Life Sciences 334 (2023) 122176

Contents lists available at ScienceDirect

Life Sciences
journal homepage: www.elsevier.com/locate/lifescie

Corilagin attenuates intestinal ischemia/reperfusion injury in mice by

inhibiting ferritinophagy-mediated ferroptosis through disrupting
NCOA4-ferritin interaction
Yunxiang Wang a, Bin Li a, b, Guanting Liu a, Qipeng Han a, Yunpeng Diao a, b, *, Jing Liu a, b, *
a
College of Pharmacy, Dalian Medical University, Dalian, 116044, China
b
Dalian Anti-Infective Traditional Chinese Medicine Development Engineering Technology Research Center, Dalian 116044, China

A R T I C L E I N F O A B S T R A C T

Chemical compounds studied in this article: Aims: Intestinal ischemia reperfusion (II/R) is a common clinical emergency. Ferroptosis is reported to play a role
Corilagin (PubChem CID: 73568) in II/R injury. Our previous studies revealed that corilagin significantly attenuates intestinal ischemia/reper­
LY294002 (PubChem CID: 3973) fusion injuries. However, the underlying molecular mechanism is unclear and requires further study.
Nigericin (PubChem CID: 16760591)
Materials and methods: DAO, GSSG/T-GSH, MDA, and Fe2+ were measured by assay kits, 4-HNE was assessed by
MG-132 (PubChem CID: 462382)
Erastin (PubChem CID: 11214940)
IHC, and 15-LOX was measured by ELISA. Mitochondrial damage was observed by TEM and cellular oxidation
Ferrostatin-1 (pubchem CID:4068248) levels were detected by C11-BODIPY 581/591 and DHE probes. LC3, p62, Beclin1, ACSL4, GPX4, NCOA4, and
Keywords:
ferritin expression were examined by WB in vivo and in vitro. IF, co-IF, q-PCR, and constructed NCOA4-knock-
Corilagin down IEC-6 cells were used to evaluate the role of NCOA4 in the effect of corilagin against II/R injury. Tem­
Ischemia-reperfusion poral and nucleoplasmic variations with or without corilagin were observed by WB. Co-IP and molecular docking
Ferroptosis were used to investigate the NCOA4-ferritin interaction.
Ferritinophagy Key findings: Corilagin attenuated II/R-induced ferroptosis both in vitro and in vivo. Further study revealed that
NCOA4 the anti-ferroptosis bioactivity of corilagin might be due to the modulation of iron homeostasis via inhibition of
ferritinophagy in an NCOA4-dependent manner.
Significance: Corilagin might be a potential therapeutic agent for II/R-induced tissue injury.

1. Introduction flora translocation. Without timely intervention and treatment, II/R

injury is highly likely to induce systemic inflammatory responses and
Ischemia-reperfusion (I/R) injuries, characterized by the exacerba­ multi-organ dysfunction [1].
tion of hypoxia damage upon the restoration of blood flow and oxygen The pathogenesis in II/R injury has been linked with excessive in­
supply, is a common pathological phenomena associated with signifi­ flammatory cytokine release, oxidative stress and epithelial cell death
cant morbidity and mortality rates. Intestinal I/R (II/R) injury usually [2,3]. During temporary blood flow deprivation and restoration, intra­
occurs during clinically localized interventions and as a severe compli­ cellular redox homeostasis is disrupted and excessive reactive oxygen
cation of several systematic diseases, such as severe infection, traumatic species (ROS) are generated in damaged tissues. Then, the ROS trigger
shock, and cardiopulmonary disease. II/R leads to impaired intestinal nucleic acid breaking and lipid peroxidation which, ultimately, leads to
barrier function with increased intestinal permeability and intestinal cell death. Ferroptosis is a recently discovered type of programmed cell

Abbreviations: II/R, Intestinal ischemia-reperfusion; OGD/R, Oxygen-glucose deprivation and reoxygenation; NCOA4, Nuclear receptor co-activator 4; i.p,
intraperitoneal injection; MDA, Malondialdehyde; GSH, Glutathione; GSSG, Oxiglutatione; 4-HNE, 4-Hydroxynonenal; 15-LOX, 15-lipoxygenase; LC3, Microtubule-
associated protein 1 light chain 3; p62, Sequestosome 1/SQSTM1; ASCL4, Acyl-CoA Synthetase Long Chain Family Member 4; GPX4, Glutathione peroxidase 4; RT-q-
PCR, Quantitative real-time polymerase chain reaction; IEC-6, Intestinal epithelial cell 6; DMEM, Dulbecco’s modified eagle medium; LAMP2, Lysosomal integral
membrane protein 2; BSA, bovine serum albumin; FBS, Fetal bovine serum; DAB, diaminobenzidine; SOD, Superoxide dismutase; DAO, Diamine oxidase; CAT,
Catalase; LDH, lactate dehydrogenase; H&E, Hematoxylin and Eosin; DAPI, 4,6-diamino-2-phenyl indole; HRP, Horseradish peroxidase; TSA, Tyramide Signal
Amplification; RIPA, Radio immunoprecipitation assay; BCA, Bicinchoninic Acid Assay; ROS, Reactive oxygen species; TEM, Transmission electron microscopy;
FTH1, Ferritin Heavy Chain 1; WB, Western blotting; sh-RNA, Short hairpin RNA.
* Corresponding authors at: College of Pharmacy, Dalian Medical University, Dalian, 116044, China.
E-mail addresses: [email protected] (Y. Diao), [email protected] (J. Liu).

https://doi.org/10.1016/j.lfs.2023.122176
Received 24 August 2023; Received in revised form 3 October 2023; Accepted 11 October 2023
Available online 18 October 2023
0024-3205/© 2023 Published by Elsevier Inc.
Y. Wang et al. Life Sciences 334 (2023) 122176

