Staphylococcus Epidermidis Ica

Biomaterials 23 (2002) 4233–4239
Detection of slime production by means of an optimised Congo red

agar plate test based on a colourimetric scale in Staphylococcus
epidermidis clinical isolates genotyped for ica locus
Carla Renata Arciolaa,b,*, Davide Campocciaa, Simonetta Gamberinia, Marina Cervellatia,
Elena Donatia, Lucio Montanaroa,b
a
Research Laboratory on Biocompatibility of Implant Materials, Rizzoli Orthopedic Institute, via di Barbiano 1/10, Bologna 40136, Italy
b
Experimental Pathology Department, University of Bologna, Italy
Received 27 April 2001; accepted 8 April 2002
Abstract
This investigation was conduced on a collection of 113 S. epidermidis strains isolated from biomaterial-associated infections. All
strains were examined both for the presence of icaA and icaD genes responsible for slime synthesis by a PCR method and for the in
vitro slime production ability by the Congo red agar (CRA) plate test. In the present study, the original CRA test was optimised
adopting a six-colour reference scale for a fine classification of colonies colours. The six-colour tones of the scale were as follows:
very black (vb), black (b), almost black (ab), which were considered as positive results, and bordeaux (brd), red (r), and very red (vr),
interpreted as negative. 57.5% of all the strains were found to be icaA icaD-positive as well as slime-forming onto CRA, exhibiting
the following colonies colours: vb (35.4%); b (15.9%); ab (6.2%). The percentage of icaA icaD-negative strains was 42.5% and all of
them were negative onto CRA: brd (19.5%), r (14.2%), vr (8.8%). The comparison of colour classification with the information on
ica genes confirmed the validity of the scale adopted, providing support to the criteria used for a correct interpretation of the
colonies colour during the execution of the CRA test. Overall these results indicate a fine consistency between these two
experimental methods and a good reliability of CRA plate test, especially when this is supported by a colourimetric scale. r 2002
Elsevier Science Ltd. All rights reserved.
Keywords: Biomaterial-associated infections; Staphylococcus epidermidis; Slime; ica Genes; Polymerase chain reaction (PCR); Microtiter plate
method; Congo red agar
1. Introduction system. The importance of the role played by slime is

