromatin by sonicating intact nuclei to release short
(~200–800 bp) length DNA fragments and then immunoprecipi-
tate this unpurified chromatin (e.g. see refs. 5, 6, 8). The protocol
presented here, instead, extracts long fragments of cross-linked
chromatin (>20 kb) from nuclei using high concentrations of
detergent and then purifies the cross-linked DNA by CsCl buoyant
density ultracentrifugation, which dissociates non-covalently attached
proteins from the DNA. The cross-linked DNA is then sonicated
to smaller sizes and the immunoprecipitation is performed on this
purified material. Recently, it has been shown that extracting DNA
by sonicating intact nuclei, as many protocols do, may introduce
an experimental bias by preferentially releasing DNA from acces-
sible chromatin regions (12). In contrast, our protocol does not
1 Genome-Wide In Vivo Cross-linking of Sequence-Specific… 5
Formaldehyde crosslinking
Chromatin isolation by CsCl

gradient; sonication
Chromatin immunoprecipitation
DNA sample
DNA amplification
and labeling DNA sequencing library
Hybridization to
genomic DNA tiling Ultra-high throughput
array sequencing
Fig. 1. Schematic representation of the ChIP-chip and ChIP-seq method.
introduce this bias (Fig. 2) (13, 14). Finally, another major difference
between protocols is the approach used to amplify the immuno-
precipitated DNA for ChIP-chip analysis. We have found that this
step must be carefully optimized to reduce as much as possible
stochastic experimental noise. Our amplification protocols have
been optimized to give high reproducible between replicas and to
faithfully preserve the relative levels of enrichment of different
DNAs even when sub-nanogram amount of genomic DNA is used
in either our ChIP-chip protocol (15) (Fig. 2).
For successful ChIP-chip or ChIP-seq experiments, it is critical
to have first rate antibodies. In our experience, affinity-purified
polyclonal antibodies are highly effective. We have been successful
in obtaining ChIP quality antibodies for nearly every factor
attempted, with good data being obtained for 21 proteins (16).
Monoclonal antibodies or antibodies raised against a short protein
sequence, in contrast, tend to be less effective; potential epitope
masking may not only affect the general effectiveness, but may also
cause bias in which genomic regions are detected. It is important
that the portion(s) of the protein chosen for affinity purifying
antibodies do not share homology with other proteins in the
organism. Suitable nonhomologous regions can be identified using
NCBI blast. Regions of approximately 100 amino acids in length
are generally effective. To further ensure that the antibodies do not
cross-react with other proteins, ideally, for each factor two ChIP
experiments should be performed using affinity-purified antibodies
against nonoverlapping parts of the same protein. We have found
that the results between such antibody pairs are strikingly similar
for the same factor, whereas data for different factors is, of course,
different (15, 17) (Fig. 2).
IgG/Input
ChIP-chip Anti-HB1/Input
Anti-HB2/Input
Bound region
Input
Anti-HB1
ChIP-seq
Anti-HB1
Boung region
late s3/7 s2 s4/6 s1s5
Fig. 2. The ChIP-chip score profile (top half ) or ChIP-seq tag-density profile (bottom half ) for anti-HB or normal rabbit IgG
control chromatin immunoprecipitation. In each case, two ChIPs were performed using two different anti-HB antibodies
against nonoverlapping epitopes (HB1 and HB2). The ChIP-chip score was calculated as log2 (mean Factor IP/mean input
DNA) for the Factor IP track, and log2 (mean IgG control IP/mean input DNA) for the IgG control track, and a moving average
with a window size of 675 bp was calculated. Shown in the figure are the unlogged window scores. The bound regions
detected by TiMAT are marked underneath the binding profiles. For ChIP-seq, the short sequence tags aligned to the
genome were extended by the average size of the fragments in the DNA library to generate the tag-density profiles, as
shown. The signals shown for the different samples were scaled to the same total number of tags. The bound regions
identified by MACS are shown underneath the profiles.
Our ChIP-chip studies have been carried out using the

Affymetrix gene chip system, and ChIP-seq has been done using
the Illumina Solexa genome analyzer. For our ChIP-chip and
ChIP-seq experiments, besides the chromatin immunoprecipita-
tion samples, two types of controls are always included: the input
DNA and mock IP controls. All three types of samples are per-
formed in duplicate for ChIP-chip. For ChIP-seq, to reduce costs
the duplicates of each sample have been pooled prior to amplifica-
tion and sequencing.
2. Materials
2.1. Fixation of 1. Large fly population cages (Genesee Scientific: #59-104).

Embryos with 2. Fine and coarse polyamide nylon mesh (Genesee Scientific:
Formaldehyde #:57–102 (fine) and #57–101 (coarse)).
3. 50% Clorox bleach (2.6% hypochlorite solution).

4. 10× PBS: 1.37 M NaCl, 27 mM KCl, 43 mM Na2HPO4,
14 mM KH2PO4 pH 7.3. Autoclave and store at room
temperature.
5. Formaldehyde/hexane fixing solution: mix 210 ml hexane,
37 ml 37% formaldehyde (Sigma, #252549), and 27.5 ml 10×
PBS, in a bottle with a magnetic stir bar. Vigorously stir the
mixture for at least half an hour. Aliquot the top layer to a sepa-
rate container. Make it the same day it is going to be used.
6. Embryo washing buffer: 1× PBS, 0.1% Triton X-100.
2.2. Purification 1. Motorized dounce homogenizer (Thomas Teflon Pestle Tissue

of Chromatin Homogenizer #3431-E25).
2. Glass dounce (Bellco #1984-40040).
3. SW28 or SW41 rotor and centrifuge tubes.
4. SS34 rotor and centrifuge tubes.
5. A sonicator (e.g., Branson sonifier 450 or Bioruptor (Diagenode)).
6. Embryo homogenization buffer: 0.3 M sucrose, 15 mM NaCl,
5 mM MgCl2, 15 mM Tris–Cl, pH 7.5, 60 mM KCl, 0.1 mM EDTA,
0.1 mM EGTA. Filter sterilize (0.22 μm) and store at 4°C.
Add DTT to 0.5 mM and PMSF to 1 mM (from a 200 mM
stock in ethanol) immediately before use.
7. Nuclear lysis buffer: 100 mM NaCl, 10 mM Tris–Cl, pH 8.0,
1 mM EDTA, 0.1%NP-40. Filter sterilize (0.22 μm) and store
at 4°C. Add PMSF to 1 mM immediately before use.
8. 20% N-lauroylsarcosine (Sigma); 20% SDS (Sigma); 20%
Triton X-100 (Sigma). Filter (0.22 μm) and store at room
temperature.
9. CsCl buffer: 2% N-lauroylsarcosine, 1 mM EDTA. Filter
(0.22 μm) and store at room temperature. Add 1 mM PMSF
immediately before use.
10. CsCl solutions of densities at 1.5, 1.4, and 1.3 g/ml. For 10 ml
solutions, dissolve 6.67 g, 5.34, and 4 g, in 8.33, 8.66, and
9 ml CsCl buffer, respectively. Adjust the volume to be pre-
pared according to number of chromatin samples.
11. Dialysis tubing (Spectrum: Spec 2).
12. Dialysis buffer: 20 mM Tris–Cl, pH 8.0, 2 mM EDTA in sterile
ddH2O. Add PMSF to 1 mM immediately before use.
2.3. Chromatin All solutions and buffers for this step should be of high quality,
Immunoprecipitation especially for applications near end of the immunoprecipitation
procedure and the subsequent processing of the samples for ChIP-
chip and ChIP-seq. Preferably, the following solutions should be
purchased from commercial resources: molecular grade water, 1 M
Tris–Cl, pH 8.0, 0.5 M EDTA, 3 M sodium acetate.
1. 50 mg/ml BSA (Invitrogen, 15561-020), 10 mg/ml RNase A

(Roche, #11119915001), 20 mg/ml proteinase K (Invitrogen,
#AM2546).
2. 1 M Tris–Cl, pH 8.0 (Sigma, #93316), 0.5 M EDTA (Sigma,
#E7889), 3 M NaOAc, pH 5.3 (Sigma, #71196).
3. 200 mM PMSF in 100% ethanol.
4. Protein A – sephacryl 1,000 beads (see Note 1).
5. IP buffer: 10 mM Tris–Cl pH 8.0, 1 mM EDTA, 150 mM
NaCl, 0.5% Triton X-100, 0.1% sodium deoxycholate (Sigma,
#5670), 0.5% N-lauroylsarcosine. Add PMSF to 1 mM imme-
diately before use.
6. 5× IP buffer.
7. 0.5 M ChrIP wash buffer: same as ChrIP buffer, except the
NaCl concentration is 0.5 M.
8. LiCl washing buffer: 10 mM Tris–Cl pH 8.0, 1 mM EDTA,
250 mM LiCl, 1% NP40 (or IGEPAL 630), 1% sodium
deoxylcholate.
9. TE: 10 mM Tris–Cl pH 8.0, 2 mM EDTA.
10. TE (10:0.1): 10 mM Tris–Cl pH 8.0, 0.1 mM EDTA.
11. Antibodies: affinity purified.
12. Normal rabbit IgG (Santa Cruz Biotech, sc-2027).
13. Glycogen.
14. Phenol/chloroform.
15. Chloroform.
16. PCR primers flanking a known binding site(s) for the tran-
scription factor to be analyzed. For ChIP-seq, where the DNA
fragments are short, the amplicon should be as close to the
true binding site as possible.
2.4. DNA Amplification 1. Sequenase 2.0 kit (USB corp, #70775Y).

and Labeling 2. Random prime primer A: GTTTCCCAGTCACGGTC(N)9.
for ChIP-Chip Custom synthesize, HPLC purify, dilute to 200 μM.
3. Random prime primer B: GTTTCCCAGTCACGGTC. Custom
synthesize, HPLC purify. dilute to 100 μM.
4. 50 mg/ml BSA (Invitrogen, #15561-020), 0.1 M DTT, 25 mM
dNTPs.
5. Microspin S-300 HR column (Amersham, #27-5130-01).
6. Taq2000 (Stratagene, #600196).
7. QIAquick PCR purification kit (Qiagen, #28104).
8. 1 U/μl DNase I (Epicentre, #D9902K).
9. One-Phor-All buffer (Roche).
10. Biotin-ddATP (Perkin Elmer, #NEL548).

11. TdTase (Roche, #3333566).
12. Thermocycler.
2.5. Array 1. 12× MES buffer: dissolve 70.4 g MES free acid monohydrate
Hybridization (Sigma, #69889), and 193.3 g MES-Na (Sigma, # M3058) in
and Scanning ddH2O, adjust to 1 l. Filter sterilize and store at 4°C.
2. 3 nM B2 oligo (Affymetrix, #900301).
3. 2× MES-Triton solution: mix 1.66 ml 12× MES, 3.44 ml 5 M
NaCl, 0.8 ml 0.5 M EDTA, 0.2 ml 1% Triton X-100, and
3.9 ml H2O. Filer sterilize, store at 4°C, shield from light.
4. Hybridization cocktail: for each chip, prepare 200 μl cocktail
by mixing 20.83 μl 12× MES, 150 μl 5 M TMAC (Sigma,
#T3411), 3 μl 3 nM B2, 2 μl herring sperm DNA (10 mg/ml),
and 18.67 μl H2O.
5. Wash buffer A: for 1 l, mix 300 ml 20× SSPE, 1 ml 10% Tween-
20, and 700 ml H2O. Filter sterilize and store at room
temperature.
6. Wash buffer B: for 500 ml, mix 41.6 ml 12× MES, 2.6 ml 5 M
NaCl, 0.5 ml 10% Tween-20 (Pierce, #28320), and 455.2 ml
H2O. Filter sterilize and store at 4°C, shield from light.
7. 2× stain buffer: for 50 ml, mix 8.35 ml 12× MES, 18.5 ml 5 M
NaCl, 0.5 ml 10% Tween-20, and 22.65 ml H2O. Filter sterilize
and store at 4°C.
8. R-phecoerythrin streptavidin (SAPE) solution: 1,200 μl each chip,
mix 600 μl 2× MES stain buffer, 48 μl 50 mg/ml BSA, 12 μl
1 mg/ml SAPE (Molecular Probes, #S866), and 540 μl ddH2O.
9. Ab solution: 600 μl each chip, 300 μl 2× MES stain buffer,
24 μl 50 mg/ml BSA (Invitrogen, #15561-020), 6 μl 10 mg/ml
normal Goat IgG (Sigma, #I5256), 3.6 μl 0.5 mg/ml biotiny-
lated anti-streptavidin (Vector Laboratories, #BA-0500), and
266.4 μl H2O.
10. Affymetrix Fluidics Station 450.
11. GeneChip Scanner 3000 7G.
2.6. Solexa Sample 1. The Illumina ChIP-seq sample preparation kit (#IP-102-1001)
Preparation provides all reagents needed. However, all reagents with the
exception of adaptor and PCR primers for enrichment of
adaptor ligated DNA fragments, both of which should be
ordered as Genomic DNA Sample Prep Oligo Only Kit from
Illumina (#FC-102-1003), can be purchased individually or as
a kit, e.g., the NEBNext DNA Sample Prep Reagent Set 1
(#E600S or E6000L) from NEB, or from other sources (in
particular, the ligase from enzymatics has been recommended
based on a previous study (18)).
2. SYBR gold (Invitrogen, #S-11494).

