Šestáková et al.

Biological Procedures Online (2019) 21:19

https://doi.org/10.1186/s12575-019-0107-z

REVIEW Open Access

DNA Methylation Validation Methods: a

Coherent Review with Practical Comparison
Šárka Šestáková1,2, Cyril Šálek1,2 and Hana Remešová2*

Abstract
Here, we present a practical overview of four commonly used validation methods for DNA methylation assessment:
methylation specific restriction endonucleases (MSRE) analysis, pyrosequencing, methylation specific high-resolution
DNA melting (MS-HRM) and quantitative methylation specific polymerase chain reaction (qMSP). Using these
methods, we measured DNA methylation levels of three loci in human genome among which one was highly methylated,
one intermediately methylated and one unmethylated. We compared the methods in terms of primer design demands,
methods’ feasibility, accuracy, time and money consumption, and usability for clinical diagnostics.
Pyrosequencing and MS-HRM proved to be the most convenient methods. Using pyrosequencing, it is possible to analyze
every CpG in a chosen region. The price of the instrument may represent the main limitation of this methodology. MS-
HRM is a simple PCR-based method. The measurement was quick, cheap and very accurate. MSRE analysis is based on
a methylation specific digestion of DNA. It does not require a bisulfite conversion of DNA as the other methods. MSRE
analysis was very easy to perform, however, it was not suitable for intermediately methylated regions and it was
also quite expensive. qMSP is a qPCR-based method that uses primers designed specifically for methylated and
unmethylated alleles of a chosen region. This was the least accurate method and also the primer design and
optimization of PCR conditions were highly demanding.
Keywords: DNA methylation, Validation methods, MSRE, Pyrosequencing, MS-HRM, qMSP

Background Nowadays, there is a rapid expansion of high-

DNA methylation plays a fundamental role in many crucial throughput methods for DNA methylation assessment
biological processes such as embryonic development, gene with single-base resolution. Array techniques can examine
imprinting, and gene expression regulation. In mammals, as much as 850,000 CpGs at once [5] and all CpG sites,
the DNA methylation occurs almost exclusively in CpG di- over 28 million in human genome [6], can be analyzed
nucleotides where a methyl group is attached to the fifth using whole-genome bisulfite sequencing. These methods
carbon of cytosine base, creating 5-methylcytosine. The provide not only an overview of the methylation status of
biological effect of DNA methylation depends not only on a certain genome, but also a methylation level of each stud-
its presence or absence but mainly on its exact location in ied CpG. Despite the advantages of these genome-wide ap-
the genome [1]. Aberrant DNA methylation has been proaches, it is still essential to have a proper technique for
proved as an inducing mechanism in many cancers and is validation of DNA methylation results for chosen loci. The
connected to other complex disorders (e.g. diabetes and ideal validation method should be sensitive, quick, cost ef-
cardiovascular diseases, neurodegenerative and psychiatric fective and suitable for screening of large sets of clinical
disorders) [2]. Therefore, DNA methylation profiles are ex- samples to acquire statistically significant data.
amined as biomarkers for diagnosis, prognosis, treatment In this review, we assessed the methylation status of cer-
response and disease monitoring [3, 4]. tain CpGs using four most common methods for DNA
methylation validation. These methods were: quantitative
PCR with prior digestion by methylation specific restric-
tion endonucleases (MSRE), pyrosequencing, methylation
* Correspondence: [email protected] specific high-resolution DNA melting (MS-HRM) analysis,
2
Institute of Hematology and Blood Transfusion, Prague, Czech Republic and quantitative methylation specific polymerase chain
Full list of author information is available at the end of the article

© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Šestáková et al. Biological Procedures Online (2019) 21:19 Page 2 of 11

reaction (qMSP). For proper evaluation of each method, that after BS conversion the DNA strands are no longer
we selected 3 distinct CpG sites within the human genome complementary. This must be kept in mind when choos-
that were > 99% methylated (methylated “M” locus), ing a method for quantification of BS converted DNA.
around 50% methylated (intermediately methylated “IM” The reliability of methylation analysis is dependent on a
locus), and < 1% methylated (unmethylated “U” locus). complete BS conversion. Unconverted cytosines, if present,
would be mistaken for methylated loci and the analysis will
Overview of Evaluated Validation Methods produce biased results. Formerly, the conversion method
Methods Based on DNA Digestion by MSRE required a high DNA input and exposure to high bisulfite
Restriction methods for quantification of DNA methyla- salt concentration under high temperatures and low pH.
tion are simple, rapid and do not require bisulfite conver- These harsh conditions resulted in significant DNA frag-
sion of DNA. Selective digestion of DNA by methylation mentation and loss [15]. Nowadays, there is a wide variety
specific restriction enzymes (HpaII, AatII, ClaI, etc.) was of commercial kits available that are able to convert as low
historically the first method used for assessing DNA as 100 pg of DNA in less than 2 h. These kits, nice compari-
methylation levels [7]. High specificity is characteristic for son is available here [16], use convenient column system
this method, however, only the specific restriction sites and guarantee more than 99% conversion efficiency.
can be analyzed which is an important limitation.
The analysis is based on a selective DNA cleavage by Pyrosequencing
MSRE which will not cut its restriction site when a Pyrosequencing is a sequencing method used for quanti-
methylated cytosine is present. The most frequently used tative methylation analysis of bisulfite converted DNA.
enzyme is HpaII with recognition sequence CCGG. It is For its relative simplicity, speed and comparable results,
also possible to use a pair of isoschisomeric enzymes, pyrosequencing can be preferred to cloning [17], a
where one is methylation sensitive and the other is not. method used as a gold standard for identification of al-
Most common pair is HpaII/MspI where MspI also lele specific methylation patterns [18]. Another advan-
cleaves CCGG sequence but regardless of its methylation tage of pyrosequencing is that it is suitable for both CpG
status. In older protocols, resulting fragments were ana- poor and CpG rich regions. Main drawback of this
lyzed on a gel or by a southern blot and the location of method is that only shorter regions (maximum 350 bp)
methylated sites was estimated from the fragments’ sizes can be analyzed. However, this disadvantage can be
[8, 9]. Newer approaches employ quantitative PCR overcome by using more sequencing primers on one
(qPCR) [10]. In order to determine methylation of a spe- amplicon or by a serial pyrosequencing [19, 20].
cific region, DNA is digested by MSRE and subsequently Pyrosequencing process can be divided into three steps:
analyzed with qPCR using primers surrounding the se- (i) PCR amplification and tagging using a biotinylated pri-
quence of interest. Methylation percentage is counted mer, (ii) isolation of the PCR product with streptavidin
from threshold cycles (Ct) measured for digested and beads and hybridization with a sequencing primer, and
undigested control DNA. For this approach, it is possible (iii) sequencing. During the sequencing step, nucleotides
to buy easy-to-use commercial kits with mixes of MSREs are added in a predefined order depending on the sequence
to target more sites, e.g. OneStep qMethyl kit from of interest. The technology is based on a release of pyro-
Zymo Research [11]. phosphate (PPi) during nucleotide incorporation when
Primers can be easily designed with free online software complementary to the template DNA strand (the purified
such as Primer3Plus [12] (http://www.bioinformatics.nl/cgi- PCR product). An ATP sulfurylase then uses PPi and ad-
bin/primer3plus/primer3plus.cgi) or Primer-BLAST [13] enosine phosphosulfate to produce ATP. ATP is utilized by
(https://www.ncbi.nlm.nih.gov/tools/primer-blast/). How- luciferase which converts luciferin to oxyluciferin. The in-
ever, it is required that at least two restriction sites are in- tensity of produced light is detected and translated as a
side the amplicon to reliably measure the DNA peak on a pyrogram [21]. Methylation percentage is then
methylation. Thus, it is not possible to investigate the calculated from the ratio of heights of a cytosine peak
methylation level of only one particular CpG site. (methylated signal) and the sum of cytosine and thymine
peaks (methylated and unmethylated signal) for each cyto-
Methods Requiring Bisulfite Converted DNA sine in a CpG dinucleotide.
Bisulfite (BS) conversion of DNA is a crucial step in As mentioned above, this method is suitable for regions
most DNA methylation analyses. Already in 1970, it was 80–200 bp long. One reason is that longer amplicons
discovered that sodium bisulfite mediates the deamin- could form secondary structures and loops that would im-
ation of cytosine into uracil while the methylated cyto- pede the sequencing reaction. The second issue arises dur-
sine is left intact [14]. After PCR amplification, the ing the sequencing procedure where nucleotides are
converted residues are read as thymines and methylated added in each sequencing cycle. The volume in reaction
cytosines will remain cytosines. It is important to note wells increases which causes dilution of all reagents and
Šestáková et al. Biological Procedures Online (2019) 21:19 Page 3 of 11

