Full download Genotype Phenotype Coupling Methods and Protocols 2nd Edition Stefan Zielonka pdf docx

Download the full version of the ebook at ebookfinal.
com
Genotype Phenotype Coupling Methods and Protocols

2nd Edition Stefan Zielonka
https://ebookfinal.com/download/genotype-phenotype-coupling-
methods-and-protocols-2nd-edition-stefan-zielonka/
OR CLICK BUTTON
DOWNLOAD EBOOK
Download more ebook instantly today at https://ebookfinal.com

Instant digital products (PDF, ePub, MOBI) available
Download now and explore formats that suit you...
Genotype to Phenotype 1st Edition J. J. Goodship (Editor)
https://ebookfinal.com/download/genotype-to-phenotype-1st-edition-j-j-
goodship-editor/
ebookfinal.com
Epigenetics Linking Genotype and Phenotype in Development

and Evolution 1st Edition Benedikt Hallgrímsson
https://ebookfinal.com/download/epigenetics-linking-genotype-and-
phenotype-in-development-and-evolution-1st-edition-benedikt-
hallgrimsson/
ebookfinal.com
Flavins and Flavoproteins Methods and Protocols 1st

Edition Stefan Weber
https://ebookfinal.com/download/flavins-and-flavoproteins-methods-and-
protocols-1st-edition-stefan-weber/
ebookfinal.com
Pharmacogenomics Methods and Protocols 2nd Edition Rosane

Charlab
https://ebookfinal.com/download/pharmacogenomics-methods-and-
protocols-2nd-edition-rosane-charlab/
ebookfinal.com
Salmonella Methods and Protocols 2nd Edition Heide
Schatten
https://ebookfinal.com/download/salmonella-methods-and-protocols-2nd-
edition-heide-schatten/
ebookfinal.com
Biological Aging Methods and Protocols 2nd Edition Huaping

Chen
https://ebookfinal.com/download/biological-aging-methods-and-
protocols-2nd-edition-huaping-chen-2/
ebookfinal.com
Pancreatic Cancer Methods and Protocols 2nd Edition Hanno

Matthaei
https://ebookfinal.com/download/pancreatic-cancer-methods-and-
protocols-2nd-edition-hanno-matthaei/
ebookfinal.com
Peptide Antibodies Methods and Protocols 2nd Edition

Gunnar Houen
https://ebookfinal.com/download/peptide-antibodies-methods-and-
protocols-2nd-edition-gunnar-houen/
ebookfinal.com
RNA Scaffolds Methods and Protocols 2nd Edition Luc

Ponchon
https://ebookfinal.com/download/rna-scaffolds-methods-and-
protocols-2nd-edition-luc-ponchon/
ebookfinal.com
Methods in
Molecular Biology 2681
Stefan Zielonka · Simon Krah Editors
Genotype
Phenotype
Coupling
Methods and Protocols
Second Edition
METHODS IN MOLECULAR BIOLOGY
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, UK
For further volumes:

http://www.springer.com/series/7651
For over 35 years, biological scientists have come to rely on the research protocols and
methodologies in the critically acclaimed Methods in Molecular Biology series. The series was
the first to introduce the step-by-step protocols approach that has become the standard in all
biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by
step fashion, opening with an introductory overview, a list of the materials and reagents
needed to complete the experiment, and followed by a detailed procedure that is supported
with a helpful notes section offering tips and tricks of the trade as well as troubleshooting
advice. These hallmark features were introduced by series editor Dr. John Walker and
constitute the key ingredient in each and every volume of the Methods in Molecular Biology
series. Tested and trusted, comprehensive and reliable, all protocols from the series are
indexed in PubMed.
Genotype Phenotype Coupling
Methods and Protocols
Second Edition
Edited by
Stefan Zielonka and Simon Krah

Protein Engineering and Antibody Technologies (PEAT), Merck Healthcare KGaA, Darmstadt, Germany
Editors
Stefan Zielonka Simon Krah
Protein Engineering and Antibody Protein Engineering and Antibody Technologies (PEAT)
Technologies (PEAT) Merck Healthcare KGaA
Merck Healthcare KGaA Darmstadt, Germany
Darmstadt, Germany
ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-0716-3278-9 ISBN 978-1-0716-3279-6 (eBook)
https://doi.org/10.1007/978-1-0716-3279-6
© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part
of Springer Nature 2020, 2023
This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part
of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation,
broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and
retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter
developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been
made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer
Nature.
The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.
Preface
Among therapeutics, monoclonal antibodies (mAbs) and antibody-based molecules are one
of the most important drug entities. This became apparent with the FDA-approval of the
100th mAb product in 2021. Since the 1970s, mAbs can be generated by hybridoma
technology. For this, B-cells from immunized mice are fused with immortalized tumor
cells and selected in HAT medium. Resulting hybridomas secrete antibodies of a defined
specificity.
In the last decades, tremendous progress in the discovery of antibodies has been made.
Several methodologies are covered under the umbrella term “directed evolution,” for which
the Nobel Prize was granted in 2018. Directed evolution mimics the process of natural
selection and leads to the isolation of variants with desired functions after iterative rounds of
in vitro mutagenesis and selection. One important representative in this field is phage
display. Herein, filamentous phages that display the protein of interest (POI) and harbor
its respective genetic information are generated after infection of phagemid carrying E. coli
cells with helper phages. Because (in principle) each phage particle harbors the genetic
information for one specific protein that is displayed on its surface, the genotype is linked
to its phenotype. Amplification and in vitro mutagenesis allow for the generation of large
DNA libraries that can be screened via phage display to identify variants with prescribed
properties. In the field of antibody discovery, it enabled the generation of fully human
antibodies, while antibodies derived from classical hybridoma campaigns were murine and
needed to be humanized tediously. Moreover, phage display was used to further engineer
binding proteins in terms of affinity, thermal stability, pH sensitivity, and much more.
Besides phage display, other display technologies were developed that all harbor specific
advantages and disadvantages. Methods and protocols for many of them have been reported
in the first edition of Genotype Phenotype Coupling, including SELEX, cDNA, ribosomal,
yeast, and mammalian display. Moreover, discovery and engineering were described not only
for classical antibodies but also for antibody fragments such as VHHs and VNARs and
alternative binding scaffolds like Affitins.
The second edition of Genotype Phenotype Coupling aims at broadening the spectrum
given in the first edition. In addition to classical display technologies, methodologies for the
generation of natively paired antibody libraries, single cell technologies, alternative scaffolds,
and in silico antibody sequence assessments are described. The application of those methods
may allow for the generation of improved therapeutics and diagnostic reagents in a shorter
time frame in the future.
We thank all contributors that helped us to make this handbook with state-of-the-art
technologies and methodologies, thereby providing an overview over an exciting and
continuously evolving field.
Darmstadt, Germany Stefan Zielonka

Simon Krah
v
Contents
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi
1 Quantitative Determination of Staphylococcus aureus Using Aptamer-Based
Recognition and DNA Amplification Machinery . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
Nandi Zhou and Rongfeng Cai
2 Construction of Synthetic VHH Libraries in Ribosome Display Format . . . . . . . 19
Audrey Guilbaud and Frédéric Pecorari
3 Isolation of Adhirons Specific for Plant Protoplast Membrane Biomarkers
Is Simplified by Phagemid Design. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33
Claudia D’Ercole and Ario de Marco
4 Facile One-Step Generation of Camelid VHH and Avian scFv Libraries
for Phage Display by Golden Gate Cloning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
Christina Bauer, Elke Ciesielski, Lukas Pekar, Simon Krah,
Lars Toleikis, Stefan Zielonka, and Carolin Sellmann
5 Identification of New Antibodies Targeting Tumor Cell Surface
Antigens by Phage Display . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61
Steffen Krohn, Matthias Peipp, and Katja Klausz
6 Phage Display of Bovine Ultralong CDRH3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83
Callum Joyce, Louise Speight, Alastair D. G. Lawson,
Anthony Scott-Tucker, and Alex Macpherson
7 Bacterial Cell Display for Selection of Affibody Molecules. . . . . . . . . . . . . . . . . . . . 99
Charles Dahlsson Leitao, Stefan Ståhl, and John Löfblom
8 Isolation of Antigen-Specific Unconventional Bovine Ultra-Long
CDR3H Antibodies Using Cattle Immunization in Combination
with Yeast Surface Display. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113
Paul Arras, Jasmin Zimmermann, Britta Lipinski,
Desislava Yanakieva, Daniel Klewinghaus, Simon Krah,
Harald Kolmar, Lukas Pekar, and Stefan Zielonka
9 Selection of High-Affinity Heterodimeric Antigen-Binding Fc Fragments
from a Large Yeast Display Library . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131
Filippo Benedetti, Gerhard Stadlmayr, Katharina Stadlbauer,
Florian Rüker, and Gordana Wozniak-Knopp
10 A Two-Step Golden Gate Cloning Procedure for the Generation
of Natively Paired YSD Fab Libraries . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 161
Lena Vollmer, Simon Krah, Stefan Zielonka, and Desislava Yanakieva
11 Single-Cell B-Cell Sequencing to Generate Natively Paired scFab
Yeast Surface Display Libraries. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 175
Nathaniel Pascual, Theodore Belecciu, Sam Schmidt,
Athar Nakisa, Xuefei Huang, and Daniel Woldring
vii
viii Contents
12 One-Pot Droplet RT-OE-PCR for the Generation of Natively

Paired Antibody Immune Libraries. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 213
Desislava Yanakieva, Lena Vollmer, Satyendra Kumar, Stefan Becker,
Lars Toleikis, Lukas Pekar, Harald Kolmar, Stefan Zielonka,
and Simon Krah
13 Affinity Maturation of the Natural Ligand (B7-H6) for Natural
Cytotoxicity Receptor NKp30 by Yeast Surface Display. . . . . . . . . . . . . . . . . . . . . . 231
Stefan Zielonka, Simon Krah, Paul Arras, Britta Lipinski,
Jasmin Zimmermann, Ammelie Svea Boje, Katja Klausz,
Matthias Peipp, and Lukas Pekar
14 Accessing Transient Binding Pockets by Protein Engineering
and Yeast Surface Display Screening . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 249
Jorge A. Lerma Romero and Harald Kolmar
15 Tyrosine Phosphorylation Screening on the Yeast Surface by Magnetic
Bead Selection and FACS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 275
Jose Ezagui and Lawrence A. Stern
16 Bulk Reformatting of Antibody Fragments Displayed on the Surface
of Yeast Cells to Final IgG Format for Mammalian Production . . . . . . . . . . . . . . . 291
Stefania C. Carrara, Jan P. Bogen, David Fiebig, Julius Grzeschik,
Björn Hock, and Harald Kolmar
17 Antibody-Secreting Cell Isolation from Different Species
for Microfluidic Antibody Hit Discovery. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 313
Ramona Gaa, Qingyong Ji, and Achim Doerner
18 Efficient Microfluidic Downstream Processes for Rapid Antibody
Hit Confirmation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 327
Ramona Gaa, Hannah Melina Mayer, Daniela Noack,
and Achim Doerner
19 Cell Line Development Using Targeted Gene Integration
into MAR-Rich Landing Pads for Stable Expression of Transgenes. . . . . . . . . . . . 343
Claudia Oliviero, Steffen C. Hinz, Julius Grzeschik, Björn Hock,
Harald Kolmar, and Gerrit Hagens
20 Generation of Human 293-F Suspension NGFR Knockout Cells
Using CRISPR/Cas9 Coupled to Fluorescent Protein Expression . . . . . . . . . . . . 361
Stefanie Schatz, Femke Harmina van Dijk, Aleksandra Elzbieta Dubiel,
Tobias Cantz, Reto Eggenschwiler, and Jörn Stitz
21 Antibody Display Technology (ADbody) to Present Challenging
and Unstable Target Proteins on Antibodies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 373
Fu-Lien Hsieh and Tao-Hsin Chang
22 SUMO: In Silico Sequence Assessment Using Multiple Optimization
Parameters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 383
Andreas Evers, Shipra Malhotra, Wolf-Guido Bolick, Ahmad Najafian,
Maria Borisovska, Shira Warszawski, Yves Fomekong Nanfack,
Daniel Kuhn, Friedrich Rippmann, Alejandro Crespo,
and Vanita Sood
Contents ix
23 Streamlined Data Analysis Pipeline for Deep Sequence-Coupled

Biopanning Identification of Pathogen-Specific Antibody Responses
in Serum. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 399
Javier Leo, Susan B. Core, and Kathryn M. Frietze
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 407
Contributors
PAUL ARRAS • Antibody Discovery and Protein Engineering, Merck Healthcare KGaA,
Darmstadt, Germany; Protein Engineering and Antibody Technologies (PEAT), Merck
Healthcare KGaA, Darmstadt, Germany
CHRISTINA BAUER • Protein Engineering and Antibody Technologies (PEAT), Merck
STEFAN BECKER • Protein Engineering and Antibody Technologies (PEAT), Merck
THEODORE BELECCIU • Department of Chemical Engineering and Materials Science,
Michigan State University, East Lansing, MI, USA; Institute for Quantitative Health
Sciences and Engineering, Michigan State University, East Lansing, MI, USA
FILIPPO BENEDETTI • Christian Doppler Laboratory for Innovative Immunotherapeutics,
Institute of Molecular Biology, Department of Biotechnology, University of Natural
Resources and Life Sciences (BOKU), Vienna, Austria
JAN P. BOGEN • Institute for Organic Chemistry and Biochemistry, Technical University of
Darmstadt, Darmstadt, Germany; Ferring Darmstadt Laboratories, Darmstadt,
Germany
AMMELIE SVEA BOJE • Stem Cell Transplantation and Immunotherapy, Division of
Antibody-Based Immunotherapy, Department of Medicine II, Christian Albrechts
University Kiel and University Medical Center Schleswig-Holstein, Kiel, Germany
WOLF-GUIDO BOLICK • Ginkgo Analytics GmbH, Hamburg, Germany
MARIA BORISOVSKA • Computational Chemistry & Biologics (CCB), EMD Serono, Billerica,
MA, USA
RONGFENG CAI • The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry
of Education, School of Biotechnology, Jiangnan University, Wuxi, China
TOBIAS CANTZ • Research Group Translational Hepatology and Stem Cell Biology,
Department of Gastroenterology, Hepatology, and Endocrinology, Hannover Medical
School, Hannover, Germany
STEFANIA C. CARRARA • Institute for Organic Chemistry and Biochemistry, Technical
University of Darmstadt, Darmstadt, Germany; Ferring Darmstadt Laboratories,
Darmstadt, Germany
TAO-HSIN CHANG • Department of Molecular Biology and Genetics, Johns Hopkins
University School of Medicine, Baltimore, MD, USA; Howard Hughes Medical Institute,
Baltimore, MD, USA
ELKE CIESIELSKI • Protein Engineering and Antibody Technologies (PEAT), Merck
SUSAN B. CORE • Department of Molecular Genetics and Microbiology, School of Medicine,
University of New Mexico, Albuquerque, NM, USA
ALEJANDRO CRESPO • Computational Chemistry & Biologics (CCB), EMD Serono, Billerica,
MA, USA
ARIO DE MARCO • Laboratory of Environmental and Life Sciences, University of Nova
Gorica, Rožna Dolina, Nova Gorica, Slovenia
CLAUDIA D’ERCOLE • Laboratory of Environmental and Life Sciences, University of Nova
Gorica, Rožna Dolina, Nova Gorica, Slovenia
xi
xii Contributors
CHARLES DAHLSSON LEITAO • Department of Protein Science, KTH – Royal Institute of

Technology, Stockholm, Sweden
ACHIM DOERNER • Protein Engineering and Antibody Technologies, Merck Healthcare
KGaA, Darmstadt, Germany
ALEKSANDRA ELZBIETA DUBIEL • Research Group Medical Biotechnology & Bioengineering,
Faculty of Applied Natural Sciences, TH Köln – University of Applied Sciences, Campus
Leverkusen, Leverkusen, Germany
RETO EGGENSCHWILER • Research Group Translational Hepatology and Stem Cell Biology,
Department of Gastroenterology, Hepatology, and Endocrinology, Hannover Medical
School, Hannover, Germany
ANDREAS EVERS • Computational Chemistry & Biologics (CCB), Merck Healthcare KGaA,
Darmstadt, Germany
JOSE EZAGUI • Department of Chemical, Biological and Materials Engineering, University of
South Florida, Tampa, FL, USA
DAVID FIEBIG • Institute for Organic Chemistry and Biochemistry, Technical University of
Darmstadt, Darmstadt, Germany; Ferring Darmstadt Laboratories, Darmstadt,
Germany
YVES FOMEKONG NANFACK • Computational Chemistry & Biologics (CCB), EMD Serono,
Billerica, MA, USA
KATHRYN M. FRIETZE • Department of Molecular Genetics and Microbiology, School of
Medicine, University of New Mexico, Albuquerque, NM, USA; Clinical and Translational
Science Center, University of New Mexico Health Sciences, Albuquerque, NM, USA
RAMONA GAA • Protein Engineering and Antibody Technologies, Merck Healthcare KGaA,
Darmstadt, Germany
JULIUS GRZESCHIK • Ferring Biologics Innovation Centre, Epalinges, Switzerland
AUDREY GUILBAUD • Nantes Université, Univ Angers, INSERM, CNRS, Immunology and
New Concepts in ImmunoTherapy, INCIT, UMR 1302/EMR6001, Nantes, France
GERRIT HAGENS • Institute of Life Technologies, Haute Ecole d’Ingénierie HES-SO Valais
Wallis, Sion, Switzerland
STEFFEN C. HINZ • Institute of Life Technologies, Haute Ecole d’Ingénierie HES-SO Valais
BJÖRN HOCK • Institute for Organic Chemistry and Biochemistry, Technical University of
Darmstadt, Darmstadt, Germany; Aerium Therapeutics, Biopôle, Epalinges, Switzerland
FU-LIEN HSIEH • Department of Molecular Biology and Genetics, Johns Hopkins University
School of Medicine, Baltimore, MD, USA; Howard Hughes Medical Institute, Baltimore,
MD, USA
XUEFEI HUANG • Institute for Quantitative Health Sciences and Engineering, Michigan
State University, East Lansing, MI, USA; Department of Chemistry, Michigan State
University, East Lansing, MI, USA
QINGYONG JI • Protein Engineering and Antibody Technologies, EMD Serono, Billerica, MA,
USA
CALLUM JOYCE • Early Solutions, UCB Biopharma UK, Slough, UK
KATJA KLAUSZ • Division of Antibody-Based Immunotherapy, Department of Internal
Medicine II, University Medical Center Schleswig-Holstein and Christian-Albrechts-
University Kiel, Kiel, Germany; Stem Cell Transplantation and Immunotherapy, Division
of Antibody-Based Immunotherapy, Department of Medicine II, Christian Albrechts
Contributors xiii
DANIEL KLEWINGHAUS • Antibody Discovery and Protein Engineering, Merck Healthcare