3. Blue-light transilluminator (Invitrogen).
4. QIAquick PCR purification kit (Qiagen, #28104), MinElute
PCR Purification Kit (Qiagen, #28004), MinElute Gel Extraction
Kit (Qiagen, #28604).
5. Q_PCR primers: Illu-F, AGCAGAAGACGGCATACGAGCT
CTTCCGATC, Illu-R, AATGATACGGCGACCACCGAGAT
CTACACTC.
6. ABI Power SYBR green PCR master mix, (#4367659).
3. Method
3.1. Embryo Collection 1. Maintain flies in large population cages in a chamber or incubator
and Fixation set at the proper temperature, humidity, and light cycle (see
Note 2). For Drosophila melanogaster, we use 25°C and 50%
humidity with a 14 h on, 10 h off light cycle.
2. On the day of embryo collection, the old molasses/yeast plates
are replaced with fresh new plates covered with yeast, which is
repeated twice for 1 h each to clear away the aged embryos
retained by the mother flies.
3. For embryo collection, a molasses plate streaked lightly with
yeast paste is placed in each cage for a certain time, usually 1 h.
4. Remove the plates with embryos and set them aside in the
incubation chamber to let the embryos to age to the desired
developmental stage.
5. Harvest the embryos on double Nitex mesh, with a coarse
mesh on top to remove dead crushed adult flies, and a bottom
fine mesh to retain embryos.
6. Wash away yeast, transfer embryos to a beaker containing 50%
bleach, mix. Dechorionate the embryos for 2 min, then pour
embryos back to the lower layer mesh, and rinse extensively.
7. Transfer embryos to a cup with mesh on the bottom, dry the
embryos by placing paper towels beneath the mesh. Completely
immerse the embryos in isopropanol in a beaker and disperse
embryos well by using a narrow metal spatula. Remove cup
and dry embryos quickly with paper towels beneath the mesh.
8. Transfer embryos to a 50-ml falcon tube and add 10 ml form-
aldehyde/hexane fixing solution per gram of embryo. Shake
briefly, and rotate for 5 min at room temperature. Allow the
embryos to settle, and pour off the fixative to a hazardous
waste bottle.
9. Add embryo washing buffer to the embryos (use >10 ml per
gram of embryos), shake vigorously, and then rotate at room
temp for 5 min. Pour onto a cup with mesh on the bottom to
drain the buffer. Transfer the embryos to a new tube and repeat
the wash with fresh buffer. Embryos should clump at first but
then eventually become monodispersed.
10. Dry embryos and transfer them to plastic tubes. Flash freeze
embryos in liquid nitrogen and store at −80°C.
3.2. Chromatin The amount of embryos used to set up each gradient, and the
Purification amount of chromatin obtained depend on the age of the embryos
and Sonication used. In the procedure described below, usually 5–7 g embryos at
stage 5 are used for each gradient, and an SW28 rotor is used for
3.2.1. Chromatin
ultracentrifugation (see Note 3). About 3 ml of purified chromatin
Purification
at concentration of 75 μg/ml is obtained. For older embryos,
adjust the amount of embryos according to their developmental
stage (e.g., 4 g for stage 10 or 11, and 2.5 g for stage 14).
1. Thaw the frozen embryos, add 35 ml of cold embryo
homogenization buffer + 0.5 mM DTT + 1 mM PMSF. Shake
hard to break the clumps. Immediately transfer to a 40-ml glass
dounce tube.
2. Dounce the embryos at 8,000 rpm for one stroke and two
strokes at 7,000 rpm using a motor – drive homogenizer
system (see Note 4).
3. Transfer to a 40 ml hand-held glass dounce and homogenize
using five strokes with an A size pestle.
4. Pour into an SS34 tube and add 0.5 ml 20% Triton X-100 to a
final concentration of 0.3%. Rock for 10 min at room temperature.
This step removes remaining cell membranes, leaving largely
nuclei suspended in cytosol and egg yolk. Spin down nuclei at
4,000 rpm (1,251 ´ g) for 15 min in an SS34 rotor at 4°C.
5. Pour off supernatant and add 5 ml nuclear lysis buffer.
Resuspend pellet by pipetting up and down a few times.
6. Transfer to a small dounce and completely homogenize by ten
strokes using a B size pestle.
7. Transfer homogenate to a 15-ml falcon tube, sonicate 20 s at
low output setting using a Branson sonifier 450, or a Bioruptor,
to partially fragment chromatin. This sonication step is not to
reduce the chromatin fragment to sizes desired for ChIP, but
rather to decrease viscosity of the sample. The DNA should be
>20 kb is size after this step. Several samples may be combined
at this step, with the sonication time increased accordingly.
8. Transfer to a clean SS34 tube. Add 1.8 ml 20% SDS (to final
concentration of 3%) and quickly vortex.
9. Add 1.2 ml 20% N-lauroylsarcosine and 1.2 ml 20% Triton
X-100. Incubate on a rotator at room temperature for 10 min.
10. Spin at 4,000 rpm (1,251 ´ g) for 10 min in an SS34 rotor. Transfer
the cleared lysate to a new tube. Avoid the lipid layer on top that
sometimes is present and the pellet, which may be loose.
11. Set up CsCl gradients by gently layering 8.5 ml of each of the
three CsCl solution on top of one another in the order of 1.5,
1.4, and 1.3 g/ml. Finish by layering the nuclear lysate on top
of the gradient.
12. Carry out ultracentrifugation in an SW28 rotor at 121,569 × g
(26,000 rpm) for 40 h at 20°C.
13. After centrifugation, remove tubes and secure each with a
clamp. Locate the chromatin, which usually does not form a
uniform layer, but rather is fibrous and clumpy and differs from
a band located about 0.5–1 cm above it that is more whitish.
Gently insert an 18 1/2 gauge needle attached to a 5-ml
syringe 0.5–1 cm below the chromatin band. Slowly pull the
plunger and until all the chromatin is drawn into the syringe,
yielding about 3 ml of chromatin for each gradient.
14. Dialyze the chromatin sample in a medium Spec 2 dialysis bag
against dialysis buffer at a volume that is >100× the volume of
the chromatin sample at 4°C for a total of 6 h, with two buffer
changes during this time.
15. Recover the chromatin, which is partly insoluble at this stage
but will go completely into solution after sonication. Flash
freeze and store at −80°C.
3.2.2. Chromatin Prior to being used for ChIP reactions, the chromatin needs to be
Sonication fragmented to the desired size range by sonication. For our ChIP-
chip experiment, we use a Branson sonifier 450. With this system,
we usually sonicate 5 ml of chromatin at a time in a 15-ml falcon
tube placed in an ice/water bath. With the power output set at 2.5,
we carry out six cycles of sonication with 30 s on and 3 min off for
each cycle, which produces chromatin fragments averaging about
500 bp, suitable for ChIP-chip. For ChIP-seq, we routinely use a
Bioruptor, which can produce short fragments, ranging from 100
to 300 bp. Below is the detailed procedure for chromatin fragmen-
tation using bioruptor.
1. First add N-lauroylsarcosine to 0.5%.
2. Aliquot 200–300 μl chromatin samples into 1.5-ml TPX hard
plastic tubes (see Note 5).
3. Put samples in the Bioruptor. During sonication, the samples
need to be kept cold. This is done by using a cold water circu-
lation system attached to the bioruptor. Alternatively, it can be
done by adding ice to the water bath, which needs to be replaced
periodically, e.g., every 10 min. Adjust the amount of ice added
so that at the end of each 10 min there is still small amount of
ice remaining.
a c d
e
500
400
300
200
100
b Input T
ti-G
M IgG An
Fig. 3. Expected results at each step of the ChIP-seq procedure. (a) DNA isolated from sonicated chromatin. (b) PCR results for
the ChIP and IgG control IP samples along with samples from serial dilution of input DNA. (c) DNA obtained following Solexa
ChIP DNA sample preparation, arrow points to adaptor dimer by-products. (d) The amplification curve and dissociation curve
from a Q_PCR analysis of a Solexa DNA library sample, a peak pointed to by an arrow corresponds to primer–dimer. (e) The
electrophoregram of a library sample from an analysis on a Bioanalyzer, again, the arrow indicates the adaptor dimer.
4. Set Bioruptor intensity to H and the on/off cycle to 15 s

ON/45 s OFF.
5. The process time should be determined empirically, but it is
very reproducible for the same type of sample once a condition
is found. For ChIP-seq, 100 min will produce fragments
averaging 200–300 bp, or 140 min total processing time can
produce fragments averaging less than 200 bp. Mix the samples
after every two rounds (10 min) of sonication in the early stages
of sonication.
6. To check the resulting DNA fragment size range and estimate
chromatin DNA concentration: first take a 50 μl of sonicated
chromatin, add 50 μl of TE and 1 μl 5 M NaCl, and incubate
at 65°C overnight to reverse cross-links. Next morning, add
2 μl 0.5 mg/ml RNase and incubate at 37°C for 30 min. Then,
add 2.5 μl 20% SDS and 2 μl of 20 mg/ml proteinase K and
incubate at 55°C for 2 h. Purify the DNA using a Qiagen
QIAquick PCR purification kit. Measure the DNA concentra-
tion by nanodrop, and run a 1.5% agarose gel to check the
DNA fragment size distribution. Figure 3a shows the fragment
size distribution of DNA purified from chromatin subjected to
14 × 10 min cycles of sonication.
3.3. Chromatin We use about 50 μg (based on DNA concentration determined as