further increased by its frequent association to reduced
Adherence and fixation of bacteria onto biomaterial antibiotic susceptibility. These considerations explain
surfaces represent a first fundamental step in the the need for diagnostic methods which identify virulent
development of implant-associated infections. Among bacteria strains by correctly detecting their ability to
various mechanisms involved in bacterial adhesion produce slime.
[1–5], the production of extracellular substance of Slime production is often observed in clinical isolates
polysaccharidic nature termed slime appears to play a of coagulase-negative staphylococci and particularly in
relevant role. Such substance mediates adhesion to S. epidermidis strains obtained from implant-associated
implant surfaces acting as a cementing matrix, enabling human infections [6,7]. The classic method most often
bacterial cells to agglomerate in multilayered biofilms, used to phenotypically detect slime production in this
and making bacteria less accessible to the host defence bacteria species is the Congo red agar (CRA) plate test
as described by Freeman et al. [8]. The CRA plate test is
performed on a solid medium, the Congo red agar. The
*Corresponding author. Research Laboratory on Biocompatibility direct analysis of the colonies formed on the solid
of Implant Materials, Rizzoli Orthopedic Institute, via di Barbiano
1/10, Bologna 40136, Italy. Tel./fax: +39-51-6366599.
medium allows the recognition of slime-producing
E-mail addresses: [email protected] (C.R. Arciola), strains (characterised by black colonies on the red agar)
[email protected] (L. Montanaro). and of non-slime-producing strains (pink/red coloured
0142-9612/02/$ - see front matter r 2002 Elsevier Science Ltd. All rights reserved.
PII: S 0 1 4 2 - 9 6 1 2 ( 0 2 ) 0 0 1 7 1 - 0
4234 C.R. Arciola et al. / Biomaterials 23 (2002) 4233–4239
colonies). Thus, the assay is not quantitative, but based commercially available identification kit (Api-Staph,
on a chromatic subjective evaluation. Furthermore, the Biome! rieux, France), and the coagulase test [13]. For the
variation from black to red colonies colour is progres- storage of the bacterial strains, a single colony of each
sive and the classification can sometimes result difficult was seeded in 8 ml of Trypticase Soy Broth (TSB, BD,
for the investigator. However, when using this techni- NJ, USA). The broth was incubated for 24 h at 371C
que, additional information can be collected by mon- and finally stored at 801C in 1-ml aliquots.
itoring the appearance of the colonies over time. For
instance, variant bacteria identifiable as pink/red spikes 2.2. Phenotypic characterisation of slime producing
on black colonies can be observed. They emerge during ability onto CRA
the execution of the test and remain confined just where
they emerged. All the strains were cultured onto CRA. CRA plates
Newly developed molecular methods recently pro- were prepared adding 0.8 g of Congo red and 36 g of
vided a direct evidence of the genetic basis of slime saccharose (both from Sigma, Missouri, USA) to 1 l of
production complementary to the CRA test. They brain heart infusion agar (Oxoid, Basingstoke, Hamp-
became available with the discovery that slime synthesis shire, England). The plates were incubated for 24 h at
is controlled by the ica operon [9,10]. The activation of 371C, and subsequently over night at room temperature.
the ica operon triggers the synthesis of the polysacchar- On CRA, slime-producing strains form black colonies,
ide intercellular adhesin (PIA), a main slime component whereas non-producing strains develop red colonies. As
consisting of linear b-1,6-linked glucosaminylglycans. previously described, the original method developed by
PIA is synthesised in vitro from UDP-N-acetylglucosa- Freeman et al. [8] was slightly implemented in its part
mine by the enzyme N-acetylglucosaminyltranferase, concerning colonies colour evaluation. For an accurate
which is encoded by the intercellular adhesion (ica) locus assessment of all the possible chromatic variations
and in particular by the icaA gene. Sole expression of exhibited by the cultured colonies, an internal reference
icaA induces only low enzymatic activity, but co- six-colour scale was used. The scale ranged from very
expression of icaA with icaD leads to a significant black (vb) to very red (vr) (see Fig. 1). Very black and
increase in the activity and is related to the full black colonies were considered as normal slime producer
phenotypic expression of the capsular polysaccharide strains, while dark, almost black colours were consid-
[10]. Molecular techniques for the identification of the ered as indicative of a weak slime production activity.
ica genes that encode for the slime synthesis represent a Conversely, very red to bordeaux coloured colonies were
very reliable tool for an accurate identification of the considered grades of red and classified as strains unable
virulent slime-forming strains [11,12]. to produce slime.
In this study, the presence of icaA and icaD genes
responsible for the slime synthesis was investigated in 2.3. Detection of icaA and icaD genes responsible for
two S. epidermidis reference strains and in a collection of slime synthesis by PCR
113 S. epidermidis isolates from biomaterial-associated
infections by a simple, rapid and highly specific PCR- The procedure used to detect the ica genes involved
based procedure. The same strains were also analysed by the following steps: preparation of bacterial lysates and
an optimisation of CRA test. In light of the difficult DNA extraction, PCR-amplification and examination
chromatic evaluation involved in the original method, a by electrophoresis on agarose gel as described in Arciola
print six-colour reference scale was adopted to support et al. [11]. The sequences of icaA and icaD were obtained
the phase of colony identification. Finally, the colour from the GenBank Sequence Database of the National
classification of each strain performed by the CRA test Centre for Biotechnology Information [http://
was compared with the more reliable information www.ncbi.nlm.nih.gov] (accession number for the ica
derived from the molecular analysis of icaA and icaD operon: U43366). Primers specific for icaA and icaD
genes. were picked on the gene sequences by the Primer3
program (National Institutes of Health, National Hu-
man Genome Research Institute. [http://www.genome.-
2. Materials and methods wi.mit.edu/genome software/other/primer3.html]). For
the detection of icaA, the primers were as follows: 50 -
2.1. Bacterial strains and strain storage TCTCTTGCAGGAGCAATCAA as the forward pri-
mer and 50 -TCAGGCACTAACATCCAGCA as the
Two S. epidermidis strains were used as reference reverse primer. These two primers include a 188-bp
strains: the slime-producer ATCC35984 and the slime- region. The two primers for the detection of icaD were,
negative ATCC12228. 113 strains of S. epidermidis respectively, 50 -ATGGTCAAGCCCAGACAGAG as
isolates from infected orthopaedic devices were investi- the forward primer and 50 -CGTGTTTTCAACATT-
gated in this study. Identification was confirmed by a TAATGCAA as the reverse primer, including a 198-bp
C.R. Arciola et al. / Biomaterials 23 (2002) 4233–4239 4235
Fig. 1. Colourimetric scale adopted for colony evaluation by CRA: (A) reference scale (vr, very red; r, red; brd, bordeaux; ab, almost black; b, black;
vb, very black); (B) particular of the colony appearance onto CRA plate; (C) PCR detection of icaA and icaD genes. Due to light reflection, the
digital images of colonies do not always perfectly correspond the closely matching appearance as per direct eye observation.
Table 1
Phenotype characterisation by CRA of the ica-positive strains (P: producer)
Strain no. PCR CRA
icaA/icaD Results 24 h 48 h Results
ATCC35984 +/+ P Very black Very black P