HARALD KOLMAR • Institute for Organic Chemistry and Biochemistry, Technical University
of Darmstadt, Darmstadt, Germany; Centre for Synthetic Biology, Technical University of
Darmstadt, Darmstadt, Germany
SIMON KRAH • Protein Engineering and Antibody Technologies (PEAT), Merck Healthcare
KGaA, Darmstadt, Germany; Antibody Discovery and Protein Engineering, Merck
STEFFEN KROHN • Division of Antibody-Based Immunotherapy, Department of Internal
University Kiel, Kiel, Germany
DANIEL KUHN • Computational Chemistry & Biologics (CCB), Merck Healthcare KGaA,
Darmstadt, Germany
SATYENDRA KUMAR • Protein Engineering and Antibody Technologies (PEAT), EMD Serono
Research and Development Institute, Billerica, MA, USA
ALASTAIR D. G. LAWSON • Early Solutions, UCB Biopharma UK, Slough, UK
JAVIER LEO • Department of Molecular Genetics and Microbiology, School of Medicine,
University of New Mexico, Albuquerque, NM, USA
JORGE A. LERMA ROMERO • Institute for Organic Chemistry and Biochemistry, Technical
University of Darmstadt, Darmstadt, Germany
BRITTA LIPINSKI • Antibody Discovery and Protein Engineering, Merck Healthcare KGaA,
Darmstadt, Germany; Protein Engineering and Antibody Technologies (PEAT), Merck
Healthcare KGaA, Darmstadt, Germany; Institute for Organic Chemistry and
Biochemistry, Technische Universit€
at Darmstadt, Darmstadt, Germany
JOHN LÖFBLOM • Department of Protein Science, KTH – Royal Institute of Technology,
Stockholm, Sweden
ALEX MACPHERSON • Early Solutions, UCB Biopharma UK, Slough, UK
SHIPRA MALHOTRA • Computational Chemistry & Biologics (CCB), EMD Serono, Billerica,
MA, USA
HANNAH MELINA MAYER • Protein Engineering and Antibody Technologies, Merck
AHMAD NAJAFIAN • Computational Chemistry & Biologics (CCB), EMD Serono, Billerica,
MA, USA
ATHAR NAKISA • Institute for Quantitative Health Sciences and Engineering, Michigan State
University, East Lansing, MI, USA; Department of Chemistry, Michigan State University,
East Lansing, MI, USA
DANIELA NOACK • Protein Engineering and Antibody Technologies, Merck Healthcare
CLAUDIA OLIVIERO • Institute of Life Technologies, Haute Ecole d’Ingénierie HES-SO Valais
NATHANIEL PASCUAL • Department of Chemical Engineering and Materials Science,
Michigan State University, East Lansing, MI, USA; Institute for Quantitative Health
Sciences and Engineering, Michigan State University, East Lansing, MI, USA
FRÉDÉRIC PECORARI • Nantes Université, Univ Angers, INSERM, CNRS, Immunology and
New Concepts in ImmunoTherapy, INCIT, UMR 1302/EMR6001, Nantes, France
MATTHIAS PEIPP • Division of Antibody-Based Immunotherapy, Department of Internal
University Kiel, Kiel, Germany; Stem Cell Transplantation and Immunotherapy, Division
xiv Contributors
of Antibody-Based Immunotherapy, Department of Medicine II, Christian Albrechts

LUKAS PEKAR • Protein Engineering and Antibody Technologies (PEAT), Merck Healthcare
KGaA, Darmstadt, Germany; Antibody Discovery and Protein Engineering, Merck
FRIEDRICH RIPPMANN • Computational Chemistry & Biologics (CCB), Merck Healthcare
FLORIAN RÜKER • Christian Doppler Laboratory for Innovative Immunotherapeutics,
STEFANIE SCHATZ • Research Group Medical Biotechnology & Bioengineering, Faculty of
Applied Natural Sciences, TH Köln – University of Applied Sciences, Campus Leverkusen,
Leverkusen, Germany; Institute of Technical Chemistry, Leibniz University Hannover,
Hannover, Germany
SAM SCHMIDT • Department of Chemical Engineering and Materials Science, Michigan
State University, East Lansing, MI, USA; Institute for Quantitative Health Sciences and
Engineering, Michigan State University, East Lansing, MI, USA
ANTHONY SCOTT-TUCKER • Early Solutions, UCB Biopharma UK, Slough, UK
CAROLIN SELLMANN • Protein Engineering and Antibody Technologies (PEAT), Merck
VANITA SOOD • Computational Chemistry & Biologics (CCB), EMD Serono, Billerica, MA,
USA
LOUISE SPEIGHT • Early Solutions, UCB Biopharma UK, Slough, UK
KATHARINA STADLBAUER • Christian Doppler Laboratory for Innovative
Immunotherapeutics, Institute of Molecular Biology, Department of Biotechnology,
University of Natural Resources and Life Sciences (BOKU), Vienna, Austria
GERHARD STADLMAYR • Christian Doppler Laboratory for Innovative Immunotherapeutics,
STEFAN STÅHL • Department of Protein Science, KTH – Royal Institute of Technology,
Stockholm, Sweden
LAWRENCE A. STERN • Department of Chemical, Biological and Materials Engineering,
University of South Florida, Tampa, FL, USA
JÖRN STITZ • Research Group Medical Biotechnology & Bioengineering, Faculty of Applied
Natural Sciences, TH Köln – University of Applied Sciences, Campus Leverkusen,
Leverkusen, Germany
LARS TOLEIKIS • Protein Engineering and Antibody Technologies (PEAT), Merck Healthcare
FEMKE HARMINA VAN DIJK • Research Group Medical Biotechnology & Bioengineering,
Faculty of Applied Natural Sciences, TH Köln – University of Applied Sciences, Campus
Leverkusen, Leverkusen, Germany
LENA VOLLMER • Institute for Organic Chemistry and Biochemistry, Technische Universit€ at
Darmstadt, Darmstadt, Germany
SHIRA WARSZAWSKI • Computational Chemistry & Biologics, Merck KGaA, Yavne, Israel
DANIEL WOLDRING • Department of Chemical Engineering and Materials Science, Michigan
State University, East Lansing, MI, USA; Institute for Quantitative Health Sciences and
Engineering, Michigan State University, East Lansing, MI, USA
Contributors xv
GORDANA WOZNIAK-KNOPP • Christian Doppler Laboratory for Innovative

Immunotherapeutics, Institute of Molecular Biology, Department of Biotechnology,
University of Natural Resources and Life Sciences (BOKU), Vienna, Austria
DESISLAVA YANAKIEVA • Antibody Discovery and Protein Engineering, Merck Healthcare
KGaA, Darmstadt, Germany; Protein Engineering and Antibody Technologies (PEAT),
Merck Healthcare KGaA, Darmstadt, Germany
NANDI ZHOU • The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry
of Education, School of Biotechnology, Jiangnan University, Wuxi, China
STEFAN ZIELONKA • Protein Engineering and Antibody Technologies (PEAT), Merck
Healthcare KGaA, Darmstadt, Germany; Antibody Discovery and Protein Engineering,
Merck Healthcare KGaA, Darmstadt, Germany; Institute for Organic Chemistry and
Biochemistry, Technische Universit€at Darmstadt, Darmstadt, Germany
JASMIN ZIMMERMANN • Antibody Discovery and Protein Engineering, Merck Healthcare
KGaA, Darmstadt, Germany; Protein Engineering and Antibody Technologies (PEAT),
Merck Healthcare KGaA, Darmstadt, Germany; Institute for Organic Chemistry and
Biochemistry, Technische Universit€at Darmstadt, Darmstadt, Germany
Chapter 1
Quantitative Determination of Staphylococcus aureus

Using Aptamer-Based Recognition and DNA Amplification
Machinery
Nandi Zhou and Rongfeng Cai
Abstract
Staphylococcus aureus (S. aureus) is a common foodborne pathogen that threatens human health and safety.
It is significant to develop sensitive detection methods for the monitoring of S. aureus contamination in
food and environment. Herein, a novel machinery based on aptamer recognition, DNA walker, and rolling
circle amplification (RCA) was designed, which can form unique DNA nanoflower and subsequently detect
low-level S. aureus contamination in samples. To this end, two rationally designed DNA duplexes were
modified on the surface of the electrode to identify S. aureus through the high affinity between aptamers
and S. aureus. Combined with the repeated movement of DNA walker machinery on the electrode surface
and RCA technology, a unique DNA nanoflower structure was formed. This can effectively transform the
biological information of aptamer recognition of S. aureus into a significantly amplified electrochemical
signal. Through reasonable design and optimization of the parameters of each part, the linear response
range of the S. aureus biosensor is from 60 to 6 × 107 CFU/mL and the detection limit is as low as 9 CFU/
mL.
Key words Staphylococcus aureus, Aptamer, DNA walker, Rolling circle amplification, Electrochemical
detection
1 Introduction
Staphylococcus aureus (S. aureus) is one of the most common food-

borne pathogens. Food contaminated by S. aureus or S. aureus
toxin can cause poisoning infections [1]. Traditional microbial
detection techniques for S. aureus include microbial detection,
instrumental analysis, immunological method, and molecular biol-
ogy detection. These methods have high detection accuracy and
good specificity. However, most of the detection methods require a
long detection time, tedious steps, and high cost, which restrict
their applications [2]. Biosensors are a kind of self-contained ana-
lytical devices consisting of biometric elements and signal
Stefan Zielonka and Simon Krah (eds.), Genotype Phenotype Coupling: Methods and Protocols, Methods in Molecular Biology,
vol. 2681, https://doi.org/10.1007/978-1-0716-3279-6_1,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023
1
2 Nandi Zhou and Rongfeng Cai
converters [3]. They are usually superior in their rapid detection

and high sensitivity, and thus have great potential in the detection
of microorganisms [4, 5].
Aptamers are DNA or RNA obtained in vitro by the systematic
evolution of ligands by exponential enrichment (SELEX), which
have special spatial structures and can bind to specific targets
[6]. The binding of aptamers to targets is similar to that of
antigen-antibody binding, both of which can be used for the con-
struction of bioanalytical platforms and are widely applied in the
diagnosis and treatment of diseases [7, 8]. The binding of aptamers
to targets is usually determined by their specific spatial structure
[9]. When designing a biosensor, a single aptamer can bind to a
specific number of targets (that is, the ratio of an aptamer to target
is 1: n) [10]. However, this recognition mechanism has certain
limitations on the sensitivity of detection, and a target molecule
can only trigger a specific number of signal molecules [11]. To
break through this limitation and improve the sensitivity of biosen-
sors, different signal amplification technologies have been devel-
oped, including cyclic amplification [12], enzyme catalysis
amplification [13], and nanomaterial-mediated amplification
[14]. Among them, cyclic amplification can make the signal
changes induced by a single molecule being recycled for multiple
times to achieve the effect of signal amplification.
In DNA-related biosensors, many amplification strategies have
been developed. Commonly used recycling reactions include roll-
ing circle amplification [15], strand displacement amplification
[16], and DNA walker-based amplification [17]. Among them,
DNA walker-based signal amplification has received extensive
attention due to its ease of synthesis, sequence predictability, and
programmability [18]. DNA walkers are nanoscale molecular
devices driven by environmental stimuli [19], enzymatic reactions
[20], or strand displacement reactions [21]. They can perform
mechanical cyclic repetitive motions along DNA tracks composed
of nucleic acids to achieve signal cascade amplification. Combined
with biosensors, the DNA components in the DNA walkers can be
triggered by specific targets. Then enzyme-mediated DNA sub-
strate hydrolysis or toehold-mediated strand replacement occurs,
leading to DNA hybridization in turn. Target binding-induced
DNA walkers can activate hundreds of signaling molecules in
response to a single, highly specific binding, providing a promising
tool for designing signal amplification methods [22].
Herein, we present a quantitative determination method for
S. aureus using aptamer-based recognition and DNA amplification
machinery. As shown in Fig. 1, the gold electrode surface is mod-
ified with aptamer/DNA walker (W) and auxiliary sequence (AS)/
RCA reaction primer (RP) duplexes. By identifying S. aureus in the
sample, aptamer recognition and DNA walker movement are trig-
gered. The DNA walker walks along the electrode surface with the
Aptamer-Based Biosensing Amplification Machinery 3
Fig. 1 Schematic representation of the biosensor for S. aureus based on a DNA walker and DNA nanoflowers.
(Reprinted by permission from ACS publications: Cai et al. [23])
help of Exo III and undergoes hydrolysis. Then the circular DNA
and phi29 DNA polymerase initiate the rolling circle amplification.
DNA nanoflowers with a high specific surface area are formed on
the electrode surface due to the self-assembly of the sequence
amplification. The loaded electroactive methylene blue provides a
high electrochemical signal to realize the determination of S. aureus
in the sample.
2 Materials
Prepare all solutions using ultrapure water (18 MΩ cm) obtained

from a Millipore water purification system and analytical grade
reagents. Store all reagents at 4 °C. Diligently follow all waste
disposal regulations when disposing waste materials.
2.1 Strains 1. Staphylococcus aureus (S. aureus, ATCC 29213).

2. Enterococcus faecium (E. faecium, ATCC 19434).
3. Listeria monocytogenes (L. monocytogenes, BNCC 336877).
4. Pseudomonas aeruginosa (P. aeruginosa, preserved in our lab).
5. Enterococcus faecalis (E. faecalis, ATCC 19433).
6. Salmonella enteritidis (S. enteritidis, BNCC103134).
2.2 Oligonucleotides 1. S. aureus aptamer: 5′- GCAATGGTACGGTACTTCCTCGG

CACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGC
TACGTCAAAAGTGCACGCTACTTTGCTAA-3′.
2. RCA reaction primer (RP): 5′-SH-(CH2)6-TTTTTTTTCGA
CTCGACTCGACTGGCAAGTACCATTGC-3′ (see Note 1).
3. DNA walker 40 (W40): 5′-SH-(CH2)6-T40- GTAGCGTG
CACTTTTGACGTAGCTGTGGGATGACCAGC
GATTTTTTTTTT-3′ (see Note 2).
4. Auxiliary sequence 1 (AS1): 5′-T15- TTGCCAGTCGAGTC
GAGTCGTCGCTGGTCATCCCA-3′ (see Note 3).
5. DNA walker 35 (W35): 5′-SH-(CH2)6-T40- GTAGCGTG
CACTTTTGACGTAGCTGTGGGATGACCTTTTTTTTTT-3′.
6. Auxiliary sequence 2 (AS2): 5′-T15- TTGCCAGTCGAGTC
GAGTCGGGTCATCCCACAGCT-3′ (see Note 4).
7. DNA walker 30 (W30): 5′-SH-(CH2)6-T40- TAGCGTG
CACTTTTGACGTAGCTGTGGGATTTTTTTTTT-3′.
8. DNA walker 25 (W25): 5′-SH-(CH2)6-T40- TGCACTTTT
GACGTAGCTGTGGGATTTTTTTTTT-3′.
9. DNA walker 20 (W20): 5′-SH-(CH2)6-T40- TTTTGACG
TAGCTGTGGGATTTTTTTTTT-3′.
10. Auxiliary sequence 25 (AS25): 5′-T15-TTGCCAGTCGAGTC
GAGTCGAAAAATCCCACAGCTACGTC-3′ (see Note 5).
11. Auxiliary sequence 20 (AS20): 5′-T15-TTGCCAGTCGAGTC
GAGTCGTCCCACAGCTACGTC-3′.
12. Auxiliary sequence 15 (AS15): 5′-T15- TTGCCAGTC
GAGTCGTCCCACAGCTACGTC-3′.
13. Auxiliary sequence 10 (AS10): 5′-T15- TTGCCAGTCGTCC
CACAGCTACGTC-3′.
14. Circular template 1 (CT1): 5′-P-CTCGACTGGCGCAATGG
TACTTGCCAGTCGAGTCGAGTCGGCAATGG
TACTTGTTTGCCGACTCGA-3′ (see Note 6).
15. Circular template 2 (CT2): 5′-P- TGCCGACTCGAG
CAATGGTACTTGCCAGTCGAGTCGAGTCGGCAATGG
TACTTGTTCTCGACTGGC-3′ (see Note 7).
16. Circular template 2 ligation primer (CT2 LP): 5′-TCGAGTC
GGCAGCCAGTCGAG-3′ (see Note 8).
2.3 Media 1. LB liquid media: Weigh 10 g peptone, 10 g NaCl, and 5 g yeast

powder and transfer to a 1 L glass beaker. Add about 100 mL
water to the beaker. Cover the beaker with plastic wrap (see
Note 9). Stir with a magnetic stirrer. Make up to 1 L with
water. Dispense the liquid media into 250 mL conical flasks,
each containing 50 mL. Seal the conical flask with the sterile
filtration air-permeable sealing film and brown paper in turn.

Sterilize for 20 min at 121 °C.
2. LB solid media: Weigh 10 g peptone, 10 g NaCl, 5 g yeast
powder, 1.5 g agar, and transfer to a 1 L glass beaker. Add
about 100 mL water to the beaker. Cover the beaker with
plastic wrap. Stir with a magnetic stirrer. Make up to 1 L with
water. Dispense the liquid media into 250 mL conical flasks,
each containing 50 mL. Seal the conical flask with the sterile
filtration air-permeable sealing film and brown paper in turn.
Sterilize for 20 min at 121 °C.
2.4 Preparation and 1. Piranha solution: Take 1 mL 30% H2O2 and 1 mL 98% H2SO4.
Modification of Gold Mix them at a ratio of 3:7. Stir with the vortex mixer (see
Electrode Note 10).
2. 0.5 M H2SO4: Take 40 mL water into a 100 mL glass beaker.
Add about 1.3889 mL of 98% H2SO4 into the beaker. Stir with
a magnetic stirrer. Make up to 50 mL with water (see Note 11).
3. 10 mM phosphate-buffered saline (PBS, pH 7.0): Weigh
1.560 g NaH2PO4·2H2O and transfer to a 1 L glass beaker.
Add about 100 mL water to the beaker. Cover the beaker with
plastic wrap. Stir with a magnetic stirrer. Make up to 1 L with
water to prepare the 10 mM NaH2PO4 solution. Weigh
3.581 g Na2HPO4·12H2O and transfer to another 1 L glass
beaker. Add about 100 mL water to the beaker. Cover the
beaker with plastic wrap. Stir with a magnetic stirrer. Make
up to 1 L with water to prepare 10 mM Na2HPO4 solution.
Weigh 7.455 g KCl and transfer to the third 1 L glass beaker.
Mix NaH2PO4 solution and Na2HPO4 solution at the ratio of
38:62 in the third beaker and adjust pH to 7.0 with the two
solutions. Stir with a magnetic stirrer. Make up to 1 L with the
two solutions. Store at 4 °C until use (see Note 12).
4. 1 M 6-mercapto-1-hexanol (6-MCH) solution: Take about
2.89 mL PBS into a 5 mL centrifuge tube. Add about 0.4 μL
97% 6-MCH into the tube. Stir with vortex mixer (see
Note 13).
2.5 Detection of S. 1. 1 mM [Fe(CN)6]4-/3- solution: Weigh 0.0823 g K3[Fe

aureus (CN)6], 0.1056 g K4Fe(CN)6, and 1.8638 g KCl and transfer
them to a 500 mL glass beaker. Add about 100 mL PBS to the
beaker. Cover the beaker with plastic wrap. Stir with a magnetic
stirrer. Make up to 250 mL with PBS.
2. 5 × TBE buffer (pH 8.0): Weigh 54 g Tris, 3.72 g
Na2EDTA·2H2O, and 27.5 g boric acid, and transfer them to
a 1 L glass beaker. Add about 100 mL water to the beaker.
Cover the beaker with plastic wrap. Stir with a magnetic stirrer.
Adjust pH to 7.0 with NaOH or HCl solution. Make up to 1 L

with water (see Note 14).
3. Gelred nucleic acid staining solution: Weigh 0.585 g NaCl, and
transfer to a 250 mL glass beaker. Add about 90 mL water and
30 μL 10,000 × Gelred to the beaker. Cover the beaker with
plastic wrap. Stir with a magnetic stirrer. Make up to 100 mL
with water.
4. 1 M NaOH: Weigh 4 g NaOH and transfer to a 250 mL glass
beaker. Add about 90 mL water to the beaker. Cover the
beaker with plastic wrap. Stir with a magnetic stirrer. Make
up to 100 mL with water (see Note 15).
5. 0.1 M NaOH: Take about 80 mL water and transfer it to a
250 mL glass beaker. Add about 10 mL 1 M NaOH to the
stirrer. Make up to 100 mL with water.
6. 1 M HCl: Take 50 mL water and transfer it to a 250 mL glass
beaker. Add about 8.333 mL of 36–38% HCl to the beaker.
Cover the beaker with plastic wrap. Stir with a magnetic stirrer.
Make up to 100 mL with water (see Note 15).
7. 0.1 M HCl: Take about 80 mL water and transfer it to a
250 mL glass beaker. Add about 10 mL 1 M HCl to the beaker.
Make up to 100 mL with water.
8. Methylene blue solution: Weigh 25.588 mg C16H18N3ClS and
transfer to a 100 mL glass beaker. Add about 40 mL PBS to the
stirrer. Make up to 50 mL with PBS.
9. Aqua regia: Take 2.5 mL HNO3 and transfer it to a 50 mL glass
beaker. Slowly add 7.5 mL HCl to the beaker. Stir with a glass
rod (see Note 16).
3 Methods
3.1 Cultivation and 1. Take S. aureus competent cell suspension from -40 °C freezer.
Preparation of Thaw at room temperature.
Bacterial Strains 2. Dip the bacterial solution with the inoculation loop and inocu-
late the bacteria on the sterilized LB solid media by the streak
plate method (see Note 17).
3. Cultivate at 37 °C for 24 h at an agitation rate of 220 rpm.
4. Pick a single colony with an inoculating loop and inoculate it in
sterilized LB liquid medium (see Note 18). Cultivate to
OD600 = 0.2.
5. Centrifuge 1 mL medium at 4 °C for 5 min at 976 g. Discard
the supernatant. Add 1 mL PBS into the bacterial precipitation.
Stir with a vortex mixer. Repeat the step and rinse the bacterial
precipitation with PBS for three times. Re-dissolve the bacterial
precipitation with 1 mL PBS.
6. Serially dilute the bacterial suspension in a tenfold gradient
with PBS.
7. Take 100 μL of bacterial suspension and spread it on the plate
(see Note 19).
8. Cultivate at 37 °C for 24 h.
9. Count the colonies on each plate (see Note 20). Calculate the
final bacterial concentration using the formula:
CFU/mL = Colonies (CFU) × Dilution factor/0.1 (mL).
10. Cultivate other bacteria for specificity studies under the same
culture conditions.
3.2 Preparation of 1. Take 2 μL of 1 μM W and 4 μL of 1 μM S. aureus aptamer to the