Immunoprecipitation described above) chromatin for each immunoprecipitation reaction
(ChIP) (see Note 6). Following ChIP, we use PCR to check enrich-
ment of a DNA region known to be bound by the factor being
studied, as described at the end of this section. If no target is known

for certain, carry out a positive control IP using an antibody for
another factor.
1. Transfer the chromatin needed for ChIP reactions to a 1.5-ml
microcentrifuge tube (or multiple tubes if a larger volume
of chromatin is needed). Spin the chromatin solution in a
microcentrifuge at full speed for 15 min at 4°C. Transfer the
chromatin solution to a new microcentrifuge tube. Discard the
30 μl or so of solution at the bottom of tube.
2. Add 5 × IP buffer at ¼ the volume of chromatin.
3. Add 7.5 μl of normal rabbit IgG per 50 μg chromatin. Incubate
30 min on ice.
4. During incubation, prepare protein-A sephacryl beads. Take
15 μl (packed beads volume) beads per 50 μg chromatin, wash
beads twice with IP buffer, and after the washing is finished,
remove buffer and leave just the beads in the tube.
5. Transfer the chromatin sample to a microcentrifuge tube con-
taining protein-A sephacryl-1000 beads. Rotate 1 h at 4°C.
6. Spin in a microcentrifuge at 4,000 rpm (1,500 ´ g) for 2 min
and then at full speed for 15 min. Transfer the precleared chro-
matin solution to a new microcentrifuge tube or to a 15-ml fal-
con tube if a relatively large volume of chromatin is used.
7. Dilute chromatin to 1.2 ml per 50 μg DNA with IP buffer, add
4 μl 50 mg/ml BSA for each 1 ml of diluted chromatin, and
add PMSF to 1 mM. Save 24 μl of the chromatin solution as
input sample (representing 2% of total input DNA).
8. For each factor IP or IgG control IP sample, use 1,200 μl of the
diluted chromatin. For factor IP samples, add 1–3 μg of puri-
fied polyclonal antibody, or appropriate amount of monoclonal
antibody. For IgG control IPs, add an equivalent amount of
normal rabbit IgG. Incubate the samples on ice for 3 h or over-
night at 4°C.
9. Transfer protein-A sephacryl-1000 beads to a microcentrifuge
tube, 10 μl (packed beads volume) for each sample. Wash beads
twice with 1 ml IP buffer + 200 μg/ml BSA. Resuspend beads
in IP buffer with BSA at a volume of 100 μl for each 10 μl beads.
10. Spin the samples in a microcentrifuge at full speed for 15 min
at 4°C. Transfer supernatant to tubes containing 100 μl of the
protein A-sephacryl suspension.
11. Rotate 30 min at 4°C.
12. Pellet the beads by spinning in a microcentrifuge at 4,000 rpm
for 1 min. Discard the supernatant.
13. Resuspend beads in 1.4 ml IP buffer, transfer to a new tube,
rotate at room temperature for 15 min. Pellet beads, discard
supernatant – this is the first wash.
14. Carry out the following consecutive washes at room temperature

similar to step 13 (except no change of tube): one wash in IP
buffer for 15 min, two washes in 0.5 M IP wash buffer for
20 min each, one wash in LiCl wash buffer for 20 min, and
finally one wash in TE for 15 min.
15. Resuspend the pellet in 1 ml TE, transfer to a new tube, and
spin down the beads. Discard the supernatant. Remove the
remaining buffer in the beads with a 30 gauge ½ in. needle
attached to a 1-ml syringe.
16. Add 100 μl TE + 2 μg RNase A and incubate at 37°C for
30 min. Resuspend the beads in middle of incubation once.
For each input sample, add 80 μl TE and 2 μg RNase A.
17. Add 50 μl of 10 mM Tris–Cl pH 8.0, 2 mM EDTA, 300 mM
NaCl and 1.5% SDS, and 40 μg of proteinase K.
18. Incubate all of the samples at 55°C, overnight.
19. Spin down and transfer the supernatant to a new tube.
20. Add 150 μl TE to the beads, resuspend, and spin again.
Combine with the supernatant from the previous step.
21. Reverse cross-linking by incubating at 65°C for 6 h.
22. Add 30 μl 3 M sodium acetate and 20 μg glycogen to each
sample.
23. Extract once with phenol: chloroform, once with chloroform.
24. Add 2.5 volume ethanol, mix. Leave at −80°C for 4 h or more.
25. Spin in a microcentrifuge at full speed for 20 min.
26. Wash with 75% ethanol twice.
27. Remove as much ethanol as possible after the last wash.
28. Air dry the DNA pellet at room temperature ~10 min.
29. Resuspend in TE (10:0.1): 20 μl for IP samples and 40 μl for
input DNA samples. The samples are now ready to be analyzed
by PCR or processed for chip or seq analysis.
30. Use PCR to check whether the IP worked. We set up PCR
reactions that each contain 1 μl of 5×, 25×, 125×, or 625×
diluted input DNA as standards, or 1 μl of the IP or IgG con-
trol IP samples. The number of PCR cycles should be adjusted
so that the signals for the input samples are proportional to the
dilutions used, instead of being saturated. An enrichment of a
minimum 10 to more than a 100-fold, based on comparison of
the signals between the IgG control IP and factor IP samples,
is expected. Figure 3b shows an example of IP results.
3.4. DNA Amplification For ChIP-chip, the DNA samples from the ChIP experiment (factor
and Labeling IP, IgG IP, and input) are amplified, labeled, and hybridized to an
for ChIP-Chip affymetrix tiling array. We have modified a commonly used random
prime-based amplification method to improve the efficiency and
reproducibility, particularly when small amounts of genomic DNA

are used. The modifications include: (1) modification of the primer
sequence to avoid primer–dimer formation, (2) 15× higher concentra-
tion of primer A, and a different purification procedure following
random priming, (3) using higher sequenase concentration, (4) more
random priming cycles (4 vs. 2), (5) changes in PCR conditions
and other adjustments. With this protocol, highly reproducible
amplification can be obtained even when as little as 0.5 ng of Drosophila
whole genomic DNA is used, with correlation coefficients between
duplicates ranging from 0.85 to 0.95 for all types of samples,
including input, mock IP, and factor IP samples. Other commonly
used methods include linker mediated PCR (5) and WGA (19).
The amount of input DNA used for amplification is about
20 ng, which is higher than those present in the ChIP or mock IP
samples. This provides the best way to control for potentially
intrinsic differences in the efficiency of amplification of different
parts of the genome. We find, however, that the amplification of IgG
control IP and factor IP samples are almost equally consistent.
3.4.1. ChIP-DNA 1. Set up the first round reaction with a total volume of 18.5 μl as
Amplification (see Note 7) follows: 10.5 μl DNA (from factor IP, IgG control IP, or 2 ng/μl
input) , 4 μl 5× sequenase buffer, 4 μl 200 μM primer A.
2. Prepare dNTP solution by mixing (for each reaction): 0.1 μl
20 mg/ml BSA, 1 μl 0.1 M DTT, 0.5 μl 25 mM dNTPs.
3. Dilute sequenase by mixing each 1 μl with 6 μl of sequenase
dilution buffer.
4. Set up the following program that consists of four cycles each
containing the following three segments on a thermocycler
(typically a Perkin Elmer 9600 or 9700): (1) 95°C 4 min, (2) 10°C
5 min, (3) 37°C hold for 8 min. Set the ramp rate such that
it takes about 10 min to ramp from 10°C from the previous
step to 37°C.
5. Put the samples in the thermocycler. Start the reactions.
6. During each cycle, after the 4 min incubation at 94°C, pause
the program, transfer the samples to ice, close the lid, and
resume the program.
7. After the temperature reaches 10°C, transfer the samples back
to the thermocycler, and add 1.6 μl dNTP mix (only for the
first of the four random priming cycles) and 1 μl of 6× diluted
sequenase (USB Corp). Make sure to add the solutions to all
samples within the 5 min incubation time. Close thermocycler.
8. Repeat steps 6 and 7 till all four random-prime synthesis cycles
are complete.
9. Purify the DNA as follows to remove the primers: take an
Amersham microspin S-300 HR column; remove the buffer
from the column by spinning at 3,000 rpm (735 ´ g) for 1 min
in a microcentrifuge; add 20 μl of TE to each random-primed sample;

load on top of the column; spin for 2 min; and save the flow
through. Take a second Amersham microspin S-300 HR col-
umn; spin 1 min to remove buffer in column; reequilibrate the
column by adding 300 μl of 10 mM Tris–Cl, pH 8.5, fol-
lowed by a 1 min centrifugation; load the flow-through saved
from the first column; spin 2 min. The purified DNA is ready
for PCR amplification.
10. Set up PCR reaction with a total volume of 100 μl: 35 μl of the
DNA sample from the first round (see Note 8), 10 μl 10× PCR
buffer, 3 μl 25 mM MgCl2, 1.5 μl 25 mM dNTPs, 4 μl 100 μM
Primer B, 44.5 μl H2O, 2 μl 5 U/μl Taq 2000.
11. Carry out PCR as follows: 15 cycles of: 95°C for 30 s, 45°C
for 30 s, 55°C for 30 s, and 72°C for 1 min; then 15–20 cycles
of 95°C for 30 s, 45°C for 30 s, 55°C for 30 s, and 72°C
for 1 min.
12. Purify the amplified DNA using a Qiagen QIAquick PCR
purification kit. Elute DNA using 35 μl H2O. Check DNA
concentration by measuring OD260. Up to 12 μg of DNA can
be obtained for each sample.
13. Run an aliquot of the amplified sample on a gel. The size range
should be somewhat smaller than the starting material (use
input DNA as a reference) to reflect efficient random-prime
amplification.
3.4.2. DNA Fragmentation, 1. Dilute DNase I (1 U/μl; Epicentre) 15× into 1× One-Phor-All
Labeling buffer (Roche).
2. Set up reactions as follows: mix 2.5 μg amplified DNA, 3.28 μl
10× One-Phor-All buffer, 2.2 μl diluted DNase I, and ddH2O
to total volume of 35 μl.
3. Incubate for 5 min at 37°C.
4. Inactivate DNase I at 99°C for 10 min, then place on ice.
5. Check 10% of the reaction by running it on a 1.5% agarose gel.
The bulk of DNA should be 50–100 bp.
3.4.3. TdT Labeling 1. Set up a 50 μl reaction by mixing 31.2 μl DNase I treated

DNA, 10 μl 5× TdT buffer, 5 μl 25 mM CoCl2, 3.6 μl 1 mM
biotin-ddATP, 0.18 μl TdTase (Roche).
2. Incubate at 37°C for 2 h.
3.5. Hybridization to We use the Affymetrix Drosophila genomic DNA tiling array.
Genomic DNA Tiling All the hybridization to chip, chip washing and staining, as well
Array and Scanning as scanning are performed according to the manufacturer’s recom-
mendation. Consult the manufacturer if different versions of the
instruments are used.
3.5.1. Hybridization 1. Dilute 2× MES-Triton to 1×. Inject 200 μl into each chip.
2. Prehybe for ~1 h in the Affymetrix hybridization oven at
45 rpm and 45°C.
3. Mix 200 μl hybridization cocktail with 50 μl of the sample
from TdT reaction.
4. Boil sample for 10 min, transfer to a 45°C TempBlock, and
incubate for 10 min.
5. Spin in a microcentrifuge at maximum speed for 3 min.
6. Inject 200 μl of the sample into the chip.
7. Carry out the hybridization in the hybridization oven at 45 rpm
and 45°C for 18 h.
3.5.2. Washing We use an Affymetrix GeneChIP Fluidics Station 450 to process

and Staining the hybridized chips using the wash/stain-protocol EukGeWS2v4.
For details of handling the Fluidics Station, follow the manufac-
turer’s instruction.
1. Load buffer A, B, and ddH2O and prime the station following
the instructions.
2. Load the chip and the SAPE staining and antibody solution.
3. Carry out washes using the EUkGeWS2v4 protocol.
3.5.3. Scanning the Chip Scan chips using Affymetrix GeneChip scanner, following the
manufacturer’s instruction.
3.6. ChIP-Seq Sample The ChIP-seq sample preparation is carried out according to the
Preparation “Illumina protocol for sample preparation for chip-seq” with some
modifications. One major change is that the PCR amplification
step is carried out before instead of after DNA size selection. This
helps to decrease the loss of DNA complexity in the sample, which
can be an issue since the amount of DNA in the ChIP sample is
low. We have found that this modification leads to higher DNA
yield. We also keep the number of PCR amplification cycles to a
minimum to limit uneven amplification of different genomic
regions, see Note 9.
3.6.1. Perform End Repair 1. Dilute Klenow DNA polymerase 1:5 with ddH2O to a final
Klenow concentration of 1 U/μl. An excess amount of enzyme
may lead to DNA degradation when the amount of DNA
sample is low.
2. Prepare the following reaction mix with a total volume of
50 μl: 10 μl DNA sample from ChIP, mock IP, or 0.1 ng/μl
input DNA; 30 μl ddH2O; 5 μl T4 DNA ligase buffer with
10 mM ATP; 2 μl dNTP mix; 1 μl T4 DNA polymerase; 1 μl diluted
Klenow DNA polymerase; 1 μl T4 polynucleotide kinase.
3. Incubate in the thermal cycler for 30 min at 20°C.