1. +/+ P Very black Very black P
9. +/+ P Very black Very blacka P
31. +/+ P Black Very black P
32. +/+ P Black Very blacka P
41. +/+ P Very black Black P
42. +/+ P Very black Black P
43. +/+ P Very black Blacka P
44. +/+ P Very black Blacka P
45. +/+ P Black Black P
46. +/+ P Black Blacka P
59. +/+ P Black Almost black WP
60. +/+ P Almost black Almost blacka WP
Table 1 (continued)
Strain no. PCR CRA
icaA/icaD Results 24 h 48 h Results
61. +/+ P Almost black Almost black WP

64. +/+ P Bordeaux Almost black WP
65. +/+ P Bordeaux Almost blackb WP
a
Colonies that were black at 24 h, but which exhibited tiny pink or red central spikes at 48 h.
b
The uncertain classification required further confirmation at 72 h of incubation.
region. All the primers were synthesised by M-Medical Also the negative reference ATCC12228 was proved to
Genenco (Firenze, Italy). PCR was performed as lack both the icaA and icaD genes. Among all 113
previously described [11]. strains, 65 resulted to be slime producers, while 48 were
identified as non-producers.
3. Results
4. Discussion
3.1. Detection of slime-producing phenotype of the strains
by CRA plate test In recent years, an increased attention is being paid to
bacterial infection as one of the main causes of implant
Phenotypic production of slime of all the strains failure. In particular, a number of studies are being
under study was assessed by cultures on CRA (Tables 1 conduced to understand the mechanisms which enable
and 2). Even with the support of the chromatic scale, at normal saprophytic bacteria to succeed in colonising
48 h the classification of two strains was still uncertain prostheses, becoming pathogen to the host. The
(between bordeaux (brd) and almost black (ab)) and the importance of the role played by slime in implant
bacterial incubation had to be extended to 72 h, as infection is well documented when examining its
indicated in the captions of the tables, for a better prevalence in strains isolated from the normal epithelial
identification. The two reference strains ATCC35984 microflora and in implant-associated infection isolates.
and ATCC12228 were found to be, respectively, positive While in the microflora only about 6% of the S.
and negative to the test, as expected. Among the 113 epidermidis strains possess the ability of slime produc-
strains investigated, the classification was as follows: 40 tion, in the second case this propriety can be present in a
vb (35.4%), 18 b (black) (15.9%), seven ab (6.2%), 22 10 time higher percentage of strains [14]. Considering
brd (19.5%), 16 r (red) (14.2%), and 10 vr (8.8%). The that all implanted devices carry on the risk of infection
seven bacterial isolates only partially stained by the with associated increase in morbidity and mortality, the
Congo red dye (ab) were considered as weak slime need for a better understanding of the mechanisms by
producers. Overall, 65 (57.5%) out of the 113 clinical which pathogens adhere and colonise a device is much
isolates turned out to be slime-producer strains. more than just a mere scientific interest. For instance, it
is also the base for the research and development of
3.2. PCR detection of icaA and icaD infection-resistant materials [15–17]. Therefore, labora-
tory study of the pathogenesis of biomaterial-related
The PCR technique was performed for both markers infections is critical.
on all the 113 staphylococcal isolates and on the two This study was designed to provide more elements for
reference strains (Tables 1 and 2). The bands obtained a correct assessment of bacteria and a key for a more
by amplification of the DNA extracted from slime- accurate CRA interpretation, reducing the variability
producing strains were verified by the image analyser due to subjective evaluation and assigning a correct
system. Using bands of Molecular Weight Marker VI as diagnostic value to colonies colour, based on the
reference standards, the system assigned the expected bp information obtained by a reliable alternative method.
lengths (103 and 198 bp, respectively, for the icaA and The comparison of the proposed optimisation of CRA
icaD genes) to the amplified bands. The slime-producing with the responses of the PCR-based technique evi-
reference strain ATCC35984 was found to be positive denced a striking concordance between these two
for both genes. Both bands also were obtained in slime- methods. All the 65 slime positive strains detected by
producing clinical isolates, while none of the two bands CRA were both icaA and icaD positive. Even though
was evidenced in non-slime-producing clinical isolates. two strains required to extend the incubation time to
Table 2
Phenotype characterisation by CRA of the ica-negative strains (NP: non producer)
Strain no. PCR CRA
IcaA/IcaD Results 24 h 48 h Results
ATCC12228 / NP Very red Very red NP