Aptamer/W, AS/RP 0.5 mL centrifuge tube. Make up to 10 μL with PBS. Stir with a
Duplexes vortex mixer.
2. Take 1 μL of 10 μM RP, and 2 μL of 10 μM AS to the 0.5 mL
centrifuge tube. Make up to 10 μL with PBS. Stir with a vortex
mixer.
3. Denature the sequences in the two tubes at 95 °C for 10 min
and place the tubes in the ice bath for 10 min to form aptamer/
W duplex and AS/RP duplex, respectively (see Note 21).
3.3 Formation of the 1. Take 8 μL of 100 μM CT1, and denature at 95 °C for 10 min.
Circular DNA Cool down slowly to 37 °C and incubate at 37 °C for 2 h.
2. DNA circular structure reaction system (40 μL): 8 μL of
100 μM CT1, 1 μL of 40 U/μL T4 DNA ligase, 4 μL
10 × T4 DNA ligase buffer, and 27 μL ddH2O. Stir with a
vortex mixer.
3. Incubate the reaction system at 16 °C for 12 h to complete the
ligation.
4. Heat the ligation solution at 65 °C for 10 min to terminate the
reaction.
5. Store the product at 4 °C for further use.
3.4 Verification 1. Assemble the matching glass plate into the plastic mold (see
Through Note 22).
Polyacrylamide-Gel 2. 12% native PAGE gel (6 mL): 2355 μL water, 2400 μL 30%
Electrophoresis (PAGE) Acryl/Bis solution (29:1), 1200 μL 5 × TBE buffer, 36 μL of
10% ammonium persulfate, and 9 μL TEMED. Blow and mix
with a pipette.
3. Cast the gel into the glass plate and insert the comb slowly and
smoothly (see Note 23).
4. Take out the gel from the mold after the gel is polymerized (see
Note 24). Fix it in the electrophoresis tank. Slowly pull out the
comb (see Note 25).
5. Add about 1 L 1 × TBE buffer to the electrophoresis tank to
cover the gel plate.
6. Take 5 μL sample and 1 μL 6 × loading buffer, mix with a
pipette. Load the mixture along the edge of the sample well.
7. Set the electrophoresis at 120 V for 45 min (see Note 26).
8. Turn off the power of the electrophoresis system.
9. Take out the gel from the tank (see Note 27).
10. Place the gel in a beaker containing Gelred staining solution.
Wrap the beaker with tin foil. Shake continuously for 45 min at
room temperature (see Note 28).
11. Photograph the electrophoresis results with a gel imager.
3.5 Preparation and 1. Soak the gold electrode in piranha solution for 15 min to
Modification of Gold remove impurities on the surface of the electrode.
Electrode 2. Rinse the surface of the electrode with ultrapure water.
3. Clean the electrode surface electrochemically with 0.5 M
H2SO4 to activate the electrode. Set the sweep range of -
0.35 to -1.5 V, scan rate at 0.1 V/s, sample interval of 0.01 V.
4. Clean the gold electrode with ultrapure water. Gently dry the
electrode surface with ultrapure nitrogen.
5. Mix the aptamer/W and AS/RP duplexes. Stir with a vortex
mixer.
6. Drop 10 μL duplexes mixture on the gold electrode surface.
Incubate in the incubator at 30 °C for 12 h to modify the
duplexes onto the electrode surface (see Note 29).
7. Rinse the electrode with ultrapure water for 15 s to remove
unmodified DNA (see Note 30).
8. Put the modified electrode in [Fe(CN)6]4-/3- solution, and
set the scan frequency of 0.1 Hz - 10 kHz. Use electrochemi-
cal impedance spectroscopy to characterize the modification
process of the electrode.
9. Put each modified electrode into 100 μL of 1 M 6-MCH at
room temperature for 60 min to avoid non-specific adsorption
of DNA on the electrode surface.
3.6 Target 1. Slowly rinse the gold electrode surface with PBS. Put the
Incubation and Exo III electrode in 100 μL PBS containing different concentrations
Enzymatic Hydrolysis of S. aureus in the incubator at 37 °C for 60 min.
2. Exo III reaction system (10 μL): 0.75 μL of 10 U/μL Exo III,
1 μL 10 × Exo III buffer, and 8.25 μL ddH2O. Stir with a
vortex mixer.
3. Drop 10 μL Exo III reaction system to the surface of the gold
electrode, and incubate at 37 °C for 80 min (see Note 31).
3.7 Rolling Circle 1. Gently rinse the electrode with PBS after the Exo III digestion
Amplification Reaction reaction.
2. Rolling circle amplification reaction system (100 μL): 2 μL
ligated CT, 10 μL 10 × phi 29 DNA polymerase buffer, 1 μL
of 10 U/μL phi 29 DNA polymerase, 5 μL of 25 μM dNTPs,
10 μL of 2 mg/mL BSA, and 72 μL methylene blue solution.
Stir with a vortex mixer.
3. Incubate the gold electrode into the rolling circle amplification
system at 30 °C for 3 h.
4. Gently rinse the gold electrode with PBS to remove excess
methylene blue. Dry the electrode with ultrapure nitrogen.
3.8 Detection of S. 1. Blow the PBS with ultrapure nitrogen for 30 min to remove the
aureus dissolved oxygen in the buffer.
2. Set the reacted gold electrode as the working electrode, the
platinum electrode as the counter electrode, and silver–silver
chloride electrode as the reference electrode.
3. Insert the three electrodes into PBS and connect them to the
electrochemical workstation.
4. Use differential pulse voltammetry scan to detect the electro-
chemical signal. Set the scan voltage within -0.5 to 0.1 V.
3.9 Optimization of 1. Take 8 μL of 100 μM CT1, and denature at 95 °C for 10 min.

the Conditions for Cool down slowly to 37 °C and incubate at 37 °C for 2 h.
Electrochemical 2. DNA circular structure reaction system for CT1 (40 μL): 8 μL
Detection of S. aureus of 100 μM CT1, 1 μL of 40 U/μL T4 DNA ligase, 4 μL
3.9.1 Optimization of the
Formation of Circular DNA
vortex mixer.
3. Take 8 μL of 100 μM CT2 and 8 μL of 100 μM CT2 LP to the
0.5 mL centrifuge tube. Denature at 95 °C for 10 min, slowly
cool down to 37 °C, and incubate at 37 °C for 2 h to make
CT2/CT2 LP duplex.
4. DNA circular structure reaction system for CT2 (40 μL): 16 μL
CT2/CT2 LP duplex, 1 μL of 40 U/μL T4 DNA ligase, 4 μL
vortex mixer.
5. Use PAGE to observe the effect of two circular DNA formation
methods. When the gel concentration is relatively high, circular
DNA cannot enter the gel, and the mobility is greatly reduced.
Therefore, linear DNA and circular DNA with equivalent
Fig. 2 PAGE image of circular DNA formation. Lane M: DNA marker; lane 1: linear
CT1 (5 μM); lane 2: circular CT1 (5 μM); lane 3: CT2 LP (5 μM); lane 4: linear CT2
(5 μM); lane 5: circular CT2 (5 μM). (Reprinted by permission from ACS
publications: Cai et al. [23])
molecular weight can be clearly distinguished by high-

concentration PAGE (see Fig. 2).
6. Take two circular DNA for the rolling circle amplification
reaction in S. aureus detection. Compare the signals of the
experimental and control groups.
3.9.2 Optimization of the 1. Design the aptamer/W and AS/RP duplexes with different
Complementary Length of lengths of the complementary regions according to the second-
Aptamer/W and AS/RP ary structure (see Note 32).
Duplexes 2. The complementary lengths of aptamer and W are 20, 25,
30, 35, and 40 bps, respectively. The complementary lengths
of AS and RP are 10, 15, 20, and 25 bps, respectively.
3. Compare the influence of duplexes with different complemen-
tary lengths on the detection and choose the optimal detection
condition.
3.9.3 Optimization of the 1. Set the concentration ratio of aptamer/W and AS/RP duplex
Concentration Ratio of as 1:1, 1:2, 1:4, 1:5, and 1:10, respectively.
Aptamer/W and AS/RP 2. Compare the difference in the detection signals under different
Duplex concentration ratios.
3.9.4 Optimization of the 1. Add 5, 7.5, 10, 12.5, and 15 U Exo III in the Exo III reaction
Concentration of Exo III and system, respectively.
Reaction Time 2. Compare the difference in the detection signals under different
concentrations of Exo III.
3. Set the reaction time of Exo III as 40, 60, 80, 100, and
120 min, respectively.
4. Compare the difference in the detection signals under different
reaction time.
3.9.5 Optimization of the 1. Add 5, 7.5, 10, 12.5, and 15 U phi29 DNA polymerase in the
Concentration of phi29 rolling circle amplification system, respectively.
DNA Polymerase and 2. Compare the detection signal and the signal growth rate under
Reaction Time different concentrations of phi29 DNA polymerase.
3. Set the rolling circle amplification reaction time as 1, 3, 5, 7,
and 9 h, respectively.
4. Compare the detection signal and the signal growth rate under
different reaction time.
3.10 Field Emission 1. Remove the protective film from the purchased silicon wafer.
Scanning Electron Soak it in freshly prepared aqua regia overnight.
Microscopy 2. Wash the silicon wafer with absolute ethanol for three times.
Characterization of Then, wash the silicon wafer with acetone for three times. Dry
DNA Nanoflowers with ultrapure nitrogen.
3. Drop 5 μL rolling circle amplification product sample in the
center of the silicon wafer.
4. Dry the silicon wafer in an oven at 28 °C for 2 h. Rinse the
silicon wafer with 3 mL ddH2O (see Note 33). Put it in the
desiccator overnight.
5. Characterize the sample by a field emission scanning electron
microscope (see Fig. 3).
3.11 Detection of S. 1. Modify the gold electrode with aptamer/W and AS/RP
aureus Using duplex. Then, block the electrode with 6-MCH to avoid non-
Aptamer-Based specific adsorption of DNA on the electrode surface.
Recognition and DNA 2. Drop 100 μL PBS containing 60 to 6 × 108 CFU/mL S. aureus
Amplification onto each electrode, respectively. Incubate the electrodes at
Machinery 37 °C for 60 min.
3. Gently wash the electrodes with PBS and dry with ultrapure
nitrogen.
4. Drop 10 μL Exo III reaction system on the electrode surface
and incubate at 37 °C for 80 min.
5. Gently wash the electrode with PBS and dry with ultrapure
nitrogen.
6. Drop 100 μL rolling circle amplification reaction system on the
surface of the electrode. Incubate at 30 °C for 3 h.
7. Gently wash the electrode with PBS and dry with ultrapure
nitrogen.
8. Use electrochemical impedance spectroscopy to characterize
each reaction of the electrode (see Fig. 4).
Fig. 3 FESEM of DNA nanoflowers produced by the RCA reaction with different RCA reaction times: (a) 1, (b)
3, (c) 5, (d) 7, and (e) 9 h. The patterns in the red box of (b) and (c) are the embryonic forms of DNA
nanoflowers. (Reprinted by permission from ACS publications: Cai et al. [23])
9. Insert the electrodes into PBS and connect them to the elec-
trochemical workstation for DPV scanning. Record the current
response of each electrode (see Fig. 5).
10. Plot the current response to the logarithm of the concentration
of S. aureus to obtain the calibration curve, which is
y = 0.3206 × logC + 3.3536, R2 = 0.9924, where y represents
the current response (μA), C represents the concentration of
S. aureus (CFU/mL) (see Fig. 6). The current response has a
linear relationship with the logarithm of the concentration of
S. aureus in the range from 60 to 6 × 107 CFU/mL. The
detection limit is 9 CFU/mL (S/N = 3).
11. Add different concentrations of S. aureus to the sterilized
filtered lake water, tap water, and diluted honey to prepare
real samples simulating S. aureus contamination. Repeat steps
1–8. Drop 100 μL real sample containing S. aureus on the
electrode in step 2. Record the current response and calculate
the concentration of S. aureus using the calibration curve.
3.12 Specificity 1. Cultivate several non-target bacteria such as E. faecium,

Studies of the L. monocytogenes, P. aeruginosa, E. faecalis, and S. enteritidis
Detection Method in LB medium.
2. Repeat steps 1–8 in Subheading 3.11. Add 100 μL of
3 × 109 CFU/mL non-target bacteria in step 2.
3. Compare the current responses of the biosensor for the detec-
tion of S. aureus and other non-target bacteria.
Fig. 4 EIS curves of each step: (a) bare electrode; (b) electrode modified with
aptamer/W and AS/RP duplexes; (c) electrode modified with aptamer/W and
AS/RP duplexes and blocked with 6-MCH; (d) electrode modified with aptamer/W
and AS/RP duplexes, blocked with 6-MCH and digested by Exo III; (e) electrode
modified with aptamer/W and AS/RP duplexes, blocked with 6-MCH, digested by
Exo III, and elongated by phi29 DNA polymerase. The inset shows an enlarged
view of curves (a), (b), and (d). EIS was modeled by using Randle’s equivalent
circuit: C is the interfacial double-layer capacitance, Rs is the solution resis-
tance, Ret is the electron transfer resistance, and Zw is the Warburg impedance.
(Reprinted by permission from ACS publications: Cai et al. [23])
Fig. 5 DPV curves recorded at different concentrations of S. aureus: (a) 60,

(b) 6 × 102, (c) 6 × 103, (d) 6 × 104, (e) 6 × 105, (f) 6 × 106, (g) 6 × 107,
(h) 1.2 × 108, (i) 3 × 108, and (j) 6 × 108 CFU/mL. (Reprinted by permission from
ACS publications: Cai et al. [23])
Fig. 6 Relationship between the current response and the concentration of

S. aureus. The inset shows the linear relationship between the current response
and the logarithm of S. aureus concentration. (Reprinted by permission from ACS
publications: Cai et al. [23])
4 Notes
1. The modified group “SH-(CH2)6” at the 5′ terminal of the

sequence is used for modifying the gold electrode via the Au–
S bond.
2. The number followed by “W” indicates the length of the
complementary region of W and aptamer. The number fol-
lowed by “T” indicates the repeat number of the base T.
3. AS sequence represents an auxiliary sequence complementary
to RP. The 3′ terminal of AS1 is complementary to the 3′
terminal of W40.
4. The 3′ terminal of AS2 is complementary to the 3′ terminal
of W35.
5. The number followed by “AS” indicates the length of the
complementary region of AS and RP (except AS1 and AS2).
6. The modified group “P” at the 5′ terminal of the sequence is
used for circular DNA formation. CT1 was designed for a self-
cyclization strategy.
7. CT2 was designed for the primer-based cyclization strategy.
8. CT2 LP sequence represents the CT2 ligation primer comple-
mentary to CT2.
9. Adding 100 mL of water after weighing the chemicals can

