J. Plant Nutr. Soil Sci. 2018, 181, 419–428 DOI: 10.1002/jpln.

201700297 419

Effects of nitrogen forms on carbohydrate metabolism and storage-root

formation of sweet potato
Chengcheng Si1#, Chunyu Shi1*, Hongjuan Liu1#, Xiangdong Zhan1, and Yongchen Liu1
1 State Key Laboratory of Crop Biology, Shandong Key Laboratory of Crop Biology, Agricultural College, Shandong Agricultural University,
61 Daizong Street, Tai’an 271018, China

Abstract
In this study, we examined the effects of different forms of nitrogen (N) fertilizer on carbohydrate
metabolism and storage root formation in sweet potato [Ipomoea batatas L. (Lam.) cv. Shangshu
19 and cv. Jixu 23] in 2015–2016. Two fertilizer treatments, ammonium nitrogen (AN) and amide
nitrogen (XN), were applied at 60 kg ha–1 in a two-factor split-plot design. The effects of nitrogen
form on the morphology of adventitious roots, carbohydrate metabolism in potential storage
roots, and number of storage roots per plant in sweet potato were investigated. The results show
that during the early growth phase, the AN treatment significantly increased the number of
adventitious roots, root tips, root length density, and fresh weight of roots (in pot trials). This treat-
ment also significantly decreased the sucrose concentration of potential storage roots and
increased the activities of cell wall, vacuolar, and cytoplasmic invertases. However, XN-treated
potential storage roots showed a relatively high starch concentration, activities of sucrose syn-
thase and ADP-glucose pyrophosphorylase, and transcription of sporamin genes. At the canopy
closure period, the AN treatment significantly increased the number of storage roots of
0.5–5.0 cm in diameter and decreased the number of those > 5 cm in diameter compared to the
control. The XN treatment induced the opposite effects. In the harvesting period, the AN treat-
ment produced the highest storage root yield and number of storage roots per plant. Thus, in field
trials the AN treatment induced a greater increase in production by increasing the number of
storage roots.

Key words: ammonium nitrogen / amide nitrogen / invertase / Ipomoea batatas (L.) Lam. / starch / sucrose

Accepted March 05, 2018

1 Introduction Starch is the primary storage component in the storage roots

of sweet potato, and its synthesis and accumulation are
The morphogenesis of adventitious roots of sweet potato to necessary for the formation of storage roots (Nakatani and
storage roots is induced by appropriate levels of endogenous Komeichi, 1992; Tsubone et al., 1997; Kim et al., 2002).
sucrose (Tsubone et al., 2000; Eguchi and Yoshida, 2008). Sucrose synthase (SuSy) is of considerable importance for
Sucrose is irreversibly hydrolyzed to glucoses and fructose conversion of sucrose to starch in sweet potato (Liu et al.,
by invertases for further metabolism and biosynthesis. Early 2014). The highest activity of SuSy is observed in initial
studies on corn, carrot, and cotton reported increased activity storage roots, but it is low in fibrous roots, expanding storage
of invertases in meristematic tissues and rapidly growing roots, and harvested storage roots (Tao et al., 2012). ADP-
young tissues and organs compared to other tissues or glucose pyrophosphorylase (AGPase) is a rate-limiting en-
organs. In the early growth phase of corn seedlings, cell-wall zyme for starch synthesis in the storage roots of sweet potato
invertase mediates the production of hexoses that are mainly (Murata and Akazawa, 1968; Nakatani and Komeichi, 1992),
used to maintain cell division (Weber et al., 1997), whereas in and the activity of this enzyme is considered one of the possi-
carrots the formation of taproots is determined by cell-wall ble factors contributing to the development of adventitious
invertase activity (Tang et al., 1999). Vacuolar invertase in roots to storage roots (Fernie et al., 2002).
cotton, potato, and tomato primarily supplies hexoses as a
carbon source to fast-growing tissues, and a high level of Sporamin is the major storage protein in sweet potato storage
vacuolar invertase activity promotes cell elongation (Klann roots, accounting for 60–80% of the total soluble protein in
et al., 1993; Greiner et al., 1999; Kohorn et al., 2006; Ruan sweet potato storage roots (Maeshima et al., 1985). Spora-
et al., 2010). Cytoplasmic invertase mediates the breakdown min is encoded by a multigene family, which is divided into
of sucrose in the cytoplasm and the decomposition products two subfamilies, sporamin A and B, based on nucleotide
are used as respiration substrates to provide energy for other homology (Hattori et al., 1989). Expression of sporamin
metabolic activities in the cell (Pan and Zhang, 2004). In rice, genes is mainly associated with storage roots, with very little
cytoplasmic invertase activity is positively correlated with root expression being observed in stems, and none at all in leaves
cell elongation (Jia et al., 2008). (Hattori et al., 1990). The formation of storage roots in sweet

* Correspondence: C. Shi; e-mail: [email protected]

#Both authors equally contributed to the publication.