4. Follow the instructions in the QIAquick PCR Purification Kit
to purify samples each on one QIAquick column, eluting in
34 μl of EB.
3.6.2. Add “A” Bases 1. Prepare the following reaction mix with a total volume of
to the 3 ′ End of the DNA 50 μl: 34 μl DNA from Subheading 3.6.1, 5 μl Klenow buffer,
Fragments 10 μl dATP, 1 μl Klenow exo (3′–5′ exo minus).
2. Incubate for 30 min at 37°C.
3. Follow the instructions in the MinElute PCR Purification Kit
to purify samples each on one MinElute column, eluting in
10 μl of EB.
3.6.3. Ligate Adapters 1. Dilute the adapter oligo mix 1:20 with water (see Note 9).
to DNA Fragments 2. Prepare the following reaction mix with a total volume of
30 μl: 10 μl DNA from Subheading 3.6.2, 15 μl DNA ligase
buffer, 1 μl diluted adapter oligo mix, 4 μl DNA ligase.
3. Incubate for 15 min at room temperature.
4. Follow the instructions in the MinElute PCR Purification Kit
to purify samples, each on one MinElute column, eluting in
10 μl of EB.
3.6.4. Enrich the 1. Set up the PCR reaction with total volume of 25 μl: 10 μl
Adapter-Modified DNA DNA, 7 μl ddH2O 10 μl 5× Phusion buffer, 1.5 μl dNTP mix,
Fragments by PCR 1 μl PCR primer 1.1, 1 μl PCR primer 2.1, 0.25 μl Phusion
polymerase.
2. Amplify using the following PCR protocol: 30 s at 98°C; then
12–15 cycles (see Note 10) of 10 s at 98°C, 30 s at 65°C, and
30 s at 72°C; finally 5 min at 72°C.
3.6.5. Size Select 1. Prepare a 1.5% agarose gel in 1× TAE or 0.5× TBE.
the Library 2. Load 500 ng of a 100 bp DNA ladder per lane of the gel.
3. Add loading buffer to the PCR product. Load the sample to
the gel. Leaving at least one lane empty between the 100 bp
ladders, load ladders on both sides of each sample lane. Be very
careful to avoid sample escaping from the wells which will
lead to cross-contamination. Minimize the number of samples
(maximum three) purified on each gel.
4. Run gel at 100 V for 1.5 h.
5. Stain the gel with SYBR-gold for 10 min or longer until the
DNA smear is clearly visible.
6. Place the gel over a blue-light transilluminator; the DNA ladder
and the DNA smear in the sample lanes should be easily visible.
In the sample lanes, besides the continuous DNA smear >150 bp,
there is sometimes a band of about 140 bp, which corresponds
to adaptor ligation by-products. Figure 3c shows an example

of the Solexa sample after run on a gel prior to size selection;
the 140 bp band is indicated.
7. Cut the portion of the gel containing DNA of the desired size
range, typically between 175 and 300 bp.
8. Take a photograph of the gel after the slice is excised.
9. Use a MinElute Gel Purification Kit to purify the DNA from
the agarose gel slices and elute the DNA in 10 μl EB.
3.6.6. Quantifying Accurate determination of the DNA concentration in the sequencing

the Solexa Library library is very important. Otherwise, it may lead to either too little
or too much of DNA from the library being loaded onto the
flow cell. If too little DNA is used, few clusters (see below) will be
generated and few reads will be obtained. On the other hand, if
too much DNA is loaded, it will lead to overcrowding and overlap
of images from neighboring clusters, which will also lead to too
few high-quality reads.
Several methods can be used for quantification. One option is
Nanodrop, but it can be inaccurate since the DNA concentration
in a sequencing library is usually very low (due to limited amplifica-
tion) and the measurement is further affected by residual contami-
nants from the column purification. More commonly used methods
are Q_PCR and Bioanalyzer. We found that the concentrations
measured by these two methods show a good correlation, but the
absolute values can vary significantly. Thus, it is important to com-
pare the concentrations measured to a library with known sequenc-
ing behavior that was quantified in a similar way. Here, we described
the quantification using Q_PCR. For using the Bioanalyzer, follow
the manufacturer’s instruction.
1. Prepare library standard: dilute a Solexa library that has a
known concentration and clustering behavior to the concentra-
tions of 0.01, 0.0033, 0.0011, 0.00037, and 0.00012 ng/μl.
2. Dilute each of the experimental Solexa library samples by 200×,
1,000×, and 5,000× to ensure that at least one of the diluted
samples has the amount of DNA within the standard range.
3. Set up reactions: to each well in a 96-well optical PCR plate,
pipet 2 μl of library standard or diluted library samples, 2 μl
Q_PCR primers (1 μM each), 6 μl ddH2O, and 10 μl ABI
Power SYBR Green PCR Master Mix.
4. Perform Q_PCR, on a Stratagene Mx3000p instrument, using
the following parameters: 95°C for 10 min; 40 cycles of 95°C
for 15 s, 65°C for 1 min, and 72°C for 30 s. Also, add a dissocia-
tion segment to the end of program.
5. Analyze the results using software associated with the Q_PCR
machine to determine the concentration of the library samples.
6. Carry out dissociation curve analysis. There should be only

one major peak in the middle of curve (Tm 77°C). Sometimes,
a secondary curve with higher Tm 81°C is also observed. This
secondary peak corresponds to the adaptor dimer. The adaptor
dimer contamination is usually not an issue. If necessary, repu-
rified the sample by agarose gel size selection.
7. Expected results: Fig. 3d shows the amplification curve for a
Solexa sample along with the standards, and the bottom panels
shows the dissociation curve, the arrow shows position of the
adaptor dimer. In Fig. 3e, the electrophoregram of the sample
after analyzed on a Bioanalyzer is also shown, and the minor
contamination of the adaptor dimer is indicated by arrow. With
15 cycles of enrichment PCR, the DNA library is expected to
have a concentration of up to 50 nM.
3.6.7. Sequencing The sequencing step is usually carried out by a core facility. Consult
of ChIP-Seq Samples with the person in charge of the sequencing about the amount
sample to use. Based on standard sequencing protocols, 1 μl of a
20 nM library is sufficient. The details about the technology and
work flow can be found from the Illumina company website.
Briefly, sequencing a DNA library can be divided in two main steps.
The first is cluster generation on a cluster station. At this step, clusters
of DNA are generated on the surface of a flow cell through a clonal
bridge amplification technology from each molecule in the library.
The next sequencing step is performed on a Solexa Genome Analyzer.
The sequencing process involves rounds of synthesis with the DNA
molecules in the clusters as template and fluorophor-dNTPs
as substrates. In each round of this sequence though synthesis
process, the incorporation of each of the four bases coupled with a
distinct fluorescence dye is captured by an imaging system, which
is followed by the cleavage release of the fluorescence dye before a
new round of sequencing is performed. The stacks of cluster images
thus produced represent the raw data, which, after the sequencing
process is finished, are processed by a suite of software, producing
the actual sequence reads.
3.7. Data Analysis We use the program, TiMAT, developed by BDTNP, for our ChIP-
chip data analysis (see ref. 15 for details). The data analysis includes
3.7.1. ChIP-Chip Data
the following main steps: (1) The complete set of six arrays from
Analysis
an experiment (Factor IP replicates, IgG control IP replicates, and
input DNA replicates) are scaled to a common median value and
then quantile normalized against each other; (2) Replicates are
averaged and log (base 2) ratio scores are calculated for Factor IP
and IgG control IP arrays: log2 (mean Factor IP/mean input DNA)
and log2 (mean IgG control IP/mean input DNA). These scores
are then smoothed using a sliding 675 bp window of trimmed
means; (3) False discovery rate (FDR) estimates are calculated by two
methods: a symmetric null distribution method, and IgG control
IP method; (4) Bound regions are then defined by collecting all

windows with scores above the given FDR threshold into contiguous
stretches of windows; (5) identify the primary peak for each bound
region – the window having maximum intensity. Results from
TiMAT, including oligonucleotide probe intensities, trimmed-
mean window scores, bound region locations, peak magnitudes
and locations, and nearby genes are reported in .sgr and .gff file
formats as well as in TiMAT’s own text-based report files.
The probe intensity profile or the window score profile for the
whole genome or just the bound regions in .sgr format can be
visualized using Affymetrix Integrated Genome Browser. It can
also be converted to wig file for UCSC genome browser. Figure 2
shows the window score profiles at the eve gene locus for IPs using
two different antibodies that recognize the transcription factor HB
and also for the IgG control IP. The bound regions identified by
TiMAT are marked underneath the profiles.
3.7.2. ChIP-Seq Data The first step of ChIP-seq data analysis is to align the reads to the
Analysis genome. This can be done using ELAND as part of the Illumina
Analysis Pipeline which also includes cluster image processing and
base calling, or using one of the several other programs, such as
MAQ (20), Bowtie (21), etc. From the aligned reads, a tag-density
profile can be generated by extending the short sequence tags by
the average length of the DNA fragments in the library. The resulting
files, in .sgr or wig format, can be viewed with a genome browser
as described above. To identify the bound regions, a range of pub-
lished software are available, among more recently released ones
are CisGenome (22), Peakseq (23), SISSRs (24), MACS (25),
GLITR (26), and Sole-Search (27). These programs usually use a
local background model and at least one control (usually the input
DNA) to calculate the statistical significance of each enriched peak,
and/or determine FDRs.
In our studies (17), first we aligned the reads to the genome
using bowtie. We used MACS (25) for peak finding. The output
from MACS is a BED file containing a list of identified peak regions
and an Excel file containing several types of information about
the bound regions. The regions can be sorted based on the
number of sequence tags in the identified regions, the fold enrich-
ment, or FDR.
Figure 2 shows the tag-density profile around the eve gene
for two IPs using different hunchback (HB) antibodies, and the
input DNA sample. The enriched regions identified by MACS
at 5% FDR are marked by horizontal bars underneath the tag-
density tracks. A comparison with ChIP-chip results in Fig. 2 shows
how ChIP-seq excels in resolution (and we note higher resolution
can be achieved by selecting even smaller fragments for sequencing).
Nevertheless, the bound regions identified by the two methods
are highly correlated.
3.8. Expected Results As shown in Fig. 2, the ChIP-chip and ChIP-seq results from our
studies show strong enrichment at strongly bound regions and
low background noise, which allows detection of not only the
strong, but also fairly low levels of binding. The results are highly
reproducible between biological replicate or between IPs using
different antibodies. In our studies, the enrichment of known
transcription factor targets in the ChIP step often exceeds 100-
fold (see Note 11). For ChIP-chip, our optimization of the DNA
amplification step significantly reduced the data noise, which leads
to very high detection sensitivity of binding. As shown previously,
we were able to detect >90% of the regions enriched by threefold
at 1% FDR cutoff in a BAC spike-in experiment carried out based
on our standard DNA amplification and hybridization procedure
in the ChIP-chip protocol (15).
In our ChIP-chip and ChIP-seq studies, we found that the
transcription factors often bind over a quantitative continuum to
thousands of regions throughout the genome (15–17), in support
of the widespread binding observed in our early studies (28). Such
widespread binding has increasingly been seen by others and
appears to be a common phenomenon for transcription factor
binding in animal cells. In addition, we found that biochemically
and functionally unrelated factors bind to highly overlapping sets
of regions (15–17, 28). This widespread and highly overlapping
binding is unlikely to be driven primarily by function. Instead, our
analysis showed while the most highly bound regions are much
more likely to be functional, many thousands of weakly bound
regions are mostly likely nonfunctional (15–17, 28), and for each
cis-regulatory element, where many factors bind, combinatorial
regulatory output is determined by the relative levels of occupancy
of each factor (16). Our more recent study indicates that wide-
spread overlapping pattern of binding may be attributed to chroma-
tin accessibility (13). In all, our studies demonstrate the importance
of interpreting the genome – wide binding data in a quantitative
manner.
4. Notes
1. We use protein A – sephacryl 1000 beads that we prepare