effectively prevent the powder from scattering.
10. Piranha solution needs to be freshly prepared. Add H2O2
dropwise into H2SO4, and the reaction process is accompanied
by exothermic heat. Piranha solution is extremely corrosive.
When preparing the solution, protective equipment is needed,
and prepare it in a fume hood. Piranha solution can explode
when mixed with organic solvents. Be careful and slow when
adding substances that also have organic groups to the
solution.
11. 0.5 M H2SO4 needs to be freshly prepared. Slowly add H2SO4
to H2O, and the reaction process is accompanied by exother-
mic heat. When preparing this solution, protective equipment
is needed, and prepare it in a fume hood.
12. Buffer must be filtered with 0.22 μm membrane before stor-
age. Reconstitute buffers every month to avoid buffer contam-
ination due to microorganisms or other conditions.
13. 6-MCH has a pungent odor. Protective equipment is needed.
The solution should be prepared and used in a fume hood.
Avoid contact with skin and eyes. Avoid inhalation of vapor or
mist droplets.
14. When the TBE buffer is prepared, it needs to be stirred over-
night with a magnetic stirrer to prevent precipitation after a
period of storage due to incomplete dissolution. Dilute five
times when used as the electrophoresis solution.
15. Concentrated HCl or concentrated NaOH can be used first to
close the gap from the starting pH to the desired pH. It is then
best to use a series of lower concentrations of HCl or NaOH to
avoid sudden drops or rises in pH.
16. Aqua regia needs to be freshly prepared. Aqua regia solution is
extremely corrosive. When preparing the solution, protective
equipment is required and prepare it in a fume hood.
17. Pay attention to avoid puncturing the solid medium when
streaking the inoculation loop.
18. When picking individual colonies, pay attention to avoid con-
tamination between colonies.
19. Number the plates according to the dilution factor, and make
three replicates for each dilution factor. After adding the
diluted bacterial solution, use a sterile spatula to spread the
bacterial solution evenly on the plate. Use a sterile spatula for
each dilution bacterial dilution. When changing the dilution of
the bacterial solution, the spatula needs to be burned and
sterilized. Put the smeared plate flat on the table for
20–30 min, so that the bacterial solution penetrates in the
medium, and then invert the plate.
20. The plate with colony numbers between 30 and 300 shall be
selected for counting.
21. When the DNA sequence is denatured, it is necessary to open
the centrifuge tube to exhaust and then cover the centrifuge
tube cap. If not, the water vapor brought by the high tempera-
ture will lift the cap of the centrifuge tube. Then, the reaction
system will evaporate.
22. After assembling the plastic mold, add water to it to check
whether the mold is completely sealed. If it is not completely
sealed, the prepared gel will leak when poured into it.
23. Combs are available in 0.75 and 1 mm sizes, corresponding to
different glass plates. Carefully match the comb and the glass
plate. The comb needs to be washed and dried before use, to
prevent uneven gel concentration near the sample well. Be
gentle when inserting the comb to avoid air bubbles.
24. It usually takes 1–2 h for the gel to coagulate. The coagulation
speed becomes slower when the room temperature is lower,
thus the amount of TEMED and ammonium persulfate can be
appropriately increased. It is not advisable to place the gel for a
long time after it has coagulated. It may result in water loss and
affect the electrophoresis performance.
25. Pull out the comb slowly and vertically to avoid damaging the
sample well.
26. The electrophoresis time can be appropriately adjusted accord-
ing to the molecular weight of the sample. When the bromo-
phenol blue dye appears at the bottom of the electrophoresis
tank, the power can be turned off.
27. The thickness of the gel is small and care should be taken when
removing it to avoid breaking the gel.
28. If the high-concentration gel is easy to break during the stain-
ing process, the amount of TEMED and amine persulfate can
be appropriately reduced under the condition of high room
temperature.
29. After the mixture is dropped on the surface of the gold elec-
trode, it is buckled with a 0.5 mL centrifuge tube to avoid
evaporation of the solution.
30. When using ultrapure water to clean the gold electrode mod-
ified with DNA, avoid rinsing the surface of the gold electrode
with water flow, to prevent the damage of the modification of
the gold electrode caused by a large impact force. The elec-
trode cleaning can be performed by flowing water over the
surface of the gold electrode.
31. After the Exo III reaction system is dropped on the surface of
the gold electrode, it is buckled with a 0.5 mL centrifuge tube
to avoid evaporation of the solution.
32. The secondary structure and Gibbs free energy predictions of
duplexes can be obtained through online analysis services IDT
(https://sg.idtdna.com/) and Nupack (http://www.nupack.
org/).
33. Avoid direct rinsing when using water to clean the surface of
the silicon wafer. The water should flow slowly over the surface
of the silicon wafer.
References
1. Li H, Tang T, Stegger M, Dalsgaard A, Liu T, Bioelectron 172:112806. https://doi.org/10.
Leisner JJ (2021) Characterization of 1016/j.bios.2020.112806
antimicrobial-resistant Staphylococcus aureus 8. Funari R, Chu KY, Shen AQ (2020) Detection
from retail foods in Beijing, China. Food of antibodies against SARS-CoV-2 spike pro-
Microbiol 93:103603. https://doi.org/10. tein by gold nanospikes in an opto-microfluidic
1016/j.fm.2020.103603 chip. Biosens Bioelectron 169:112578.
2. Zhao Y, Xia D, Ma P, Gao X, Kang W, Wei J https://doi.org/10.1016/j.bios.2020.
(2020) Advances in the detection of virulence 112578
genes of Staphylococcus aureus originate from 9. Odeh F, Nsairat H, Alshaer W, Ismail MA,
food. Food Sci Hum Wellness 9:40–44. Esawi E, Qaqish B et al (2019) Aptamers
https://doi.org/10.1016/j.fshw.2019. chemistry: chemical modifications and conju-
12.004 gation strategies. Molecules 25:3. https://doi.
3. Jeong WJ, Choi SH, Lee HS, Lim YB (2019) A org/10.3390/molecules25010003
fluorescent supramolecular biosensor for bac- 10. Yan M, Bai W, Zhu C, Huang Y, Yan J, Chen A
terial detection via binding-induced changes in (2016) Design of nuclease-based target recy-
coiled-coil molecular assembly. Sens Actuators cling signal amplification in aptasensors. Bio-
B Chem 290:93–99. https://doi.org/10. sens Bioelectron 77:613–623. https://doi.
1016/j.snb.2019.03.112 org/10.1016/j.bios.2015.10.015
4. Mukama O, Wu J, Li Z, Liang Q, Yi Z, Lu X 11. Kim DM, Yoo SM (2020) DNA-modifying
et al (2020) An ultrasensitive and specific enzyme reaction-based biosensors for disease
point-of-care CRISPR/Cas12 based lateral diagnostics: recent biotechnological advances
flow biosensor for the rapid detection of and future perspectives. Crit Rev Biotechnol
nucleic acids. Biosens Bioelectron 159: 40:787–803. https://doi.org/10.1080/
112143. https://doi.org/10.1016/j.bios. 07388551.2020.1764485
2020.112143 12. Ren R, Bi Q, Yuan R, Xiang Y (2020) An
5. Bu T, Yao X, Huang L, Dou L, Zhao B, Yang B efficient, label-free and sensitive electrochemi-
et al (2020) Dual recognition strategy and cal microRNA sensor based on target-initiated
magnetic enrichment based lateral flow assay catalytic hairpin assembly of trivalent DNA-
toward Salmonella enteritidis detection. zyme junctions. Sens Actuators B Chem 304:
Talanta 206:120204. https://doi.org/10. 127068. https://doi.org/10.1016/j.snb.
1016/j.talanta.2019.120204 2019.127068
6. Sharifi S, Vahed SZ, Ahmadian E, Dizaj SM, 13. Wang JR, Xia C, Yang L, Li YF, Li CM, Huang
Eftekhari A, Khalilov R et al (2020) Detection CZ (2020) DNA nanofirecrackers assembled
of pathogenic bacteria via nanomaterials- through hybridization chain reaction for ultra-
modified aptasensors. Biosens Bioelectron sensitive SERS immunoassay of prostate spe-
150:111933. https://doi.org/10.1016/j. cific antigen. Anal Chem 92:4046–4052.
bios.2019.111933 https://doi.org/10.1021/acs.analchem.
7. Zhu A, Ali S, Xu Y, Ouyang Q, Chen Q (2021) 9b05648
A SERS aptasensor based on AuNPs functiona- 14. Han S, Liu W, Zheng M, Wang R (2020)
lized PDMS film for selective and sensitive Label-free and ultrasensitive electrochemical
detection of Staphylococcus aureus. Biosens DNA biosensor based on urchinlike carbon
nanotube-gold nanoparticle nanoclusters. Anal DNA walkers in living cells for microRNA
Chem 92:4780–4787. https://doi.org/10. imaging. Nanoscale 13:1863–1868. https://
1021/acs.analchem.9b03520 doi.org/10.1039/d0nr06651f
15. Huang R, He L, Li S, Liu H, Jin L, Chen Z et al 20. Yin Y, Chen G, Gong L, Ge K, Pan W, Li N
(2020) A simple fluorescence aptasensor for et al (2020) DNAzyme-powered three-dimen-
gastric cancer exosome detection based on sional DNA walker nanoprobe for detection
branched rolling circle amplification. Nano- amyloid beta-peptide oligomer in living cells
scale 12:2445–2451. https://doi.org/10. and in vivo. Anal Chem 92:9247–9256.
1039/c9nr08747h https://doi.org/10.1021/acs.analchem.
16. Li X, Zhang P, Dou L, Wang Y, Sun K, Zhang 0c01592
X et al (2020) Detection of circulating tumor 21. Oishi M, Saito K (2020) Simple single-legged
cells in breast cancer patients by nanopore sens- DNA walkers at diffusion-limited nanointer-
ing with aptamer-mediated amplification. ACS faces of gold nanoparticles driven by a DNA
Sens 5:2359–2366. https://doi.org/10. circuit mechanism. ACS Nano 14:3477–3489.
1021/acssensors.9b02537 https://doi.org/10.1021/acsnano.9b09581
17. Lv S, Zhang K, Zhu L, Tang D (2020) ZIF-8- 22. Wang Y, Wang Y, Liu S, Sun W, Zhang M,
assisted NaYF4:Yb,Tm@ZnO converter with Jiang L et al (2021) Toehold-mediated DNA
exonuclease III-powered DNA walker for strand displacement-driven super-fast tripedal
near-infrared light responsive biosensor. Anal DNA walker for ultrasensitive and label-free
Chem 92:1470–1476. https://doi.org/10. electrochemical detection of ochratoxin
1021/acs.analchem.9b04710 A. Anal Chim Acta 1143:21–30. https://doi.
18. Yang H, Xiao M, Lai W, Wan Y, Li L, Pei H org/10.1016/j.aca.2020.11.013
(2020) Stochastic DNA dual-walkers for ultra- 23. Cai R, Zhang S, Chen L, Li M, Zhang Y, Zhou
fast colorimetric bacteria detection. Anal Chem N (2021) Self-assembled DNA nanoflowers
92:4990–4995. https://doi.org/10.1021/ triggered by a DNA walker for highly sensitive
acs.analchem.9b05149 electrochemical detection of Staphylococcus
19. Hu H, Zhou F, Wang B, Chang X, Dai T, Tian aureus. ACS Appl Mater Interfaces 13:4905–
R et al (2021) Autonomous operation of 3D 4919
Chapter 2
Construction of Synthetic VHH Libraries in Ribosome

Display Format
Audrey Guilbaud and Frédéric Pecorari
Abstract
Single-domain antibodies, or VHH, represent an attractive molecular basis to design affinity proteins with
favorable properties. Beyond high affinity and specificity for their cognate target, they usually show high
stability and high production yields in bacteria, yeast, or mammalian cells. In addition to these favorable
properties, their ease of engineering makes them useful for many applications. Until the past few years, the
generation of VHH involved the immunization of a Camelidae with the target antigen, followed by a phage
display selection using phage libraries encoding the VHH repertoire of the animal blood sample. However,
this approach is constrained by the accessibility to the animals, and the output relies on the animal’s immune
system.
Recently, synthetic VHH libraries have been designed to avoid the use of animals. Here, we describe the
construction of VHH combinatorial libraries and their use for the selection of binders by ribosome display,
a fully in vitro selection technique.
Key words Ribosome display, Synthetic library, Single-domain antibody, VHH, Nanobody
1 Introduction
Besides conventional IgGs, Camelidae also produces IgG2 and

IgG3 devoid of light chain. Thus, these heavy-chain antibodies
recognize their cognate antigen only via their VH domains. The
fragment corresponding to the VH domain is called VHH or
single-domain antibody (sdAb) and is also known under the com-
mercial name “Nanobody”. Their discovery in 1993 [1] shifted the
smallest antibody fragment to retain the antigen-binding specificity
of a whole antibody from scFvs (25 kDa) to VHHs (14 kDa). Their
small size is associated with a simpler structural organization than
that of conventional antibodies (150 kDa), only one polypeptide
chain and a unique disulfide bridge. These characteristics make
their recombinant production possible with high yields not only
in mammalian expression systems but also in cheaper bacterial
systems [2]. Moreover, their simple structural organization makes
19
20 Audrey Guilbaud and Frédéric Pecorari
them easier to engineer than full-length IgGs. The long CDR3

loop of VHHs allows them to recognize epitopes located in cavities
on the surface of proteins, epitopes that are mostly inaccessible to
classical antibodies. VHHs are also characterized by favorable prop-
erties, such as solubility, stability to pH, and temperatures [3, 4],
and are thus attractive for various applications.
For instance, VHHs have been a basis for developing a broad
range of reagents useful for affinity purification or target capture
[5, 6], for helping the crystallization of difficult proteins [7, 8], for
imaging cells and tissues [9] or as high-resolution probes for elec-
tronic microscopy [10]. As VHHs also exhibit low or no immuno-
genicity [11, 12], they have been used for in vivo tumor imaging
[13, 14] and for the development of a wide variety of immuno-
therapy approaches (see [15] for a recent review). In 2019, the FDA
approved the first VHH, in fact, a VHH dimer, which is the Sanofi’s
caplacizumab for the treatment of acquired thrombotic thrombo-
cytopenic purpura [16].
This great interest in VHHs from many research teams has led
to the exploration of several ways to generate them. An approach
commonly used is to immunize with the target of interest a cam-
elid, often a llama, and then collect blood to generate an immune
library from the B lymphocytes [17]. This library is then used to
perform phage display selections against the target to enrich for
sequences with specificity for the target. Finally, a screening and
characterization campaign is driven to identify the most interesting
VHH clones regarding the final application. This process has
proved successful and the vast majority of VHHs have been
obtained in this way. However, it has several drawbacks. In addition
to being time consuming and expensive, it is not possible for all
laboratories interested in generating VHHs to have access to came-
lids. Furthermore, the VHHs obtained depend on the output of
the animal’s immune system, which may bias the diversity of char-
acteristics of the VHHs obtained. It is also obviously challenging to
work with animals when dealing with toxic or non-immunogenic
targets.
An alternative approach is to use a synthetic library instead of an
immune library in combination with selections by phage display
[18–20] or yeast display [21]. Usually, these non-immune libraries
are designed according to experimental feedback about stable and
well-produced VHHs, or according to a consensus framework
derived from llama genes. In order to improve the design of these
libraries, it is also mandatory to carefully consider the length and
composition of CDRs. Such libraries need to represent a much
larger diversity than an immune library, at least 109 individual
clones, to allow identification of high-affinity VHHs. This is
restricting the selection techniques such as phage display or yeast
display as they involve a cell-transformation step with the DNA
library, a limiting step for the manipulation of large libraries.
VHH Libraries for Ribosome Display Selections 21
This is mainly why several synthetic VHH libraries have recently

been designed for their use in the ribosome display selection tech-
nique [22, 23]. Being performed entirely in vitro, the ribosome
display has the advantage to avoid the limiting step of having cells
transformed with the DNA of the libraries. This allows to work with
diversities of at least 1012 sequences. In this selection technique, the
link between the phenotype and the genotype is maintained by the
ribosome [18]. Our group uses this powerful technique for
15 years to identify Affitins with high affinity selected from syn-
thetic libraries [24–26].
McMahon et al. [21] described the design of synthetic VHH
libraries (1 × 108 variants) for their use in yeast display selections. In
the following sections, we describe the generation of large VHH
libraries (>1 × 1012 variants), adapted from McMahon et al., in a
format suited to ribosome display.
2 Materials
2.1 Oligonucleotides VH-L1.1: 5′- CTTTAAGAAGGAGATATATCTATGGGATCC

CAGGTGCAGCTGCAG
2.1.1 Primers Used for
GAAAGCGGCGGCGGCCTGGTGCAGGCGGGCGGCAG
Generation of the 5′-
-3′.
Flanking Region of the
Ribosome Display VH-L1.2: 5′- GCCGCTCGCCGCGCAGCTCAGGCG
Construct and the CAGGCTGCCGCCCGCCTGC-3′.
Randomized Positions of VH-L1.3: 5′- CGCGGCGAGCGGCWMTATT
the Gene Encoding VHH TYTNNSNNSNNSNNSATGGGCTGGTATCGCCAGG-3′.
VH-L1.4: 5′-TTCGCGTTCTTTGCCCGGCGCCTGGCGATAC
CAGCCCAT-3′.
VH-L1.5: 5′- CCGGGCAAAGAACGCGAAYTTGTTGCCR
STATTRVTNNSGGTRSTANTACCWATTATGCGGA
TAGCGTGAAAGGCC-3′.
VH-L1.6: 5′- GTTTTTCGCGTTATCGCGGCTAATGG
TAAAGCGGCCTTTCACGCTATCCGCATA-3′.
VH-L1.7 5′- AGCCGCGATAACGCGAAAAACACCGTG
TATCTGCAGATGAACAGCCTGAAACC-3′.
VH-L1.8 5′- CGCGCAATAATACACCGCGG
TATCTTCCGGTTTCAGGCTGTTCATCTGCAGA-3′.
VH-L1.9a 5′- CCGCGGTGTATTATTGCGCG
GYTNNSNNSNNSNNSNNSNNSNNSYWTNN
STATTGGGGCCAGGGCACC-3′.
VH-L1.9b 5′- CCGCGGTGTATTATTGCGCG
GYTNNSNNSNNSNNSNNSNNSNNSNNSNNSNNSNN
SYWTNNSTATTGGGGCCAGGGCACC-3′.
VH-L1.9c 5′- CCGCGGTGTATTATTGCGCG

GYTNNSNNSNNSNNSNNSNNSNNSNNSNNSNNSNNS
NNSNNSNNSNNSYWTNNSTATTGGGGCCAGGGCACC-
3′.
VH-L1.10: 5′- GAATTCGGCCCCCGAGGCCATA
TAAAGCTTGCCGCTGCTCACGGT
CACCTGGGTGCCCTGGCCCCAATA-3′.
T7C: 5′-ATACGAAATTAATACGACTCACTATAGGGAGACCA
CAACGGTTTCCCTC-3′.
SDA_RDV3: 5′- AGACCACAACGGTTTCCCTCTAGAAA
TAATTTTGTTTAACTTTAAGAAGGAGATATATCTATG -
3′.
AF-link-R: 5′-GAATTCGGCCCCCGAGGCCATATAAAGC-3′.
2.1.2 Primers for the AF-link-F: 5′- AAGCTTTATATGGCCTCGGGGGCCGAATTC -

Amplification of tolA Linker 3′.
Encoded by pFP-RDV3 AF-link-R: 5′-GAATTCGGCCCCCGAGGCCATATAAAGC-3′.
TolAkurz: 5′- CCGCACACCAGTAAGGTGTGCGGTTT
CAGTTGCCGCTTTCTTTCT-3′.
2.1.3 Primers for the T7B: 5′-ATACGAAATTAATACGACTCACTATAGGGAGACCA

Final Assembly of the 5′- CAACGG-3′.
Construct and tolA Linker TolAkurz: 5′- CCGCACACCAGTAAGGTGTGCGGTTT
CAGTTGCCGCTTTCTTTCT-3′.
2.1.4 Primers for PCR to NGS-VHH_Fint: 5′- TCGTCGGCAGCGTCAGATGTGTATAA

Prepare NGS Samples GAGACAGCTGAGCTGCGCGGCGAGC-3′.
NGS_VHH_Rint: 5′- GTCTCGTGGGCTCGGAGATGTGTA
TAAGAGACAGGGGTGCCCTGGCCCCAATA-3′.
2.2 PCR 1. UHP water (various suppliers).