66. / NP Bordeaux Bordeauxa NP
67. / NP Bordeaux Bordeaux NP
87. / NP Red Bordeaux NP
88. / NP Bordeaux Red NP
100. / NP Red Red NP
104. / NP Red Very red NP
109. / NP Very red Very red NP
a
The uncertain classification required further confirmation at 72 h of incubation.
72 h before the final reading of the plate, at 48 h the between these two extreme tones. Each single colony
colonies were generally promptly classified by the scale. formed on the agar could be monitored for the
The analysis of ica genes also confirmed that transition development of possible variants. In a number of
from negative to positive results occurs when colonies bacterial strains, at 48 h of incubation, the formation
on CRA plates turn from a bordeaux to an almost grey of pink/red coloured spikes within black colonies could
tone. The chromatic scale was found to be a convenient be evidenced by this technique. Concerning the nature of
tool for an easier and more objective discrimination such spikes, there is some experimental proof which
supports the development of new clones referred to as ples, methods, and applications. Totowa, NJ: Humana Press Inc.,
biofilm-negative, which result to have lost both icaA and 2000. p. 307–30.
icaD genes [11]. By other authors, similar changes [4] Montanaro L, Arciola CR. Studying bacterial adhesion to
irregular or porous surfaces. In: An YH, Friedmann RJ,
encountered in bacteria deriving from a single producer editors. Handbook of bacterial adhesion. Principles,
strain were attributed just to phenotypic and not to methods and applications. Totowa, NJ: Humana Press Inc.,
genotypic variations [14]. These authors postulated the 2000. p. 331–43.
possibility of the existence of phenotypic variants due to [5] Cristhensen GD, Simpson WA, Bisno AL, Beachey EH.
modulation of ica genes transcription rather than gene Adherence of slime-producing Staphyloccus epidermidis to smooth
surfaces. Infect Immun 1982;SS:2870–7.
deletion. Phenotypic variant bacteria were uniquely [6] Ammendolia MG, Di Rosa R, Montanaro L, Arciola CR,
evidenced in clinical infection isolates and not in Baldassarri L. Slime production and expression of the slime-
saprophytic isolates, indicating such a variability in a associated antigen by staphylococcal clinical isolates. J Clin
feature which could be typical of pathogenic strains. In Microbiol 1999;37:3235–8.
[7] Rupp ME, Ulphani JS, Fey PD, Bartscht K, Mack D.
this investigation, such variations were observed in 7 out
Characterization of the importance of polysaccharide intercellular
of 65 bacterial isolates, originally resulted to be positive adhesin/hemagglutinin of Staphylococcus epidermidis in the
slime-producer (see Table 1). Under these circumstances pathogenesis of biomaterial-based infection in a mouse foreign
CRA could represent an additional and not alternative body infection model. Infect Immun 1999;67(5):2627–32.
source of information with respect to the genotype [8] Freeman DJ, Falkiner FR, Keane CT. New method for detecting
characterisation of the ica locus achieved by PCR. slime production by coagulase-negative staphylococci. J Clin
Pathol 1989;42:872–4.
The molecular approach should be taken into [9] Mack D, Haeder M, Siemssen N, Laufs R. Association of biofilm
consideration for the rapid and correct diagnosis of production of coagulase-negative staphylococci with expression of
virulent bacteria strains. Even though the PCR techni- a specific polysaccharide intercellular adhesin. J Infect Dis
que could be considered more laborious, time of 1996;174(4):881–4.
execution is shorter with respect to CRA and its [10] Gerke C, Kraft A, Sussmuth R, Schweitzer O, Gotz F.