thus a decrease of the signal. At the same time, the back- on the 3’end which should be unique in the amplicon.
ground signal rises during the sequencing due to an in- Also, it is not recommended to use the non-biotinylated
complete degradation of previously added nucleotides PCR primer as a sequencing primer. The sequencing pri-
[21]. Because of that, a signal measured after 90–100 cy- mer should differ from the PCR primer in at least one
cles has low quality and the results are not credible [20]. additional nucleotide on the 3’end [21]. Nevertheless, we
Having a strong amplicon with no side product, and tried to use the non-biotinylated primer as a sequencing
therefore a high-quality primer design, is crucial for this primer in some of our previous experiments and the py-
assay. One way is to order the primers from commercial rosequencing was successful.
companies. For example, Qiagen offers a full assay design A set of assay validation reactions, listed in appendix B
for desired regions and it is also possible to buy a prede- of PyroMark Q24 User Manual 2016, should be always
signed primer set. The other option is to use a free soft- performed before using the assay to analyze samples.
ware for bisulfite primer design such as MethPrimer [22] These controls are (i) PCR reaction without template
(http://www.ucsf.edu/urogene/methprimer/index1.html), DNA, (ii) PCR product without sequencing primer, (iii)
Bisearch [23] (http://bisearch.enzim.hu/) or MethylPrimer sequencing primer without PCR product, (iv) biotinyl-
Express by Applied biosystems (http://www.appliedbiosys ated primer without PCR product, and (v) sequencing
tems.com/methylprimerexpress). Moreover, it is important primer and biotinylated primer together without PCR
to check for potential primer dimers formation or product. Moreover, in each assay, controls of BS conver-
self-complementarity of the primers, e.g. with Multiple Pri- sion should be included in the dispensation order [21].
mer Analyzer (https://www.thermofisher.com/cz/en/home/ The BS conversion ratio can be evaluated when a dis-
brands/thermo-scientific/molecular-biology/molecular-biol- pensation of cytosine nucleotides is incorporated before
ogy-learning-center/molecular-biology-resource-library/ or after thymines which are supposedly converted cyto-
thermo-scientific-web-tools/multiple-primer-analyzer.html). sines in the sequence. In case of an unsuccessful BS con-
Primers should be 15–30 bp long (20 bp is optimal) with a version, peaks would appear in the pyrogram for these
melting temperature between 50 and 69 °C (optimally additional dispensations.
60 °C) [24]. There should be at least four non-CpG cyto-
sines in each primer to assure that only a properly BS con- Methylation Specific HRM Analysis
verted DNA will be amplified. Presence of a CpG and MS-HRM is a method based on different melting tem-
therefore a use of a degenerated primer in not recom- peratures (Tm) of methylated and unmethylated DNA.
mended because it may lead to a preferential amplification Tm is defined as a temperature at which the two DNA
of a specific subset of molecules [21]. However, in some of strands dissociate and is characterized by a sudden drop
our previous experiments we used degenerated primers of fluorescence signal due to a release of an intercalating
without any difficulties. One of the PCR primers must be dye, e.g. SYBR Green, EvaGreen or SYTO9. Tm depends
labeled on its 5’end by biotin and this primer should be on the DNA base composition because CG base pairs
purified by HPLC or an equivalent procedure to assure are connected by three hydrogen bonds and AT pairs
zero contamination by free biotin molecules. The orienta- only by two. This also enables to differentiate between
tion of a sequencing assay depends on which primer is methylated and unmethylated DNA after a BS conver-
tagged. It is also essential to incorporate all biotinylated sion where the unmethylated cytosines are converted to
primers into amplicons during the PCR step. Otherwise, uraciles and after PCR changed to thymines.
these primers might compete with the amplicons during MS-HRM comprises of PCR for amplification of a
the streptavidin binding. It is recommended to use 0.1 μM chosen region followed by HRM analysis with ramping
biotinylated primer and 0.2 μM unlabeled primer concen- by only 0.1 °C [26]. It is recommended to use quantita-
trations and 45–50 PCR cycles. It is also possible to use a tive PCR for the amplification as an additional quality
universal biotinylated primer and a tailed reverse primer in control [27]. For the DNA methylation assessment,
5:(0.01–1) ratio [20, 25]. The use of a universal biotinylated DNA standards are analyzed together with the samples.
primer significantly reduces the costs when having more Standards are prepared by diluting fully methylated BS
pyrosequencing assays for various regions. On the other converted DNA by fully unmethylated BS converted
hand, it sometimes requires deeper PCR optimization to DNA and are usually 100, 75, 50, 25, 10 and 0% methyl-
gain a sufficient amount of the PCR product. The amount ated. By comparing the HRM curves of standards and
and size of the amplified PCR product as well as a negative samples it is possible to determine an approximate
PCR control should be always checked by an agarose gel methylation level [26]. Several more quantitative ap-
electrophoresis to prevent further complications. proaches for establishing the DNA methylation were de-
Sequencing primer should be 15–20 bp long with a veloped. It is possible to construct a linear curve by
melting temperature between 45 and 55 °C. The most plotting the temperature at which 50% of DNA is disso-
relevant part of the primer are the last four or five bases ciated (T50) against the methylation percentage of the
Šestáková et al. Biological Procedures Online (2019) 21:19 Page 4 of 11