2. Phusion DNA Polymerase (Thermo Fisher Scientific).
3. dNTP solution: 10 mM of each dNTP.
4. 1 kb Plus DNA ladder.
5. 6× Orange DNA loading dye or equivalent.
6. Agarose.
7. GelRed nucleic acid gel stain (Biotium).
8. 1× TAE: 40 mM Tris–HCl base, 20 mM acetic acid, and
1 mM EDTA.
9. Wizard SV Gel and PCR Clean-Up System (Promega).
3 Methods
The VH-L1 library described here is adapted from the work of

McMahon et al. [21]. This library corresponds to the randomiza-
tion of CDR1, CDR2, and CDR3. The latter one has three lengths
with 7, 11, and 15 randomized codons, resulting in libraries
VH-L1a, VH-L1b, and VH-L1c, respectively. The randomized
codon positions are the same as those described by McMahon
et al. [21] (Fig. 1). Similarly to McMahon et al., to synthesize the
library we perform a PCR to assemble a combination of nine
non-degenerated sequences and three degenerated oligonucleo-
tides that include WMT, TYT, YTT, RST, RVT, ANT, WAT,
GYT, and YWT triplets to encode restricted sets of randomized
amino acids. For the representation of the 20 amino acids, we use
the NNS triplets instead of the trimer phosphoramidites to synthe-
size oligonucleotides used by McMahon et al., as these reagents are
quite expensive and not accessible to all laboratories. The complete
assembly of the VH-L1 library is performed by a final PCR to
obtain sequences into the ribosome display format. It includes
flanking regions with a T7 promoter, a ribosome binding site, a
tolA linker, and stem loops at the ends to stabilize the construct,
necessary for selection by ribosome display (Fig. 2a; see Notes 1
and 2).
The tolA linker fragment is amplified by PCR from the ribo-
some display plasmid pFP-RDV3 (Fig. 2b; see Note 3) which
encodes the part of the Escherichia coli tolA gene that is needed
for the ribosome display construct [26]. The VH-L1 libraries (a, b,
and c) thus obtained are validated by the next generation sequenc-
ing. The final DNA product does not contain a stop codon, and as a
Fig. 1 Scheme representing the CDR randomization strategy used for the synthesis of libraries. Triplets and the
corresponding sets of encoded amino acids are indicated under CDR. The NNS triplet encodes the whole set of
amino acids, which is represented by a “#”. (Adapted from McMahon et al. [21])
Fig. 2 Schemes of the ribosome display constructs. (a) Scheme of the VH-L1a library in the ribosome display
format with a zoom on the VHH region depicting the primers used to generate the VHH gene with randomized
CDR. (b) Vector pFP-RDV3. It contains a β-lactamase gene for ampicillin resistance. The 487-bp region
(152–638) possesses all functional regions required for cloning, in vitro transcription, and translation. A
result the corresponding mRNAs, as this is important for ribosome

to stall after in vitro translation of the library [27]. Thus, under
ribosome display conditions, mainly high concentration of Mg2+ at
4 °C, the link between phenotype and genotype is created via the
ternary complexes translated VHH-ribosome-mRNA, which are
essential for selections.
3.1 Production of 1. The DNA product containing the randomized VHH gene is
Input Library obtained by two distinct PCRs. The first one uses a combina-
tion of eight standards (T7C, SDA_RDV3, VH-L1.1,
3.1.1 Production of the
VH-L1.2, VH-L1.4, VH-L1.6, VH-L1.7, and VH-L1.8) and
VHH Library Fragments
two degenerated oligonucleotides encoding wobble triplets
(VH-L1.3 and VH-L1.5). The second PCR consists of the
assembly of the degenerated (VH-L1.9a, b, or c) and the
standard (VH-L1.10) oligonucleotides. The two products are
then assembled by PCR to obtain the VHH fragment library
(see Note 4).
2. For the first PCR, prepare 200 μL PCR mixture in PCR tubes
(50 μL/tube) containing 8 pmol of each internal primer
(0.8 μL of 10 μM primer SDA_RDV3, VH-L1.1, VH-L1.2,
VH-L1.4, VH-L1.6, and VH-L1.7), 40 pmol of each external
primer (4 μL of 10 μM primer T7C and VH-L1.8), 4 μL of
dNTPs mix (containing 10 mM of each dNTP), 40 μL of 5×
Phusion-GC buffer, and 4 U of Phusion DNA polymerase.
3. Use a thermocycler to perform the following PCR program: an
initial denaturation step at 98 °C for 30 s, followed by 35 cycles
of 98 °C for 10 s, 65 °C for 30 s, 72 °C for 20 s with a final
elongation step of 72 °C for 5 min.
4. For the second PCR, prepare 200 μL PCR mixture in PCR
tubes (50 μL/tube) containing 40 pmol of VH-L1.9a and
VH-L1.10 primers (4 μL of 10 μM primer), 4 μL of dNTPs
mix (containing 10 mM of each dNTP), 40 μL of 5× Phusion-
GC buffer, and 4 U of Phusion DNA polymerase. Prepare two
more PCR mixes in the same way, replacing VH-L1.9a primer
with VH-L1.9b or VH-L1.9c primer.
of 98 °C for 10 s, 63 °C for 30 s, 72 °C for 15 s with a final
elongation step of 72 °C for 5 min.
ä
Fig. 2 (continued) BamHI/HindIII cloning cassette (244–275) encoding four stop codons in different reading
frames is useful for sub-cloning DNA outputs during selection. Upstream of the VHH gene are located a
ribosome binding site (RBS, 227–232), a hairpin-loop (178–198), and a T7 promoter (162–177). As an
N-terminal fusion may be problematic for target recognition, the FLAG tag is located downstream of the VHH
gene (315–338). After the FLAG tag is located a “tether” region, TolA (363–638) ending with a hairpin loop
region (616–638)
6. Prepare a 1.5% agarose gel. Mix 5 μL of each of the PCR

reactions with 1 μL of 6× Orange DNA loading dye buffer
and load these samples on the gel. On an adjacent lane, load
5 μL of 1 kb Plus DNA ladder and run the gel at 110 V for at
least 40 min.
7. Image the gel and if the correct products corresponding to the
expected sizes of 386 and 119 bps (131 and 143 bps for
libraries b and c, respectively) are observed for the first and
second PCR, respectively, load the rest of the PCR mixtures on
separate 1.5% agarose gels to avoid cross-contaminations and
excise the bands.
8. Purify the DNA product using Promega Wizard SV PCR and
Gel purification kit according to the manufacturer’s specifica-
tions. Elute DNA with 38 μL UHP water.
9. Determine the concentration of the purified PCR products by
UV absorbance. About 2.5 and 1.1 μg of purified DNA should
be obtained for the first and second PCR, respectively.
10. To assemble DNA fragments from step 8, for each library,
prepare 300 μL PCR mixture in PCR tubes (50 μL/tube)
containing 450 and 150 ng of DNA from the first and second
PCR, respectively, 150 pmol of each T7b and AF-link-R primer
(15 μL of 10 μM primer), 6 μL of dNTPs mix (containing
10 mM of each dNTP), 60 μL of 5× Phusion-GC buffer, and
6 U of Phusion DNA polymerase.
initial denaturation step at 98 °C for 30 s, followed by eight
cycles of 98 °C for 10 s, 45 °C for 30 s, 72 °C for 20 s, followed
by 30 cycles of 98 °C for 30 s, 55 °C for 30 s, 72 °C for 25 s
with a final elongation step of 72 °C for 5 min.
12. Control the product on 1.5% agarose gel as in step 6.
13. Image the gel and if the correct products corresponding to the
expected sizes of 485, 497, and 509 bps (for libraries a, b, and
c, respectively) are observed, load the rest of the PCR mixtures
on separate 1.5% agarose gels to avoid cross-contaminations
and excise the bands.
14. Purify the DNA product as in step 8.
15. Determine the concentration of the purified PCR products by
UV absorbance. About 2.6 μg of purified DNA should be
obtained (see Note 5).
3.1.2 Production of the 1. The tolA spacer is obtained in large quantities via PCR amplifi-
tolA Fragment cation from pFP-RDV3 vector (see Note 3). Prepare 500 μL
PCR mixture in PCR tubes (50 μL/tube) containing 250 pmol
of each primer (2.5 μL of 100 μM primer AF-link-F and tolA-
kurz), 250 ng of pFP-RDV3 vector (2.5 μL of 100 ng/μL),
10 μL of dNTPs mix (containing 10 mM of each dNTP),

100 μL of 5× Phusion HF buffer, and 10 U of Phusion DNA
polymerase.
initial denaturation at 98 °C for 30 s, then 30 cycles of 98 °C
for 10 s, 69 °C for 30 s, 72 °C for 20 s, and final elongation at
72 °C for 5 min.
3. Control the product on 1.0% agarose gel as in step 6. The PCR
should give an amplicon of 339 bps.
4. Purify the DNA product as in step 8.
5. Determine the concentration of the tolA linker by UV absor-
bance and store the product at -20 °C. About 3.2 μg of
purified DNA should be obtained.
3.1.3 Production of the 1. For each library, prepare 500 μL PCR mixture in PCR tubes
Ribosome Display (50 μL/tube) containing 250 pmol of each primer (2.5 μL of
Construct 100 μM primer T7B and TolAkurz), 600 ng of VHH library
from Subheading 3.1.1, 525 ng of tolA linker from Subhead-
ing 3.1.2, 10 μL of dNTPs mix (containing 10 mM of each
dNTP), 100 μL of 5× Phusion HF buffer, and 10 U of Phusion
polymerase.
of 98 °C for 10 s, 45 °C for 30 s, 72 °C for 30 s, and then
30 cycles of 98 °C for 10 s, 55 °C for 30 s, 72 °C for 30 s with a
final elongation step of 72 °C for 5 min.
3. Control the product on 1.5% agarose gel as in Subheading
3.1.1, step 6. The PCR should give amplicons of 824, 836,
and 848 bps.
4. Purify the DNA product as in Subheading 3.1.1, steps 7 and 8.
5. Determine the concentration of DNA products by UV absor-
bance. About 7–11 μg of purified DNA should be obtained.
6. Each μg of the obtained libraries is equivalent to about
1.2 × 1012 molecules (see Notes 6 and 7). The library can be
stored at -80 °C for several months or years.
3.1.4 Next-Generation 1. For each library, prepare 50 μL PCR mixture in a PCR tube
Sequencing containing 25 pmol of each primer (2.5 μL of 10 μM adapter
primer NGS-VHH_Fint and NGS-VHH_Rint) (Fig. 3a), 5 ng
of VHH library from Subheading 3.1.3, 1 μL of dNTPs mix
(containing 10 mM of each dNTP), 10 μL of 5× Phusion HF
buffer, 3 μL of DMSO, and 1 U of Phusion polymerase.
initial denaturation step at 98 °C for 30 s 98 °C for 10 s,
followed by 20 cycles of PCR of 98 °C for 10 s, 66 °C for
Fig. 3 (a) Principle of the preparation of samples for sequencing by Illumina NGS technology. The orange and
blue sequences indicated on the PCR product obtained with primers NGS-VHH_Fint and NGS-VHH_Rint are
used by the core-facility to perform a second PCR to index samples with Nextera adapters allowing multiplex
sequencing. (b) Agarose gel electrophoresis run with samples obtained from PCR described in Subheading
3.1.4 (expected sizes are 347, 359, and 371 bps, for libraries a, b, and c, respectively)
30 s, 72 °C for 10 s with a final elongation step of 72 °C for

5 min.
3. Purify the products with Promega Wizard SV Gel and PCR
Clean-up kit and determine the concentration of the purified
PCR product by UV absorbance.
4. Control the homogeneity of the products on 1.5% agarose gel
as in Subheading 3.1.1, step 6.
5. The products thus obtained are ready for a second PCR using
Nextera index primers for Illumina next-generation sequenc-
ing (See Note 8). This second PCR is usually performed at the
NGS core-facility (Fig. 3b).
4 Notes
1. The tolA spacer allows the displayed proteins to properly fold

away from the ribosome and to have enough degree of freedom
to interact with the target.
2. We use a construction similar to the one described by Amstutz
et al [28] but with modifications to meet our needs, such as
FLAG and RGS-His6 tags at C-terminus of VHH and different
restriction sites. This system is compatible with prokaryotic
in vitro translation with an E. coli S30 extract for ribosome
display (Fig. 2a).
3. The ribosome display vector pFP-RDV3 (Fig. 2b) is obtained
by cloning the following sequence of a synthetic DNA product
in pUC18 plasmid (ATCC 37253) via NcoI and MluI restric-
tion sites (highlighted below in bold):
5′-CCATGG ATACGAAATTAATACGACTCACTATAGG
GAGACCACAACGGTTTCCCTCTAGAAA
TAATTTTGTTTAACTTTAAGAAGGAGATATATC
TATGGGATCCTAATGAGGTACCCTGAGTA
GAAGCTTTATATGGCCTCGGGGGCCGAATTCTCT
GAGCTCTCTGGGGACTACAAAGATGACGATGA
CAAAGGCACCGGTTCCGGCGGTTCTGGCCA
GAAGCAAGCTGAAGAGGCGGCAGC
GAAAGCGGCGGCAGATGCTAAAGCGAAGGCC
GAAGCAGATGCTAAAGCTGCGGAAGAAGCAGC
GAAGAAAGCGGCTGCAGACGCAAAGAAAAAAGCA
GAAGCAGAAGCCGCCAAAGCCGCAGCCGAAGCG
CAGAAAAAAGCCGAGGCAGCCGCTGCGGCACT
GAAGAAGAAAGCGGAAGCGGCAGAAGCAGCTG
CAGCTGAAGCAAGAAAGAAAGCGGCAACT
GAAACCGCACACCTTACTGGTGTGCGGTA
AACGCGT-3′.
4. For the construction of high-quality libraries, it is recom-
mended to use highly purified oligonucleotides (HPLC purifi-
cation). This is to avoid as much as possible undesirable
sequences due to n-1 products.
5. This DNA product corresponds to the gene of VHH, flanked
by the 5′ sequence necessary for ribosome display and an
additional 3′ sequence necessary for subsequent PCR assembly
step with the tolA spacer (Fig. 2).
6. The upper limit for the size of the library at this step can be
estimated to about 1.2 × 1012 variants when manipulating 1 μg
of DNA.
7. It is crucial for the construction of libraries and their
subsequent use for selections that PCR products obtained till
this step are of high quality as judged by agarose electrophore-

sis (i.e. a single sharp band without any smear).
8. We usually request pair-end sequencing to cover the whole
VHH sequence (Miseq, Flowcell Micro). Reads obtained are
assembled and analyzed using Galaxy tools (https://usegalaxy.
org/). NGS is useful to evaluate the quality of the libraries on
large samples. As an indication, from 182225 VHH sequenced
for libraries VH-L1, we determined that, by following this
protocol for library preparation, 172400 sequences were dif-
ferent and that the largest cluster of sequences was composed
of not more than four members (unpublished observation).
Acknowledgments
The authors thank all previous members of the laboratory who

helped to develop this protocol.
References
1. Hamers-Casterman C, Atarhouch T, Muylder- 9. Yamagata M, Sanes JR (2018) Reporter–nano-
mans S et al (1993) Naturally occurring antibody fusions (RANbodies) as versatile, small,
bodies devoid of light chains. Nature 363:446– sensitive immunohistochemical reagents. Proc
448 Natl Acad Sci 115:2126–2131
2. de Marco A (2020) Recombinant expression of 10. Kijanka M, van Donselaar EG, Muller WH et al
nanobodies and nanobody-derived immunor- (2017) A novel immuno-gold labeling proto-
eagents. Protein Expr Purif 172:105645 col for nanobody-based detection of HER2 in
3. Goldman ER, Liu JL, Zabetakis D, Anderson breast cancer cells using immuno-electron
GP (2017) Enhancing stability of camelid and microscopy. J Struct Biol 199:1–11
shark single domain antibodies: an overview. 11. Baral TN, Magez S, Stijlemans B et al (2006)
Front Immunol 8:865 Experimental therapy of African trypanosomia-
4. Pia EAD, Martinez KL (2015) Single domain sis with a nanobody-conjugated human trypa-
antibodies as a powerful tool for high quality nolytic factor. Nat Med 12:580–584
surface plasmon resonance studies. PLoS One 12. Ackaert C, Smiejkowska N, Xavier C et al
10:e0124303 (2021) Immunogenicity risk profile of nanobo-
5. Huang C, Ren J, Ji F et al (2020) Nanobody- dies. Front Immunol 12:632687
based high-performance immunosorbent for 13. Bridoux J, Broos K, Lecocq Q et al (2020)
selective beta 2-microglobulin purification Anti-human PD-L1 nanobody for immuno-
from blood. Acta Biomater 107:232–241 PET imaging: validation of a conjugation strat-
6. Verheesen P, ten Haaft MR, Lindner N et al egy for clinical translation. Biomol Ther 10:
(2003) Beneficial properties of single-domain E1388
antibody fragments for application in immu- 14. Xavier C, Vaneycken I, D’huyvetter M et al
noaffinity purification and immuno-perfusion (2013) Synthesis, preclinical validation, dosim-
chromatography. Biochim Biophys Acta 1624: etry, and toxicity of 68Ga-NOTA-anti-HER2
21–28 Nanobodies for iPET imaging of HER2 recep-
7. Rasmussen SGF, Choi H-J, Fung JJ et al tor expression in cancer. J Nucl Med 54:776–
(2011) Structure of a nanobody-stabilized 784
active state of the β(2) adrenoceptor. Nature 15. Chanier T, Chames P (2019) Nanobody engi-
469:175–180 neering: toward next generation immu-
8. Löw C, Yau YH, Pardon E et al (2013) Nano- notherapies and immunoimaging of cancer.
body mediated crystallization of an archeal Antibodies (Basel) 8:13
mechanosensitive channel. PLoS One 8:
e77984
16. Morrison C (2019) Nanobody approval gives against delicate proteins. Nat Protoc 15:
domain antibodies a boost. Nat Rev Drug Dis- 1707–1741
cov 18:485–487 23. Chen X, Gentili M, Hacohen N, Regev A
17. Pardon E, Laeremans T, Triest S et al (2014) A (2021) A cell-free nanobody engineering plat-
general protocol for the generation of Nano- form rapidly generates SARS-CoV-2 neutraliz-
bodies for structural biology. Nat Protoc 9: ing nanobodies. Nat Commun 12:5506
674–693 24. Mouratou B, Schaeffer F, Guilvout I et al
18. Yan J, Li G, Hu Y et al (2014) Construction of (2007) Remodeling a DNA-binding protein
a synthetic phage-displayed Nanobody library as a specific in vivo inhibitor of bacterial secre-
with CDR3 regions randomized by trinucleo- tin PulD. Proc Natl Acad Sci U S A 104:
tide cassettes for diagnostic applications. J 17983–17988
Transl Med 12:343 25. Kalichuk V, Renodon-Corniere A, Behar G
19. Yan J, Wang P, Zhu M et al (2015) Characteri- et al (2018) A novel, smaller scaffold for Affi-
zation and applications of Nanobodies against tins: showcase with binders specific for
human procalcitonin selected from a novel EpCAM. Biotechnol Bioeng 115:10
naı̈ve Nanobody phage display library. J Nano- 26. Kalichuk V, Kambarev S, Behar G et al (2020)
biotechnol 13:33 Affitins: ribosome display for selection of
20. Moutel S, Bery N, Bernard V et al (2016) Aho7c-based affinity proteins. Methods Mol
NaLi-H1: a universal synthetic library of huma- Biol 2070:19–41
nized nanobodies providing highly functional 27. Hanes J, Pluckthun A (1997) In vitro selection
antibodies and intrabodies. eLife 5:e16228 and evolution of functional proteins by using
21. McMahon C, Baier AS (2018) Yeast surface ribosome display. Proc Natl Acad Sci U S A 94:
display platform for rapid discovery of confor- 4937–4942
mationally selective nanobodies. Nat Struct 28. Amstutz P, Binz HK, Zahnd C, Pluckthun A
Mol Biol 25:289–296 (2006) Ribosome display: in vitro selection of
22. Zimmermann I, Egloff P, Hutter CAJ et al protein-protein interactions. In: Celis J
(2020) Generation of synthetic nanobodies (ed) Cell biology – a laboratory handbook.
Elsevier Academic Press, pp 497–509
Chapter 3
Isolation of Adhirons Specific for Plant Protoplast