ourselves (15) in our ChIP reactions. We found such beads
are more efficient in IP reactions especially when chromatin
fragments in the IP reactions are relatively large.
2. Maintaining flies health under proper conditions makes a big
difference in minimizing egg retention and larvae contami-
nation, and increases embryo yield. A cage containing about
100 ml flies can lay between 0.5 and 0.7 g embryos in 1 h.
3. For samples from fewer embryos (as little as 0.1 g embryo has
been used successfully), use a SW41 rotor. In this case, reduce
the amounts of all reagents, including buffers, detergents, and
CsCl solution, as well as sonication time for the lysate, by three
times compared to that described for an SW28 rotor. In addition,
carry out the ultracentrifugation at 234,116 × g (37,000 rpm)
for 24 h.
4. If no motor-drive available, go to next step, dounce the
embryos a few more times while carrying out the homogeniza-
tion using A pestle.
5. It is important to keep the volumes of different samples the
same to achieve similar extent of sonication. In addition, sonica-
tion is more efficient and smaller fragment size can be achieved
by carrying out the sonication in small volumes in a 1.5-ml
tube than carrying out the sonication in a larger volume in a
15-ml plastic tube.
6. Good ChIP results have been obtained with ten times less
chromatin (in this case, use low retention microcentrifuge tubes),
but will likely produce noisier data in ChIP-chip and ChIP-seq.
7. The efficiency of random prime amplification methods is
dependent on the average length of the DNA fragments in the
sample. The method works well for ChIP-chip samples that
contain DNA fragments averaging more than 500 bp. With
DNA fragments <300 bp, the results become less reproducible.
For the procedure described here, make sure to pipette
accurately and use P2 pipettor for small volumes. If the ampli-
fication goes well, the amplification products will be smaller in
size compared to starting material, as expected for frequent
internal random-priming.
8. It is important not to use more than 35 μl for each 100 μl reac-
tion; the residual amount of primer A remaining can inhibit
the PCR reaction.
9. Diluting the adaptor is important to avoid or at least reduce an
adaptor dimer ligation artifact. A 10–50× dilution is often rec-
ommended, but we have found that a dilution of 50× may lead
to low yield of ligation products and lower reproducibility.
10. Based on the amount of chromatin we usually use (50 μg in
each ChIP), 12 cycles produce just enough DNA to be sequenced
if the standard Illumina presequencing sample preparation
procedure is followed. Adjust the cycle number based on the
amount of starting material or determine the cycle numbers
empirically. The goal is to minimize the number of cycles as
each cycle increases the amount of experimental noise.
11. The 100× enrichment was based on PCR, or the peak height
in ChIP-seq. In ChIP-chip, the corresponding enrichment is
about tenfold, which was seen for most factors in our ChIP-
chip analysis (16).
References
1. Biggin MD, Tjian R (2001) Transcriptional of Drosophila transcription factor binding.

regulation in Drosophila: the post-genome chal- Genome Biology. 12, R34.
lenge. Funct Integr Genomics. 1, 223–234. 14. Kaplan, T., Li, X.-Y., Sabo, P.J., Thomas, S.,
2. Gilmour, D. S., Rougvie, A. E., and Lis, J. T. Stamatoyannopoulos, J.A., Biggin, M.D. , and
(1991) Protein-DNA cross-linking as a means Eisen, M.B. (2011) Predicting the Landscape of
to determine the distribution of proteins on Transcription Factor Binding During Early
DNA in vivo. Meth. Cell Biol. 35, 369–381. Drosophila Development. PLoS Genet. 7,
3. Carr, A. and Biggin, M.D. (1999) An in vivo e1001290.
UV crosslinking assay that detects DNA bind- 15. Li, X.-Y., Macarthur, S., Bourgon, R., Nix, D.,
ing by sequence-specific transcription factors. Pollard, D.A., et al. (2008) Transcription
Methods Mol Biol. 119, 497–508. Factors Bind Thousands of Active and Inactive
4. Orlando, V. (2000) Mapping chromosomal Regions in the Drosophila Blastoderm. Plos
proteins in vivo by formaldehyde-crosslinked- Biol. 6, e27.
chromatin immunoprecipitation, Trends 16. Macarthur, S., Li, X.-Y., Li, J., Brown, J.B.,
Biochem. Sci. 25, 99–104. Chu, H.C., et al. (2009) Developmental roles
5. Ren, B., Robert, F., Wyrick, J.J., Aparicio, O., of 21 Drosophila transcription factors are deter-
Jennings, E.G., Simon, I., Zeitlinger, J., mined by quantitative differences in binding to
Schreiber, J., Hannett, N., Kanin, E., Volkert, an overlapping set of thousands of genomic
T.L., Wilson, C.J., Bell, S.P., and Young, R.A. regions. Genome Biol. 10, R80.
(2000) Genome-wide location and function of 17. Bradley, R.K., Li, X.-Y., Trapnell, C., Davidson,
DNA binding proteins. Science 290, 2306–9. S., Pachter, L., et al. (2010) Binding site turn-
6. Iyer, V.R., Horak, C.E., Scafe, C.S., Botstein, over produces pervasive quantitative changes
D., Snyder, M., et al. (2001) Genomic binding in transcription factor binding between closely
sites of the yeast cell-cycle transcription factors related Drosophila species. Plos Biol. 8,
SBF and MBF. Nature 409, 533–538. e1000343.
7. Metzker, M.L. (2010) Sequencing technolo- 18. Quail, M.A., Kozarewa, I., Smith, F., Scally, A.,
gies — the next generation. Nature Reviews Stephens, P.J. et al., (2008) A large genome
Genetics 11, 31–46. center’s improvements to the Illumina sequenc-
8. Johnson, D.S., Mortazavi, A., Myers, R.M.,and ing system, Nat. Methods 5, 1005–1010.
Wold, B. (2007) Genome-wide mapping of 19. O’Geen, H., Nicolet, C.M., Blahnik, K., Green,
in vivo protein–DNA interactions. Science 316, R., Farnham, P.J. (2006) Comparison of sam-
1497–1502. ple preparation methods for ChIP-chip assays.
9. Barski, A., Cuddapah, S., Cui, K., Roh, T.Y., Biotechniques 41, 577–80.
D.E. Schones et al., (2007) High-resolution 20. Li, H., Ruan, J. & Durbin, R. (2008) Mapping
profiling of histone methylations in the human short DNA sequencing reads and calling vari-
genome, Cell 129, 823–837. ants using mapping quality scores. Genome Res.
10. Robertson, G., Hirst, M., Bainbridge, M., 18, 1851–1858.
Bilenky, M., Zhao Y. et al. (2007) Genome- 21. Langmead B, Trapnell C, Pop M, Salzberg SL.
wide profiles of STAT1 DNA association using (2009) Ultrafast and memory-efficient align-
chromatin immunoprecipitation and massively ment of short DNA sequences to the human
parallel sequencing, Nat. Methods 4, genome. Genome Biol. 10, R25.
651–657. 22. Ji, H., Jian, H., Ma., W., Johnson, D.S., Myers,
11. Toth, J., and Biggin, M.D. (2000) The specific- R.M., and Wong, W,H. (2008) An integrated
ity of protein-DNA crosslinking by formalde- software system for analyzing CHIP-chip and
hyde: in vitro and in drosophila embryos. ChIP-seq data. Nat. Biotechnol. 26, 1293–1300.
Nucleic Acids Res. 15, e4. 23. Rozowsky, J., Euskirchen, G., Auerbach, R.K.,
12. Auerbach, R.K., Euskirchen, G., Rozowsky, J., Zhang, Z.D., Gibson, T., Bjornson, R.,
Lamarre-Vincent, N., Moqtaderi, Z., et al. Carriero, N., Snyder, M., Gerstein, M.B.
(2009) Mapping accessible chromatin regions (2009) PeakSeq enables systematic scoring of
using Sono-Seq. Proc Natl Acad Sci USA 106, ChIP-seq experiments relative to controls. Nat
14926–14931. Biotechnol. 27, 66–75.
13. Li, X.-Y., Thomas,S., Sabo, P.J., Eisen, M.B., 24. Jothi, R., Cuddapah, S., Barski, A., Cui, K.,
Stamatoyannopoulos, J.A., and Biggin, M.D. Zhao, K. (2008) Genome-wide identification of
(2011) The role of chromatin accessibility in in vivo protein-DNA binding sites from ChIP-
directing the widespread, overlapping patterns Seq data. Nucleic Acids Res. 36, 5221–31.
25. Zhang ,Y., Liu, T., Meyer, C.A., Eeckhoute, J., C.M., Ludäscher, B., Korf, I., and Farnham,
Johnson, D.S., Bernstein, B.E., Nussbaum, C., P.J. (2010) Sole-Search: an integrated analysis
Myers, R.M., Brown, M., Li, W., et al. (2008) program for peak detection and functional
Model-based analysis of ChIP-Seq (MACS). annotation using ChIP-seq data. Nucleic Acids
Genome Biol. 9, R137. Res. 38, e13.
26. Tuteja, G., White, P., Schug, J., Kaestner, K.H.. 28. Carr. A., Biggin, M.D. (1999) A comparison of
(2009) Extracting transcription factor targets from in vivo and in vitro DNA-binding specificities
ChIP-Seq data. Nucleic Acids Res. 37, e113. suggests a new model for homeoprotein DNA
27. Blahnik, K.R., Dou, L., O’Geen, H., McPhillips, binding in Drosophila embryos. EMBO J.
T., Xu, X., Cao, A.R., Iyengar, S., Nicolet, 18,1598–608.
Chapter 2
Characterization of Complex Regulatory Networks

and Identification of Promoter Regulatory Elements
in Yeast: “In Silico” and “Wet-Lab” Approaches
Nuno P. Mira, Miguel C. Teixeira, and Isabel Sá-Correia
Abstract
Transcription is the first step in the flow of biological information from genome to proteome and its tight
regulation is a crucial checkpoint in most biological processes occurring in all living organisms. In eukaryotes,
one of the most important mechanisms of transcriptional regulation relies on the activity of transcription
factors which, upon binding to specific nucleotide motifs (consensus) present in the promoter region of
target genes, modulate the activity of RNA polymerase II activating and/or repressing gene transcription.
The identification of binding sites for these transcription factors is crucial to the understanding of
transcriptional regulation at the molecular level and to the prediction of putative target genes for each
transcription factor. However, transcription regulation cannot simply be reduced to transcription factor-
gene associations. Frequently, the transcript level of a given gene is determined by a multitude of activators
and/or repressors resulting in intertwined and complex regulatory networks. Two case studies dedicated
to the study of transcriptional regulation in the experimental model Saccharomyces cerevisiae are presented
in this chapter. The computational tools available in YEASTRACT information system are explored in both
studies, to identify the regulatory elements that serve as functional DNA-binding sites for a transcription
factor (Rim101p), and to characterize the regulatory network underlying the transcriptional regulation
of a given yeast gene (FLR1). A set of easily accessible experimental approaches that can be used to confirm
the predictions of the bioinformatic analysis is also detailed.
Key words: Transcriptional regulation, Transcription factors, cis-Regulatory elements, Transcriptional

regulatory network, Bioinformatics, Saccharomyces cerevisiae, YEASTRACT
Ales Vancura (ed.), Transcriptional Regulation: Methods and Protocols, Methods in Molecular Biology, vol. 809,
DOI 10.1007/978-1-61779-376-9_2, © Springer Science+Business Media, LLC 2012
27
28 N.P. Mira et al.
1. Introduction
1.1. Identification In this era of postgenomic research in the model eukaryote

of the Rim101p- Saccharomyces cerevisiae, the identification of the genes regulated
Binding Site: In silico by a given transcription factor is being performed mostly at a
analysis of the genome-wide scale; for example, by comparing the transcriptomes
promoter region of of a parental strain and a deletion mutant lacking the transcription
Rim101p-regulated factor under study. Often, this approach leads to the identification
genes of hundreds of putative, direct or indirect, target genes. With such
a vast initial dataset it is difficult, if not impossible, to extract
common regulatory elements within the promoter region of the
co-regulated genes without the use of appropriate computational
tools. Several algorithms, usually called “DNA motif finders”, were
developed to search the promoter region of co-regulated genes
for overrepresented nucleotide sequences (e.g., AlignAce, http://
www.psc.edu/general/software/packages/alignace/; MEME,
http://meme.nbcr.net/meme4_4_0/intro.html – among many
others) (1, 2). The success of these algorithms in identifying
functional binding sites is, however, limited by the fact that the
comparison of genome-wide expression in wild-type versus tran-
scription factor deletion mutant cells provides direct and indirect
target genes, which means that part of the genes used as an input
dataset to the algorithm may not contain the binding site of inter-
est in their promoter. Another problem is that transcription fac-
tors frequently do not bind to a single nucleotide sequence but,
instead, they recognize a set of related (degenerated) sequences. The
binding of a given transcription factor to its recognition sequence
is also known to be largely influenced by environmental condi-
tions; it is possible that a DNA-binding site that is functional under
a specific condition is nonfunctional when the cells are under a dif-
ferent condition (3, 4).
The first example described in this chapter aims at demon-
strating how the computational tools available in the YEASTRACT
information system (5, 6), in particular the MUSA algorithm, can
be used to analyze results from genomic expression analysis and
extract a putative-binding site for the yeast transcription factor
Rim101p. YEASTRACT is a database in which all the docu-
mented regulatory associations between yeast transcription fac-
tors and their target genes as well as between transcription
factors and their DNA-binding sites have been gathered. This
congregation of information turns YEASTRACT into a powerful
and unique tool for the study of transcriptional regulation in
S. cerevisiae.
Rim101p is the final effector of a signaling pathway well
conserved among fungi whose physiological function was first
associated with adaptation and resistance to alkaline pH conditions
(7). In S. cerevisiae, Rim101p functions as a transcriptional repressor,
Exploring the Variety of Random
Documents with Different Content
PHILOKTETES.
Oh Achilles szülötte! hát nem üdvözölsz