standards [28]. Another method estimates the methyla- this method is more suitable for CpG rich regions, like
tion level by using two sets of primers, methylated and CpG islands. There should be again at least five thymines,
unmethylated, for amplification. A differential melting BS converted unmethylated cytosines, included in the se-
profile is then calculated by normalizing the methylated quence to assure that only a properly BS converted DNA
HRM profile against the unmethylated. The differential will be amplified [16]. Primers length should be at least
fluorescence peak heights are then plotted against the 23 bp with melting temperature between 55 and 65 °C. It
dilution factor which generates a linear calibration curve is recommended that Met and Unm primers have similar
[29]. Another approach uses peak heights and area melting temperatures. To achieve that, it is often needed
under the curve (AUC) of normalized and temperature to prolong the Unm primer on the 5’end because the BS
shifted first derivatives of HRM curves. There is a linear conversion decreases the Tm of unmethylated DNA [35].
dependency between these values and the methylation The above-mentioned software for finding bisulfite
percentage [27]. primers for pyrosequencing or MS-HRM can be also used
For MS-HRM analysis, the only requirement are primers for designing MSP primer sets.
surrounding the region with CpGs of interest. It is again During the PCR, the number of amplification cycles
crucial to obtain a pure PCR product. Primers should be should not exceed 35 because after that a false methyla-
between 15 and 30 bp long with similar melting tempera- tion signal could appear. It is also crucial to use such an-
tures around 65 °C. This will allow to run the PCR at ap- nealing temperature (Tann) that the primers are specific
proximately 60 °C which is important for the method’s for the DNA methylation status they were designed for
specificity [30]. Generally, for this type of primers that sur- [35]. Thus, it is essential to perform proper control reac-
round the region of interest, it is not advised to have a CpG tions in each new MSP experiment such as PCR with both
inside the primer. However, Wojdacz et al. have shown that methylated and unmethylated standards, no template con-
inclusion of a CpG in the primer sequence can compensate trol and PCR with non-converted DNA [16].
the PCR bias towards unmethylated alleles and thus signifi- For a long time, this method was only qualitative. As a
cantly increase the method’s sensitivity [30, 31]. They also result of the electrophoresis, it was possible to recognize
claim that MS-HRM is taken as a method to assess methy- that only methylated or unmethylated locus or both loci
lation levels and therefore a slight bias towards the methyl- were amplified. Previous studies did not find any clear
ated sequences further increases the method’s sensitivity correlation between the size of the band on the gel and
[32]. According to their recommendations, the primers the amount of DNA examined. Nevertheless, this does not
should contain one or two CpG dinucleotides as close to compromise the great sensitivity of this method [16].
their 5’end as possible [33]. It is necessary to have several Newer protocols employ quantitative PCR and make this
thymines, corresponding to unmethylated cytosines, in- method semiquantitative or quantitative. For example, for
cluded in the primer sequence to amplify only properly establishing unmethylated DNA, qPCR is performed with
converted DNA. It is also advisable to check for primer di- Unm primers together with bisulfite specific primers
mers and loops formation. The amplicon should be kept (BSP) that amplify chosen locus independently of its
small, around 100 bp, to reduce the complexity of its melt- methylation status. The ratio of unmethylated alleles to
ing profile [32]. Nevertheless, it should be considered that a total number of amplified molecules is then calculated by
shorter PCR product gives higher sensitivity but limited either classical ΔΔCt approach with or without correction
resolution between methylation levels because of only small for primers efficiency [36] or by a demethylation index, as
difference between methylated and unmethylated DNA. proposed in another study [37]. Apart from using simple
Longer amplicons have more distinguishable methylation qPCR with an intercalating dye, a quantitative method
profiles [26]. called MethylLight was developed. It uses a pair of methy-
lation specific TaqMan probes where each probe, designed
Methylation Specific PCR for either methylated or unmethylated DNA, is tagged
In this methodology, DNA methylation is examined by with different fluorophore [38]. When using quantitative
two sets of primers where one is specific for a methyl- MSP approaches, it is advisable to perform a melt analysis
ated state (Met) and the other pair for an unmethylated after the PCR to check for any side products [35].
state (Unm) of a certain genomic locus. A set of two
PCR reactions is performed and the products are ana- Results and Discussion
lyzed via a gel electrophoresis [34]. MSRE Analysis
Despite the relative simplicity of this method, finding With the MSRE approach, we were able to accurately
convenient methylated and unmethylated primers is measure methylation levels of the M and U loci. However,
sometimes challenging. The primers are designed to span for the IM locus, we acquired lower methylation levels
the analyzed region and should contain from one to three than expected. Therefore, we performed two additional
CpGs ideally located at the 3’end of the primer. Therefore, MSRE experiments with shortened digestion time to see
Šestáková et al. Biological Procedures Online (2019) 21:19 Page 5 of 11