Membrane Biomarkers Is Simplified by Phagemid Design
Claudia D’Ercole and Ario de Marco
Abstract
Phage display is an effective method to retrieve binders specific for a target epitope from a large clone
library. Nevertheless, the panning process allows for the accumulation of some contaminant clones into the
selected phage pool and, consequently, each clone requires individual screening to verify its actual specific-
ity. This step is time-consuming, independently on the chosen method, and relies on the availability of
reliable reagents. Since phages display a single binder responsible for the antigen recognition but their coat
is formed by several repeats of the same proteins, the targeting of coat epitopes is often exploited to amplify
the signal. Commercial anti-M13 antibodies are commonly labeled with peroxidase or FITC but custo-
mized antibodies might be necessary for specific applications. Here, we report a protocol describing the
selection of anti-protoplast Adhirons that relies on the availability of nanobodies fused to a fluorescent
protein to use during flow cytometry screening. Specifically, when preparing our Adhiron synthetic library,
we designed a new phagemid that allows the expression of the clones fused to three tags. These can interact
with a large variety of commercial and home-made reagents, selected according to the needs of the
downstream characterization process. In the described case, we combined the ALFA-tagged Adhirons
with an anti-ALFAtag nanobody fused with the fluorescent protein mRuby3.
Key words Pea protoplasts, ALFAtag, Customized reagents, Adhirons, Protoplast biomarkers
1 Introduction
Large collections of antibody fragments and synthetic binders of

different origin have become largely accessible and have been used
to recover reagents specific for almost any kind of molecule
[1, 2]. We explored the possibility to exploit phage display to isolate
Adhirons starting from a new library prepared in our laboratory.
Adhirons are a relatively new class of binders, obtained by hyper-
mutating two loops of a phytocystatin scaffold known for its out-
standing stability [3]. Specifically, we wished to assess the suitability
of this library for the recovery of binders specific for plant proto-
plast biomarkers due to the scarce availability of reagents selective
for plant proteins and the peculiar challenges that are represented
33
34 Claudia D’Ercole and Ario de Marco
6xHis ALFAtag SpyTag Adhiron
mRuby3
Nb
phage
Fig. 1 Characteristics of the Adhiron library clones. The Adhiron phage display
library was built using a phagemid designed to express the Adhiron clones fused
to a multi-tag (Top): a 6xHis sequence, an ALFAtag, and a SpyTag. Consequently,
when displayed on the phages (Bottom), the Adhirons were decorated with tags
that allow specific activities: (i) affinity purification (HisTag), (ii) covalent binding
to SpyCatcher, which can be fused to further functional partners (SpyTag), and
(iii) direct detection, using a fluorescent anti-ALFAtag nanobody (ALFAtag). The
pink strips inside the Adhiron unit indicate the two hypervariable regions
responsible for the target selective recognition
by protoplasts and by membrane proteins. Whereas plant compo-

nents such as soluble proteins known to induce allergic reactions
have been used to immunize animals and recover the
corresponding antibody fragments by panning ad hoc prepared
immune libraries [4, 5], there is no published report describing
successful panning performed directly on protoplasts to identify
binders targeting membrane epitopes. We collected experience in
panning pre-immune nanobody libraries directly against whole
mammalian cells, unicellular microalgae, cyanobacteria, and even
extracellular vesicles [6–9]. In this work, we describe the use of a
synthetic Adhiron library for performing blind panning on freshly
isolated pea protoplasts with the aim of identifying binders able to
recognize surface antigens displayed on the protoplast surface. The
pairs of Adhirons/membrane biomarkers can be used for direct
imaging, immunoprecipitation, the discovery of the antigen, and,
in the middle term, their use can be even conceived for in vivo
targeting/delivery.
The library was cloned in a modified phagemid that provides a
multi-tag for which a large array of inexpensive and customized
reagents can be produced directly in the lab. These are then prefer-
entially used according to the required application (Fig. 1). In the
example described in the present contribution, we exploited the
ALFAtag [10] to target the Adhiron construct with a recombinant,
home-made anti-ALFAtag nanobody fused to fluorescent proteins.
These detection reagents are particularly handy during flow-
cytometry screening because they allow the direct target labelling
Flow Cytrometric Screening of Anti-Protoplast Adhirons 35
without the necessity of a secondary antibody or the in vitro label-

ing of the primary. In our case, we initially produced two versions of
the nanobody, one fused to mClover3 and the second to mRuby3.
This availability allowed the direct comparison of the reagents and
choosing the red fluorescent protein for the screening purpose
because its signal better enabled to be distinguished from proto-
plast autofluorescence. It must be also underlined that the same
anti-ALFAtag nanobody can be fused, according to the experimen-
tal requirements, also to other functional partners, such as enzymes
or split-proteins. This flexibility enables to adapt the reagent to
different diagnostic platforms or alternative screening protocols
and provides even solutions that might be not available
commercially.
Finally, considering the usually high yields at which recombi-
nant Adhirons are produced, we expect that the panning and
screening approach described above could represent not only a
protocol to secure binders selective for plant targets but a conve-
nient generic approach to obtain inexpensive reagents for the sci-
entific community.
2 Materials
2.1 Protoplast 1. Enzymatic digestion solution: 1 M mannitol, 100 mM

Isolation MES-KOH, pH 5.6, 0.37% w/v macerozyme, and 1.5% w/v
cellulase in a total volume of 10 mL (see Note 1).
2. Solution for enzymatic digestion quenching (W5): 2 mM
MES, 154 mM NaCl, 125 mM CaCl2, and 5 mM KCl, pH 5.7.
3. Resuspension solution (MMG): 4 mM MES, 0.4 M mannitol,
and 15 mM MgCl2, pH 5.7.
4. Polypropylene mesh (mesh pores: 105 μm; thickness: 121 μm)
(see Note 2).
5. Scalpel.
6. Incubator.
7. Falcon tubes (15 mL).
8. Petri dishes 92 × 16 mm.
9. Beckman Allegra X-22R benchtop centrifuge with swinging
bucket rotor, model SX4250 (see Note 3).
10. Fixed-angle centrifuge (see Note 4).
2.2 Protoplast 1. Epifluorescence and bright-field microscope (see Note 5).

Assessments 2. Hemocytometer.
36 Claudia D’Ercole and Ario de Marco
2.3 Biopanning 1. MM medium: 10 mL M9 medium (5×), 100 μL 1 M MgSO4,

2.5 mL 20% glucose, 100 μL 1% thiamine, and milliQ water
(sterile) to the final volume of 50 mL.
2. E. coli strain TG1.
3. Dynabeads® M-450 Epoxy (see Note 6).
4. Phosphate-buffered saline.
5. Phosphate-buffered saline containing 0.4 M mannitol (see
Note 7).
6. Blocking solution: 1% milk in PBS/mannitol.
7. Adhiron library (diversity of 7 × 109).
8. 2xTY medium.
9. 2% glucose.
10. Ampicillin stock solution (100 mg/mL) dissolved in H2O.
11. Kanamycin stock solution (50 mg/mL) dissolved in H2O.
12. Elution solution: 0.2 M glycine-HCl, pH 2.2, 1 mg/mL BSA.
13. Neutralizing solution: 1 M Tris–HCl, pH 9.1.
14. Precipitation solution (PS): 30% PEG-600, 2.5 M NaCl.
15. M13K07 helper phages (stock solution 1 × 1011 pfu/mL).
16. Erlenmayer flask (250 mL).
17. Glycerol.
18. Cryotubes.
19. Microcentrifuge tubes (1.5 mL).
20. Falcon tubes (15 mL).
21. Magnetic rack.
22. Eppendorf MiniSpin centrifuge for 1.5 mL tubes.
23. Petri dish 150 × 20 mm.
24. Standard 96-well microplate, flat bottom.
2.4 Screening 1. MegaBlock 96 deep-well plates (volume: 2.2 mL).

2. Standard 96-well microplate, round bottom.
3. 2xTY medium.
4. Phosphate-buffered saline containing 0.4 M mannitol (see
Note 7).
5. Blocking solution: 1% milk in PBS/mannitol (see Note 7).
6. M13K07 helper phages (stock solution 1 × 1011 pfu/mL).
7. Ampicillin stock solution (100 mg/mL) dissolved in H2O.
8. Kanamycin stock solution (50 mg/mL) dissolved in H2O.
9. Beckman Allegra X-22R benchtop centrifuge with microplate
rotor, model S2096.
Flow Cytrometric Screening of Anti-Protoplast Adhirons 37
10. Anti-ALFAtag-mRuby3 nanobodies.

11. Filter tips.
12. Sterile toothpicks.
13. Incubator.
14. Guava® easyCyte™ Flow Cytometer (or equivalent
instrument).
3 Methods
3.1 Protoplast Day 0

Isolation
1. Grow Pisum sativum plants in a growth chamber at 24–26 °C
with a light/dark photoperiod of 16:8 (see Note 8).
2. Collect 1.5 g of leaves from 2-week-old plants (see Note 8) and
cut 0.5–1 mm wide intra-veining strips.
3. Incubate strips with the digestion solution for 3:30 h, at 30 °C,
with gentle shaking (70 rpm) (see Note 1).
4. Add W5 solution to stop the enzymatic reaction.
5. Filter the digested solution with polypropylene mesh (see Note
2).
6. Wash the digested cell suspension twice by resuspending in
2 mL of MMG solution and pelleting for 3 min at 100 × g.
7. Resuspend the pellet in 1 mL of MMG solution and keep it at
4 °C (see Note 9).
3.2 Biopanning Day 0—Preliminary Steps
3.2.1 Coating of Beads 1. Grow overnight TG1 E. coli cells in 50 mL of MM medium

with the Antigen (See using a 250 mL flask at 37 °C and 220 rpm.
Note 10) 2. Resuspend by vortex (30 s to 1 min) the magnetic beads
(Dynabeads® M-450 Epoxy) and add 50 μL/sample in two
Eppendorf (1.5 mL).
3. Wash beads three times with 1 mL of PBS, collect them by
means of a magnetic rack, and resuspend them in 50 μL of PBS.
4. Coat the beads with 500 μL of the depletion antigen milk
(2 mg/mL). Label one tube “milk dep1” and the other one
“milk dep2”.
5. Incubate under rotation 16–24 h, 4 °C.
Day 1—First Round of Biopanning
Other documents randomly have
different content
While the statement made by one writer that the Italians put
cheese into everything they eat is an exaggeration, it is true that
many of their dishes are thus enriched; and it is this enriching of
foods with cheese, to make up for the absence or scarcity of meat,
that constitutes one of the great lessons Italy is teaching the world.
Gastronomically, this lesson is as valuable as what France has taught
the world regarding the dessert usefulness of ripened cheese as an
appetizer; and from an economic point of view it is much more
important, because meat is becoming dearer every year, whereas
cheese is not only cheaper but more nutritious than meat.
More nutritious—yes, twice as nutritious. In Farmers' Bulletin 487,
entitled Cheese and its Economical Uses, two of our Government's
nutrition experts published a table (p. 13) based on a series of
experiments which show that "cheese has nearly twice as much
protein, weight for weight, as beef of average composition as
purchased, and that its fuel value is more than twice as great. It
contains over twenty-five per cent. more protein than the same
weight of porterhouse steak as purchased, and nearly twice as much
fat."
Thus does science justify the culinary practices of Italy, and
explain how it happens that the sturdy sons of that land, instead of
being, as many foolishly suppose, idlers, habitually indulging in dolce
far niente, can and do accomplish the hardest manual labor, notably
railway building—abroad as well as at home—on a diet which
contains little or no meat.
Among the first things that strike one on visiting Italy the first
time is the universal custom of putting grated cheese in the soup.
Being hot, the soup dissolves the cheese at once; and this is a
point of great importance. There is an impression the world over
that cheese is indigestible, and this is correct so far as raw cheese is
concerned, unless it is taken in small quantities at dessert and
carefully munched with a hard cracker or a crusty roll of bread.
Cooked cheese, however, is easily digested—provided the cook
knows her business and does not follow the British custom,
graphically described by the eminent chemist, W. Mattieu Williams,
of making, for instance, "macaroni-cheese," which is "commonly
prepared in England by depositing macaroni in a pie-dish, and then
covering it with a stratum of grated cheese, and placing this in an
oven or before a fire until the cheese is desiccated, browned, and
converted into a horny, caseous form of carbon that would induce
chronic dyspepsia in the stomach of a wild-boar if he fed upon it for
a week."
How it should be prepared, it is not the mission of this volume to
indicate. The best cook books reveal the method and so does the
Farmers' Bulletin (No. 487) just referred to. This bulletin should be,
indeed, bound and placed in the kitchen of every American and
English home, as it goes into the subject in much more detail than
any of the cook books. There are in it pages on Kinds of Cheese
Used in American Homes, The Care of Cheese in the Home, The
Flavor of Cheese, Nutritive Value and Cost of Cheese and Some
Other Food Materials, Home-made Cheeses, Cheese Dishes and
Their Preparation, Cheese Soups and Vegetables Cooked with
Cheese, Cheese Salads and Sandwiches, Cheese Pastry, etc.
Especially important are the pages devoted to a description of
"Cheese dishes which may be used in the same way as meat." Under
this head we find, among many other things, and with the recipes in
full, references to cheese sauces, corn and cheese soufflé, macaroni
and cheese, baked rice and cheese, cheese rolls, nut and cheese
roast, Boston roast, baked eggs with cheese, cheese omelet, fried
bread with cheese, cheese with mush, cheese croquettes, oatmeal
with cheese, etc.
Doubtless the best cooking cheese is Parmesan; but when the
genuine article cannot be obtained in bulk (never buy it grated, in a
bottle) it is better to use Swiss or even American cheese (cheddar).
The Dutch Edam is also excellent for the kitchen, as good as when
eaten raw. Of the Italian uncooked cheeses for the table, the best
are Gorgonzola and, particularly, Caciocavallo. This is not, as its
name suggests, made of mare's milk. It looks like a rag doll, is
similar to Edam in consistency and has a very pleasant and unique
Flavor owing to its being slightly smoked. Beware of American
imitations, cured with "liquid smoke."
In times of meat scarcity and high prices it is well to remember
that hard-working men can (as experiments have shown) fully
sustain their strength for months on the cheapest of all products of
the dairy—cottage cheese made of skim milk, to which, just before
eating it, some cream is added for fat and flavor. Strange to say, in
all the literature on this matter I have never seen any reference to
the transformations to which cottage cheese can be subjected. By
standing a few days, it gets a ripening flavor that appeals to
epicures, and if it is then boiled it assumes a consistency like that of
Port Salut, making another pleasant variant.
A helpful little volume for those who wish to know how the
Italians use cheese in cooking and how they make a number of
other national dishes is Antonia Isola's "Simple Italian Cookery."
Here are receipts showing how risotto, and other rice dishes, ravioli,
polenta, gnocchi of farina or potato, are made (all of them delicious
and desirable in American and English homes, particularly the
gnocchi), and how eggs, fishes, vegetables, and meats can be
cooked in tempting Italian ways. The chestnut, as a matter of
course, is a frequent ingredient in the dressings and the pastry.
BIRDS, TOMATO PASTE AND GARLIC.
While the Italians are sparing in their use of meat, it must not be
supposed that they do not know how to make the most of it when
they do indulge in it. They are born cooks—it's a great pity none of
them are ever to be found in our "intelligence offices"—and their
experts know as well as the great French chefs how to prepare a
savory roast, stew, broil, entrée, or dessert. In the making of sauces,
the blending of meat and vegetable flavors, the cooking of fish and
shellfish, one also finds much variety and local Flavor on the
peninsula. Details as to those points may be found in abundance in
the forty pages Col. Newham-Davis devotes to this country in his
"Gourmet's Guide to Europe."
To enjoy the national and particularly the local varieties of Flavor,
it is well to take only a room in an Italian hotel and eat in the
restaurants. I always do this, paying a little more for the room,
which is only fair to the host. The trouble with these hotels is that
the table d'hôte, though usually good, is not Italian but French, and
in Italy you want something different, to get an idea of the
variations in flavor of the spaghettis, the minestrone soups, the
gnocchis, the risottos, and so on. Sometimes the hotel has attached
to it a locally conducted restaurant, in which case it is needless to
hunt for another.
For one of their gastronomic habits the Italians are justly
denounced by other Europeans—their slaughter of millions of birds,
largely blackbirds, siskins, green-finches, and other song birds, that
yearly seek a refuge among them on their flight to or from the
north. All efforts to curb this slaughter have so far proved unavailing.
The difficulty is double: the birds are very good to eat and the
common people cannot understand our point of view. Lina Duff
Gordon, in her book, "Home Life in Italy" (which takes the reader
right into the kitchens and the market places), tells about one of the
hunters: "Once, when he offered us a bunch of blackbirds strung
together by the neck, which he said made an excellent roast, we
seized upon the opportunity to deliver a lecture on the shooting of
singing birds. He listened so attentively that we rejoiced at having
made an impression on an important convert, until looking up with
eyes very wide open, he exclaimed: 'Ah! Sangue della Madonna!
Then you have no sport in England!'"
It is hardly fair to chide the Italians for making too much use of
garlic, unless we include in our censure the French—particularly
those of the Southern provinces—and the Spaniards, who not only
put it in their food but eat it raw in chunks. On this point I may be
permitted to cite from my "Spain and Morocco" some remarks on a
peasant who drove me from Baza to Lorca: "At noon he took his
lunch, composed of ten raw tomatoes, half a loaf of bread, a piece
of raw ham, and a large bulb of garlic consisting of a score of
bulblets, which he took one at a time to flavor his portions. It is
doubtful if he expected another meal that day, and in watching him
a brilliant theory came to my mind:—perhaps the poorer classes in
Spain are so fond of garlic for the reason that they have so little to
eat; for, as it takes several days to digest a bulb of it, they always
feel as if they had something in their stomachs."
In the best Italian restaurants, as in those of Paris, it is
understood that garlic, while delicious for flavoring, is so only in
homœopathic doses. Moreover one can always dine without garlic by
simply saying to the waiter, when ordering a dish, senz' aglio.
Whether Italian peasants eat raw ham, as that Spanish teamster
did, I do not know. Ham is not an Italian specialty. At Naples one
may get the genuine smoked article, but it is so expensive that only
the wealthy folk can afford it. But in his enthusiastic addiction to
tomatoes that Spaniard was akin to the Italians. How they do love
them—raw or cooked—more even than we do, if that be possible.
Next to cheese, nothing is so frequently added to the macaronis as
tomato sauce, either as we make it, or in the form of the paste
which is one of the unique Italian products that ought to be better
known in other countries.
The best tomato paste comes from the Province of Naples, where
it is made of a small variety of the fruit which has a special Flavor
that is much relished. This, to be sure, they do not waste on
foreigners. What is exported is, as we read in the "Daily Consular
and Trade Reports" (Dec., 1910), usually not even second rate, but
"of the third quality," which is "of course, very inferior, because it
contains little tomato extract and is almost entirely liquid. There is
no demand for it in the Italian market, and it is prepared exclusively
for exportation to America, where it meets the requirements of the
immigrant peasants from Sicily. The latter, when at home, either do
not use any tomato paste or consume a certain kind of hard tomato
paste (conserva di pomidoro) which is made by the peasant
women."
Consul Hernando de Soto further informs us that "tomato paste
of the first and second quality also is exported, though in much
smaller quantity, from Palermo to the United States, where it is
patronized by a more prosperous class of Italians and also, it is
stated, by some Americans."
Many more Americans would buy tomato paste were they sure of
not getting the third-class article after paying for the best, as
happens with so many things we eat.
IX
GERMAN AND AUSTRIAN DELICACIES
A COSMOPOLITAN CUISINE.
n the matter of cuisine the Germans are the most

cosmopolitan of all peoples; they learn eagerly from
other nations, and sometimes improve on the original.
They like variety; when traveling, unlike the English and
Americans, they prefer things new to them, and it has been justly
said that one of the Germans' chief objects in touring is to enjoy
exotic pleasures of the table.
At home they avoid monotony by frequently supping in
restaurants or beer gardens, the whole family being taken there,
including the dog, unless a great crowd is expected because of a
special musical treat, in which case the public is informed that
"Hunde dürfen nicht mitgebracht werden."
And how enthusiastically these burghers discuss the diverse good
things placed before them! A Berlin author maintains that three-
fourths of all Germans, and four-fifths of their cousins, the Austrians,
talk more about eating than about anything else, and that the most
successful novels in their countries are those in which there are
descriptions of banquets that make the mouth water. No need of
preaching gastronomy to them!
To deny that the Germans have a cuisine of their own, as some
of their own writers have done, is folly. While they have set a good
example in being willing to learn from their neighbors—as the
Italians learned from the Orientals and the French from the Italians
—they have also originated and improved a number of things
gastronomic which deserve to be transplanted to other countries.
A contributor to the "Frankfurter Zeitung" points out that "more
than one dish which in Germany, France, and England is relished
under a French name was originated by German cooks." He exhorts
these cooks to give the dishes they create German names, choosing
such as a foreigner can pronounce. England has succeeded in adding
some of its food names—like beefsteak, Irish stew, mock-turtle soup,
pudding, roast beef, toast—to the world-language, and the French
have shown by their adoption of Lied, Concertmeister, Hinterland,
Bock, etc., that they would not balk at German culinary terms.
DELICATESSEN STORES.
As a matter of fact some German terms have already become