ª 2018 The Authors. Journal of Plant Nutrition and Soil Science published by Wiley-VCH Verlag GmbH & Co. KGaA www.plant-soil.com
This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in
any medium, provided the original work is properly cited.
420 Si, Shi, Liu, Zhan, Liu J. Plant Nutr. Soil Sci. 2018, 181, 419–428

potatoes is accompanied by the synthesis Table 1: Climatic growth conditions for sweet potato.
of large amounts of sporamin protein
(Nakamura et al., 1991). Year Month Total rainfall Maximum Minimum Average
(mm) temperature temperature Temperature
Studies have shown that sweet potatoes (°C) (°C) (°C)
show significant differences in their effi- 5 50.29 15.3 8.1 11.8
ciency for utilizing amide and ammonium
nitrogen. Moreover, application of ammo- 6 110.21 19.2 11.9 15.8
nium fertilizers increases the nitrogen (N) 7 179.56 20.6 15.3 18.0
production efficiency and yield of storage 2015
roots (Shi et al., 2010). However, the regu- 8 225.83 19.7 14.5 16.9
latory mechanisms of different N fertilizers 9 26.93 15.7 10.3 13.0
on the number of sweet potato storage
roots have been rarely investigated. 10 22.08 11.7 5.3 8.5

5 71.11 15.0 7.6 11.4

By examining the effects of a gradient of
five N treatments (0, 60, 120, 180, and 6 228.85 19.1 12.7 16.1
–1
240 kg ha ), Chen et al. (2015) found that 7 546.37 20.8 16.2 18.5
N applied at a rate of 60 kg ha–1 produced 2016
8 441.44 20.8 16.0 18.3
the highest yield of storage roots of sweet
potato and enhanced the soluble sugar 9 34.55 17.9 11.6 14.7
concentration and starch quality of these
10 129.28 11.0 5.0 8.0
roots. In the present study, using an N ferti-
–1
lizer level of 60 kg ha , we chose two
sweet potato cultivars with significantly dif-
ferent numbers of storage roots to examine the effects of dif- total and available N, P, and K concentrations were 1.23,
ferent N forms on the growth of sweet potato adventitious 87.65, 16.00, and 77.80 mg kg–1 dry soil, respectively. In
roots, carbohydrate metabolism during the differentiation of 2016, the organic matter concentration was 1.7%, and the
young roots into storage roots, and storage-root formation. total and available N, P, and K concentrations were 1.20,
The primary aim of the study was to elucidate the regulatory 83.67, 18.83, and 76.56 mg kg–1 dry soil, respectively.
effect of ammonium and amide N on the number of storage
roots and the mechanism of this regulatory effect to provide
theoretical support for designing a cultivation program that
promotes the formation of storage roots and improves yield. 2.2 Field experiments
This study employed a two-factor split-plot design, with S19
2 Material and methods and J23 being assigned to the main plot and the different N
treatments assigned to subplots. The fertilizers used were
ammonium sulfate (21% N), urea (46% N), and potassium
2.1 Plant material and growth conditions sulfate (K2O 50%) provided by Sinofert Holdings Limited
Two cultivars of sweet potato [Ipomoea batatas (L.) Lam. cv. (Beijing, China). Three different fertilizer treatments were
Shangshu 19 (S19) and cv. Jixu 23 (J23)] were used in this used: 60 kg ha–1 as ammonium nitrogen (AN), 60 kg ha–1 as
study. The number of storage roots formed by S19 is signifi- amide nitrogen (XN), and no nitrogen fertilizer (N0). The
cantly higher than that formed by J23 (Wang et al., 2016). fertilizers were applied at the base of each row to reduce nitri-
Both cultivars are routinely grown in China. Plant cuttings fication of the AN fertilizer. Potassium fertilizer at a level of
(slips), approximately 25 cm in length, were cut from sprout- 197 kg K ha–1 was applied in all treatments. Sulfur powder
ing storage roots. Three unfolding leaves (the third, fourth, was applied to ensure that all the treatments had the same
and fifth leaf from the apex) were retained on the cuttings and sulfur levels. The six treatment groups, each in quadruplicate,
all other leaves were excised. All terminal and axillary buds were randomly allocated to different subplots. Each subplot
were also removed. had an area of 16 m2, with a row spacing of 0.8 m. The slips
were spaced at 0.25 m and planted at a depth of approxi-
The experiments were conducted from May 2015 to October mately 0.10 m in soil beds. In 2015, the slips were planted on
2016 at the Tai’an Experimental Station of Shandong May 15 and storage roots were harvested on October 22 of
Agricultural University, Tai’an, China (360°09¢N, 117°09¢E; the same year, whereas in 2016, the slips were planted on
128 m asl). Climate data for the two growth seasons were May 12 and the roots were harvested on October 24.
provided by the China Meteorological Data Service Center
(http://data.cma.cn/en), the details of which are shown in
Tab. 1. The two-year experiments were conducted in the
2.3 Pot experiment
same field. The soil type of this field is a sandy loam with a In 2015, a pot experiment was conducted simultaneously as
clay content of 48.3%. In 2015, the organic matter concentra- an auxiliary test for field experiments to study the root charac-
tion in the 0–20 cm soil layer of the field was 1.4%, and the teristics of sweet potato at the early stage of growth. Plastic

ª 2018 The Authors. Journal of Plant Nutrition and Soil Science published by Wiley-VCH Verlag GmbH & Co. KGaA www.plant-soil.com
J. Plant Nutr. Soil Sci. 2018, 181, 419–428 Nitrogen forms and carbohydrate metabolism 421