agarose gel electrophoresis, the peak height of a single

base was always around 50–200 units.
In the resulting pyrograms, it was obvious that the sig-
nal starts dropping significantly after 45th dispensation
cycle which roughly corresponds to a 100 bp region.
This is in accordance with the recommendations for this
method to keep the studied region short [20].
In our experiments, we measured four CpGs in the M
locus and all were highly methylated (95.4 ± 3.1%). In
the U locus, we measured three CpGs and all were
unmethylated (7.4 ± 3.1%). There were only two CpGs in
the IM locus. The IM CpG chosen from the Infinium
Fig. 1 The influence of digestion time on measured methylation MethylationEPIC BeadChip data was indeed intermedi-
levels in MSRE analysis. Error bars represent the standard deviation
ately methylated 58.5 ± 7.3%. However, the next CpG in-
(n = 4). M - methylated locus, IM – intermediately methylated locus,
U – unmethylated locus cluded in the sequenced amplicon was rather
unmethylated 18.4 ± 3.8%. The final average methylation
of the studied region was thus around 37%. This demon-
whether it will increase the methods accuracy for the IM strates the main advantage of the pyrosequencing
locus. The recommended digestion time was 2 h, so we method which is the base resolution. The other quite
additionally tried 1.5-h and 1-h digestions. There was no beneficial aspect of pyrosequencing is the bisulfite con-
statistically significant difference in DNA methylation version control which allows us to see whether the BS
levels measured after various digestion times. We achieved conversion was done properly [21]. We always included
only a slight improvement for the IM locus, where the cal- at least three of these BS control dispensations in our
culated methylation percentage rose from 12 to 17% when pyrosequencing assays.
the digestion time was shortened to 1 h. The methylation
levels for M and U loci remained the same. The results for MS-HRM
all three loci are shown in Fig. 1. Based on these results, Wojdacz et al. have shown that inclusion of a CpG to
we propose that a shorter digestion time may be used to the primer sequence can compensate the PCR bias of
make the MSRE method faster while retaining the original unmethylated alleles by favoring amplification of methyl-
results. ated alleles [32]. Thus, we designed two sets of HRM
primers for the M and U loci. One primer set did not in-
clude any CpGs in its sequence. The other set was de-
Pyrosequencing signed according to Wojdacz et al. [30] and each primer
In the pyrosequencing procedure, the most important step had one or two CpGs on its 5’end. It was not possible to
for a successful analysis is gaining a strong amplicon. design Wojdacz HRM primers for the IM region because
However, even when we detected a strong band on our of its CpG shortage. Sequences of the primers are listed
agarose gel after the PCR, we did not achieve the desirable in Table 1.
signal during pyrosequencing. Thus, we tried to enhance From acquired MS-HRM data, we constructed calibra-
the binding of the amplified, biotin-labeled PCR product tion curves as proposed by Tse et al. [27] for every pri-
by adding more streptavidin beads into the process. We mer set. The correlation coefficients (R2) for peak
compared the results after adding 1, 2 and 3 μl of strepta- height-based calibration curves together with calculated
vidin beads per sample. The 2 μl proved to be ideal for methylation levels for each locus are summarized in
gaining the strongest signal on the pyrogram. Additionally, Table 2. The AUC-based calibration curves had slightly
we prolonged the agitation step to 20 min to increase the lower correlation coefficients. This was probably caused
number of bound molecules. Also, we noticed that after by less exact AUC calculations performed in Excel which
the agitation, it is essential to proceed immediately to the we used to keep the data analysis as simple as possible.
next step to ensure that the beads are resuspended in the Still, the AUC-based DNA methylation assessment gave
tube and will be taken up efficiently by the probes in the similar results as the peak height approach (see
subsequent procedure. According to the manufacturer, for Additional file 1).
accurate results the peak height of a single base should be Interestingly, the results in Table 2 show that the
at least 40 units in the pyrogram. From our experience, ex- Wojdacz’s improvement of primers’ sequence was
periments where single based peaks are at least 25 units quite beneficial for the U region. However, it caused
high give reliable results. Nevertheless, when a strong a deviation in measurements of the M region result-
amplicon was acquired, judging by the results of the ing in worse R2 of the calibration curve and lower
Šestáková et al. Biological Procedures Online (2019) 21:19 Page 6 of 11

Table 1 Primer sequences and characteristics

Primer type Forward/ sequencing primer Reverse primer Tann Product
[°C] length [bp]
M pyrosequencing GGTAGGAGGATGGTTTGAATT/ GTGCCGAGGCTCAGGCAACACTACTCTTACCAAAACAACC 60 373/
GGTGGAAATGAAGTAGGTGTGTTTG 227
IM pyrosequencing GTTAAGGGGGTGTATTTTAGAGA/ GTGCCGAGGCTCAGGCCTTAACTACTTTCCCAAACTACCT 58 399/
GGTAGAGAGAAGTTTTTTTTGTAGG 339
U pyrosequencing GGGGGGGTGTTAGTATTTG/ GTGCCGAGGCTCAGGCCCAAACTAACCTAATAAAACC 58 300/
TTAGTATTTGYGTTGTGGAGTG 290
Universal biotinylated primer 5’biotin-TCTGTGCCGAGGCTCAGGC
M MSRE TTTTCTGTGACCTCCTTTGG CAGTGTGACTGCTGGTGAAG 60 243
N MSRE GCAATAGGCGTTAATGTCGT AGGAGTGGCAAAAGAGGACT 60 199
U MSRE CGCTTAGCAATCATCGACTT GAAACAGGCCGCATCCTC 60 265
M MSP Met GTATATTCGGAATTATTTCGTTTTC AATTAACAACCGACAACCG 56 72
M MSP Unm GATGTATATTTGGAATTATTTTGTTTTT AATTAACAACCAACAACCA 56 75
IM MSP Met CGGTTTTTATAGTTTTGAATTAGATC TTATTTATTATCACATCAACTACTTCCG 58 166
IM MSP Unm ATTGGTTTTTATAGTTTTGAATTAGATT TTATTTATTATCACATCAACTACTTCCA 58 168
U MSP Met CGTTGTGGAGTGAAGTGAATC ACCGAACGAACAATAAACGAA 54 210
U MSP Unm TGTGTTGTGGAGTGAAGTGAATT ACCAAACAAACAATAAACAAAAAA 54 212
M HRM TTGGGTGGAAATGAAGTAGGTGTG CCAAACCATTAACCATAACAATA 54–58* 94
*
IM HRM TTTGGGGAAAAAATATATGGAGTT CTACTAATAAAACCCTTTACTCCCA 54–58 90
U HRM TTAGTATTTGYGTTGTGGAGTG CCRACACTTACTCTTATTAACRATC 54–58* 93
M HRM Wojdacz CGGGGGGGTGTTAGTATTTG CCCGACACTTACTCTTATTAACRATC 55 110
U HRM Wojdacz TCGTGTTTTTTTTTGGGTGGAAATG GCGACCAAACCATTAACCATAACA 55 104
*
For MS-HRM experiments Tann was 55 °C, in qMSP experiments Tann of MSP primers was used
M methylated locus, IM intermediately methylated locus, U unmethylated locus, MSP methylation specific PCR, Met primers for methylated DNA sequence, Unm
primers for unmethylated DNA sequence, HRM high resolution melting analysis, Tann annealing temperature