part of the world-language—among them sauerkraut, pumpernickel
and the names of various sausages and cheeses. The most eloquent
testimony to German international influence is, however, the
ubiquitous delicatessen store. In New York there is one every few
blocks, and these places are patronized by many who are not
Germans. To be sure, few of these shops equal the originals in
Munich, Dresden, or Berlin, in variety and gorgeousness of display.
Edward Grieg, like most of the great composers, was an epicure.
It is related of him that one of his favorite amusements was to gaze
at the displays of good things in the delicatessen stores. One day,
while lingering before one of these windows he said to the American
composer, Frank Van der Stucken: "What an ideal symphony! How
perfect in all its details, in form, contents, and instrumentation!"
Grand gastronomic symphonies they are, indeed; and what is
more, the appeal of these delicacies is to the palate as well as to the
eyes. When a German pays his good money he wants something
good to eat, and if he is fooled, woe to the culprit. Strict are the
laws, and enforced they are, too. Officers of the health boards visit
the stores at unexpected times, taking away samples for chemical
analysis. Fines are inflicted for the least lack of obedience to the
pure food law, while gross offenders may be punished by life-long
imprisonment with hard labor.
The examiners, of course, visit not only the delicatessen stores
but the butcher shops, groceries, bakeries and all places where food
is offered for sale.
In Berlin there is a special institute for the inspection of
foodstuffs which is directly under the control of the police. It makes
chemical and bacteriological examinations of things offered for sale.
Purchasers who suffer from the ill effects of foodstuffs have the
privilege of applying to the police, who promptly make an
examination of the suspected article. This does not cost the
complainant a penny and the expense to the city of this invaluable
institute is only about $12,000 a year.
Encouraged by the knowledge of these facts, a German may
boldly enter any delicatessen store, confident of getting things that
will taste good and do no harm. And what a variety of luxuries is
spread out before him!
Cold roast joints of all the butchers' meats are placed in line on
the counter, with hams, raw or cooked, and sausages diverse, all
eager to be sliced to suit. I say eager because these things—
especially the sausages and the hams—taste so good that it surely
must give them altruistic joy to be eaten. Cold fowl is there, too,
ready for the carving knife, or to be taken away whole. The Germans
often lunch or sup on these sliced meats, huge platterfuls of which
are brought on the table—Gemischter Aufschnitt—and none of it is
wasted, you may be sure.
Chicken and fish salads diverse, including herring salad, and
potato salad—one of Germany's great contributions to the world's
gastronomic treasure—are at hand, as well as another international
delicacy of Teutonic origin—sauerkraut, raw or cooked; and
sauerkraut is a delicacy; nor is it indigestible when cooked the right
way and long enough. Proof of its high standing is provided by the
fact that France's gastronomic high priest, Brillat-Savarin—whose
famous work on the Physiology of Taste has become so popular that
a penny edition of it is sold in the streets—puts it, with partridge, on
the menu of one of three fine dinners he suggests. The French,
indeed, are almost as much addicted to the eating of sauerkraut as
are the Germans. In England and America not a few persons
foolishly sneer at it as "rotten cabbage." It is no more rotten than
pickles are rotten, for it is simply pickled cabbage—cabbage pickled
in its own juice plus salt, and soured by fermentation.
The pickles eaten by Germans are not all sour; they like, almost
better than the sour kinds, the dill pickles, which are cucumbers
preserved in a liquid flavored with the blossoms and seeds of an
umbelliferous Oriental plant, anethum, cultivated in German gardens
for its spicy aroma. Teutons seem to take to this naturally; with
others it is an acquired taste, like that for olives.
Smoked or soused herrings, sprats, and diverse spiced fish
(marinirt) are always on sale in the delicatessen stores, and they are
acknowledged among the best specialties of Germany. Eel and other
fish in jelly are other characteristic edibles the Fatherland has reason
to be proud of; and have you ever eaten cold goose in an acidulated
meat jelly? It is worth while going to Berlin, just to taste this
Prussian Gänseweisssauer.
Smoked Pomeranian goosebreast is always in stock; its taste is
not unlike that of raw smoked ham and there is no danger of
trichinosis, though, to be sure, that danger from eating ham has
been reduced in Germany to a minimum by the strict system of meat
inspection.
The heads and feet of calves, sheep, and swine, wild and
domestic, are much in demand; a wild boar's head often is the
center of interest in the show window of a delicatessen store. Of
course there are also canned meats and vegetables, with diverse
fancy groceries and cheeses of various countries, together with
crackers and breads of diverse shape, size, and color. But enough
has been said to show that a German delicatessen store is a treasure
house of appetizing foods, many of them peculiar to the Fatherland,
and most of them agreeable to the palate of a real gourmet.
It is possible that a thousand years hence Bismarck's fame as a
statesman may have waned; but Bismarck herring will continue to
be served in all lands until the seas are fished out. On a warm
summer day, when you are not hungry and yet feel a vague longing
for something piquant, try a Bismarck herring with potato salad. You
will bless me for the advice. It is very good for the stomach, too, the
doctors say.
SAUSAGES AND SMOKED HAM.
The French have excellent sausages and so have the Italians.

They are hard to beat, and yet, in the matter of variety and general
excellence, the Germans as makers of würste are supreme.
Various are the tastes of sausage eaters, but all of them may be
gratified west of the Rhine. I have before me a book by Nicolaus
Merges bearing the title "Internationale Wurst und Fleischwaaren
Fabrikation." Concise directions are given in it for the making of
more than a hundred and fifty kinds of sausages, all of which are
manufactured in Germany, though some are of foreign origin.
Why so many kinds of sausage? There is not much difference in
their nutritive value. They are made in different ways simply to
secure variety in Flavor, to please all palates.
The book referred to shows how this variety is secured. Different
meats are used and these are diversely blended, spiced, and cured.
The possibilities are unlimited; the hundred and fifty varieties in the
Merges volume are a mere fraction of the total number, nearly every
locality having its special kind.
Of liver sausages there are two dozen varieties, the cheapest
being made from ordinary beef liver while the Gänselebertrüffelwurst
(goose-liver-truffle sausage) may cost a dollar a pound. Of sausages
in which blood is used there are more than a score. These are
cheap, and—well, if they cost nothing I wouldn't eat them.
The biggest of all the sausages is the Cervelat made in
Braunschweig (many German towns have become world-famed by
the making of some particularly well-flavored sausage, cheese, cake,
or beer). The Brunswick brand is compounded of beef and pork,
both lean and fat. The Westphalian variety includes less beef. Some
kinds of Cervelat exclude pork, containing only beef or veal. There is
also a homœopathetic Cervelat. It is intended for convalescents, and
has a minimum of fat and spices. A kosher Cervelat is made for
Hebrews.
Beef from old cows is not in the best repute, yet for the making
of Salami it is preferred to the tenderloin of a young steer. (The
toughest meat sometimes has the richest Flavor.) Salami hails from
Italy, but special varieties of it are made in Germany, as well as in
Holland, Switzerland, Russia, and Hungary.
It is needless to give details regarding Plockwurst, Mettwurst,
Knoblauchwurst, Knackwurst, Schwartenmagen, etc., in all their
transformations. In some varieties anchovies, kidneys, or brains are
used.
Bärenwurst is not often seen now, as bears are getting scarce.
Horse meat of course is used (why not?) for cheaper sorts, and the
bow-wow joke of the comic papers is not altogether without
foundation. American Indians agreed with the Chinese in regarding
dog meat as a great delicacy—the dish of honor to be served to
guests. Dog meat sausage may be quite legitimate, as long as it is
honestly labeled as such.
There is a story of a wealthy Berlin butcher whose son had been
promoted in the army by Moltke, and who, to show his gratitude,
advised the Field Marshal never to eat sausage. But those days of
uncertainty are past. Inspection is now so strict in the Fatherland
that one can safely eat whatever is offered.
When the eminent German novelist, Ernst von Wolzogen, visited
the United States (1911) he exclaimed, on the eve of departure, to a
reporter for the New York "Staatszeitung": "Great heavens, if you
knew what an indescribable longing has often seized me in your
country for a good German sausage! No—for their food I cannot
envy the Americans."
Considering the large number of Germans in the United States it
seems strange that they do not insist on having as good sausage
made here as on the other side. But they do not. The home-made
sausage is usually compounded of worthless scraps, and is apt to be
indigestible. As for the "imported" Cervelat and other kinds, they are
often so in name only—which explains that wail, de profundis, of
Freiherr von Wolzogen.
American sausages made after English or original recipes are
generally spoiled by an excessive amount of sage. Sage should
always be used homœopathically, else it overpowers all other
flavors. Were I Czar in the realm of gastronomy I should forbid the
use of sage altogether.
The next time you go to Europe do not forget to make an
automobile trip from Munich to Berlin, taking in Nuremberg on the
way. We did that, with some friends, in the summer of 1912, and
when we reached the city of Hans Sachs we steered straight for the
Bratwurstglöcklein, a little eating shop, known by name at least, to
epicures the world over, though only one dish is cooked in it, and
that dish, as the name indicates, is sausage.
Five Würstchen, no bigger than your thumb, are served with a
portion of sauerkraut. The cost is half a mark—twelve cents—a
portion and you can have as many encores as you like. Some of us
took four, and so tender and tasty were the little things, as well as
the kraut that we had no occasion to regret it. After all, we were
mere tyros, as our waiter informed us; he has known many a man to
eat a dozen portions or more and not send for an ambulance—at
least, that's what he said. The number of portions served daily vary
from 3,000 to 5,000; the record is 25,000 served on a day when
there was a Sängerfest.
Nuremberg has two other eating places similar to this, but the
Bratwurstglöcklein maintains its preeminence, owing to its traditions;
for it was in its little rooms that the men who (with the aid of the
Bratwurstglöcklein) made that city famous—among them Sachs,
Welleland and Dürer—used to gather for food and drink.
After we had paid our bill—not a ruinous one for an automobile
party—we started for the next town on our list, after buying a few
boxes of the world-famed honey cakes (Lebkuchen) of the town. We
all had seen the other sights of Nuremberg before. Besides, we were
on a gastronomic trip, and discipline had to be preserved.
Observation has convinced me that Americans would be as
enthusiastic sausage eaters as the Germans are if they could get
them as well made and cooked. In a large New York down-town
restaurant you can see, on certain days, half the guests ordering
"country sausages," which, though good, are not to be mentioned
on the same day as those of the Bratwurstglöcklein. The inference is
inevitable that a lunch-room serving honest duplicates of the
German delicacy would prove a gold-mine.
The proprietor of another down-town restaurant who provides
excellent little Frankfurters informed me he got them at a certain
shop in which two butchers had successively made their fortune by
simply manufacturing these honest little sausages and really
smoking them instead of using "liquid smoke." It makes such a
difference to the palate as well as the stomach.
Genuine Frankfurters are made of solid meat (not lungs) and
they are always smoked. They are known as Frankfurters throughout
the greater part of Germany and Austria, but in Frankfort they call
them Wiener Würstel, to dignify them, presumably, as exotics.
Smoked sausages and other meats are in great vogue among the
Germans, whose addiction to them gives them the right to pose as
true epicures. Do they not provide the whole world with smoked
goosebreast, Hamburger Rauchfleish, and the best of all hams, the
smoked Westphalian?
In South Germany they have a special word for smoked meats,
Geselchtes, or Selchware. The composer Brahms never missed a
chance to get a dish of "G'selchtes"; it gave him an appetite when
nothing else would.
Bismarck, the most famous of German gourmets, took great
delight in feasting on smoked meats and fish—Spickgans, Spickaal,
Schinken, &c. He knew as much about the different varieties and the
places they came from as any dealer in delicatessen, as we know
from the table talk recorded by Dr. Moritz Busch.
Smoked Westphalian ham has carried the fame of Germany to
the lunch tables of all parts of the world; and not a whit inferior in
Flavor is the Austrian variety, Prager Schinken. Raw or cooked, these
are among the superlative delights of the epicure, ranking with
caviare, Camembert, and canvasback duck.
On the appetizing quality of properly smoked meats which makes
the mouth water and facilitates digestion I have already commented.
German and Austrian hams owe their fame to the fact that they
are smoked and otherwise cured scientifically, regardless of cost,
with a view to developing the most delicate Flavor.
The first thing to be noted is that the men who cure the meats
do not dare to denature them (i. e., spoil their natural Flavor) by
soaking them in solutions of chemicals which are not only injurious
to health but which would make it possible for them to hide the
putrescence of spoiled meats—as is so often done in America.
The law on this point is very strict. By orders of the Imperial
Federal Council, dated July 4, 1908, the following substances have
been forbidden: Boric acid and salts thereof, formaldehyde, the
hydroxides and carbonates of the alkaline salts, sulphurous acid and
the salts thereof, the salts of hyposulphurous acid, hypofluoric acid
and salts thereof, salicylic acid and its compounds, chloric acid and
salts, and all coloring matter.
Consul Talbot J. Albert, of Brunswick writes that "the German
inspection laws, especially in regard to hams and all hog products
are so strict that their adulteration would be immediately detected,
the products confiscated, and the manufacturer severely punished."
The ingredients used in the curing of hams before they are
smoked are salt, saltpeter, and pepper. The quantity of these and
other ingredients and the method employed are business secrets
difficult to ascertain.
In America, sugar-cured ham is advertised in large letters. Sugar,
no doubt, is a good preservative, and it is harmless, but somehow it
seems as incongruous with meat as salt is with cream or butter. Ask
an epicure if he would like his oysters with sugar, and see him
shudder. In Germany, hams are seldom sugar-cured.
"The Daily Consular and Trade Reports" for December 8, 1909,
contains such information on the subject of smoked sausages and
hams as the consuls in various German cities were able to gather.
They found that sausage is smoked up to three or four weeks,
unless it is to be eaten at once. The smoking makes it lose some
weight and cost more—but what of that, as long as the Flavor is
improved? The American way is to save the full weight by using
chemicals and then sell the denatured stuff as "smoked" meat. It is
profitable to the packer. The consumer—well, it serves him right if he
continues to buy such stuff without a protest.
Of the contributors to the Consular symposium on smoked meats
in Germany, Vice-Consul Frederick Hoyermann of Bremen gave the
most informing account.
"The fresh ham is put into pure common salt (sodium chloride)
and is kept therein for about three weeks, whereupon it is washed
and air-dried. After having been exposed to the air for about eight
days it is ready for the smoking process, which lasts from six to eight
weeks. It is hung up in the smoke of beechwood chips, which must
burn slowly so as not to create heat or evolve too much smoke. The
ham must be smoked thoroughly but gradually, and must remain
cool while undergoing the process. Thereupon it is cleaned and is
then ready for use."
Now note what the same writer says about the "quick-smoking"
process: "Hams are smoked by a simpler and cheaper process, pine
wood being used for smoking instead of beech, the time allowed for
smoking is considerably reduced, and stronger smoke applied. Hams
thus cured are, of course, inferior in quality, as they lack in Flavor
and are not fit for export, because only high-class meats will pay the
cost of transportation."
The so-called Westphalian hams do not all come from
Westphalia. The name is generally applied to choice hams which
have been smoked thoroughly but gradually in accordance with the
methods indicated in the preceding paragraphs.
One more important detail. The Germans know the value of
feeding Flavor into food. As Consul Carl Bailey Hurst, of Plauen
wrote: "The best and most durable hams are those of hogs which
have been fed during the few weeks previous to slaughtering on
acorns or corn."
Juniper berries are sometimes thrown on the beech wood while
hams are being smoked, in the belief that that still further improves
their Flavor. Maybe it does—I have had no opportunity for
comparisons. Possibly it is a mistake. The Germans, though they
make the best hams and sausages in the world, are as a nation far
from impeccable; in the use of spices, in particular, they often
blunder grossly. It is surely an aberration of taste to mix cloves, bay
leaves, cinnamon, caraway seeds, sage, or ginger with the
preserving fluid; for these strong condiments destroy the individual
Flavor of the meat.
Excessive use of spices is the chief blemish of German cookery.
Many otherwise well-made dishes are spoiled by the addition of
pungent condiments which completely monopolize the palate. The
excessive use of these condiments is a survival of medieval
coarseness. I shall not dwell on this, however, or on other deplorable
relics of the coarse appetite of former generations, because the
object of this book is not to point out the shortcomings of European
nations but to call attention to practices in which they are ahead of
us. Let us therefore proceed to another department of gastronomy
in which the Germans (and their neighbors) can teach us useful
lessons.
LIVE FISH BROUGHT TO THE KITCHEN.
The Paradise of fish-eaters is Copenhagen. New York and other