pots of 0.25 m height with an upper and lower inner diameter 10-mL centrifuge tube and mixed with 5 mL 80% ethanol. The
of 0.23 m and 0.20 m, respectively, were used. Each plastic mixture was incubated in a water bath shaker at 80°C for
pot was filled with 10 kg of plow-layer soil from the field, and 30 min and then centrifuged at 4000 g for 5 min. The extrac-
the pots were buried flush with the soil surface. Each plastic tion of pellets was repeated additional two times using 80%
pot was planted with two slips, but 7 d after planting, one ethanol. The three supernatants were combined and diluted
plant was removed from each pot to ensure that all plants in to 25 mL with 80% ethanol, mixed, and stored at –20°C.
each treatment grew regularly and evenly. For each treat- Sucrose levels were assayed in the resuspended supernatant
ment, 20 pots were prepared, and the treatments and condi- according to previously described protocols (Hendrix, 1993).
tions of the pot experiment were consistent with those in the The ethanol-insoluble residue was used for starch extraction.
field. Before extraction, ethanol was removed through evaporation.
To release the starch from the residue, tubes with the residue
and added 2 mL distilled water were placed in a boiling bath
2.4 Sampling for 15 min and then cooled to room temperature. Root starch
In 2015, 15 d and 30 d after planting, the pots were dug out of was hydrolyzed with 9.2 mM HClO4 (2 mL) for 15 min. Dis-
the ground, the soil was carefully washed away with water tilled water (4 mL) was added to the samples, which were
from selected pots, and the whole roots were collected for then centrifuged at 3,000 g for 10 min. The residue was
analysis of root characteristics. In 2016, the samples were extracted once more using 4.6 mM HClO4 (2 mL). The super-
collected 14, 21, 28, and 35 d after planting. For each plant, natants were retained, combined, and their volume was
the thickest 3–4 roots, namely potential storage roots, were adjusted with distilled water to 25 mL. Starch concentration
selected, cut to approximately 1-cm segments, and uniformly was measured spectrophotometrically at 620 nm using an
mixed. All of the segments were rapidly frozen with liquid anthrone reagent (Seifter et al., 1950). Glucose was used as
nitrogen and stored at –80°C for later enzymatic activity the standard.
measurements. The remainder of the segments was placed
in paper bags, blanched at 105°C, dried at 60°C, ground to 2.7 Enzyme activity determination
powder, and stored in a desiccator prior to quantitation of The roots collected in 2016 that were frozen in liquid nitrogen
sucrose and starch concentrations. and stored at –80°C were used for enzyme activity assays.

At the canopy closure period (45 d after planting) in 2015 and 2.7.1 Invertase activity assay
2016, five plants were selected to analyze the number of
young storage roots (diameter 0.5–1.0 cm), developing stor- Extraction of invertase and determination of its activity were
age roots (diameter 1.0–5.0 cm), and mature storage roots performed as described by Tang et al. (1999) with modifica-
(diameter > 5.0 cm; Tanaka et al., 2008; Noh et al., 2012), tions. Root samples (0.3–0.4 g fresh mass) were ground in
and to determine the mean fresh weight of the mature sweet liquid nitrogen to a fine powder with a precooled mortar and
potatoes. At harvest, roots that were greater than 1.0 cm in pestle and carefully mixed with 5 mL ice-cold 25 mM sodium
diameter were selected as storage roots. The number of acetate buffer (pH 5.0) containing 0.5% b-mercaptoethanol,
storage roots per plant was counted and the fresh weight of a 10 mM lysine, 1 mM EDTA, and 0.1 mM phenylmethanesul-
single storage root was weighed. The total number of storage fonyl fluoride. The homogenates were centrifuged at 10,000 g
roots in each subplot was also counted. at 4°C for 30 min in a cooled centrifuge (model 3K30; Sigma
Laborzentrifugen GmbH, Osterode, Germany), and the super-
natants were used to determine the activities of acid-soluble
2.5 Root parameters invertase (EC 3.2.1.26) and neutral/alkaline invertase
(EC 3.2.1.27). The pellets were washed with 5 mL ice-cold
The number of adventitious roots was counted manually and redistilled water, centrifuged at 10,000 g at 4°C for 30 min,
root diameter was measured using a Vernier caliper. Measure- and the supernatants were discarded. This process was
ments of the length of roots and root tips were performed as repeated three times. Cell-wall proteins were extracted from
described by Iglesias-Dı́az et al. (2009) with modifications. The the resulting pellets with 5 mL 1 M NaCl overnight at 4°C. The
software used to analyze root length and number of root tips extracts were centrifuged at 10,000 g for 20 min, and the
was Delta-T Scan (Delta-T Devices Ltd., Cambridge, UK), supernatants were used to determine the activity of cell wall-
which was installed in a computer coupled to a flatbed scanner binding invertase (EC 3.2.1.26). Invertase activity was
(HP ScanJet 8200; HewletPackard Co., USA). The scanner, assayed in a reaction system consisting of: 50 mM sucrose,
which has a resolution of 300 dpi, was used to scan the whole 13.5 mM citric acid, and 26.5 mM disodium phosphate
washed roots of each plant. The black and white threshold was (pH 4.6) for cell-wall invertase; 50 mM sucrose, 10.5 mM citric
used for root recognition. To set the threshold, an object of acid, and 29 mM disodium phosphate (pH 5.4) for soluble
known width and length was scanned with the root sample. acid invertase; and 50 mM sucrose, 10.5 mM citric acid, and
The threshold used was 35. Root length density was defined 29 mM disodium phosphate (pH 7.5) for neutral/alkaline inver-
as the length of the roots within a unit volume of soil. tase. The reaction was initiated by adding 100 mL enzyme
extract. The total volume of the assay system was 0.5 mL. In
control assays, sucrose was omitted. The assay mixture was
2.6 Sucrose and starch determination
incubated at 37°C for 30 min. The reaction was stopped by
Dried root tissue was ground and filtered through a 1-mm adding 1 mL alkaline copper reagent (boiled at 100°C for
sieve. The powdered material (0.1 g) was placed into a 10 min) and the liberated reducing sugars were determined