calculated methylation levels. It is thus not so qMSP

straightforwardly beneficial to introduce the CpGs We designed both Met and Unm primer sets for each
into primers’ sequence. Gaining the optimal results locus to perform the qMSP experiments. Reassuringly, in
apparently require additional thorough Ta all investigated samples, the M locus was amplified only
optimization to achieve equal amplification of meth- by Met primers, the U locus only by Unm primers and the
ylated and unmethylated alleles with Wojdacz’s IM locus was amplified by both Met and Unmet primer
primers [26]. Nevertheless, with all primer sets, the sets. Regarding the DNA methylated and unmethylated
methylation levels of all three loci were measured standards, all three loci were always amplified only by the
accurately enough. corresponding Met or Unm primer set. The HRM primers
were used as BSP, amplifying the region independently of
its methylation status. Summary of Ct values and mea-
Table 2 Correlation coefficients for peak height-based MS-HRM sured efficiencies for all primer sets is shown in Table 3.
calibration curves and counted methylation levels We were not able to measure the efficiency for IM Unm
Locus name Primer set R2 Methylation [%] ± SD
primer set properly. The deviation between duplicates was
(n = 10) higher probably because the efficiency of the primer set
M M HRM 0.952 93.61 5.28 was low and the amplification of the first dilution began
M M HRM Wojdacz 0.798 85.49 5.13
always after 34th cycle. The measurement was thus less
reliable despite the fact that the resulting calibration curve
IM IM HRM 0.973 29.20 4.71
had R2 > 0.99. Therefore, we tried to count the efficiency
U U HRM 0.868 2.69 1.04 of MSP primers based on Ct values measured for stan-
U U HRM Wojdacz 0.938 0.57 0.81 dards and an assumption that BSP primers have 100% effi-
C BSP
M methylated locus, IM intermediately methylated locus, U unmethylated
locus, R2 square of the correlation coefficient, SD standard deviation.
ciency. We used the following equation E c ¼ 100∙ C MSP
t
.
t
Šestáková et al. Biological Procedures Online (2019) 21:19 Page 7 of 11

Table 3 qMSP Ct values and primers’ efficiencies

Locus and used Average Ct of samples (n = 10) Ct of standards Efficiency
primer set
MSP ± SD BSP ± SD MSP BSP MSP measured MSP counted BSP measured
M Met 23.18 0.52 22.88 0.27 24.01 22.70 96.47 94.57 83.00
IM Met 34.54 1.23 24.33 0.35 29.23 24.51 81.13 83.85 94.78
IM Unm 32.21 0.50 24.33 0.35 31.99 25.15 125.80 78.63 94.78
U Unm 37.36 0.80 23.04 0.20 37.95 23.40 65.93 61.66 90.52
M methylated locus, IM intermediately methylated locus, U unmethylated locus, Met primers for methylated DNA sequence, Unm primers for unmethylated DNA
sequence, MSP methylation specific primers, BSP bisulfite specific primers (methylation independent), SD standard deviation.

This counted efficiency corresponded well with the mea- Overall Methods Comparison
sured efficiency (Table 3) and we used it in the subsequent The final results of DNA methylation levels measured
analysis for the IM Unm primer set. by all four methods are shown in Fig. 2. All methods
We analyzed our data using all three approaches were comparable and correlated with each other with
reviewed by Housseiny et al. [36]. The relative expres- R2 > 0.92 and p-value < 1.2·10− 17, except the qMSP
sion ratio method, developed originally by Pfaffl [39], method results of which were spoiled by extreme standard
gave very variable results with extremely high standard deviations. We also provide a review of all costs and mea-
deviation and thus was not reliable (see Additional file 2). surements for each method in Table 5 and a final evalu-
The other approaches, demethylation index and ΔΔCt, ation of few other parameters in Table 6.
gave quite similar results, reviewed in Table 4. The M Indisputably, pyrosequencing has most advantages in
locus was highly amplified by the MSP Met primers. terms of the DNA methylation assessment of a specific
The seemingly double amplification of MSP primers locus. Primer design and interpretation of the results is
compared to BSP primers indicated by ΔΔCt ≅ 2 is prob- straightforward with available software. Only the PCR step
ably caused by the method’s inaccuracy because when may require some optimization for gaining a sufficient
we repeated the experiment with five samples, the ΔΔCt amplicon but this is not always necessary. A disadvantage
results were 1.5 ± 0.3. The ΔΔCt results for U locus were of this method may be the relatively high price of the in-
close to 1, meaning that the number of molecules ampli- strument. Also, the method is more time consuming be-
fied by MSP Unm and BSP primer set was comparable. cause it comprises three steps: PCR, gel electrophoresis
Regarding the IM locus, the MSP Unm primers ampli- and sequencing itself. This also corresponds with the
fied around half of the molecules in comparison with higher price per one measurement.
the BSP primers, which corresponds with the expected When the pyrosequencing instrumentation is unavail-
intermediate methylation level of this locus. However, able, we recommend using MS-HRM. The primer de-
the results of MSP Met primers were spoiled by the dis- sign is feasible for most regions. In our experiment, we
proportionately high Ct measured for the methylated had a CpG poor region (IM) as well as CpG dense re-
DNA standard resulting in a very low ratio of molecules gions (M and U) and were able to design reliable sets of
amplified by MSP Met primers in the samples. This primers for both. As we discussed in the chapter about
could be caused by a higher affinity of Met primers to the results from MS-HRM, deep optimization of
the methylated DNA standard, compared to samples’ primers’ sequence and Tann is not needed for method
DNA that was rather unmethylated in the IM region. resolution of 5–10%. This method is very simple as well
as cost and time effective. The approximate results can
be derived immediately from the melting curves. The
exact quantification is not so straightforward when a
Table 4 Summary of qMSP methylation results calculated using specific software is not provided. Nevertheless, the cal-
demethylation index and ΔΔCt approach culations can be done using free software and Excel, as
Locus and used Demethylation index ΔΔCt we have shown.
primer set
Average (n = 10) ± SD Average (n = 10) ± SD The MSRE analysis proved to be a quick and simple
M Met 2.02 0.60 2.09 0.66 method. The main advantage of this approach is that it
IM Met 0.05 0.03 0.03 0.02 does not require the BS conversion of DNA. Thus, less
IM Unm 0.51 0.10 0.50 0.12 DNA is needed to perform the analysis and it also makes
the primer design easier. We were able to accurately
U Unm 1.03 0.30 1.30 0.66
measured the DNA methylation in M and U regions.
M methylated locus, IM intermediately methylated locus, U unmethylated
locus, Met primers for methylated DNA sequence, Unm primers for
Obviously though, the method is not suitable for inter-
unmethylated DNA sequence, SD standard deviation mediately methylated loci. Even by shortening the
Šestáková et al. Biological Procedures Online (2019) 21:19 Page 8 of 11