death caused by excessive iron-dependent ROS production and lipid (F3252-A and F2378-A) were purchased by Shanghai KeXing Trading
peroxidation [4]. It has been reported to be associated with patho­ Co., Ltd. (Shanghai, China). Anti-ACSL4 (ab155282), anti-ferritin
physiological processes in a variety of diseases, and play a crucial role in (ab75973) and anti-GPX4 (ab125066) were obtained from Abcam
the mechanism during II/R injury [5]. Evidence suggests that the inhi­ (Shanghai, China). Anti-β-actin (10341–1-AP), anti-p62 (18420–1-AP),
bition of ferroptosis could significantly relieve II/R-induced tissue anti-LC3B (14600–1-AP), anti-Beclin1 (11306–1-AP) and anti-LAMP2
damage and acute lung injury [6,7]. Thus, inhibition of ferroptosis may (66301–1-Ig) were obtained from Proteintech Group (Wuhan, China).
be an effective treatment strategy for II/R injury. Anti-4-HNE (bs-6313R), anti-LC3A (bs-33,309 M) and anti-NCOA4 (bs-
An Imbalance in iron metabolism is the main cause of ferroptosis. 19051R) were obtained from Bioss Group (Beijing, China).
Intracellular redox-active iron can promote the production of lipid
reactive oxygen species, leading to lipid peroxidation and subsequent
cell death [8]. Ferritin is a cytosolic iron storage protein complex 2.2. Animals
capable of chelating iron atoms. Ferritin plays an important role in
maintaining the balance of intracellular redox state by sequestering Male C57BL/6 J mice (6 weeks old) were purchased from Experi­
redox-active iron [9]. The process of selective autophagy-dependent mental Animal Center of Dalian Medical University (Certificate of
degradation of ferritin, known as ferritinophagy, can release the Conformity: No. SYXK (Liao) 2018–0001). The experimental protocol
chelated iron atoms in ferritin and regulate iron homeostasis. Nuclear was approved by the Animal Care and Ethics Committee of Dalian
receptor coactivator 4 (NCOA4), an autophagic cargo receptor, mediates Medical University (approval number: AEE19007) and performed ac­
ferritinophagy by directly recognizing and binding the heavy chain of cording to the Principles for the Care and Use of Laboratory Animals in
ferritin. It then delivers iron-bound ferritin to autophagosomes for Research (State Council of China, 1988). All mice were housed for 7 days
lysosomal degradation and free iron release. Iron is crucial for DNA under optimal conditions of 25 ◦ C, 50 % humidity, 12/12 day-night
replication. Low iron promotes the stabilization of nuclear NCOA4 cycle and free access to food and water prior to the experiment.
protein and inhibits DNA replication [10]. NCOA4-mediated ferriti­ Mice were fasted for 12 h with free access to water before the ex­
nophagy is a feedback regulation mechanism of free iron in cells. The periments. After being anesthetized with tribromoethanol (400 mg/kg),
content of free iron in cells will increase when NCOA4-mediated ferri­ the superior mesenteric artery (SMA) was clamped with a noninvasive
tinophagy is activated, while NCOA4 will be degraded in a ubiquitin- microvascular clamp for 45 min, and the clamp was then gently released
dependent manner to reduce ferritinophagy flux to balance iron levels for 1 h reperfusion.
when iron is abundant [11]. Studies have shown that excessive ferriti­ Male C57BL/6 J mice were randomly assigned into 6 groups (n = 8).
nophagy induced by various diseases results in intracellular redox-active (1) Sham group: normal saline was administered via intraperitoneal
iron overload and lipid peroxide deposition, and is intimately involved injection (i.p) for 7 days before pseudo-surgery; (2) II/R group: animals
in ferroptosis [11,12]. Therefore, there is an urgent need to explore were subjected II/R model after being given a normal saline (i.p) for 7
intervention drugs targeting ferritinophagy in order to improve the consecutive days; (3) Sham + Cor (30 mg/kg) group: animals were
ferroptosis-related pathological process for the prevention and treat­ pretreated with corilagin at a dose of 30 mg/kg (i.p) once daily for 7
ment of II/R. days before pseudo-surgery; (4) II/R + Cor (7.5 mg/kg) group: animals
Corilagin, a natural ellagitannin found in a variety of plants, pos­ were pretreated with corilagin at a dose of 7.5 mg/kg (i.p) once daily for
sesses many biological and pharmacological properties, such as anti- 7 days before the II/R surgery; (5) II/R + Cor (15 mg/kg) group: animals
inflammatory, anti-apoptosis, and anti-oxidant activities [13,14]. Cor­ were pretreated with corilagin at a dose of 15 mg/kg (i.p) once daily for
ilagin has been found to protect bone marrow-derived mesenchymal 7 days before the II/R surgery; (6) II/R + Cor (30 mg/kg) group: animals
stem cells against erastin-induced ferroptosis. Our previous studies have were pretreated with corilagin at a dose of 30 mg/kg (i.p) once daily for
found that corilagin could significantly attenuate II/R-induced injuries 7 days before the II/R surgery [3,15].
by relieving oxidative stress, inhibiting cell death, and regulating
autophagy pathway [3,14]. Due to the excellent antioxidant and anti­
ferroptosis bioactivities of corilagin, we proposed that corilagin might 2.3. Cells
effectively ameliorate II/R-induced ferroptosis. However, the mecha­
nism is still unknown. Thus, the aim of this study is to demonstrate the IEC-6 cells were cultured in DMEM (Gibco, CA, USA) supplemented
mechanism by which corilagin inhibits II/R-induced ferroptosis. with 10 % FBS (Gibco, CA, USA), 50 U/mL penicillin and 50 U/mL
streptomycin at 37 ◦ C and in a humidified atmosphere containing 5 %
2. Materials and methods CO2. For OGD/R model, IEC-6 cells were incubated in serum/glucose-
free DMEM (Gibco, CA, USA) in a 5 % CO2, 1 % O2 and 94 % N2 hyp­
2.1. Chemicals and materials oxic chamber at 37 ◦ C for 2 h to simulate ischemia by deprivation of
oxygen and glucose, and then replaced in a normal culture environment.
Corilagin (B20672, purity ≥98 %) was purchased from Shanghai Stable transduced NCOA4 knockdown packaged lentiviral vector3
Yuanye Bio-Technology Co., Ltd. (Shanghai, China). LY294002 (S1105) (H1/GFP&Puro) was constructed and synthesised by GenePharma
was purchased from Selleck (Shanghai, China). Nigericin (28643–80-3) (Shanghai, China). The shRNA plasmid sequence used to target silencing
was purchased from MedChemExpress (Shanghai, China). MG-132 NCOA4 was GGGAAGGACAAGAATGGAATG with negative control of
(T2154), Erastin (T1765) and Ferrostatin-1 (Fer-1, T6500) were pur­ TTCTCCGAACGTGTCACGT.
chased from TargetMol (Shanghai, China). Rat small intestinal crypt
epithelial cell line (IEC-6 cells) was purchased from American Type
Culture Collection (ATCC). Total glutathione/Oxidized glutathione 2.4. Biochemical analysis
assay kit (A061–1-2), catalase (CAT) assay kit (A007–1-1), superoxide
dismutase (SOD) assay kit (A001–3), reduced glutathione (GSH) assay The intestinal tissues and IEC-6 cells were homogenized and centri­
kit (A006–2-1), and cell malondialdehyde (MDA) assay kit (A003–4-1) fuged, and the supernatants were collected for the subsequent
were obtained from Nanjing Jiancheng Institute of Biotechnology biochemical analysis. All the kits were performed according to manu­
(Nanjing, China). Tissue iron content assay kit (BC4355) and diamine facturer’s instructions. Cell viability determination and EC50 value
oxidase (DAO) activity assay kit (BC1280) were obtained from Solarbio determination was performed by Cell Counting Kit 8 reagent (APExBIO,
(Beijing, China). Iron colorimetric assay kit (E1042) was purchased by USA) and cell mortality was performed by LDH release levels, which
ApplyGen Biotech (Beijing, China). 15-lipoxygenase (15-LOX) assay kits were purchased by Beyotime Biotech Co., Ltd. (Beijing, China).