Characterisation of the N-acetylglucosaminyltransferase activity
particular sensitivity makes unnecessary a day time for involved in the biosynthesis of the Staphylococcus epidermidis
bacterial culture expansion. polysaccharide intercellular adhesin. J Biol Chem 1998;273:
18586–93.
[11] Arciola CR, Collamati S, Donati E, Montanaro L. A rapid PCR-
Acknowledgements method for the detection of slime-producing strains of Staphylo-
coccus epidermidis and Staphylococcus aureus in periprosthesis
infections. Diagn Mol Pathol 2001;10(2):130–7.
This work was supported by Italian Ministry of [12] Arciola CR, Baldassarri L, Montanaro L. Presence of icaA and
Health Grant (reference number SVE 225/2001) ‘‘Patho- icaD genes and slime production in a collection of staphylococcal
genesis and molecular epidemiology of implant-asso- strains from catheter-associated infections. J Clin Microbiol 2001;
ciated infections and strategies of prevention’’. 39(6):2151–6.
[13] Kloos WE, Schleifer KN. Simplified scheme for routine identifi-
The technical assistance of D. Cavedagna and V. cation of human Staphylococcus species. J Clin Microbiol
Pirini is gratefully acknowledged. We are also grateful to 1975;1:82–8.
C. Vescovini for the skilled assistance in preparing the [14] Ziebuhr W, Heilmann C, Gotz . F, Meyer P, Wilms K, Straube E,
manuscript. Hacker J. Detection of the intercellular adhesion gene cluster
(ica) and phase variation in Staphylococcus epidermidis
blood culture strains and mucosal isolates. Inf Immun 1997;65(3):
890–6.
References [15] Arciola CR, Caramazza R, Pizzoferrato A. Related articles in
vitro adhesion of Staphylococcus epidermidis on heparin-surface-
[1] An YH, Friedmann RJ. Concise review of mechanisms of modified intraocular lenses. J Cataract Refract Surg 1994;20(2):
bacterial adhesion to biomaterial surfaces. J Biomed Mater Res 158–61.
1998;43:338–48. [16] Arciola CR, Radin L, Alvergna P, Cenni E, Pizzoferrato A.
[2] Foster TJ, McDevitt D. Molecular basis of adherence of Related articles heparin surface treatment of poly(methylmetha-
staphylococci to biomaterials. In: Bisno AL, Waldvogel FA, crylate) alters adhesion of a Staphylococcus aureus strain:
editors. Infection associated with indwelling medical devices. utility of bacterial fatty acid analysis. Biomaterials 1993;14(15):
Washington: American Society for Microbiology, 1994. p. 31–43. 1161–4.
[3] Mack KD, Bartscht S, Dobinsky MA, Horstkotte H, Kiel K-M, [17] Arciola CR, Montanaro L, Caramazza R, Sassoli V, Cavedagna
Knobloch A, Schafer P. Staphylococcal factors involved in D. Inhibition of bacterial adherence to a high-water-content
adhesion and biofilm formation on biomaterials. In: An YH, polymer by a water-soluble, nonsteroidal, anti-inflammatory
Friedmann RJ, editors. Handbook of bacterial adhesion. Princi- drug. J Biomed Mater Res 1998;42:1–5.

Staphylococcus Epidermidis Ica

Uploaded by

Copyright:

Available Formats

Staphylococcus Epidermidis Ica

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Staphylococcus Epidermidis Ica

Uploaded by

Copyright:

Available Formats

Biomaterials 23 (2002) 4233–4239

Detection of slime production by means of an optimised Congo red

1. Introduction system. The importance of the role played by slime is

Strain no. PCR CRA

icaA/icaD Results 24 h 48 h Results

ATCC35984 +/+ P Very black Very black P

Strain no. PCR CRA

icaA/icaD Results 24 h 48 h Results

61. +/+ P Almost black Almost black WP

Strain no. PCR CRA

IcaA/IcaD Results 24 h 48 h Results

ATCC12228 / NP Very red Very red NP

You might also like