Fig. 2 Summary of DNA methylation levels measured by the investigated methods. The average methylation of 10 samples is shown, the error
bars represent the SD. Displayed MSRE data were measured after 2-h digestion. Displayed MS-HRM data were acquired using HRM M, HRM IM
and HRM U Wojdacz primers. qMSP data shown were calculated using ΔΔCt approach and multiplied by 100 to gain the percentage. For the M
locus in qMSP, all values were higher than 100% so we set the mean to 100% to make the figure more comprehensible, the SD was calculated
from the original values multiplied by 100. For the IM and U loci in qMSP, we calculated the methylation percentage as 1-(Unm ΔΔCt), the SD
was also calculated from the original ΔΔCt values multiplied by 100. M – methylated locus, IM – intermediately methylated locus, U –
unmethylated locus

digestion time to half of that recommended, the mea- which both Met and Unm primer sets were specific only
sured DNA methylation of IM locus remained signifi- for the methylated or unmethylated allele respectively but
cantly lower than expected. Also, the method is very still functional so that it amplified the corresponding
costly when compared to the other three. DNA standard. When we finally achieved this, the primers
The last method evaluated was qMSP and this caused had very low efficiency, except for the M Met primer set.
the most difficulties. The primer design was quite challen- Moreover, the exact quantification of measured data was
ging and nearly impossible for the IM locus because of its difficult and the results of the M and U loci had extremely
lack of CpGs. Another issue was to find a suitable Tann at high standard deviations within the samples. This method,

Table 5 Costs summary of each method

Method Total cost of Number of samples measured Number of standards Total number of Cost per
analysis [$] measured measurements measurement [$]
MSRE analysis 576 10 for each locus*, Test and 2 for each locus*, duplicates 144 4
Reference reaction, duplicates
pyrosequencing 162‡ 10 for each locus* 2 for each locus* 36 4.5
*
MS-HRM 85 10 for each locus , duplicates 6 for each locus*, duplicates 96 0.9
qMSP 196 10 for each primer set†, duplicates 2 for each primer set†, duplicates 216 0.9
*
Number of loci = 3
†
Number of MSP/HRM primer sets for each locus = 3
‡
price of the pyrosequencing instrument ca 45,000 $

Table 6 Overall evaluation of tested methods

Method Base resolution Consistency across Analysis of Method Time Price
methylation levels acquired data optimization consumption
MSRE analysis – * * * * ***
Pyrosequencing + *** * * *** **
MS-HRM – *** ** */**(if needed) * *
qMSP – ** *** *** ** **
* - simple/low, ** - intermediate, *** - demanding/high
Šestáková et al. Biological Procedures Online (2019) 21:19 Page 9 of 11

despite of its simplicity, is also quite expensive because it Samples and DNA Standards
requires amplification of a chosen region by at least one This study was approved by the Institutional Ethics
MSP primer set and BSP primers. Committee and all blood donors provided their full con-
sent. Mononuclear cells of ten healthy blood donors
Conclusion were harvested from buffy coats by Ficoll gradient cen-
Even in the era of arrays and next-generation sequencing, trifugation (Histopaque, Sigma-Aldrich, St.Louis, MO,
it is essential to have a method for validation of acquired USA). DNA was extracted using MagCore system
DNA methylation data. A quick, cost-effective, and reli- (RBCBioscience, New Taipei City, Tchaj-wan). Human
able method that would enable to confirm or reject a po- Methylated & Non-methylated DNA Set (Zymo Re-
tential clinical significance of certain methylation changes search, Irvine, CA, USA) was used as methylated and
and could be used in common laboratory practice is still unmethylated standards.
needed.
We tested four standard methods that are used for DNA MSRE Analysis
methylation validation: MSRE analysis, pyrosequencing, OneStep qMethyl Kit (Zymo Research) was used for
MS-HRM and qMSP. In terms of overall feasibility, ob- MSRE analysis. For each sample, DNA (20 ng) was proc-
tained DNA methylation information and consistency essed through the Test and Reference reactions according
across various methylation levels, we consider pyrosequenc- to the manufacturer’s protocol. In the PCR step, Tann was
ing and MS-HRM approaches as the most suitable. Pyrose- set to 60 °C and annealing time was shortened to 45 s.
quencing enables base resolution and thus acquisition of a Rotor-Gene Q 2plex HRM Platform (Qiagen, Hilden,
methylation level for each CpG in the region, an indisput- Germany) was used to perform the measurements.
able benefit. MS-HRM can be also designed to investigate a
single CpG locus when needed. Otherwise, it provides an Bisulfite Conversion
overall DNA methylation status of all CpGs inside the stud- DNA (500 ng) was treated with bisulfite using EZ DNA
ied region. Apparently, MSRE and qMSP are not very Methylation-Lightning Kit (Zymo Research). For MS-
applicable for the detection of intermediate levels of DNA HRM and qMSP experiments, the concentration of BS
methylation. Nonetheless, MSRE does not require BS con- converted DNA was measured by NanoDrop™ One/OneC
version of DNA and as we showed here, the digestion time Microvolume UV-Vis Spectrophotometer (Thermo Fisher
can be shortened to one half. This makes the MSRE ana- Scientific, Waltham, MA, USA) and then adjusted to
lysis the simplest and fastest out of the four methods com- 10 ng·μl− 1.
pared. The qMSP approach proved to be quite imprecise
and demanding so it may be more convenient to keep this Primer Design
method only as a qualitative tool. For MSRE analysis, online software Primer3Plus (http://
www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.
Materials and Methods cgi) was used. For methods that require BS converted
Characterization of Analyzed CpGs DNA, we used Methyl Primer Express Software v1.0
The three analyzed CpGs with different levels of methyla- (Thermo Fisher Scientific). For primers’ sequences and
tion were selected based on healthy donors’ data from characteristics see Table 1. Positions of all primer pairs
Infinium MethylationEPIC BeadChip (Illumina, San within the studied regions are shown in Fig. 3.
Diego, CA, USA) acquired in our previous work [40].
Characteristic of chosen loci is summarized in Table 7. Pyrosequencing
These CpG dinucleotides were also chosen so that they BS converted DNA (10–20 ng) was first amplified using
are within CCGG sequence to enable their cutting by HotStar HiFidelity Polymerase Kit (Qiagen) with final
MSRE. 2.5 mM MgCl2 concentration. To increase primers’ spe-
cificity and for easy gel loading, we added CoralLoad
Table 7 Specifications of selected CpG sites Concentrate from PyroMark PCR kit (Qiagen) to the final
Locus BeadChip Cytosine location (hg 19) Beta value for concentration of 1x. The final concentration of forward and
name probe ID all samples
Chromosome Position
measured with universal biotinylated primer was 0.2 μM. The final concen-
BeadChip tration of reverse tailed primer was 0.04 μM. We used rec-
M cg24337108 10 11,797,422 > 0.99 ommended PCR reaction conditions for PyroMark PCR
IM cg25722983 1 36,840,028 from 0.45 to 0.55 with 48 PCR cycles and Tann according to Table 1. Ampli-
con quality (1 μl of PCR reaction) was checked using 2%
U cg09655782 4 57,333,859 < 0.1
agarose gel electrophoresis. Pyrosequencing was performed
M methylated locus, IM intermediately methylated locus, U unmethylated
locus, BeadChip Infinium MethylationEPIC BeadChip (Illumina), Beta value
on PyroMark Q24 instrument (Qiagen). Pyrosequencing
corresponds to methylation percentage protocol (User Manual 01/2016) was optimized by adding
Šestáková et al. Biological Procedures Online (2019) 21:19 Page 10 of 11