2
Y. Wang et al. Life Sciences 334 (2023) 122176

2.5. Immunohistochemistry and incubated with specific primary antibodies overnight at 4 ◦ C. Then,
the membranes were incubated with HRP-conjugated secondary anti­
After ischemia-reperfusion treatment, the intestinal tissues were bodies (1: 10000; Abcam, USA) for 2 h at 37 ◦ C. The expressions of
collected and fixed in a 4 % paraformaldehyde solution for 24 h. In­ proteins were normalized to β-actin [14].
testinal paraffin-slides were dewaxed by xylene, anhydrous ethanol, 95
%, 85 % and 75 % ethanol in that order, and antigen microwave- 2.8. Immunoprecipitation
restoration was performed by citrate. The slides were incubated in 3
% H2O2 with methanol for endogenous peroxidase depletion and serum Two μg of anti-NCOA4 was incubated with protein A/G magnetic
blocking. Specific primary antibodies were incubated overnight at 4 ◦ C, beads in a vertical rotation mixer for 30 min. IEC-6 cells were lysed in a
and finally with HRP-conjugated Affinipure Goat Anti-Mouse/Rat IgG non-denatured lysis buffer. And then 1 mg protein supernatant was
for 1 h at 37 ◦ C, then re-dyed by hematoxylin after DAB working solution incubated with the above protein A/G magnetic beads in a vertical
[16]. rotation mixer overnight at 4 ◦ C. Western blotting assays were per­
formed after denaturing elution [18].
2.6. Immunofluorescence
2.9. RT-qPCR
IEC-6 cells were fixed in 4 % paraformaldehyde for 30 min, perfo­
rated with 0.1 % Triton X-100 for 10 min and blocked with 5 % BSA for Total RNA was extracted by RNAiso Plus reagent (TaKaRa, 9109) and
60 min. Cells were incubated overnight at 4 ◦ C with primary antibodies then transcribed into cDNA by PrimeScript™ RT reagent Kit (TaKaRa,
and fluoresced with Cy3-conjugated donkey anti-rabbit IgG. The cells RR047A). For RT-qPCR, the TB Green® Premix Ex Taq™ II (TaKaRa,
were stained with DAPI solution before observation. Intestinal paraffin- RR820A) were used. Primer sequences used in this study were as
slides were dewaxed for antigen repair, endogenous peroxidase and following: RAT-FTH1-F, 5′-TGCGCCAGAACTTTCAC-3′; RAT-FTH1-R, 5′-
serum blocking, then incubated with specific primary antibodies at 4 ◦ C GTACAAGGCCACATCATCC-3′；RAT-NCOA4-F, TCTGCAAAGCCAAC­
overnight, and finally with HRP-conjugated Affinipure Goat Anti- GAG; RAT-NCOA4-R, TCCATTCTTGTCCTTCCCT；RAT-β-actin-F, 5′-
Mouse/Rat IgG. The slides were stained with TSA-520/570 reagent ACAGGACAATGCGACTCC-3′; RAT-β-actin-R, 5′-TTCGGCAGTAAGCCA­
and DAPI solution before observation [3,17]. GAC-3′.

2.7. Western blot analysis 2.10. Transmission electron microscopy

Total proteins from tissue or cells were extracted with RIPA lysis Intestinal tissue was fixed with 4 % glutaraldehyde for 2 h, postfixed
buffer. After protein concentration determination by BCA method, with 1 % osmium tetroxide for another 2 h, and dehydrated in a graded
proteins were separated by sodium dodecyl sulfate-polyacrylamide gel ethanol series. Polymerization embedded in acetone and resin was
electrophoresis. The proteins were then transferred to polyvinylidene performed at 60 ◦ C for 48 h. Ultrathin slides (60–80 nm) were prepared
difluoride membranes. The membranes were closed with 5 % skim milk and subjected to staining by uranyl acetate and lead citrate for 15 min.

Fig. 1. Corilagin alleviated II/R-induced injury both in vivo and in vitro. (A) H&E staining of ileum histological lesion (Scale = 100 μm). (B) Chiu’s score of intestinal
tissue. (C) DAO levels in intestinal tissues. (D) The effects of corilagin with different administration time on OGD/R-injured IEC-6 cells. (E) The effects of corilagin on
cell viability of different activators-injured IEC-6 cells. Values are expressed as mean ± SEM (A-C, n ≥ 6; D-E, n ≥ 3). **p < 0.01 vs sham group; #p < 0.05, ##p < 0.01
vs II/R or OGD/R group.

3
Y. Wang et al. Life Sciences 334 (2023) 122176

Fig. 2. Corilagin inhibited II/R-induced ferroptosis in vivo. (A-C) The concent levels of Fe2+, GSSG/T-GSH ratio and 15-LOX in intestinal tissues. (D). Mitochondrial
damage in intestinal tissues observed by TEM. (Scale = 2 μm and 1 μm). (E) The expression levels of 4-HNE by IHC (scale = 50 μm). (F) The protein expression levels
of ASCL4 and GPX4 by WB. Values are expressed as mean ± SEM (A-C, n ≥ 6; D-E, n ≥ 3). **p < 0.01 vs sham group; #p < 0.05, ##p < 0.01 vs II/R group.

Electron photomicrographs were taken using a transmission electron 2.13. Molecular docking simulation
microscope [19].
Molecular docking was performed by using Autodock Vina1.2.3
2.11. Nuclear-plasma protein extraction [21]. PyMol was used to visualize. The PDB ID used are as follows: FTH1:
3AJO; NCOA4: AFQ13772F1, which 383–522 of NCOA4 was deter­
According to the reagent manufacturer’s instructions, cells were mined as the binding peptide. The corilagin structure was downloaded
firstly lysed by plasma protein extraction reagent to release cytoplasmic from Pubchem ID: 73568. Each docking is repeated for six times, with
proteins and then the nucleus was obtained by centrifugation and nu­ the most exothermic conformation selected for visualization.
clear proteins were obtained by nuclear protein extraction reagent,
which was obtained from Solarbio (Beijing, China) [20]. 2.14. Statistical analysis

2.12. Reactive oxygen species and lipid peroxidation All the experiments and data analysis were conducted according to a
single-blind study design. All the data were expressed as the means ±
After OGD/R treatment, cells were incubated with C11-BODIPY 581/ standard error of the mean (SEM). One-way ANOVA analysis of variance
591 probe (2.5 μM) which was purchased from ThermoFisher (MA, USA) with Tukey’s multiple comparisons test as a post-test was used to
and DHE superoxide anion probe (5 μM) which was purchased from determine statistical significance of results. All experiments that
Beyotime Biotech Co., Ltd. (Beijing, China) for 30 min at 37 ◦ C in an required statistical data were repeated at least six times and p values
incubator for loading [4]. <0.05 were considered statistically significant.

4
Y. Wang et al. Life Sciences 334 (2023) 122176

Fig. 3. Corilagin inhibited the ferroptosis by inhibiting ferritinophagy. (A) The effects of corilagin and Fer-1 on Erastin and OGD/R-injured IEC-6 cells. (B) Fluo­
rescent co-localization of Lamp2 (red) and Ferritin (green) (scale = 20 μm and 10 μm). (C) The expression levels of p62, Beclin1, ferritin and LC3 II/LC3 I ratio by
WB. Values are expressed as mean ± SEM (A-B, n ≥ 3; C–D, n ≥ 6). *p < 0.05, **p < 0.01 vs sham group; #p < 0.05, ##p < 0.01 vs II/R group.