ª 2018 The Authors. Journal of Plant Nutrition and Soil Science published by Wiley-VCH Verlag GmbH & Co. KGaA www.plant-soil.com
422 Si, Shi, Liu, Zhan, Liu J. Plant Nutr. Soil Sci. 2018, 181, 419–428

using the Nelson–Somogyi reagent system (Somogyi, 1952). China) from potential storage roots under normal conditions
Glucose was used as the standard for these reactions. during the storage root formation stage (14 and 28 d after
Enzyme activities were quantified spectrophotometrically at planting). The qRT-PCR was performed in a 25 mL reaction
660 nm using a UV-vis spectrophotometer (model UV-9100, volume containing 2X TransStart Top Green q-PCR SuperMix
Ruili Co., Beijing, China). Proteins in the extracts were meas- (TransGen BioteCh, Beijing, China). Quantitative analysis
ured as described by Bradford (1976) with bovine serum was conducted using the Bio-Rad CFX Manager system
albumin as a standard. Invertase activity was expressed as (Hercules, CA, USA). This method normalizes the expression
the amount of reducing sugars produced from sucrose per of a specific gene against a control with the formula 2–44CT.
minute. The mRNA levels of the stably expressed gene actin
were used as a control gene for the qRT-PCR analyses.
Genetic data from the qRT-PCR experiments are listed in
2.7.2 Sucrose synthase (SuSy) activity assay Tab. 2.
Extraction of SuSy (EC 2.4.1.13) and determination of its
activity were performed as described by Zhao et al. (2013)
and Zhang et al. (2012) with modifications. A reaction
2.9 Statistical analysis
medium composed of 50 mM MOPS-NaOH (pH 7.5), The analysis was carried out according to a completely
10 mM MgSO2, 10 mM fructose, 10 mM fructose, and 5 mM randomized design with three replications. For significant
uridine 5¢-diphosphate glucose was used. The assay was values, means were separated by the least significant differ-
performed by mixing 0.15 mL of the reaction medium with ence (LSD) test at P £ 5% using IBM SPSS Statistics 24.0
0.2 mL of enzyme sample. After incubation of the mixture at (IBM, Armonk, NY, USA). The figures were designed with
37°C for 30 min, the reaction was stopped by adding 0.1 mL SigmaPlot software (SigmaPlot 12.5, Systat Software, San
30% (w/v) NaOH and placing the sample in boiling water for Jose, CA, USA).
5 min. When cooled to room temperature, 0.5 mL resorcinol
solution (12% v/v) and 0.5 mL 12 mM HCl were added to the
mixture, which was then incubated in a water bath at 80°C for 3 Results
10 min. Blank controls were obtained by adding sterile water
in place of the HCl to the reaction medium containing resor- 3.1 Effects of nitrogen forms on yield
cinol. Enzyme activities were quantified spectrophotometri-
cally at 480 nm using a UV-vis spectrophotometer (model During the 2-year experiment, the AN treatment consistently
UV-9100, Ruili, China). produced the highest yield of storage roots, with an increase
of 5.6–9.6% compared to the control (N0) group. The XN
treatment generated a similar yield as the control. The AN
2.7.3 ADP-glucose pyrophosphorylase (AGPase) treatment also produced the highest number of storage roots
activity assay per plant, with an increase of 8.3–37.5% compared to the
control. However, the mean weight of storage roots was
AGPase (EC 2.7.7.27) was extracted as described by Kerr
smaller compared to that in the control (Tab. 3).
et al. (1984) with some modifications. Roots (0.2 g) were
ground with a pre-cooled mortar and pestle in 1.5 mL of
extract buffer containing 50 mM HEPES-NaOH (pH 7.5),
5 mM MgCl2, 1 mM EDTA, 2 mM reduced glutathione, 2% Table 2: Primer sequences.
(w/v) polyethylene glycol-20000 (PEG-20), 1% (w/v) bovine
serum albumin, 0.4% (v/v) Triton X-100, and 5% (w/v) insolu- Primers Sequence
ble polyvinylpolypyrrolidone (PVPP). The extract was then
centrifuged at 13,000 g for 5 min in an Eppendorf microcen- b-Actin-F AGCAGCATGAAGATTAAGGTTGTAGCAC
trifuge (Hamburg, Germany), and the supernatant was used b-Actin-R TGGAAAATTAGAAGCACTTCCTGTGAAC
immediately for AGPase activity measurement. Enzyme
activity was assayed by measuring pyrophosphate (PPi)-de- SporaminA1-F TCGTATCCCCCAACGACTTA
pendent glucose-1-phosphate formation using a continuous SporaminA1-R GATTCCCCAGTTCACGTTGT
spectrophotometric assay. The assay mixture (1 mL) con-
tained 50 mM HEPES-KOH (pH 8.0), 1 mM adenosine 5¢-di- SporaminA2-F CTTTCAGGAAATACTGCCCG
phosphoglucose, 5 mM MgCl2, 0.6 mM NAD, 1.5 mM PPi, SporaminA2-R TCCCCCAACGACTTAGACAAC
3 mM phosphoglycerate, 2 units G6P dehydrogenase
SporaminB1-F AACACGAAGGGAGTATTACTGAGAG
(EC1.1.1.49, NAD-linked, from Leuconostoc mesenteroides),
2 units phosphoglucomutase, and 20 mL of extract. The reac- SsporaminB1-R CGACAATAGCAACCAGTTCAAGA
tion was initiated by adding PPi.
SporaminB2-F GTAAACTGGGGGATCAAGCA

SporaminB2-R GCCAACGTTGAAGCATTTCT
2.8 Quantitative reverse transcription PCR
(qRT-PCR) analysis
Total RNA was isolated according to the manufacturer’s pro-
tocol using an RNAprep Pure Plant Kit (TianGen, Beijing,