Fig. 3 Positions of primer pairs, CpGs and restriction sites within studied regions. CpGs are shown as red and yellow bars on a line representing
the DNA sequence. The red CpG is the one originally chosen from Infinium MethylationEPIC BeadChip. The scissors indicate sites that are cut by
MSREs. The lighter blue primers were used for initial pyrosequencing PCR and the darker blue primers represent the sequencing primers. The
patterned light green HRM primers were designed with a CpG on its 5’end (M/U Wojdacz primers)

2 μl of sepharose-coated Streptavidin beads (step 5.3.3.2) Green PCR Kit (Qiagen). The final concentration of
and by prolonging the agitation step to 20 min (step primers was 0.5 μM. We kept recommended cycling con-
5.3.3.6). ditions with 40 cycles and Tann according to Table 1. In
one run, all samples together with methylated and
unmethylated DNA standards were amplified with meth-
MS-HRM Analysis
ylated MSP, unmethylated MSP and HRM primers. For
We prepared 100, 75, 50, 25, 10 and 0% methylated stan-
each primer set, the amplification efficiency was calculated
dards by mixing BS converted DNA methylated and
according to Dorak et al. [42]. We performed qPCR with
unmethylated standards. 15 ng of BS converted samples
four dilutions of BS converted DNA of one sample and
and standards were processed using EpiTect HRM PCR
plotted decadic logarithm of the dilutions against acquired
Kit (Qiagen). Reaction conditions were set according to
Cts. The efficiency was then calculated from the slope of
manufacturer’s protocol. The amount of reagents was ad-
the calibration curve as follows: E ¼ ½10ð−slopeÞ −1 ∙100. All
1

justed to 20 μl final volume. The final concentration of

primers was 0.375 μM. The experiment was performed on measurements were done using StepOnePlus Real-Time
Rotor-Gene Q 2plex HRM Platform (Qiagen). For the PCR System (Thermo Fisher Scientific). Methylation levels
HRM analysis, the ramping was set from 67.1 to 82.2 °C, were calculated using all three approaches reviewed in
rising by 0.1 °C/2 s. Raw data were processed using web- Husseiny et al. [36].
based tool uAnalyze [41]. In the software, we performed
baseline normalization and calculated the difference Additional files
curves for all standards and samples using the 0% methyl-
ated standard as a reference curve. Calibration curves Additional file 1: Correlation coefficients for AUC-based MS-HRM
calibration curves and counted methylation levels. (DOCX 14 kb)
were then plotted in Microsoft Excel according to Tse
Additional file 2: qMSP methylation results calculated using the
et al. [27] using peak heights and AUC of the standards’ relative expression ration. (DOCX 12 kb)
processed data. From the calibration curves, the methyla-
tion percentage of analyzed samples was calculated.
Acknowledgements
Not applicable.
qMSP
Quantitative PCR with subsequent melting curve analysis Authors’ Contributions
SS performed the measurements, data analysis and wrote the manuscript. CS
was performed with 10–15 ng of BS converted DNA. Re- revised the manuscript. HR designed the study and wrote the manuscript. All
action mix (20 μl) was prepared using QuantiTect SYBR® authors read and approved the final version.
Šestáková et al. Biological Procedures Online (2019) 21:19 Page 11 of 11