3. Results such as enlargement of the hepatic lobular space and alveolar fibrosis.
There were also no differences in body weight and antioxidant enzymes
3.1. Corilagin alleviated II/R-induced injury both in vivo and in vitro between the two groups. However, II/R injuries induced dilated liver
lobules with central venous bleeding, alveolar hyaline membrane for­
The toxicity of corilagin to mice was first investigated. Compared mation with pneumonedema, and sharp reductions in CAT and SOD
with the control group, corilagin (30 mg/kg, i.p) did not have any sig­ activities in liver and lung tissues (Fig. S1 A-F). The above results
nificant negative effects on the morphology of the liver and lung tissues, showed that corilagin (30 mg/kg, i.p) had no toxicity to the mice. Then,

5
Y. Wang et al. Life Sciences 334 (2023) 122176

Fig. 4. Corilagin inhibited NCOA4 expression and NCOA4-mediated ferritinophagy in vivo. (A-B) The expression levels of NCOA4 in intestinal tissue by WB and IHC
(scale = 100 μm). (C) Fluorescent co-localization of NCOA4 (red) and LC3 (green) (scale = 40 μm and 10 μm). Values are expressed as mean ± SEM (A-B, n ≥ 6; C, n
≥ 3). *p < 0.05, **p < 0.01 vs sham group; #p < 0.05, ##p < 0.01 vs II/R group.

hematoxylin-eosin (H&E) staining and DAO activity were used to pyroptosis and ferroptosis are reported to contribute to II/R injury
investigate the protective effects of corilagin on II/R-induced tissue [22–24]. To further explore the mechanism underlying corilagin, As
lesion. Intact intestinal mucosal epitheliums with clearly visible goblet shown in Fig. 1E, LY294002, MG132, nigericin and erastin, the inducers
cells were observed in the sham and corilagin-pretreated sham mice. of apoptosis, autophagy, pyroptosis and ferroptosis, respectively, were
Significant increases of the DAO activity and intestinal morphologic administered to intestinal epithelial IEC-6 cells to mimic the different
alterations, including the disintegration of lamina propria and intestinal programmed cell death modes during II/R. The results demonstrated
villi lysis (yellow arrows) and the disorganization of basal gland (red that corilagin was more effective in alleviating erastin-induced ferrop­
arrows) were observed in the II/R-injured mice. The pre-treatment of tosis. Therefore, inhibiting of II/R-induced ferroptosis might be the main
corilagin (7.5, 15, and 30 mg/kg) significantly attenuated II/R-induced mechanism of corilagin.
the intestinal damage in a dose-dependent manner with marked resto­ To investigate the anti-ferroptosis effects of corilagin, the concen­
ration of Chiu’s score and DAO activity. (Fig. 1A-C). This indicates that trations of intestinal bivalence iron (Fe2+) and 15-LOX, as well as the
corilagin effectively alleviated II/R-induced intestinal tissue damage in GSSG/T-GSH ratio in intestinal tissues were detected. As shown in
mice. Fig. 2A-C, the levels of Fe2+, 15-LOX and GSSG/T-GSH ratio were
Similar results were also obtained in vitro. Corilagin had no signifi­ significantly increased in II/R mice compared with the sham group.
cant effects on the viability and mortality of intestinal epithelial cells Moreover, the pretreatment of corilagin (7.5, 15 and 30 mg/kg) reversed
(IEC-6) with concentrations <8 μM. (Fig. S1 G and H). Furthermore, the increased expression levels of Fe2+, 15-LOX and GSSG/T-GSH ratio
OGD/R model was established to mimic II/R damage in vitro, and the when compared with II/R mice. Then, as ferroptosis coincided with
pre-administration of corilagin for 24 h at concentrations of 0.25, 0.5, 1 morphologic changes, the mitochondrial morphology was observed by
and 2 μM showed excellent protective effects against OGD/R-induced transmission electron microscopy (Fig. 2D). Pretreatment with corilagin
cell damage (Fig. 1D). (30 mg/kg) showed excellent alleviation of II/R-induced mitochondrial
damages, such as cavitation lesions and mitochondrial cristae breakage
(red arrows). Further, the expression levels of ferroptosis-related pro­
3.2. Corilagin inhibits II/R-induced ferroptosis both in vivo and in vitro
teins, ASCL4, GPX4 and the lipid peroxidation product 4-HNE-modified
proteins, were investigated by WB and IHC analyses (Fig. 2E-F). II/R
Multiple cell death modes, including apoptosis, autophagy,

6
Y. Wang et al. Life Sciences 334 (2023) 122176

Fig. 5. Corilagin inhibited ferritinophagy through NCOA4-dependent pathways. (A-D)The content levels of Fe2+, GSH, 15-LOX and MDA in OGD/R-injured IEC-6
cells with or without sh-NCOA4. (E) The protein expression levels of ASCL4, p62, Beclin1, GPX4, ferritin and LC3 II/LC3 I by WB. (F) The cellular ROS content by
DHE probe (Scale = 100 μm). Values are expressed as mean ± SEM (A-D, n ≥ 3; E-F, n ≥ 6). *p < 0.05, **p < 0.01 vs control group; #p < 0.05, ##p < 0.01 vs OGD/R
group; &p < 0.05 and ns vs sh-NCOA4 + OGD/R group.

injury significantly up-regulated the expression levels of ASCL4 and 4- and MDA (Fig. S2A–D). Then, the ROS-DHE and C11-BODIPY 581/
HNE modified proteins, and down-regulated the expression levels of 591 probes were used to detect superoxide anions and lipid peroxida­
GPX4. Compared with II/R mice, corilagin prevented the over- tion, respectively. OGD/R resulted in significant increases in oxidative
expression of ASCL4 and 4-HNE-modified proteins and restored the stress and lipid peroxidation, while the pretreatment of corilagin
dysregulated GPX4 expression. terminated the increase in ROS and lipid peroxidation (Fig. S2E).
The anti-ferroptosis effects of corilagin were also confirmed in vitro. Additionally, the protein expression levels of ASCL4 and GPX4 were also
Along with the decrease in GSH, the increases of Fe2+, 15-LOX and MDA detected, and the alleviation of OGD/R-induced up-regulation of ASCL4
were observed in OGD/R injured IEC-6 cells. Corilagin blocked the and down-regulation of GPX4 was observed after pretreatment with
OGD/R-induced dysregulation of the increases of Fe2+, GSH, 15-LOX corilagin (Fig. S2F). Together, the above data confirmed the hypothesis

7
Y. Wang et al. Life Sciences 334 (2023) 122176

Fig. 6. Corilagin inhibited NCOA4-mediated ferritinophagy via multiple ways. (A-B) The effects of corilagin on the NCOA4 expression in OGD/R-injured IEC-6 cells
with different reoxygenation times at protein and mRNA levels. (C) The expression levels of NCOA4 in nucleus and cytoplasm by WB. (D) The interaction between
NCOA4 and Ferritin by co-IP. (E) The affinity of corilagin with NCOA4 and FTH1 by AutoDock Vina. (F) Molecular docking between corilagin and FTH1. Values are
expressed as mean ± SEM (A, C, E and F, n ≥ 6; B and D, n ≥ 3). *p < 0.05 vs control group; #p < 0.05 vs OGD/R group.