Többé hangoddal? Igy hagynád el e helyet!
ODYSSEUS (Neoptolemoshoz).
Siess, ne nézz rá, bárminő nagylelkű vagy,

Nehogy megrontsad szánalomból a sikert.
PHILOKTETES (a karhoz).
Ti is magamra hagytok, oh idegenek,

Nem szánakoztok szenvedéseim felett?
KAR.
Ez ifjú itt hajónk vezére, és a mit

Ő mond neked, mi is azt fogjuk mondani.
NEOPTOLEMOS.
Bizonynyal gyenge szivünek fog mondani

Odysseus; ám ha kivánná e férfiú,
Maradjatok, míg útra kész lesz a hajó,
S imánkat elvégeztük indulás előtt.
Addig tán jobbra fordul ennek szándoka
Irántunk. Most mi ketten hát eltávozunk,
Ti meg, ha majd szólítlak, tüstént jöjjetek.
(Neoptolemos, Odysseus el.)
PHILOKTETES.
Első versszak.
Oh forró s fagyos sziklaüreg!

Nem hagylak el hát soha sem
Téged, én nyomorult szegény!
Látni fogod halálomat is,
Igy rendelte a végzet,
Oh jaj, jaj, jaj!
Oh szomorú barlang,
Melyet betölte keservem!
Mi fog táplálni ezentúl?
Hol van számomra remény,
Hol van a kéz, mely az éhezőt enyhíti?
Fenn a magasban
Átsuhan a levegőn madarak raja,
De én nem gátolom meg.
KAR.
Magad, magad, akartad ezt így,

Boldogtalan! És nem más keze
Dönte nagyobb hatalommal e sorsba;
Rajtad állt a meggondolás,
Ám te nagyobbra becsülted a rossz sorsot a jónál.
PHILOKTETES.
Első ellenversszak.
Oh én nyomorult, nyomorult!
Megtörve a szörnyű kíntól,
Nem látva emberi arczot,
Elhagyatva kell ezután
Elvesznem nyomorultan!
Jaj, jaj, jaj, jaj!
Nem szerez élelmet
Többé az erős kéz
Szárnyas fegyvere által;
Mert elámíta az áruló,
Csalfa szavával eláltatá lelkemet.
Vajha e kínok
Gyötrenék a gonoszt oly hosszú időn át,
A mint engem gyötörnek!
KAR.
Az ég, az ég hozá reád ezt,

S nem emberi csalfaság, kezem
Által. Azért e baljóslatú átkot
Másra szórd és nem reánk,
Mert remegek, nehogy elveszítsd jó indulatunkat.
PHILOKTETES.
Második versszak.
Oh jaj, jaj! ott ül most valahol

A part fehér fövenyén,
S kaczagva rázza kezében
Életadó nyilamat,
Melyhez senki se nyúlt még.
Oh hű fegyver, a hű
Kézből elragadott íj!
Nemde, ha érzelem él idegedben,
Szánva tekintesz Herakles
Szegény frigyesére,
A ki lövésre nem feszít soha többé?
Urat váltasz, a cselszövő
Keze fog forgatni ezentúl,
Tanúja lészsz gaztetteinek,
S szemléled a gyűlöletest,
Számtalan új bajt fűzve a bűnhöz,
A melyet ellenem elkövetett.
KAR.
A férfiú mondja a jót igaznak,

Ám ha kimondta, szidalmat
Ne tegyen hozzá a boszús nyelv.
Mert sokaknak akaratját
Teljesíté egyedül ő,
Segélyt hozván az egész seregnek.
PHILOKTETES.
Második ellenversszak.
Oh repülő madarak, s ti
Csillogó szemű vadjai
Erdős hegyeimnek,
Nem fogtok futni ezentúl
Előlem; nincs a hatalmas
Nyíl többé kezeimben;
Oh nyomorult vagyok immár!
Nem védi senki e tájat,
Nincs több félni valótok;
Jertek előre hát,
Üssetek kedvtelve dús lakomát
Véres tagjaimon!
Hiszen úgy sincs messze halálom.
Mi táplálhatná életemet?
Ki él meg a levegőből,
Ha soha sem kap semmit a földtől,
A mi erőt és életet ád?
KAR.
Az égre, közelegj hozzánk bizalommal,

Kik jót akarva közelgénk,
Tudd meg, e kíntól
Megmenekülsz, ha akarsz.
Mert iszonyú, táplálni a kórt,
Ezernyi kínját nem tudva viselni.
PHILOKTETES.
Megint, megint eszembe juttatád a régi bajt,

Oh útasok legjobbja, te!
Miért ölsz meg, miért gyötörsz?
KAR.
Mit értesz ezzel?
PHILOKTETES.
Mért akarsz a gyűlöletes

Trója felé vinni magaddal?
KAR.
Tudom, ez volna a legjobb.
PHILOKTETES.
El, el innen! Hagyj magamra!
KAR.
Örömest, örömest teszem ezt a parancsot azonnal.

El innen, el innen,
A hajóra, helyünkre!
PHILOKTETES.
Zeusra, ki átkomat hallja, ne menj el, esengek!
KAR.
Csillapulj!
PHILOKTETES.
Emberek!
Az égre, maradjatok!
KAR.
Miért kiáltasz?
PHILOKTETES.
Oh jaj! oh jaj! Oh sors! oh sors!

Oda életem! Ah!
Lábam, lábam, oh mit tegyek,
Hová legyek veled ezentúl?
Jertek, oh emberek, vissza e helyre!
KAR.
Mért? Hogy újra útnak ereszsz,

A mint előbb kijelentéd?
PHILOKTETES.
Ne ródd bűnömül,
Ha viharos kínjaim között
Botor szót monda ki ajkam.
KAR.
Jőjj, a miként mondám, boldogtalan ember!
PHILOKTETES.
Nem, soha sem, soha sem, vedd ezt bizonyosnak,

Bárha tüzes villámaival
Hamvasztana el a boszus isten!
Veszszen el Ilion és a ki vívja!
Mind, a kik eldobtak, sebemet megutálva, magoktól!
Még csak ez egyet kérem, oh idegenek!
KAR.
Szólj, mi e kérés?
PHILOKTETES.
Ha van valahol kard,

Vagy bárd, avagy íj, hozzátok ide.
KAR.
És mit akarsz vele tenni?
PHILOKTETES.
Tagjaimat s fejemet levágni kezemmel,

Halált, halált akarok most!
KAR.
Miért?
PHILOKTETES.
Atyámat keresem.
KAR.
És hol?
PHILOKTETES.
Hadesben;
Mert nem látja már a napot,
Oh városom, drága hazám,
Oh ha viszont látnálak, én szegény!
Ki elhagyva szent habjaidat,28)
A gyűlölt Danaok frigyese
Levék; s ime most megsemmisültem.
(El a barlangba.)
KAR.
Rég útra keltem volna már hajóm felé,

És ott is volnék, ha nem látná most szemem
Odysseust erre jönni, s Achilles nemes
Szülöttét, a ki gyors léptekkel közeleg.
(Neoptolemos és Odysseus fellépnek.)
ODYSSEUS.
Nem mondanád, mért fordultál meg útadon,

S miért jösz oly sietve vissza most ide?
NEOPTOLEMOS.
Hogy az előbbi bünömet jóvá tegyem.
ODYSSEUS.
Csodálatos szót mondasz. És mi volt e bűn?
NEOPTOLEMOS.
Hogy rád és az egész seregre hallgaték –
ODYSSEUS.
S mi dolgot tettél, a mi nem hozzád való?
NEOPTOLEMOS.
Rút csalfasággal rászedém e férfiút.

ODYSSEUS.
Kit? Oh jaj! csak nem forralsz új tervet megint?
NEOPTOLEMOS.
Nem, semmi újat! Ámde Poeas gyermekét –
ODYSSEUS.
Mi szándokod van? Elfogott a rettegés.
NEOPTOLEMOS.
Fölkeresem, s az elrabolt nyilat megint –
ODYSSEUS.
Oh Zeus, mit mondasz! Tán csak vissza nem adod?
NEOPTOLEMOS.
Alávalóan, jogtalan ragadtam el.
ODYSSEUS.
Az istenekre, csúfságból beszélsz-e így?
NEOPTOLEMOS.
Igen, ha csúfság a valót kimondani.
ODYSSEUS.
Mit hallok, oh Achilles sarja! Mit beszélsz?
NEOPTOLEMOS.
Kétszer, háromszor ismételjem ugyanazt?

ODYSSEUS.
Bár egyszer sem hallottam volna ezt a szót!
NEOPTOLEMOS.
Értsd meg hát tisztán, mindent elmondtam neked.
ODYSSEUS.
Van még, van még, ki meggátolja tettedet.
NEOPTOLEMOS.
Mit szólsz? Ki az, ki ebben gátot vet nekem?
ODYSSEUS.
Achaea összes népe, és köztük magam.
NEOPTOLEMOS.
Okos létedre nem mondtál most okosat.
ODYSSEUS.
S te nem beszélsz és nem cselekszel okosan.
NEOPTOLEMOS.
Okosságnál igazságosság többet ér.
ODYSSEUS.
De mily igazság, visszaadni azt, a mit

Tanácsom által nyertél?
NEOPTOLEMOS.
Csak jóvá teszem,
A mit előbb alávalóan vétkezém.
ODYSSEUS.
S nem félsz Argos sergétől, ha ezt megteszed?
NEOPTOLEMOS.
A jog mellettem van, hiában fenyegetsz.

S erőszakkal sem gátolod meg szándokom.
ODYSSEUS.
Nem Trója ellen küzdünk hát, de ellened.
NEOPTOLEMOS.
Hadd jőjjön, a minek kell!
ODYSSEUS.
Látod, hogy kezem

A kardhoz nyult már?
NEOPTOLEMOS.
Láthatsz tüstént engem is,

Hogy azt teszem, s habozni épen nem fogok.
ODYSSEUS.
Legyen hát, távozom most és tudtul adom

Ezt a seregnek, tőle végy majd büntetést. (El.)
NEOPTOLEMOS.
Bölcsen tevél. Ha mindig így gondolkozol,

Távol tartasz magadtól minden bánatot.
S most halld szavam, Philoktetes, Poeas fia!
E sziklabarlang árnyékából lépj elő!
(Philoktetes előlép.)
PHILOKTETES.
Mi zaj hangzik fel újra e barlang előtt?