ª 2018 The Authors. Journal of Plant Nutrition and Soil Science published by Wiley-VCH Verlag GmbH & Co. KGaA www.plant-soil.com
J. Plant Nutr. Soil Sci. 2018, 181, 419–428 Nitrogen forms and carbohydrate metabolism 423

Table 3: Effect of nitrogen forms on the fresh yield of storage root and yield traits in field trials.a

Year Cultivar Treatment Storage root Average fresh Yield Storage root Yield increment
number per weight of (kg ha–1) number (%)
plant storage root increment
(g) (%)

N0 4.0 b 180.79 b 40677.1 b 0.0 0.0

S19 AN 4.3 a 176.34 b 42949.2 a 8.3 5.6

XN 4.0 b 176.06 b 39910.7 b 0.8 –1.9

2015
N0 2.9d 190.12 a 30671.4d 0.0 0.0

J23 AN 3.3c 175.32 b 32890.3c 16.4 7.2

XN 2.9d 185.58 ab 30227.3d 1.1 –1.5

N0 4.0 b 211.56 b 46709.2 b 0.0 0.00

S19 AN 4.5 a 197.22 c 49635.60 a 10.6 6.3

XN 4.1 b 210.74 b 47076.8 ab 1.5 0.8

2016
N0 2.7 d 246.31 a 36992.2 d 0.0 0.0

J23 AN 3.7 c 196.36c 40535.7 c 37.5 9.58

XN 2.7 d 247.14 a 37395.8 d 0.8 1.2

aNote: yield increment compared to N0 treatment.

3.2 Effects of nitrogen forms on the characteristics ment produced a similar number of storage roots of 0.5–1.0 cm
of storage roots during the canopy closure in diameter as observed in the control group, but had a signifi-
period cantly smaller number of storage roots of 1–5 cm in diameter
and a significantly higher number of storage roots with a
Compared to the control, the AN treatment significantly diameter > 5 cm. These observations indicate that the AN treat-
increased the number of storage roots of 0.5–5.0 cm in ment delayed the expansion of storage roots and was condu-
diameter. However, the number of storage roots with a cive in increasing the number of these roots (Tab. 4).
diameter > 5 cm was significantly decreased. The XN treat-

Table 4: Effect of nitrogen forms on the number of he storage roots, storage-root fresh weight per plant, and the compositional features at
canopy closure period.

Year Cultivar Treatment Average fresh Storage root Young Developingstorage Maturestorage
weight of number per storage root root number per root number
storage root plant number per plant per plant
(g) plant (1–5 cm) (> 5 cm)
(0.5–1.0 cm)

N0 72.44 d 5.7 b 1.7 b 2.4 b 1.6 d

S19 AN 78.29 c 6.2 a 2.3 a 3.1 a 0.8 e

XN 71.44 d 5.7 b 1.7 b 2.2 c 1.9 c

2015
N0 81.85 b 4.6 d 0.63 d 1.6 e 2.4 b

J23 AN 95.79 a 5.0 c 1.0 c 2.0 d 2.0 c

XN 83.04 b 4.54 d 0.7 d 1.2 f 2.7 a

N0 85.85 c 6.7 b 2.3 b 3.4 b 1.0 c

S19 AN 93.65 b 8.3 a 4.0 a 3.7 a 0.7 d

XN 85.23 c 6.6 b 2.3 b 3.0 c 1.3 b

2016
N0 92.96 b 4.3 b 1.0 d 2.0 d 1.3 b

J23 AN 97.63 a 5.5 c 2.0 c 3.0 c 0.5 e

XN 92.53 b 4.4 b 1.0 d 1.7 e 1.7 a

ª 2018 The Authors. Journal of Plant Nutrition and Soil Science published by Wiley-VCH Verlag GmbH & Co. KGaA www.plant-soil.com
424 Si, Shi, Liu, Zhan, Liu J. Plant Nutr. Soil Sci. 2018, 181, 419–428

3.3 Effects of nitrogen forms on adventitious root in sucrose content compared to that in the XN treatment. The
development AN treatment produced sweet potatoes with a starch content
similar to that of the control, whereas the XN treatment
The S19 plants had a greater number of root tips and adventi- resulted in a significantly higher starch content (Tab. 6).
tious roots and a greater root length density of adventitious
roots compared to the J23 plants. The number of adventitious
3.5 Effects of nitrogen forms on invertase activity
roots of S19 had increased by 18.4–29.9% 30 d after planting
compared to that at 15 d after planting. In contrast, the During the differentiation of young roots to storage roots, the
increase in number of adventitious roots of J23 for the same activities of the three invertases showed a similar trend, with
period was only 7.5–16.0%. The effects of different nitrogen activities initially increasing and subsequently decreasing.
forms on adventitious root development were similar for both The activities of cell-wall invertase and cytoplasmic invertase
cultivars. Thus, fresh root weight,
number of root tips, number of ad-
Table 6: Effect of nitrogen forms on sucrose and starch concentrations in potential storage roots
ventitious roots, and root length in the 2016 field trial during early stages.
density were all significantly higher
in the AN treatment than in the XN
Days after Cultivar Treatment Contents of Contents
treatment and were significantly
planting sucrose of starch
greater in the XN treatment than in (mg g–1 DW) (mg g–1 DW)
the control. As indicated by these
findings, the AN treatment was N0 30.30 a 100.8 c
more efficient than the XN treatment AN 25.01 b 104.14 c
S19
or the control in promoting the
growth of sweet potato roots XN 29.14 a 111.93 b
(Tab. 5). 14 d
N0 30.08 a 119.29 b

J23 AN 22.08 c 115.42 b

3.4 Effects of nitrogen forms XN 26.29 b 143.27 a
on sucrose and starch
concentration N0 38.43 b 226.66 c

S19 AN 30.75 c 231.31c

During the early period of sweet
potato growth, the two different XN 37.83 b 277.49 a
nitrogen treatments decreased the 28 d
N0 47.99 a 250.09 b
sucrose content in both sweet pota-
to cultivars compared with that in J23 AN 31.48 c 255.23 b
the control. Moreover, the AN treat-
XN 37.24 b 285.04 a
ment resulted in a marked decrease

Table 5: Effect of nitrogen forms on root characteristics in the 2015 pot trial at early growth stage.