Funding 17. Frommer M, Mcdonald LE, Millar DS, Collis CM, Watt F, Grigg GW, et al. A
This work was supported by the Project for Conceptual Development of genomic sequencing protocol that yields a positive display of 5-
Research Organization (00023736, Institute of Hematology and Blood methylcytosine residues in individual DNA strands. 1992,.
Transfusion) provided by Ministry of Health of the Czech Republic. 18. Reed K, Poulin ML, Yan L, Parissenti AM. Comparison of bisulfite sequencing
PCR with pyrosequencing for measuring differences in DNA methylation.
Anal Biochem. 2010;397(1):96–106.
Availability of Data and Materials
19. Tost J, El abdalaoui H, Glynne Gut I. Serial pyrosequencing for quantitative
The datasets supporting the conclusions of this article are included within
DNA methylation analysis. BioTechniques. 2006;40(6):721–6.
the article (and its additional files).
20. Delaney C, Garg SK, Yung R. Analysis of DNA methylation by
pyrosequencing. Methods Mol Biol. 2015;1343:249.
Ethics Approval and Consent to Participate 21. Tost J, Gut IG. DNA methylation analysis by pyrosequencing. Nat Protoc.
This work was conducted in accordance with the principles of the 2007;2(9):2265–75.
Declaration of Helsinki and was approved by the Ethics Committee of the 22. Li L, Dahiya R. MethPrimer: designing primers for methylation PCRs.
Institute of Hematology and Blood Transfusion, Prague, Czech Republic. All Bioinformatics. 2002;18(11):1427–31.
blood donors provided written informed consent. 23. Arányi T, Váradi A, Simon I, Tusnády GE. The BiSearch web server. BMC
bioinformatics. 2006;7(1):431.
24. King CR, Scott-Horton T. Pyrosequencing. In: Marsh S, editor.
Consent for Publication Pyrosequencing protocols Totowa. NJ: Humana Press; 2007. p. 39–55.
Not applicable. 25. Guo D, Milewicz DM. Universal primer applications for pyrosequencing. In: Marsh
S, editor. Pyrosequencing protocols Totowa. NJ: Humana Press; 2007. p. 57–62.
Competing Interests 26. Wojdacz TK, Dobrovic A. Methylation-sensitive high resolution melting (MS-
The authors declare that they have no competing interests. HRM): a new approach for sensitive and high-throughput assessment of
methylation. Nucleic Acids Res. 2007 Mar;35(6):e41.
Author details 27. Tse MY, Ashbury JE, Zwingerman N, King WD, Taylor SA, Pang SC. A refined,
1 rapid and reproducible high resolution melt (HRM)-based method suitable
Institute of Clinical and Experimental Hematology, First Faculty of Medicine,
Charles University and Institute of Hematology and Blood Transfusion, for quantification of global LINE-1 repetitive element methylation. BMC Res
Prague, Czech Republic. 2Institute of Hematology and Blood Transfusion, Notes. 2011;4(1):565.
Prague, Czech Republic. 28. Smith E, Jones ME, Drew PA. Quantitation of DNA methylation by melt
curve analysis. BMC Cancer. 2009;9(1):123.
Received: 6 June 2019 Accepted: 9 August 2019 29. Malentacchi F, Forni G, Vinci S, Orlando C. Quantitative evaluation of DNA
methylation by optimization of a differential-high resolution melt analysis
protocol. Nucleic Acids Res. 2009 Jul;37(12):e86.
30. Wojdacz TK, Borgbo T, Hansen LL. Primer design versus PCR bias in
References methylation independent PCR amplifications. Epigenetics. 2009;4(4):231–4.
1. Schubeler D. Function and information content of DNA methylation. 31. Wojdacz TK, Lotte HL. Reversal of PCR bias for improved sensitivity of the
Nature. 2015;517(7534):321. DNA methylation melting curve assay. BioTechniques. 2006;41(3):274–8.
2. Jin Z, Liu Y. DNA methylation in human diseases. Genes & Diseases. 2018; 32. Hansen LL, Wojdacz TK, Dobrovic A. Methylation-sensitive high-resolution
5(1):1–8. melting. Nat Protoc. 2008;3(12):1903–8.
3. Levenson VV. DNA methylation as a universal biomarker. Expert Rev Mol 33. Wojdacz TK, Hansen LL, Dobrovic A. A new approach to primer design for
Diagn. 2010;10(4):481–8. the control of PCR bias in methylation studies. BMC Res Notes. 2008;1(1):54.
4. Heyn H, Esteller M. DNA methylation profiling in the clinic: applications and 34. Herman JG, Graff JR, Myöhänen S, Nelkin BD, Baylin SB. Methylation-Specific
challenges. Nat Rev Genet. 2012;13(10):679–92. PCR: A Novel PCR Assay for Methylation Status of CpG Islands. Proc Natl
5. Pidsley R, Zotenko E, Peters TJ, Lawrence MG, Risbridger GP, Molloy P, et al. Acad Sci U S A. 1996;93(18):9821–6.
Critical evaluation of the Illumina MethylationEPIC BeadChip microarray for 35. Derks S, Lentjes MH, Hellebrekers DM, de Bruïne AP, Herman JG, van Engeland
whole-genome DNA methylation profiling. Genome Biol. 2016;17(1):208. M. Methylation-specific PCR unraveled. Cellular oncology : the official journal of
6. Lövkvist C, Dodd IB, Sneppen K, Haerter JO. DNA methylation in human the International Society for Cellular Oncology. 2004;26(5–6):291–9.
epigenomes depends on local topology of CpG sites. Nucleic Acids Res. 36. Husseiny MI, Kuroda A, Kaye AN, Nair I, Kandeel F, Ferreri K.
2016;44(11):5123–32. Development of a Quantitative Methylation-Specific Polymerase Chain
7. Cedar H, Solage A, Glaser G, Razin A. Direct detection of methylated cytosine in Reaction Method for Monitoring Beta Cell Death in Type 1 Diabetes.
DNA by use of the restriction enzyme MspI. Nucleic Acids Res. 1979;6(6):2125–32. PLoS One. 2012 Oct 1;7(10):e47942.
8. Fraga MF, Esteller M. DNA Methylation: A Profile of Methods and 37. Akirav EM, Lebastchi J, Galvan EM, Henegariu O, Akirav M, Ablamunits V, et
Applications. BioTechniques. 2002;33(3):632–49. al. Detection of β cell death in diabetes using differentially methylated
9. Singer-Sam J, LeBon JM, Tanguay RL, Riggs AD. A quantitative Hpall-PCR circulating DNA. Proc Natl Acad Sci U S A. 2011;108(47):19018–23.
assay to measure methylation of DNA from a small number of cells. Nucleic 38. Eads CA, Danenberg KD, Kawakami K, Saltz LB, Blake C, Shibata D, et al.
Acids Res. 1990;18(3):687. MethyLight: a high-throughput assay to measure DNA methylation. Nucleic
10. Itoi E, Kokubun S, Hashimoto K, Roach HI. Improved Quantification of DNA Acids Res. 2000;28(8):e32.
Methylation Using Methylation-Sensitive Restriction Enzymes and Real-Time 39. Pfaffl MW. A new mathematical model for relative quantification in real-time
PCR. Epigenetics. 2007;2(2):86–91. RT-PCR. Nucleic Acids Res. 2001;29(9):45.
11. Kurdyukov S, Bullock M. DNA Methylation Analysis: Choosing the Right 40. Šestáková Š, Krejčík Z, Folta A, Cerovská E, Šálek C, Merkerová MD, et al. DNA
Method. Biology. 2016;5(1):3. methylation and hydroxymethylation patterns in acute myeloid leukemia
12. Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, Leunissen JAM. Primer3Plus, patients with mutations in DNMT3A and IDH1/2 and their combinations.
an enhanced web interface to Primer3. Nucleic Acids Res. 2007;35(suppl2):W74. Cancer Biomark: Section A of Disease Markers. 2019;25(1):43–51.
13. Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer- 41. Dwight Z, Palais R, Wittwer C. uAnalyze: web-based high-resolution DNA
BLAST: A tool to design target-specific primers for polymerase chain melting analysis with comparison to thermodynamic predictions. IEEE/ACM
reaction. BMC bioinformatics. 2012;13(1):134. Trans Comput Biol Bioinform. 2012;9(6):1805–11.
14. Hayatsu H, Wataya Y, Kazushige K. Addition of sodium bisulfite to uracil and 42. Pfaffl MW. Real-time qPCR amplification efficiency. In: Dorak MT, editor. Real-
to cytosine. J Am Chem Soc. 1970;92(3):724–6. time PCR. 1st ed. London: Taylor & Francis; 2007. p. 68–71.
15. Sant KE, Nahar MS, Dolinoy DC. DNA methylation screening and analysis.
Methods Mol Biol (Clifton, NJ). 2012;886:385–406.
16. Hernández HG, Tse MY, Pang SC, Arboleda H, Forero DA. Optimizing Publisher’s Note
methodologies for PCR-based DNA methylation analysis. BioTechniques. Springer Nature remains neutral with regard to jurisdictional claims in
2013;55(4):181–97. published maps and institutional affiliations.