Miért hivtok ki, mit akartok, emberek?
(Észreveszi Neoptolemost.)
Jaj! Rossz van készülőben! Miért jövél megint?

Hogy régi szenvedésem újakkal tetézd?
NEOPTOLEMOS.
Bizzál, és engedd elbeszélnem, mért jövék.
PHILOKTETES.
Félek; mert azelőtt is szép volt a szavad,

S mivel szavadnak hittem, nagy bajomra lett.
NEOPTOLEMOS.
Hát nem lehet, hogy változik az érzelem?
PHILOKTETES.
Midőn elloptad íjam, akkor is ilyen

Valál: igaz beszédű és álnok szivű.
NEOPTOLEMOS.
De most ne félj; csak azt kivánom hallani,

Miként fordult szándékod: itt maradsz-e vagy
Velünk hajózol?
PHILOKTETES.
Hallgass, ne beszélj tovább!

Akármit mondasz, hasztalan minden szavad,
NEOPTOLEMOS.
Ez szándokod hát?
PHILOKTETES.
Inkább, mintsem mondhatom.
NEOPTOLEMOS.
Jobban szerettem volna, hogy szavamra hajts;

De ha beszédem nincs kedvedre, felhagyok
Vele azonnal.
PHILOKTETES.
Hasztalan is szólanál.
Mert nem nyered meg jó szándékomat soha,
Te, a ki csalfán elraboltad éltemet,
És azután bölcs oktatással jösz elém,
Te, a legjobb atyának legrosszabb fia!
Átok reátok, Atridák! Átok reád
És Laërtes fiára!
NEOPTOLEMOS.
Hagyd az átkokat!
Ime, fogadd el kezeimből íjadat.
PHILOKTETES.
Mit mondasz? Újra csalfaság játszik velem?
NEOPTOLEMOS.
A felséges Zeus szent nevére esküszöm!
PHILOKTETES.
Oh, drága hangok – ha való, a mit beszélsz.
NEOPTOLEMOS.
Tüstént tett fogja bizonyítni; nyujtsd ki hát

Jobb kezedet s légy újra fegyvered ura.
(Odysseus hirtelen előlép.)
ODYSSEUS.
S én megtiltom – tanúim rá az istenek –

Az Atridák és a sereg nevében ezt!
PHILOKTETES (átveszi az íjat).
Fiam, ki szól itt? Nem Odysseus hangja ez,

A melyet hallok?
ODYSSEUS.
Tudd meg bizton, én vagyok,

S erőszakkal Trójába viszlek, bár velem
Vagy ellenem fog tenni Achilles fia.
PHILOKTETES (íját felhúzza).
De nem jó kedvvel, ha e nyil bizton talál.
NEOPTOLEMOS (megragadja karját).

Hah, nem, soha! Az égre! Hagyd el íjadat!
PHILOKTETES.
Az égre, hagyd el karomat, kedves fiam!
NEOPTOLEMOS.
El nem bocsátom!
(Odysseus elfut.)
PHILOKTETES.
Oh, jaj! mért nem engedéd,

Hogy meggyilkoljam gyűlölt ellenségemet?
NEOPTOLEMOS.
Szégyen lett volna mindkettőnkre nézve az.
PHILOKTETES.
Tudd meg hát legalább, hogy a vezérek, e

Hazug hírmondók, szóval hősök egyedül,
De gyávák ott, hol dárda ellen dárda küzd.
NEOPTOLEMOS.
Legyen! Megvan már íjad, s így nincs semmi ok

Haragra vagy panaszra többé ellenem.
PHILOKTETES.
Úgy van. Nemes törzsödhöz méltóan tevél,

Fiam; nem Sisyphostól nyerted éltedet,
Hanem Achillestől, kit életében és
Halálában mindig legjobbnak mondtanak.
NEOPTOLEMOS.
Örömmel hallom e dicséretet atyám

S magam felől; de hallgass most rám, s tudd mi az,
Mit tőled kérek. Embernek viselni kell
A sorsot, melyet istenek küldtek reá;
De a ki önmagának készít szenvedést,
Miként te, az nem érdemel bocsánatot,
És nem lesz méltó szánalomra soha sem.
Te el vagy keseredve és nem hallgatod
A jó tanácsot, ellenségnek tartod azt,
Ki jó szándékkal jóra intve jő feléd.
S én mégis mondom – Zeus legyen reá tanúm –
S te hallgass rám, vésd jól szivedbe szavamat:
Az istenek küldötték ezt a kórt reád,
Mert vakmerőn közelgél a kigyó felé,
Mely Chryse nyilt szentélyét rejtve őrizé;29)
S tudd meg, hogy kórod meg nem szűnik soha sem,
Míg ez a nap keletről jő fel s nyugaton
Pihen le, ha csak önszántodból útra nem
Indulsz és nem jelensz meg Trója sikjain,
Hol fölleled Asklepiosnak fiait,
Kik meggyógyítják kórodat, hogy azután
Velem s nyiladdal elpusztítsad Pergamost.
Elmondom azt is, mint tudám meg ezeket:
Foglyunkká tettük Ilionból Helenost,
A legjobb jóst, ki tisztán megjövendölé,
Hogy így fog jönni; s azt is hozzátette még,
Hogy a jelen nyár látni fogja biztosan
Egész Trójának elbukását; s önmagát
Halálra szánta, ha csalárd volt jóslata.
S most tudva mindezt, jer jó szántodból velünk.
Hisz oly szép lenne, az egész hellen sereg
Legelső hőseként, először gyógyulást
Találni, s aztán Trója sokszor siratott
Várát fényes dicsőséggel megdönteni.
PHILOKTETES.
Oh, gyűlölt élet, mért tartasz még ide fenn,

Mért nem bocsátsz Hades honába engemet?
Jaj, mit tegyek? Hogy tudjak ellenállani
Ez embernek, ki oly jó indulattal int?
Engedjek hát? De hogy fogok majd, én szegény,
A napvilágra lépni? Kit köszöntsek ott?
Oh szem, mely láttad minden szenvedésemet!
Mint tudnád elviselni, hogy az Atridák
Között láss újra, kik megronták éltemet?
Hogy ott lásd mellettem Laërtes gaz fiát?
Nem elmult szenvedéseim emléke bánt,
Nem az gyötör, hanem jövendő kínjaim
Félelme; mert ha egyszer rosszat szült a szív,
Úgy mindig új meg új bűnöknek anyja lesz.
Csodálkozással tölt el a te dolgod is.
Nem kellene Trójába menned, s engemet
Azokhoz vinned, a kik meggyaláztanak,
Ellopva tőled hős atyádnak fegyverét:
S te értök harczolsz, s engem is rá kényszerítsz?
Ne tedd ezt, oh fiam, hanem mint esküvél,
Vezess hazámba, és te Skyrosban maradj!
Hadd veszszenek el gonoszul e gonoszok!
Kettős hálát nyersz tőlem így jutalmadul,30)
Kettős hálát atyámtól; és a rosszakat
Nem oltalmazván, nem fogsz rossznak látszani!
NEOPTOLEMOS.
Helyes beszéd, de mégis azt óhajtanám,

Hogy hallgatnál az istenekre és reám,
S távoznál innen jó barátod oldalán.
PHILOKTETES.
Tán Trója mezejére, és Atreus gyűlölt

Fiához? Oda vinném sebhedt lábamat?
NEOPTOLEMOS.
Azokhoz, a kik meggyógyítják gennyedő

Lábad sebét, s megenyhítik fájdalmadat.
PHILOKTETES.
Oh, mily szörnyű tanácsot adsz! Mit is beszélsz!
NEOPTOLEMOS.
A mit rám és rád nézve legjobbnak hiszek.
PHILOKTETES.
S így szólva nem szégyenled istentől magad?
NEOPTOLEMOS.
Mért szégyenkezni a miatt, mi hasznot ad?
PHILOKTETES.
Az Atridáknak ád ez hasznot vagy nekem?
NEOPTOLEMOS.
Mint jó barátod szólok és jót akarok.
PHILOKTETES.
Te, a ki ellenimnek adnál engem át?
NEOPTOLEMOS.
Oh, kedvesem, ne légy a balsorsban daczos!
PHILOKTETES.
Ismerlek; el akarsz e szóval veszteni.
NEOPTOLEMOS.
Bizonynyal nem; de nem akarsz megérteni.
PHILOKTETES.
Az Atridák eldobtak, ennyit jól tudok.
NEOPTOLEMOS.
A kik eldobtak, ime most megmentenek.
PHILOKTETES.
De Tróját jó szántomból nem látom soha.
NEOPTOLEMOS.
Mi van még hátra, mit tegyek, ha semmi szó,

És semmi kérés nem képes megdönteni?
Legkönnyebb lesz, ha semmit sem szólok tovább,
S te élsz, mint eddig éltél, menthetetlenül.
PHILOKTETES.
Hadd szenvedjem hát a reám mért szenvedést!

De azt, mit jobb kezeddel szentül fogadál, –
Hogy elviszesz hazámba, – teljesítsd, fiam!
Ne halogasd hát és ne szólj többé nekem
Trójáról; mert eléggé gyötrött már e név.
NEOPTOLEMOS.
Induljunk, ha tetszik.
PHILOKTETES.
Mily nemes szót mondál, oh fiam!
NEOPTOLEMOS.
Lépj előre bátran, bizton.
PHILOKTETES.
Mint erőm megengedi.
NEOPTOLEMOS.
Mint kerüljem Argos vádját?
PHILOKTETES.
Hagyd az aggodalmakat.
NEOPTOLEMOS.
S ha országom elpusztítják?
PHILOKTETES.
Akkor én is ott leszek.
NEOPTOLEMOS.
Mit fogsz tenni védelmemre?
PHILOKTETES.
Itt van Herakles nyila –
NEOPTOLEMOS.
S ezzel?
PHILOKTETES.
Távol tartom őket.
NEOPTOLEMOS.
Végy itt búcsút és kövess.
(Herakles megjelenik egy felhőben.)
HERAKLES.
Nem addig, a míg nem hallod a szót,

Poeas fia, ajkaimon!
Mert tudd meg, Herakles hangja beszél,
Herakles alakját látod előtted.
Érted vagyok itt, elhagyva miattad
A mennyei trónt,
Hogy kijelentsem Zeus akaratját,
S meggátoljam az útat, melybe fogál.
Ügyelj hát szavaimra!
Először ennen sorsom említem neked,
Mily fárasztó küzdelmek és munkák után
Nyerék örök dicsőséget, mint láthatod.
Eléd is, tudd meg, ily czélt tűzött végzeted,
Hogy fáradj, szenvedj és dicsőséget szerezz.
Menj hát e férfiúval Trója városa
Elé, s azonnal megszűnik gyászos bajod;
Aztán a hadseregnek legjobb hőseként
Kioltod nyilvesszőmmel Páris életét,
Ki mind e bajnak egykoron forrása volt;
Megdöntöd Tróját, és a zsákmány legjavát
Küldöd hazádba, palotádnak ékeül,
Atyádnak, ősz Poeasnak, Oeta mezején.
S a zsákmányt, mely a hadseregtől jut reád,
Vidd el máglyámra, nyilaim emlékeül.
Hallgass te is szavamra, Achilles fia!
Mert nem hódíthatod meg Trója ormait
E férfi nélkül, a mint ő sem nélküled.
Őrizzétek hát egymást, mint együtt nevelt
Oroszlánpár! S elküldöm majd Asklepiost
Trójába, a ki meggyógyítja kórodat.
A sors akarja, hogy másodszor döntse meg
E várost íjam. Ám ha majd pusztítani
Fogjátok földét, tiszteljétek azt, mi szent.
Mert minden mást csekélyebbnek tart Zeus atyám;
De a kegyesség síron túl is megmarad,
S éljünk vagy haljunk, nem enyészik el soha.
PHILOKTETES.
Oh, isteni hang, rég vágytam utánad.

Míg megjelenél!
Követem parancsaidat.
NEOPTOLEMOS.
Én is megfogadom szavadat.
HERAKLES.
Ne késsetek hát cselekedni;

Int már az idő,
És útra készen vár a hajó.
(Eltünik.)
PHILOKTETES.
Fel hát! Utólszor üdvözlöm e földet.