that corilagin is a promising drug candidate for treatment of II/R by exhibited punctate ferritin lysosomal localization (blue arrows),
inhibiting ferroptosis of intestinal epithelial cells. whereas the pretreatment of corilagin led to diffuse ferritin staining
(Fig. 3C), indicating the important role of ferritinophagy in the anti-
3.3. Corilagin inhibits II/R-induced ferritinophagy both in vivo and in ferroptosis effects of corilagin. The protein levels of Ferritin and p62
vitro were significantly down regulated, while the protein levels of Beclin1
and LC3B II/I ratio were up regulated after II/R injury in vivo and OGD/R
Erastin accelerates oxidation, leads to the accumulation of endoge­ injury in vitro. Pretreatment with corilagin suppressed the dysregulation
nous reactive oxygen species and induces ferroptosis through iron- of those proteins (Fig. 3D and Fig. S3). The above results indicated that
dependent signaling pathways. As a synthetic antioxidant and selec­ corilagin blocked ferritin colocalization with lysosomes and caused
tive ferroptosis inhibitor, Fer-1 can inhibit ferroptosis via a reductive impaired ferritinophagy.
mechanism to prevent damage to membrane lipids. To further study the
anti-ferroptosis effects of corilagin, the EC50 values of corilagin and Fer- 3.4. Corilagin inhibits ferritinophagy in a NCOA4-dependent manner
1 for erastin-induced ferroptosis and OGD/R-induced cell death were
detected in vitro. As a result, the EC50 values of Fer-1 and corilagin for NCOA4-mediated ferritinophagy is a key factor that triggers ferrop­
erastin-treated IEC-6 cells were 13.3 and 27.1 nM, respectively, while tosis [25]. The protein expression of NCOA4 was investigated by WB,
the EC50 values of Fer-1 and corilagin for OGD/R-injured IEC-6 cells IHC and immunofluorescence. The results showed that the NCOA4 was
were 444 and 34.9 nM, respectively (Fig. 3A-B). The large difference in significantly up-regulated after II/R injury in vivo and OGD/R injury in
EC50 values of Fer-1 for erastin-treated IEC-6 cells versus OGD/R-injured vitro. Pretreatment with corilagin suppressed the upregulation of
IEC-6 cells suggests that the mechanism of II/R-induced ferroptosis was NCOA4 (Fig. 4A-B and Fig. S4A–B). The mRNA expression levels of
not just dependent on the ROS accumulation and lipid peroxidation. The NCOA4 were consistent with those at the protein level while the mRNA
same is true for the anti-ferroptosis mechanism of corilagin. expression of FTH1 was almost unchanged by OGD/R or corilagin
Immunofluorescence experiments were used to observe the ferritin treatment (Fig. S4 C–D). Moreover, co-localized fluorescence of NCOA4
lysosomal localization. The intestinal tissue of II/R injured mice (red) and LC3 (green) was adopted to investigate NCOA4-mediated

8
Y. Wang et al. Life Sciences 334 (2023) 122176

autophagy. Significantly increased co-localization of NCOA4 and LC3 serious intestinal tissue damage, and even systemic inflammatory
was observed in II/R injured intestinal tissue, and pretreatment with response syndrome and multiple organ dysfunction syndrome [27].
corilagin (30 mg/kg) significantly blocked this process (Fig. 4C). Unfortunately, II/R injury still remains a headache condition due to a
Therefore, NCOA4 might be a target for corilagin to downregulate lack of specific tools for its treatment until now. Traditional Chinese
ferritinophagy. herbal medicines contain many natural products with multiple biolog­
To further explore the specific role of NCOA4 in the inhibition of ical and pharmacological effects. Thus, the use of traditional Chinese
ferritinophagy by corilagin, the expression of NCOA4 was knock-down herbal medicines for the treatment of II/R injury has become a research
in IEC-6 cells by using GFP-puro-shRNA plasmid. The increased con­ hotspot in the search for safe and effective treatments.
tent levels of intracellular Fe2+, GSH, 15-LOX, MDA and ROS, the up- An understanding the disease pathophysiology is crucial to the
regulated protein expression levels of ASCL4, and the excessive con­ exploration of novel therapeutic strategies. Recently, intestinal barrier
sumption of GPX4 induced by OGD/R injury were significantly reversed dysfunction and the resulting leakage of gut contents have been proved
after NCOA4 knock-down, suggesting that knocking down NCOA4 can to play critical roles in the transmission of damaging signals to remote
inhibit OGD/R-induced ferroptosis. The content levels of intracellular organs damage during II/R [28]. An increase in the rate of intestinal
Fe2+, GSH, 15-LOX and ROS were almost unchanged after corilagin epithelial cell death underlies extensive epithelial erosion [29]. Multiple
pretreatment (1 μM) of IEC-6 cells with knocked-down NCOA4 (Fig. 5A- types of programmed cell death, including apoptosis, pyroptosis, auto­
E), indicating that NCOA4 played an important role in the anti- phagy and ferroptosis are activated during II/R and contribute to severe
ferroptosis effect of corilagin. Moreover, the knock-down of NCOA4 barrier dysfunction [22–24]. Our previous studies revealed that cor­
also reversed OGD/R-induced dysregulation of protein expression levels ilagin can alleviate II/R-induced apoptosis, pyroptosis and autophagy
of ferritin, Beclin1, p62 and the LC3 II/I ratio, suggesting that knocking flux impairment [3,14]. Corilagin also exhibits protective effects on
down NCOA4 can inhibit OGD/R-induced ferritinophagy. Corilagin erastin-induced ferroptosis in bone marrow-derived mesenchymal stem
pretreatment (1 μM) had little effect on the protein expression of ferritin, cells [30]. Therefore, corilagin was expected to be a potential candidate
p62 and the LC3 II/I ratio in IEC-6 cells after NCOA4 konck-down for II/R treatment. The current results have confirmed this hypothesis.
(Fig. 5F), indicating that the corilagin regulated ferritinophagy in an In addition, the current findings indicate that, among the programmed
NCOA4-dependent manner. death models induced in vitro, corilagin exhibited the most significant
inhibitory effect on ferroptosis. Thus, the regulation of ferroptosis might
3.5. Corilagin inhibits NCOA4-mediated ferritinophagy via multiple ways be involved in the main mechanisms of corilagin.
Ferroptosis is a regulated form of cell death driven by loss of activity
The injuries induced by different reperfusion times varies, and fer­ of the lipid repair enzyme GPX4 and subsequent accumulation of lipid-
roptosis is mainly occurs in the early stage of reperfusion [24]. With the based ROS [31]. Ferroptosis is considered an important factor in the
increase in re‑oxygenation time, the expression levels of NCOA4 occurrence and development of II/R injury in the early stage of reper­
increased first and then decreased both at protein and mRNA levels. fusion as well as distal organ damage in the late stage [24]. The current
Corilagin could inhibit OGD/R-induced up-regulation of NCOA4 both at findings demonstrated that that corilagin also has an effective anti-
protein and mRNA levels (Fig. 6A-B). The expression levels of NCOA4 in ferroptosis on II/R injury. Corilagin significantly inhibited both II/R-
nucleus and cytoplasm were detected by WB. Under typical OGD/R and OGD/R- induced upregulation of GSH consumption, intracellular
condition (reoxygenation time of 60 min), OGD/R significantly pro­ Fe2+ concentration, lipid peroxidation, mitochondrial damage and
moted the up-regulation of NCOA4 in cytoplasm, but had little effect on cellular ROS. Within the concentration range used in this study, the
NCOA4 in the nucleus. After pretreatment with corilagin, there was a intestinal tissue damage, GSH consumption, intracellular ROS content,
significant increase in the protein expression level of NCOA4 in the lipid peroxidation, and ASCL4 upregulation were all improved in a dose-
nucleus, but the expression level of cytoplasmic NCOA4 drastically dependent manner as the dose increased, but GPX4 expression was
decreased (Fig. 6C). The above results indicated that corilagin can not abnormal at highest doses. Furthermore, minimal disparities were
only inhibit ferritin degradation by down-regulating the cytoplasmic observed in the EC50 values of erastin-induced ferroptosis or OGD/R-
NCOA4 protein but also promotes the nuclear NCOA4 protein stabili­ induced cell death following corilagin pretreatment. However, Fer-1
zation and inhibits DNA replication origin activation. exhibited an over 30-fold increase. These results suggest that other un­
Ferritinophagy is facilitated through the direct recognition of FTH1 known mechanisms contribute to corilagin’s significant anti-ferroptosis
by NCOA4, which subsequently transports the ferritin complex to effect; these effects are not simply due to its antioxidant activity.
autophagosomes for the purpose of lysosomal degradation and subse­ Autophagy, a cellular process of self-degradation and self-digestion,
quent release of iron. [26]. Accordingly, to further investigate the effects plays a crucial role in maintaining intracellular homeostasis by regu­
of corilagin on NCOA4-FTH1 protein-protein interaction, coimmuno­ lating diverse signal transductions. It primarily targets dysfunctional or
precipitation (co-IP) assay was used. As shown in Fig. 6D, there was little damaged organelles, as they are closely associated with the dysfunction
difference in the endogenous NCOA4-FTH1 interaction between control of the intestinal mucosal barrier in the context of I/R. [32]. Improve­
and OGD/R-injured IEC-6 cells, however, the NCOA4-FTH1 interaction ments in the intestinal epithelial barrier function following II/R can be
was substantially impaired by corilagin. The results of molecular dock­ achieved through the restoration of impaired autophagy flux. [33].
ing analysis showed that corilagin had a higher affinity for FTH1 than However, several studies have indicated excessive activated autophagy
NOCO4 (Fig. 6E), and corilagin might interact with FTH1 by hydrogen also exacerbates the barrier dysfunction in II/R [34]. Ferroptosis is
bonds with the amino acid residues of R23, N26, H106 and H110 closely linked to excessive autophagy-mediated ferritin degradation,
(Fig. 6F and Fig. S6). R23 is a conserved surface arginine on FTH1 and is specifically NCOA4-mediated ferritinophagy in which NCOA4 binds to
essential for ferritin association with NCOA4 [18]. So, corilagin might ferritin, delivers it to nascent autophagosomes and then merges with the
disrupt the direct interaction of FTH1 with NCOA4 through competitive lysosomes for ferritin degradation and iron release [35]. Excessive fer­
binding with R23, thus inhibit NCOA4-mediated ferritinophagy. ritinophagy increases the amount of divalent iron in the intracellular
labile‑iron-pool, resulting in increased ROS content and lipid peroxi­
4. Discussion and conclusion dation through the Fenton reaction; this causes ferroptosis [36].
NCOA4-mediated ferritinophagy is reported to contribute to I/R-
II/R injury is a complex clinical disease with high morbidity and induced ferroptosis in myocardium and brain and to the ionizing
mortality. Ischemic injury caused by hypoxemia and reperfusion injury radiation-induced ferroptosis in intestinal epithelial cells [35,37,38].
caused by blood reflow are considered two stages of II/R injury. Here, we found that autophagy, including NCOA4-mediated ferriti­
Ischemic injury will be further amplified after reperfusion, resulting in nophagy, was activated both in vivo and in vitro. Corilagin inhibited II/R-