Days after planting Cultivar Treatment Average fresh Root tip Adventitious root Root length
weight of root number number per plant density
(g) per plant (mm cm–3)

N0 5.83 d 578.7 d 42.3 b 66.54 c

S19 AN 9.63 b 815.3 a 49.0 a 92.00 a

XN 7.62 c 720.0 c 43.0 b 72.53 b

15 d
N0 8.03 c 454.5 e 25.0 d 46.25 e

J23 AN 13.96 a 778.0 ab 29.0 c 69.82 bc

XN 10.61 b 700.0 c 26.5 d 59.33 d

N0 22.63 c 982.0 c 55.0 b 85.32 c

S19 AN 28.36 a 1204.5 a 58.0 a 101.00 a

XN 25.95 b 1106.0 b 54.00 b 99.77 b

30 d
N0 16.76 e 915.5 cd 29.0 d 53.16 f

J23 AN 22.67 c 1195.5 b 32.0 c 66.54 d

XN 19.75 d 973.5 c 28.5 d 60.76 e

ª 2018 The Authors. Journal of Plant Nutrition and Soil Science published by Wiley-VCH Verlag GmbH & Co. KGaA www.plant-soil.com
J. Plant Nutr. Soil Sci. 2018, 181, 419–428 Nitrogen forms and carbohydrate metabolism 425

reached their highest values 28 d after

planting, whereas that of vacuolar invertase
peaked 21 d after planting. In the AN treat-
ment, increases in the activities of the three
invertases were relatively large compared
to those in the control. In contrast, the XN
treatment had no significant effect on inver-
tase activities or the increase in invertase
activity was less than that in the AN treat-
ment (Fig. 1).

3.6 Effects of nitrogen forms

on sucrose synthase
and ADP-glucose
pyrophosphorylase activity
The activity of SuSy in the two sweet potato
cultivars followed a similar trend, namely,
an initial decrease in activity followed by an
increase. In particular, the lowest SuSy
activity was observed 21 d and 28 d after
planting of J23 and S19, respectively. SuSy
activity in the AN treatment was similar to
that in the control, but was increased sig-
nificantly in the XN treatment. During the
differentiation of young roots to storage
roots in both sweet potato cultivars, the
AGPase activity followed a similar trend to
that observed for SuSy (a decrease fol-
lowed by an increase), and the effects of Figure 1: Activities of invertases in potential storage roots during storage root formation
different N forms on its activity were also in the 2016 field trial; CW-Inv = cell-wall invertase, V-Inv = vacuolar invertase, C-Inv =
cytoplasmic invertase. Error bars represent standard deviation (n = 3).
similar to those detected for SuSy activity
(Fig. 2).

3.7 Effects of nitrogen forms on

the transcription of sporamin
genes
In both cultivars, the transcription levels
of sporamin A1, sporamin A2, sporamin
B1, and sporamin B2 increased with
the development of sweet potato roots.
The XN treatment significantly in-
creased the transcription of sporamin
A1 and sporamin A2 from 14 d after
planting onwards to the control. The AN
treatment induced an increase in their
transcription starting from 21 d after
planting, although the increase was
smaller than that observed in the XN
treatment. Both treatments significantly
increased the transcription of sporamin
B1 and sporamin B2 compared to that
in the control, with the XN treatment
having a larger effect than the AN treat- Figure 2: SuSy (sucrose synthase) and AGPase (ADP-glucose pyrophosphorylase) activities
ment (Fig. 3). in potential storage root during storage root formation in the 2016 field trial. Error bars rep-
resent standard deviation (n = 3).

ª 2018 The Authors. Journal of Plant Nutrition and Soil Science published by Wiley-VCH Verlag GmbH & Co. KGaA www.plant-soil.com
426 Si, Shi, Liu, Zhan, Liu J. Plant Nutr. Soil Sci. 2018, 181, 419–428

using optimal N levels that produce the

highest yield (data not presented). The
results show that the two different types of
N fertilizers had different regulatory effects
on the growth of adventitious roots and the
formation of storage roots of sweet potato.
In the early growth stage (pot experiment,
the first 30 d after planting), both AN and
XN fertilizers significantly increased the
number of root tips and adventitious roots,
the root length density, and the fresh weight
of roots, although the increase was greater
in AN treatments than in XN treatments
(Tab. 5). At the canopy closure period (field
experiment, 45 d after planting), the AN
treatment significantly increased the num-
ber of storage roots with a diameter of
0.5–5.0 cm and significantly decreased the
number of storage roots with a diameter
> 5 cm, whereas the XN treatment signifi-
cantly decreased the number of storage
roots of 1.0–5.0 cm in diameter and signifi-
cantly increased the number of storage
roots with a diameter > 5 cm (Tab. 4). At
maturity, the AN treatment led to a signifi-
cant increase in yield and in the number of
storage roots per plant (Tab. 3). These
results indicate that the AN treatment
increased the number of storage roots by
promoting the growth of adventitious roots
and delaying the expansion of storage
roots.