Köszöntelek, óvó sziklafedél,
Nymphák a habokban, a réten,
Hullámok haragos moraja,
Oh déli vihar, mely fejemet
Gyakorta megöntéd barlangom ölén,
Oh Hermes ormai, melyek
Sokszor visszaverétek a kín
Bús sóhajait, panaszát!
Most oh phœbosi forrás, enyhe ital,
Elhagylak, elhagylak örökre –
Nem hittük ezt mi úgy-e soha?
Isten veled, Lemnos, habverte sziget,
Küldj oda vész kerülte úton,
Hova Mœra vezet, a hatalmas,
S barátaim akaratja, s az isten
Mindenható parancsa!
KAR.
Fel hát! szálljunk mind a hajóra,

S kérjük a tenger nymphái kegyét,
Védjék útunkat a vésztől!
Jegyzetek Philokteteshez.
1. Poeas fia Philoktetes, ki melisinek neveztetik, mert
atyja a thessaliai Melisben uralkodott.
2. Mert Neoptolemos nem volt Helena kérői közt, kik
eskűvel kötelezték magukat a leendő férj védelmére.
3. Mint Odysseus.
4. Melyen Philoktetest kitették.
5. Mert Philoktetes épen Chryse oltárát akarta
fölkeresni, midőn a kigyó megmarta.
6. Herakles győzhetetlen íja, melyet Apollotól, az isteni
íjásztól kapott.
7. Skyros, sziget az aegaei tengeren, hol Deidamia.
Lykomedes király leánya, Achillestől, ki a leányok közt
rejtezett, Neoptolemost szülte.
8. Odysseus a kephalleni szigetek királya, melyeknek
lakói mint kalózok váltak híresekké; azért Philoktetes
ez elnevezésben keserű czélzást tesz Odysseus
csalfaságára.
9. Sophokles itt azon mondát követi, hogy Odysseus és
Phoenix, Achilles nevelője mentek Neoptolemosért.
10. Sigeion hegyfokot Trója mellett gyászosnak
mondja, mert itt feküdt holtan Achilles.
11. A föld alatt Cybele vagy Rhea istennő értetik;
bérczesnek mondják, mert a hegyormokon tisztelték.
12. Paktolos folyó Tmolosból jött alá, hol Cybele fő
székhelye volt.
13. Az istennő szekerébe oroszlánok voltak fogva;

sokszor rajzolták oroszlánon nyargalva.
14. Diomedes, ki Odysseussal együtt kitette volt
Philoktetest.
15. Odysseus, kinek anyját Antikleiát, midőn vele
Sisyphostól teherben volt, drága pénzen vásárolta meg
s vette nőül Laërtes.
16. Philoktetes Chalkodont, Abas fiát említi, ki
Heraklesnek szövetségese volt.
17. Peparethos (ma Skopelos) híres volt olaj-, gabna-
és bortermeléséről. Azért e költött elbeszélésben
helyesen van választva, mert valószínű volt, hogy a
peparethosi borkalmárok összeköttetésben álltak a
görög táborral.
18. Akamas és Demophon, kiket Sophokles a Homer
utáni eposból vett.
19. Czélzás Sisyphosra, ki haldokolva megparancsolta
nejének, hogy testét temetetlenül hagyja. Az
alvilágban aztán engedelmet kért Plutótól, hogy
visszatérjen a földre s nejét e hanyagságért
megbüntesse. Az engedélyt megkapta, de aztán nem
akart többé az alvilágba visszatérni, míg erővel nem
kényszerítették rá.
20. A nyugati szél mindkettőjökre kedvezőtlen, mert
állítólag üldözőik is Trója felől hajóznak Hellas felé.
21. Ixion, kit Zeus, mivel Junót merte szeretni, az
alvilágban örökkön forgó kerékre kötött.
22. Herakles, ki Oeta ormán máglyára tétette magát s
a tűzből az istenek közé emelkedett.
23. A nagy szerencse rendesen magára vonja az
istenek irigy féltékenységét; azért ez íj minden
tulajdonosára vészt hozott eddig: Heraklesre és
Philoktetesre. Engesztelje meg tehát Neoptolemos az
istenek irigységét, nehogy őt is bajba döntse ez isteni
erejű íj birása.
24. A lemnosi tűz a Moschylos vulkán, mely Lemnos
szigetén volt.
25. A kar biztatja Neoptolemost, hogy mivel az íj

kezében van, siessen el, mielőtt Philoktetes fölébredne,
mert így az íj megnyerése nem fog semmi veszélylyel
járni.
26. Neoptolemos, ki régóta benső harczban van
önmagával, nem képes tovább folytatni tettetését.
27. Odysseus őrültnek tette magát, de Palamedes azon
cselt használta ellene, mintha fiát Telemachost meg
akarná ölni; Odysseus erre elárulván, hogy őrültsége
szinlelt volt, kényszerült részt venni a hadjáratban.
28. Sperchios folyó.
29. Chrysének, mint nymphának, nem volt temploma,
hanem csak kerített berke szabad ég alatt.
30. A mennyiben Philoktetest megszabadítja és az
Atridákat megrontja.
*** END OF THE PROJECT GUTENBERG EBOOK PHILOKTETES ***
Updated editions will replace the previous one—the old editions will
be renamed.
Creating the works from print editions not protected by U.S.

copyright law means that no one owns a United States copyright in
these works, so the Foundation (and you!) can copy and distribute it
in the United States without permission and without paying
copyright royalties. Special rules, set forth in the General Terms of
Use part of this license, apply to copying and distributing Project
Gutenberg™ electronic works to protect the PROJECT GUTENBERG™
concept and trademark. Project Gutenberg is a registered trademark,
and may not be used if you charge for an eBook, except by following
the terms of the trademark license, including paying royalties for use
of the Project Gutenberg trademark. If you do not charge anything
for copies of this eBook, complying with the trademark license is
very easy. You may use this eBook for nearly any purpose such as
creation of derivative works, reports, performances and research.
Project Gutenberg eBooks may be modified and printed and given
away—you may do practically ANYTHING in the United States with
eBooks not protected by U.S. copyright law. Redistribution is subject
to the trademark license, especially commercial redistribution.
START: FULL LICENSE

THE FULL PROJECT GUTENBERG LICENSE
PLEASE READ THIS BEFORE YOU DISTRIBUTE OR USE THIS
WORK
To protect the Project Gutenberg™ mission of promoting the free

distribution of electronic works, by using or distributing this work (or
any other work associated in any way with the phrase “Project
Gutenberg”), you agree to comply with all the terms of the Full
Project Gutenberg™ License available with this file or online at
www.gutenberg.org/license.
Section 1. General Terms of Use and

Redistributing Project Gutenberg™
electronic works
1.A. By reading or using any part of this Project Gutenberg™
electronic work, you indicate that you have read, understand, agree
to and accept all the terms of this license and intellectual property
(trademark/copyright) agreement. If you do not agree to abide by all
the terms of this agreement, you must cease using and return or
destroy all copies of Project Gutenberg™ electronic works in your
possession. If you paid a fee for obtaining a copy of or access to a
Project Gutenberg™ electronic work and you do not agree to be
bound by the terms of this agreement, you may obtain a refund
from the person or entity to whom you paid the fee as set forth in
paragraph 1.E.8.
1.B. “Project Gutenberg” is a registered trademark. It may only be

used on or associated in any way with an electronic work by people
who agree to be bound by the terms of this agreement. There are a
few things that you can do with most Project Gutenberg™ electronic
works even without complying with the full terms of this agreement.
See paragraph 1.C below. There are a lot of things you can do with
Project Gutenberg™ electronic works if you follow the terms of this
agreement and help preserve free future access to Project
Gutenberg™ electronic works. See paragraph 1.E below.

Instant Access to Transcriptional Regulation Methods and Protocols 1st Edition Xiao-Yong Li ebook Full Chapters

Uploaded by

Copyright:

Available Formats

Instant Access to Transcriptional Regulation Methods and Protocols 1st Edition Xiao-Yong Li ebook Full Chapters

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Instant Access to Transcriptional Regulation Methods and Protocols 1st Edition Xiao-Yong Li ebook Full Chapters

Uploaded by

Copyright:

Available Formats

Download the full version of the ebook at

Transcriptional Regulation Methods and

Explore and download more ebook at https://ebookultra.com

Bacterial Transcriptional Control Methods and Protocols

Genomic Imprinting Methods and Protocols 1st Edition Yong

Moral Partiality 1st Edition Yong Li

Plant Signalling Networks Methods and Protocols 2012th

Bacterial Gene Regulation and Transcriptional Networks 1st

Post Transcriptional Gene Regulation 2nd ed. 2016 Edition

Polyadenylation Methods and Protocols 1st Edition Joanna

Microsatellites Methods and Protocols 1st Edition

For further volumes:

Methods and Protocols

ISSN 1064-3745 e-ISSN 1940-6029

Library of Congress Control Number: 2011941586

© Springer Science+Business Media, LLC 2012

Printed on acid-free paper

Humana Press is part of Springer Science+Business Media (www.springer.com)

Queens, NY, USA Ales Vancura

PART I PROMOTER ELEMENTS, TRANSCRIPTION FACTORS,

1 Genome-Wide In Vivo Cross-linking of Sequence-Specific

11 Mapping Protein–DNA Interactions Using ChIP-Sequencing . . . . . . . . . . . . . . . . . 157

PART II CHROMATIN STRUCTURE

15 Computational Analysis of Promoter Elements and Chromatin

24 Chromatin Immunoprecipitation in Mouse Hippocampal

PART III CHROMATIN MODIFYING COMPLEXES

25 Approaches for Studying Nucleosome Movement by ATP-Dependent

PART IV RNA SYNTHESIS AND REGULATION

32 Analysis of mRNA Abundance and Stability by Ribonuclease

37 Quantitative Analysis of Transcription Elongation by RNA

SHIGEKI ARAI • Division of Gene Structure and Function, Research Center

ANTONIO CONCONI • Département de Microbiologie et Infectiologie,

CHRIS MURGATROYD • Max Planck Institute for Psychiatry, Munich, Germany

TAKUMI TAKIZAWA • Graduate School of Biological Sciences, Nara Institute of Science

Promoter Elements, Transcription Factors,

Genome-Wide In Vivo Cross-linking of Sequence-Specific

Key words: In vivo cross-linking, Sequence-specific transcription factors, ChIP-chip, Chip-seq

Sequence-specific transcription factors control the differential

of transcription factors in vivo at a sample of genomic regions and

Chromatin isolation by CsCl

Fig. 1. Schematic representation of the ChIP-chip and ChIP-seq method.

late s3/7 s2 s4/6 s1s5

Our ChIP-chip studies have been carried out using the

2.1. Fixation of 1. Large fly population cages (Genesee Scientific: #59-104).

3. 50% Clorox bleach (2.6% hypochlorite solution).

2.2. Purification 1. Motorized dounce homogenizer (Thomas Teflon Pestle Tissue

1. 50 mg/ml BSA (Invitrogen, 15561-020), 10 mg/ml RNase A

2.4. DNA Amplification 1. Sequenase 2.0 kit (USB corp, #70775Y).

10. Biotin-ddATP (Perkin Elmer, #NEL548).

2. SYBR gold (Invitrogen, #S-11494).

4. Set Bioruptor intensity to H and the on/off cycle to 15 s

3.3. Chromatin We use about 50 μg (based on DNA concentration determined as

studied, as described at the end of this section. If no target is known

14. Carry out the following consecutive washes at room temperature

reproducibility, particularly when small amounts of genomic DNA

in a microcentrifuge; add 20 μl of TE to each random-primed sample;

3.4.3. TdT Labeling 1. Set up a 50 μl reaction by mixing 31.2 μl DNase I treated

3.5.2. Washing We use an Affymetrix GeneChIP Fluidics Station 450 to process

3. Incubate in the thermal cycler for 30 min at 20°C.

to adaptor ligation by-products. Figure 3c shows an example