American port towns could get some very important hints from the
way things are done there. Before 1892 it was difficult to bring live
fish into the town without contaminating them with sewage and
spoiling their flavor. In that year a general sewage system was
constructed by which the city's sewage is carried two kilometers out
into the open sea, thus putting an end to the contamination of the
ocean front and the harbor. The gratifying results of this reform were
described by the London "Lancet's" representative at the Sanitary
Congress in Copenhagen, October, 1910:
"This not only puts an end to the nuisances that used to arise,
but enables boats full of live fish to come close to shore and right
into the town by means of the fresh-water canals. In this manner at
least the smaller fish are kept alive till the moment they are sold.
Any number of wooden boats are pierced with holes and filled with
fish; these boats just float on the surface of the water, and the living
fish is taken out of them when wanted. But as every one cannot go
to the water's edge to buy fish, there are water tanks on wheels and
the live fish is brought to the doors of the people's houses.
"Never before," this sanitarian continues, "have I been in a town
where all the fish, whether cheap or dear is so beautifully fresh. The
principal fish market was built by the municipality and is let to a
wholesale fish salesman. It is a delight to see how clean and bright
these premises are kept. There is no spreading the fish on slabs so
that dust and dirt may settle on them. Very pretty tessellated tile
tanks are filled with running water, and here the smaller fish swim
about."
In Berlin and other German cities the fish are also brought alive
to the kitchen. An eminent artist who is also an ideal hausfrau, Mme.
Gadski, informed me that she wouldn't think of buying a dead fish.
"They are brought to the kitchen alive, and I reject those that are
not swimming about," she said.
The Germans are great eaters of fresh-water fishes, and there
are ingenious arrangements for bringing them to market alive.
The large fish of the ocean cannot, of course, be delivered alive,
but the transportation facilities are now so excellent that not only
the more expensive kinds, like sole, turbot, and sterlet, but the
cheaper sorts, like cod, haddock, plaice, and herring, are brought to
city and town markets in prime condition.
A German culinary authority specially calls attention to the fact
that the "ancient and fish-like smell" is a thing of the past. In the
days when transportation facilities were less adequate this odor
made it necessary to boil fish in two waters, throwing the first away.
Now the cook has only the natural odor of the unspoiled fish to deal
with, which, being agreeable, is carefully preserved in the cooking.
The fishing places off the German coast are visited daily by fast
steamers to collect the catch. The boats are provided with
refrigerating apparatus, and so are the express trains which at
Stettin, Geestemmünde, Cuxhaven, and other coast towns, take the
fish from the boats and carry them at full speed to the cities all over
the Empire.
The same excellent arrangements for keeping the fish cold
without spoiling their flavor by freezing them are to be found on
German steamers. On the eighth day out on the Kaiserin Auguste
Victoria I found the salmon as fresh-tasting as if it had just been
caught. "How do you do it?" I asked Captain Ruser; and he
explained the system—the refrigerating arrangements which, with
steady ventilation, provide a frigid atmosphere without actually
freezing the fish or the meat.
Such things cost time and money; but the Germans, being a
gastronomic nation, consider them worth while, on sea as well as on
shore.
Hamburg sets a good example in showing what a municipal
government can do in the way of providing the people with fresh fish
and telling them what to do with them. The following is from the
"Fremdenblatt" of that city; similar notices frequently appear in the
newspapers:
Sale of Cheap Sea Fish. "The Staatliche Fischereidirektion" informs us that
on Tuesday, August 20, there will be on sale, at the known 150 shops, fresh
haddocks—averaging 3/4 pound apiece—at 23 pfennigs [5-3/4 cents] a
pound. Besides this, many shops offer for sale fresh mackerel at twenty to
twenty-five pfennigs [5 to 6-1/4 cents] apiece, according to size. The
mackerel is an excellent fish both for frying and boiling. New directions for
cooking haddock in a variety of ways are contained in the illustrated booklet,
"Fischkost," which is given free to purchasers at all the stalls.
The Hamburgers are lucky in having the "net gains" of sea

fishing placed before them at the earliest possible moment. With the
aid of the arrangements just referred to these fishes can, however,
be bought in good condition as far away as Vienna. A few years ago
the Austrian officials had a number of railway cars constructed for
the transportation of sea fish and also of live fresh-water fish.
Germany has had such cars for decades, bringing fish not only from
her own ports but from Holland and elsewhere. African eels are sent
from Algiers to Marseilles and thence by express trains all the way to
Berlin.
Eels are usually despised in America and with good reason, for
their scavenging habits often make them inedible. But there are eels
that live on fresh food, such as small crustaceans at the bottom of
the sea, and fish roe; and these are as good as any fish that swims.
The large eels served in Berlin are as tender, juicy, and sweet-
flavored as shad. When I was a student at the University of Berlin,
one of my pet excursions was up the Spree, stopping at an inn
where eels of medium size—blau gesotten, were served as a
specialty. They were delicious, though they did look strikingly like
snakes as they lay curled up on the plate swallowing their own tails.
Not a few persons whose education has been neglected refuse to
eat eels, believing them to be allied to snakes, when in truth they
are no more related to snakes, zoölogically, than whales are. And
even if they were of the snake family what of it, if they taste good?
The eminent Norwegian explorer, Dr. Lumholtz, who spent several
years among the Australian wild men, told me on his return, while
we were enjoying a dish of terrapin together at Henry Villard's, that
much as he liked this reptilian delicacy, of which we Americans are
so proud, he thought that python liver, which he had had frequent
occasion to eat, was quite as good.
While studying at Heidelberg I did not neglect, it is needless to
say, the Wolfsbrunnen, famous for its trout. I have eaten trout,
caught by myself in many parts of the world, including the Maine
woods, Lake Tahoe in California, and Trout Lake in the State of
Washington; but none tasted better than a dish served in Berlin at a
sumptuous new hotel oddly called Boarding Palace.
All over Germany fish-breeding in ponds is an important industry.
Bavaria alone had, in 1909, over 33,000 acres of such ponds, and
probably has many more now; Saxony had 200,000 acres, while
Silesia had nearly 60,000. The total area of fish ponds in the Empire
probably does not fall far short of a quarter of a million acres.
Carp are grown in special abundance, and German carp are very
good to eat, especially when they have been artificially fed and
fattened with rice, potatoes, fish meal, or dairy refuse.
Other kinds grown are perch, pike-perch, tench, eels, and trout
of several kinds, including the American rainbow. The trout are fed
shellfish, slaughterhouse refuse, horse meat, fish meal, and specially
prepared foods.
Everything is done with German thoroughness, and the results
once more prove gastronomy to be a good guide to wealth.
The profits are increased by selling the fish direct to consumers.
Fish-growing associations have been formed for this special purpose
all over the empire.
As these ponds are scattered all over the country it is possible to
have everywhere fish just out of the water; and, as I have said
before, the poorest variety of fish just caught has a finer Flavor than
the best variety that has been kept a few days by any method
whatever. I have lived in Germany three years and do not remember
ever to have had on my plate insipid fish, such as we are doomed
three times out of four to eat in our own country, chiefly because the
fish are frozen.
Dr. Wiley insists in his "Foods and Their Adulteration" (1911) that
"the consumer is entitled to know whether in any given case the fish
he purchases is a fresh or a cold storage article. At the present time,
in so far as I know, there are no national, state or municipal laws
whereby this fact can be ascertained. Without raising the question of
comparative value or palatability there is no doubt but what the
consumer is entitled to know the character of the fish he purchases."
Big Frauds in Fish: Under this head the "National Food Magazine"
of Chicago has published some remarks by G. J. L. Janes, which
vividly depict the outrages perpetrated in the United States by cold-
storage men.
"The legal regulations governing the sale of fish are so lax that
we have decided to stop handling fresh fish altogether rather than
suffer the unjust competition and be a party to so many deceptions
on the public. A dealer can take any kind of frozen fish, thaw it out,
and mark it strictly fresh-caught fish, and if he so desire, sell it as
such. This is being done all along State Street in Chicago to-day. It is
not only a fraud and cheat on the public, but it is dangerous. Fresh-
caught halibut costs 12 cents a pound wholesale. There is 20 per
cent. waste in it, because of the fins, skin, etc., and hence we have
to add 20 per cent. to the cost in order to break even on it.
Nevertheless certain stores are advertising strictly fresh-caught
halibut at 10-1/2 cents a pound retail. Of course this is frozen halibut
they are selling. That can be bought at 8 cents a pound wholesale.
The same is true of other fishes, especially white fish. That costs 22
cents a pound when fresh. Certain stores advertise "fancy white-fish
winter caught" at 10 cents retail. There is no mention of its being
frozen or cold storage fish, and so the public is deceived. It is
dangerous economy to buy cheap fish. No other food deteriorates so
rapidly after it comes from the water. Especially is this true of white
fish, which spoils quickest of all. Freezing breaks up the tissues, and
when it once is thawed it decomposes with enormous rapidity."
As long as the American public patiently tolerates such
impositions on purse and stomach it seems hardly worth while to
discuss the more subtle gastronomic problems, such as the question
put by Dr. Wiley: "Whether or not the flavor and character of the
flesh are impaired by the suffocation process subsequent to the
capture of the fish." Undoubtedly fish is best when killed the instant
it leaves the water, and then at once eviscerated and cleaned.
When we have become sufficiently civilized to insist on such
measures being taken, attention will be paid to the suggestions of
the Danish fisheries agent, Captain A. Solling, communicated to the
"Daily Consular and Trade Reports" by Consul-General Wallace C.
Bond, of Copenhagen. Captain Solling recommends that the fish, at
least the better kinds, be cut while yet alive, promptly cleaned, and
then wrapped in specially prepared paper which would prevent its
coming in direct contact with the chopped ice. The objection may be
raised, he admits, that this way of treating fish is too particular and
takes too long; but the increased work and the increased expense
will, he feels sure, soon be offset by the higher price secured on
account of the better preservation of the fish; and "the intelligent
fishmonger will soon discover the advantage of handling fish, which
if not sold to-day, may be sold in 3, 4 or 8 days and still be equally
good and fresh."
Progress along this line of gastronomic civilization will be a boon
to the American farmer. There are tens of thousands of lakelets and
ponds in our country, most of which might be used for fish culture.
They will be so used by farmers as soon as we have learned the
lesson the German ponds teach, and stopped buying the flavorless
frozen stuff sold in our fish markets.
In Switzerland there has been formed a Fish-Growers' Association
for the enlightenment of the land owners. Its motto is: "Every
Farmer a Fish Pond Owner." Attention is called to the demonstrated
fact that an acre of fish pond is more profitable than the same area
devoted to the ordinary farm crops.
GAME AND GEESE.
The same care that the Germans show in the growing and
transportation of fish is also manifested in their treatment of game.
During the automobile tour across Germany to which reference
has been made, we purposely stopped, as a rule, at the smaller
towns and taverns; but everywhere, without advance notice, we had
excellent food. I had previously come to the conclusion that the
average German restaurant serves nearly if not quite as good meals
as the average French restaurant, at least in the provinces.
It was game season, and everywhere we were able to get
partridges—plump young birds, juicy, and cooked scientifically, at
about one-third American prices.
Hares and rabbits are a German specialty, and Hasenrücken is a
very different thing from the undrawn rabbit abomination sold in
American markets. The Californian cottontail is the nearest approach
we have to the Teutonic hare. I shot dozens of them in Los Angeles
County one winter and found them as tender and almost as well
flavored as young chicken.
Venison is seldom to be had in our markets and usually only at
fancy prices. In German restaurants it is as cheap as beef;
sometimes cheaper. The back—Rehrücken—costs a trifle more, and
is better than the rest of the meat, which is usually served roasted
or as a ragout; but all is good. It seems to be a specialty of the
Rhine boats.
Other game also is abundant and cheap, for the simple reason
that the greed for sport is regulated by severe laws which are strictly
enforced. We, too, now have game laws in most of our States, but
they are seldom enforced effectively and most of them, moreover,
were made on the principle of locking the stable door after the horse
has been stolen.
Africa is at present the scene of ruthless slaughter of game, big
and little, but at its worst it is not often so reckless, extravagant, and
wasteful as the hideous carnage of which Americans have been
guilty. Time was when wild pigeons blackened the sky and were slain
by the hundreds with poles. Wild turkeys inhabited every thicket and
could be bought for twenty cents apiece—they are twice as much a
pound now, though seldom on sale at any price. Ruffled grouse were
so plentiful that a bounty was offered for their extermination, their
abundance being a menace to the crops. To-day you pay $5 for a
brace of these birds. Deer, until lately, were killed for their haunches,
the rest being left for beasts of prey; while millions of buffaloes were
slaughtered for their tongues and hides—often for the tongues
alone.
The Audubon Society, aided by generous donors and, to some
extent, by the Government, has done royal service to protect game
and song birds. The intelligent sporting clubs are lending useful aid,
while the Yellowstone Park has been set aside as a great game
preserve. Unfortunately, although the animals are safe from guns
while they remain in the Park, thousands are slaughtered in winter
when hunger drives them outside its limits, while many thousands
more perish because no provision is made for feeding these poor
wards of the Government.
A pathetic picture is printed in Dillon Wallace's splendid book,
"Saddle and Camp in the Rockies." It tells a sad story. One settler
told him there had been times when he could walk half a mile on the
bodies of dead elk. Instead of helping its wards, the Federal
Government actually gave permits to sheepmen which would have
devastated the last refuge of the elks. The settlers saved the
situation by holding an indignation meeting. "The sheepmen saw the
point—and the rope—and discreetly departed."
In Germany the game animals are cared for in winter. While
visiting Mark Twain's daughter and her husband, the eminent
pianist-composer, Ossip Gabrilowitsch, in the Bavarian Highlands, in
the summer of 1912, we met at their house a young tenor who was
also a mighty hunter before the Lord. He gave us an account of the
game laws and the general arrangements for preservation and
multiplication, which convinced us that if we are to retrieve the
errors and crimes of our predecessors, East and West, we must
follow the example of Germany.
Pointing to the meadows round about, he explained that the hay
made on these is preserved and fed to the deer in winter. Often one
may see as many as a hundred at a time assembling for their daily
meal, and people come all the way from Munich to see them at it.
As it had been found that too much hay or other dry food was
not good for the deer, the owners of private game preserves, of
which there are many, have taken to planting beets, turnips or
potatoes, which remain in the ground till the animals dig them out
from under the snow and soil.
A suggestive detail regarding the protection of birds is that
thickets, bristling with thorns, are specially provided to help them
during nesting time and when pursued by birds or beasts of prey.
The clearing away of thickets in America has done almost as much
as actual slaughter in exterminating birds. Lovers of song birds as
well as epicures who like game for a change would unite in blessing
our railway companies if they followed the German example of
planting shrubs as homes for birds all along the railroad
embankments.
While the Germans are fond of partridges and other game birds,
their favorite food, so far as the feathered tribes are concerned, is
the domesticated goose. In the markets, especially of the northern
cities, more geese are exposed for sale than all other kinds of
poultry combined, and in restaurants Gänsebraten is seldom absent
from the menu. The French rather look down on roast goose, but
that is because their roast goose is not so juicy and tender as the
Prussian, whether owing to a difference in variety or rearing I cannot
tell.
The Germans are most painstaking in the growing and the proper
feeding of this bird. They know that corn fodder yields the largest
amount of fat—and goose fat is much in demand—while the finest
Flavor is secured by feeding barley malt.
The best goose, like the best beef, is grown where there is
abundant pasturage. There is less of this in the Empire than there
used to be, hence large numbers of geese are imported. From six to
seven millions of them are annually brought across the border,
mostly from Russia. Every day, a special "goose train," consisting of
from fifteen to forty cars crosses the Russian frontier bound for
Berlin or Strassburg.
Deer in German Forest
Strassburg is one of the many cities that were made famous by a

special food. Goose liver was already relished as a great delicacy by
the ancient Romans; Horace refers in one of his poems to the joys of
eating the liver of the white goose fattened with juicy figs. In
Strassburg, unfortunately, the geese are not fattened with figs, but
are locked up in cages and stuffed for a number of days with shelled
corn or noodles till their overworked livers become abnormally
enlarged, after which they are made into what is known the world
over as pâté de foie gras. This mixture of liver, meat and truffles is
now prepared on a large scale also in Toulouse and other French
places, but the headquarters for it is Alsace, where it is made in
many places, though it is said that there is a growing opposition to it
on account of the cruelty inseparable from the stuffing process. It's a
great pity that such cruelty should be necessary, for not a few
epicures feel like the Rev. Sydney Smith, who exclaimed: "My idea of
heaven is eating foies gras to the sound of trumpets."
IN A BERLIN MARKET.
That the goose is the food of the day and every day is made
manifest in the markets of Berlin, of which there are more than a
dozen. All the poultry stalls are filled with them, so much so that
other meat, even the ever-present veal, shrinks timidly into the
background.
Wherever one stops, the displays are most attractive. There are
unfrozen, fresh-killed meats of all kinds, tempting even the sightseer
who has no intention of buying. Autumn flowers, and large boxes of
deep red Preisselbeeren—a berry very similar to the mountain
cranberry found on Maine's highest peaks, and growing everywhere
in Germany (it ought to be acclimated in our fields)—give rich
autumnal hues to many of the market stalls, while the fragrance of
Gravenstein apples fills the air near the fruit stalls.
As in Paris, the sea fish are fresh-caught, with ice about them,
but never frozen, while fresh-water fish are carried to the buyer's
house in a tank and selected alive. The German krebs, or crawfish, is
almost as much in evidence as the French écrevisses, and like these,
it is kept in tanks of cold, running water, except for a few boxfuls,

Full download Genotype Phenotype Coupling Methods and Protocols 2nd Edition Stefan Zielonka pdf docx

Uploaded by

Copyright:

Available Formats

Full download Genotype Phenotype Coupling Methods and Protocols 2nd Edition Stefan Zielonka pdf docx

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Full download Genotype Phenotype Coupling Methods and Protocols 2nd Edition Stefan Zielonka pdf docx

Uploaded by

Copyright:

Available Formats

Download the full version of the ebook at ebookfinal.

Genotype Phenotype Coupling Methods and Protocols

Download more ebook instantly today at https://ebookfinal.com

Genotype to Phenotype 1st Edition J. J. Goodship (Editor)

Epigenetics Linking Genotype and Phenotype in Development

Flavins and Flavoproteins Methods and Protocols 1st

Pharmacogenomics Methods and Protocols 2nd Edition Rosane

Biological Aging Methods and Protocols 2nd Edition Huaping

Pancreatic Cancer Methods and Protocols 2nd Edition Hanno

Peptide Antibodies Methods and Protocols 2nd Edition

RNA Scaffolds Methods and Protocols 2nd Edition Luc

Stefan Zielonka · Simon Krah Editors

For further volumes:

Methods and Protocols

Stefan Zielonka and Simon Krah

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Darmstadt, Germany Stefan Zielonka

12 One-Pot Droplet RT-OE-PCR for the Generation of Natively

23 Streamlined Data Analysis Pipeline for Deep Sequence-Coupled

CHARLES DAHLSSON LEITAO • Department of Protein Science, KTH – Royal Institute of

DANIEL KLEWINGHAUS • Antibody Discovery and Protein Engineering, Merck Healthcare

of Antibody-Based Immunotherapy, Department of Medicine II, Christian Albrechts

GORDANA WOZNIAK-KNOPP • Christian Doppler Laboratory for Innovative

Quantitative Determination of Staphylococcus aureus

Staphylococcus aureus (S. aureus) is one of the most common food-

converters [3]. They are usually superior in their rapid detection

Prepare all solutions using ultrapure water (18 MΩ cm) obtained

2.1 Strains 1. Staphylococcus aureus (S. aureus, ATCC 29213).

2.2 Oligonucleotides 1. S. aureus aptamer: 5′- GCAATGGTACGGTACTTCCTCGG

2.3 Media 1. LB liquid media: Weigh 10 g peptone, 10 g NaCl, and 5 g yeast

filtration air-permeable sealing film and brown paper in turn.

2.5 Detection of S. 1. 1 mM [Fe(CN)6]4-/3- solution: Weigh 0.0823 g K3[Fe

Adjust pH to 7.0 with NaOH or HCl solution. Make up to 1 L

3.2 Preparation of 1. Take 2 μL of 1 μM W and 4 μL of 1 μM S. aureus aptamer to the

3.9 Optimization of 1. Take 8 μL of 100 μM CT1, and denature at 95 °C for 10 min.

molecular weight can be clearly distinguished by high-

3.12 Specificity 1. Cultivate several non-target bacteria such as E. faecium,

Fig. 5 DPV curves recorded at different concentrations of S. aureus: (a) 60,

Fig. 6 Relationship between the current response and the concentration of

1. The modified group “SH-(CH2)6” at the 5′ terminal of the

9. Adding 100 mL of water after weighing the chemicals can

Construction of Synthetic VHH Libraries in Ribosome

Besides conventional IgGs, Camelidae also produces IgG2 and

them easier to engineer than full-length IgGs. The long CDR3

This is mainly why several synthetic VHH libraries have recently

2.1 Oligonucleotides VH-L1.1: 5′- CTTTAAGAAGGAGATATATCTATGGGATCC

VH-L1.9c 5′- CCGCGGTGTATTATTGCGCG

2.1.2 Primers for the AF-link-F: 5′- AAGCTTTATATGGCCTCGGGGGCCGAATTC -

2.1.3 Primers for the T7B: 5′-ATACGAAATTAATACGACTCACTATAGGGAGACCA

2.1.4 Primers for PCR to NGS-VHH_Fint: 5′- TCGTCGGCAGCGTCAGATGTGTATAA

2.2 PCR 1. UHP water (various suppliers).

The VH-L1 library described here is adapted from the work of

result the corresponding mRNAs, as this is important for ribosome

6. Prepare a 1.5% agarose gel. Mix 5 μL of each of the PCR

10 μL of dNTPs mix (containing 10 mM of each dNTP),

30 s, 72 °C for 10 s with a final elongation step of 72 °C for

1. The tolA spacer allows the displayed proteins to properly fold

this step are of high quality as judged by agarose electrophore-

The authors thank all previous members of the laboratory who

Isolation of Adhirons Specific for Plant Protoplast