4.2 Effects of nitrogen forms on

carbohydrate metabolism and
differentiation of storage root
number
Studies on corn, rice, carrot, cotton, potato,
and tomato have shown that hexoses pro-
duced by the activity of cell-wall invertase
are primarily used to maintain cell division,
Figure 3: Relative gene transcription levels of sporamin in potential storage roots during and that they have little effect on the
storage root formation in the 2016 field trial. Error bars represent standard deviation synthesis of starch (Weber et al., 1997).
(n = 3). Formation of taproots is influenced by the
level of cell-wall invertase activity (Tang
et al., 1999), and high cytoplasmic inver-
4 Discussion tase activity facilitates root cell elongation (Jia et al., 2008).
Vacuolar invertase primarily provides hexoses as a carbon
4.1 Effects of nitrogen forms on adventitious root source for the rapidly growing tissues, and high vacuolar in-
vertase activity facilitates cell elongation (Klann et al., 1993;
development and the number of storage roots
Greiner et al., 1999; Kohorn et al., 2006; Ruan et al., 2010).
Under N deficiency conditions, sweet potatoes produce a The present study shows that the activities of these three in-
small number of thin roots and have difficulties in forming stor- vertases during the differentiation of young roots to storage
age roots (Villordon et al., 2012). By contrast, an excess of roots were higher in S19 than in J23 (Fig. 1). Treatment with
nitrogen inhibits the activity of the adventitious root cambium AN significantly increased the activities of all three invertases
and causes lignification of central cells, suppressing the for- (Fig. 1) and decreased the sucrose concentration (Tab. 6).
mation of storage roots (Togari, 1950; Wilson, 1973; Bourke, These findings indicate that during the differentiation of young
1985; Gifford et al., 2008). The present study was conducted roots to storage roots, the AN treatment promoted the break-

ª 2018 The Authors. Journal of Plant Nutrition and Soil Science published by Wiley-VCH Verlag GmbH & Co. KGaA www.plant-soil.com
J. Plant Nutr. Soil Sci. 2018, 181, 419–428 Nitrogen forms and carbohydrate metabolism 427

down of sucrose into hexoses by increasing the activities of dong Agriculture Innovation team (SDAIT-16-01), and the
invertases and provided the substrates and energy necessary Natural Science Foundation of Shandong Province
for cell division, which eventually increased the number of (ZR2014CQ040). The translation services were provided by
storage roots. Accdon.

Starch is the main storage compound in sweet potato storage

roots, and the formation of storage roots involves both the ac- References
cumulation of starch and the proliferation of cells (Kim et al., Bradford, M. M. (1976): A rapid and sensitive method for the quanti-
2002). High SuSy and AGPase activities are conducive to the tation of microgram quantities of protein utilizing the principle of
synthesis of starch (Nakatani and Komeichi, 1992). The re- protein-dye binging. Anal. Biochem. 72, 248–254.
sults of the present study show that during the differentiation Bourke, R. M. (1985): Influence of nitrogen and potassium fertilizer
of young sweet potato roots to storage roots, the AN treat- on growth of sweet potato (Ipomoea batatas) in Papua New
ment did not induce a significant change in starch concentra- Guinea. Field Crop. Res. 12, 363–375.
tion (Tab. 6), SuSy activity, or AGPase activity in either of the Chen, X.- G., Ding, Y.-F., Tang, Z.-H., Wei, M., Shi, X.-M.,
two tested cultivars compared to those in the control (Fig. 2). Zhang, A.-J., Li, H.-M. (2015): Suitable nitrogen rate for storage
However, these parameters were significantly increased after root yield and quality of sweet potato. J. Plant Nutr. Fertil. 21,
the XN treatment (Tab. 6, Fig. 2). These findings show that 979–986.
during differentiation, over-accumulation of starch due to XN Eguchi, T., Yoshida, S. (2008): Effects of application of sucrose and
treatment would prevent the formation of more storage roots. cytokinin to roots on the formation of tuberous roots in sweet potato
(Ipomoea batatas (L.) Lam.). Plant Root 2, 7–13.
Fernie, A. R., Willmitzer, L., Trethewey, R. N. (2002): Sucrose to
4.3 Effects of nitrogen forms on the expression of starch: a transition in molecular plant physiology. Trends Plant Sci.
sporamin genes and differentiation of storage 7, 35–41.
roots Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M.,
Birnbaum, K. D. (2008): Cell-specific nitrogen responses mediate
Concomitant with the development of sweet potato storage
developmental plasticity. P. Natl. Acad. Sci. USA 105, 803–808.
roots, there is a large increase in the synthesis of sporamin,
which in turn is positively correlated with starch concentration Greiner, S., Rausch, T., Sonnewald, U., Herbers, K. (1999): Ectopic
expression of a tobacco invertase inhibitor homolog prevents cold-
(Nakamura et al., 1991). The present study shows that during
induced sweetening of potato tubers. Nat. Biotechnol. 17,
the differentiation of young roots into storage roots, the
708–711.
AN treatment significantly delayed the transcription of
Hattori, T., Nakagawa, S., Nakamura, K. (1990): High-level
sporamin A. Moreover, increases in the transcription levels of
expression of tuberous root storage protein genes of sweet potato
sporamin A and sporamin B in the AN treatment were smaller
in stems of plantlets grown in in vitro on sucrose medium. Plant
compared to those in the XN treatment (Fig. 3). These results Mol. Biol. 14, 595–604.
indicate that during the differentiation of young roots into
Hattori, T., Yoshida, N., Nakamura, K. (1989): Structural relationship
storage roots, high levels of sporamin gene expression could
among the members of multigene family coding for the sweet
prevent the formation of storage roots, and that the AN treat- potato tuberous roots storage proteins. Plant Mol. Biol. 13,
ment delayed and decreased sporamin gene transcription, 563–572.
thereby promoting the formation of a greater number of
Hendrix, D. L. (1993): Rapid extraction and analysis of nonstructural
storage roots. carbohydrates in plant tissues. Crop Sci. 33, 1306–1311.
Iglesias-Dı́az, M. I., Lamosa, S., Rodil, C., Iglesias-Dı́az, M. I.,
Lamosa, S., Rodil, C., Dı́az-Rodrı́guez, F. (2009): Root develop-
5 Conclusions
ment of Thuja plicata in peat-substitute rooting media. Sci. Hortic.
Compared to the XN treatment, the AN treatment induced a 122, 102–108.
greater increase in sweet potato yield by increasing the num- Jia, L., Zhang, B., Mao, C., Li, J., Wu, Y., Wu, P., Wu, Z. (2008):
ber of storage roots. The AN treatment increased the activ- OsCYT-INV1 for alkaline/neutral invertase is involved in root cell
ities of invertases in potential storage roots, promoting the development and reproductivity in rice (Oryza sativa, L.). Planta
decomposition of sucrose. This decomposition provides more 228, 51–59.
hexoses as necessary substrates and energy substrates for Kerr, P. S., Huber, S. C., Israel, D. W. (1984): Effect of N-source on
the formation of storage roots. Moreover, the AN treatment soybean leaf sucrose phosphate synthase, starch formation, and
reduced the conversion of sucrose to starch and presumably whole plant growth. Plant Physiol. 75, 483–488.
decreased the accumulation of the protein sporamin. Thus, Kim, S. H., Mizuno, K., Sawada, S., Fujimura, T. (2002): Regulation
the AN treatment can prolong the time needed for differentia- of tuber formation and ADP-glucose pyrophosphorylase (AGPase)
tion of young roots to storage roots and may delay the initia- in sweet potato (Ipomoea batatas (L.) Lam.) by nitrate. Plant
tion of storage root expansion to increase the number of Growth Regul. 37, 207–213.
storage roots per plant. Klann, E. M., Chetelat, R. T., Bennett, A. B. (1993): Expression of
acid invertase gene controls sugar composition in tomato (Lyco-
persicon) fruit. Plant Physiol. 103, 863–870.
Acknowledgments Kohorn, B. D., Kobayashi, M., Johansen, S., Riese, J., Huang, L.-F.,
Koch, K., Fu, S., Dotson, D., Byers, N. (2006): An Arabidopsis cell
This work was funded by a grant from the National Nature wall-associated kinase required for invertase activity and cell
Science Foundation of China (NSFC; 31371577), the Shan- growth. Plant J. 46, 307–316.