9
Y. Wang et al. Life Sciences 334 (2023) 122176

Fig. 7. Corilagin attenuates intestinal ischemia-reperfusion injury by disrupting the NCOA4-Ferritin interaction to reduce ferroptosis (by Figdraw).

induced autophagic degradation of ferritin by inhibiting the upregula­ protective effects on II/R via inhibiting ferroptosis (Fig. 7). Our studies
tions of autophagy-related proteins and NCOA4. Moreover, knocking suggest that (i) corilagin is a potent ferroptosis inhibitor and a potent
down NCOA4 significantly suppressed the OGD/R-induced ROS increase therapeutic agent ameliorating II/R injury; (ii) corilagin alleviated II/R-
and the activation of autophagy, ferritin degradation, and ferroptosis, induced ferroptosis by inhibiting NCOA4-mediated ferritinophagy; (iii)
confirming the crucial roles of NCOA4-mediated ferritinophagy in II/R corilagin suppressed II/R-induced up-regulation of NCOA4 at both
injuries. Corilagin pretreatment did not induce significant changes in mRNA and protein levels and promoted the nuclear NCOA4 protein
contents of intracellular Fe2+, ferritin, GSH, 15-LOX and cellular ROS, stabilization and the resulting inhibition of DNA replication origin
confirming that the antiferroptosis effect of corilagin is achieved activation; (iv) corilagin might disrupt the direct interaction of FTH1
through the regulation of NCOA4-mediated ferritinophagy. and NCOA4 through competitive binding with FTH1. This work pro­
Iron is also found to be essential for DNA replication and repair. Low vides novel insights into the mechanisms of corilagin as a potential
iron conditions trigger nuclear NCOA4 stabilization and binding to DNA candidate for the treatment of II/R.
replication origins to block their activation and prevent replication
stress. This is essential for maintaining genome integrity and sustaining CRediT authorship contribution statement
high rates of cell proliferation during tissue regeneration [10]. Corilagin
could significantly increase the levels of nuclear NCOA4 protein. This Yunxiang Wang: Data curation, Investigation, Writing – original
result indicated that corilagin inhibited DNA replication origin activa­ draft. Bin Li: Methodology, Investigation, Formal analysis. Guanting
tion by stabilizing nuclear NCOA4 protein. Liu: Formal analysis, Investigation. Qipeng Han: Formal analysis,
Ferritinophagy is initiated by the direct association of NCOA4 and Investigation. Yunpeng Diao: Funding acquisition, Methodology,
FTH1, the heavy chain of ferritin; the complex is then transported to Project administration, Resources, Supervision, Writing – review &
autophagosomes for lysosomal degradation and iron release from FTH1. editing. Jing Liu: Conceptualization, Funding acquisition, Project
Therefore, direct binding of NCOA4 to FTH1 is critical for ferritinophagy administration, Software, Visualization, Supervision, Writing – review &
[18], and disrupting the NCOA4-FTH1 interaction is a promising ther­ editing.
apeutic strategy for blocking ferroptosis [26]. NCOA4 interacts with
ferritin via a conserved C-terminal domain of amino acids 383–522, and Declaration of competing interest
the surface residue R23 in FTH1 is essential for their interaction. In this
study, corilagin pretreatment was confirmed to weaken the NCOA4- The authors declare that they have no known competing financial
FTH1 interaction. Molecular docking analysis showed that corilagin interests or personal relationships that could have appeared to influence
had a good affinity with FTH1, and the binding site was located at the the work reported in this paper.
interaction interface of NCOA4-FTH1. Corilagin might form H-bonds
with the FTH1 amino acid residues of R23, N26, H106 and N110, sug­ Data availability
gesting that the disruptive effect of corilagin on the NCOA4-FTH1
complex may occur due to competitive binding with R23 residues in Data will be made available on request.
FTH1.
In conclusion, this study provides evidence that corilagin possesses

10
Y. Wang et al. Life Sciences 334 (2023) 122176

Acknowledgements [18] J. Mancias, L. Pontano Vaites, S. Nissim, D. Biancur, A. Kim, X. Wang, et al.,
Ferritinophagy via NCOA4 is required for erythropoiesis and is regulated by iron
dependent HERC2-mediated proteolysis, Elife 4 (2015), e10308, https://doi.org/
This work was supported by Star of the Youth Science and Tech­ 10.7554/eLife.10308.
nology in Dalian City (2021RQ007). [19] W. Tao, F. Liu, J. Zhang, S. Fu, H. Zhan, K. Qian, miR-3587 inhibitor attenuates
Ferroptosis following renal ischemia-reperfusion through HO-1, Front. Mol. Biosci.
8 (2021), 789927, https://doi.org/10.3389/fmolb.2021.789927.
Appendix A. Supplementary data [20] Y. Yang, Y. Zhang, J. Yang, M. Zhang, T. Tian, Y. Jiang, et al., Interdependent
nuclear co-trafficking of ASPP1 and p53 aggravates cardiac ischemia/reperfusion
Supplementary data to this article can be found online at https://doi. injury, Circ. Res. 132 (2) (2023) 208–222, https://doi.org/10.1161/
circresaha.122.321153.
org/10.1016/j.lfs.2023.122176. [21] J. Eberhardt, D. Santos-Martins, A. Tillack, S. Forli, AutoDock Vina 1.2.0: new
docking methods, expanded force field, and python bindings, J. Chem. Inf. Model.
References 61 (8) (2021) 3891–3898, https://doi.org/10.1021/acs.jcim.1c00203.
[22] N. El-Malkey, A. Alsemeh, W. Ashour, N. Hassan, H. Edrees, Fetuin-a exerts a
protective effect against experimentally induced intestinal ischemia/reperfusion by
[1] Q. Hu, J. Ren, G. Li, J. Wu, X. Wu, G. Wang, et al., The mitochondrially targeted
suppressing autophagic cell death, Exp. Biol. Med. 246 (11) (2021) 1307–1317,
antioxidant MitoQ protects the intestinal barrier by ameliorating mitochondrial
https://doi.org/10.1177/1535370221995207.
DNA damage via the Nrf2/ARE signaling pathway, Cell Death Dis. 9 (3) (2018)
[23] C. Hsu, C. Huang, L. Chien, M. Lin, C. Chang, H. Lin, et al., Ischemia/reperfusion
403, https://doi.org/10.1038/s41419-018-0436-x.
injured intestinal epithelial cells cause cortical neuron death by releasing exosomal
[2] Y. Li, B. Xu, M. Xu, D. Chen, Y. Xiong, M. Lian, et al., 6-Gingerol protects intestinal
microRNAs associated with apoptosis, necroptosis, and pyroptosis, Sci. Rep.-UK 10
barrier from ischemia/reperfusion-induced damage via inhibition of p38 MAPK to
(1) (2020) 14409, https://doi.org/10.1038/s41598-020-71310-5.
NF-κB signalling, Pharmacol. Res. 119 (2017) 137–148, https://doi.org/10.1016/j.
[24] Y. Li, D. Feng, Z. Wang, Y. Zhao, R. Sun, D. Tian, et al., Ischemia-induced ACSL4
phrs.2017.01.026.
activation contributes to ferroptosis-mediated tissue injury in intestinal ischemia/
[3] W. Li, K. Yang, B. Li, Y. Wang, J. Liu, D. Chen, et al., Corilagin alleviates intestinal
reperfusion, Cell Death Differ. 26 (11) (2019) 2284–2299, https://doi.org/
ischemia/reperfusion-induced intestinal and lung injury in mice inhibiting NLRP3
10.1038/s41418-019-0299-4.
inflammasome activation and pyroptosis, Front. Pharmacol. 13 (2022) 1060104,
[25] J. Wu, Q. Liu, X. Zhang, M. Tan, X. Li, P. Liu, et al., The interaction between STING
https://doi.org/10.3389/fphar.2022.1060104.
and NCOA4 exacerbates lethal sepsis by orchestrating ferroptosis and
[4] Z. Wang, M. Yao, L. Jiang, L. Wang, Y. Yang, Q. Wang, et al., Dexmedetomidine
inflammatory responses in macrophages, Cell Death Dis. 13 (7) (2022) 653,
attenuates myocardial ischemia/reperfusion-induced ferroptosis via AMPK/GSK-
https://doi.org/10.1038/s41419-022-05115-x.
3β/Nrf2 axis, Biomed. Pharmacother. 154 (2022), 113572, https://doi.org/
[26] Y. Fang, X. Chen, Q. Tan, H. Zhou, J. Xu, Q. Gu, Inhibiting ferroptosis through
10.1016/j.biopha.2022.113572.
disrupting the NCOA4-FTH1 interaction: a new mechanism of action, ACS Cent.
[5] H. Yan, Q. Tuo, Q. Yin, P. Lei, The pathological role of ferroptosis in ischemia/
Sci. 7 (6) (2021) 980–989, https://doi.org/10.1021/acscentsci.0c01592.
reperfusion-related injury, Zool. Res. 41 (3) (2020) 220–230, https://doi.org/
[27] G. Li, Y. Zhang, Z. Fan, Cellular signal transduction pathways involved in acute
10.24272/j.issn.2095-8137.2020.042.
lung injury induced by intestinal ischemia-reperfusion, Oxid. Med. Cell. Longev.
[6] Z. Zhongyin, W. Wei, X. Juan, F. Guohua, Isoliquiritin apioside relieves intestinal
2021 (2021) 9985701, https://doi.org/10.1155/2021/9985701.
ischemia/reperfusion-induced acute lung injury by blocking Hif-1α-mediated
[28] D. Dai, F. Dai, J. Chen, M. Jin, M. Li, D. Hu, Z. Liu, et al., Integrated multi-omics
ferroptosis, Int. Immunopharmacol. 108 (2022), 108852, https://doi.org/10.1016/
reveal important roles of gut contents in intestinal ischemia-reperfusion induced
j.intimp.2022.108852.
injuries in rats, Commun. Biol. 5 (1) (2022) 938, https://doi.org/10.1038/s42003-
[7] Y. Feng, W. Ye, W. Tian, J. Meng, M. Zhang, Y. Sun, et al., Old targets, new
022-03887-8.
strategy: Apigenin-7-O-β-d-(− 6″-p-coumaroyl)-glucopyranoside prevents
[29] J. Patankar, C. Becker, Cell death in the gut epithelium and implications for
endothelial ferroptosis and alleviates intestinal ischemia-reperfusion injury
chronic inflammation, Nat. Rev. Gastroenterol. Hepatol. 17 (9) (2020) 543–556,
through HO-1 and MAO-B inhibition, Free Radic. Biol. Med. 184 (2022) 74–88,
https://doi.org/10.1038/s41575-020-0326-4.
https://doi.org/10.1016/j.freeradbiomed.2022.03.033.
[30] X. Li, J. Liu, B. Chen, Y. Chen, W. Dai, Y. Li, et al., Covalent bridging of corilagin
[8] L. Zhu, W. Lian, Z. Yao, X. Yang, Z. Wang, Y. Lai, et al., Integrated analysis of
improves antiferroptosis activity: comparison with 1,3,6-tri-galloyl-β-d-
ferroptosis and immunity-related genes associated with intestinal ischemia/
glucopyranose, ACS Med. Chem. Lett. 11 (11) (2020) 2232–2237, https://doi.org/
reperfusion injury, J. Inflamm. Res. 15 (2022) 2397–2411, https://doi.org/
10.1021/acsmedchemlett.0c00359.
10.2147/jir.S351990.
[31] Y. Wang, F. Quan, Q. Cao, Y. Lin, C. Yue, R. Bi, et al., Quercetin alleviates acute
[9] S. Masaldan, A. Bush, D. Devos, A. Rolland, C. Moreau, Striking while the iron is
kidney injury by inhibiting ferroptosis, J. Adv. Res. 28 (2021) 231–243, https://
hot: Iron metabolism and ferroptosis in neurodegeneration, Free Radic. Biol. Med.
doi.org/10.1016/j.jare.2020.07.007.
133 (2019) 221–233, https://doi.org/10.1016/j.freeradbiomed.2018.09.033.
[32] X. Liu, B. Yang, Y. Tan, J. Feng, J. Jia, C. Yang, et al., The role of AMPK-Sirt1-
[10] G. Federico, F. Carrillo, F. Dapporto, M. Chiariello, M. Santoro, R. Bellelli, et al.,
autophagy pathway in the intestinal protection process by propofol against
NCOA4 links iron bioavailability to DNA metabolism, Cell Rep. 40 (7) (2022),
regional ischemia/reperfusion injury in rats, Int. Immunopharmacol. 111 (2022),
111207, https://doi.org/10.1016/j.celrep.2022.111207.
109114, https://doi.org/10.1016/j.intimp.2022.109114.
[11] J. He, Z. Li, P. Xia, A. Shi, X.F. Chen, J. Zhang, et al., Ferroptosis and ferritinophagy
[33] Y. Li, P. Zhang, J. Zhang, W. Bao, J. Li, Y. Wei, et al., Role of autophagy inducers
in diabetes complications, Mol. Metab. 60 (2022), 101470, https://doi.org/
and inhibitors in intestinal barrier injury induced by intestinal ischemia-
10.1016/j.molmet.2022.101470.
reperfusion (I/R), J. Immunol. Res. 2022 (2022) 9822157, https://doi.org/
[12] K. Li, B. Chen, A. Xu, J. Shen, K. Li, K. Hao, et al., TRIM7 modulates NCOA4-
10.1155/2022/9822157.
mediated ferritinophagy and ferroptosis in glioblastoma cells, Redox Biol. 56
[34] L. Zhenzhen, L. Wenting, Z. Jianmin, Z. Guangru, L. Disheng, Z. Zhiyu, et al., miR-
(2022), 102451, https://doi.org/10.1016/j.redox.2022.102451.
146a-5p/TXNIP axis attenuates intestinal ischemia-reperfusion injury by inhibiting
[13] F. Jin, D. Cheng, J. Tao, S. Zhang, R. Pang, Y. Guo, et al., Anti-inflammatory and
autophagy via the PRKAA/mTOR signaling pathway, Biochem. Pharmacol. 197
anti-oxidative effects of corilagin in a rat model of acute cholestasis, BMC
(2022), 114839, https://doi.org/10.1016/j.bcp.2021.114839.
Gastroenterol. 13 (2013) 79, https://doi.org/10.1186/1471-230x-13-79.
[35] H. Zhou, Y. Zhou, J. Mao, L. Tang, J. Xu, Z. Wang, et al., NCOA4-mediated
[14] B. Li, W. Li, M. Zheng, Y. Wang, Y. Diao, X. Mou, et al., Corilagin alleviates
ferritinophagy is involved in ionizing radiation-induced ferroptosis of intestinal
intestinal ischemia/reperfusion injury by relieving oxidative stress and apoptosis
epithelial cells, Redox Biol. 55 (2022), 102413, https://doi.org/10.1016/j.
via AMPK/Sirt1-autophagy pathway, Exp. Biol. Med. 248 (4) (2023) 317–326,
redox.2022.102413.
https://doi.org/10.1177/15353702221147560.
[36] X. Chen, C. Yu, R. Kang, G. Kroemer, D. Tang, Cellular degradation systems in
[15] H. Xiao, C. Lin, D. Ho, J. Peng, Y. Chen, S. Tsang, et al., Inhibitory effect of the
ferroptosis, Cell Death Differ. 28 (4) (2021) 1135–1148, https://doi.org/10.1038/
gallotannin corilagin on dextran sulfate sodium-induced murine ulcerative colitis,
s41418-020-00728-1.
J. Nat. Prod. 76 (11) (2013) 2120–2125, https://doi.org/10.1021/np4006772.
[37] B. Li, W. Wang, Y. Li, S. Wang, H. Liu, Z. Xia, et al., cGAS-STING pathway
[16] B. Li, Y. Wang, X. Yuan, G. Liu, Y. Diao, J. Liu, 6-Shogaol from dried ginger protects
aggravates early cerebral ischemia-reperfusion injury in mice by activating
against intestinal ischemia/reperfusion by inhibiting cell apoptosis via the BDNF/
NCOA4-mediated ferritinophagy, Exp. Neurol. 359 (2023), 114269, https://doi.
TrkB/PI3K/AKT pathway, Mol. Nutr. Food Res. 67 (13) (2023), e2200773, https://
org/10.1016/j.expneurol.2022.114269.
doi.org/10.1002/mnfr.202200773.
[38] W. Li, W. Li, Y. Wang, Y. Leng, Z. Xia, Inhibition of DNMT-1 alleviates ferroptosis
[17] J. Zhang, J. Wu, C. Chen, G. He, W. Liu, S. Xu, et al., A micro-chamber free digital
through NCOA4 mediated ferritinophagy during diabetes myocardial ischemia/
bio-detection for multiplexed and ultrasensitive immunoassay based on encoded
reperfusion injury, Cell Death Discov. 7 (1) (2021) 267, https://doi.org/10.1038/
magnetic microbeads and tyramide signal amplification strategy, Talanta 262
s41420-021-00656-0.
(2023), 124685, https://doi.org/10.1016/j.talanta.2023.124685.

11