ª 2018 The Authors. Journal of Plant Nutrition and Soil Science published by Wiley-VCH Verlag GmbH & Co. KGaA www.plant-soil.com
428 Si, Shi, Liu, Zhan, Liu J. Plant Nutr. Soil Sci. 2018, 181, 419–428

Liu, H.-J., Yao, H.-L., Shi, C.-Y., Zhang, L.-M. (2014): Effect of potas- [Ipomoea batatas (L.) Lam.]. PloS one 7. DOI: 10.1371/journal.
sium application time on starch accumulation and related enzyme pone.0036234.
activities of sweet potato variety Jixu 23. Sci. Agric. Sin. 1, 43–52. Tang, G. Q., Lüscher, M., Sturm, A. (1999): Antisense repression of
Maeshima, M., Sasaki, T., Asahi, T. (1985): Characterization of major vacuolar and cell wall invertase in transgenic carrot alters early
proteins in sweet potato tuberous roots. Phytochemistry 24, plant development and sucrose partitioning. Plant Cell 11,
1899–1902. 177–189.
Murata, T., Akazawa, T. (1968): Enzymic mechanism of starch Togari, Y. (1950): A study of tuberous root formation in sweet potato.
synthesis in sweet potato roots: I. requirement of potassium ions Bull. Natl. Agric. Exp. Stn. 68, 1–96.
for starch synthetase. Arch. Biochem. Biophys. 126, 873–879. Tsubone, M., Kubota, F., Saitou, K., Kadowaki, M. (2000):
Nakatani, M., Komeichi, M. (1992): Changes in endogenous indole Enhancement of tuberous root production and Adenosine
acetic acid level during development of roots in sweet potato. Jap. 5¢-Diphosphate Pyrophosphorylase (AGPase) activity in sweet
J. Crop Sci. 61, 683–684. potato (Ipomoea batatas Lam.) by exogenous injection of sucrose
Nakamura, K., Ohto, M. A., Yoshida, N., Nakamura, K. (1991): solution. J. Agron. Crop Sci. 184, 181–186.
Sucrose-induced accumulation of b-amylase occurs concomitant Tsubone, M., Kubota, F., Saitou, K. (1997): Effect of grafting on the
with the accumulation of starch and sporamin in leaf-petiole activity of adenosine 5¢-diphosphate glucose pyrophosphorylase
cuttings of sweet potato. Plant Physiol. 96, 902–909. and tuberous root production in sweet potato (Ipomoea batatas
Noh, S. A., Lee, H. S., Kim, Y. S., Noh, S. A., Lee, H. S., Kim, Y. S., Lam.). J. Agron. Crop. Sci. 66, 509–510.
Paek, K. H., Shin, J. S., Bae, J. M. (2012): Down-regulation of the Villordon, A., LaBonte, D., Solis, J., Firon, N. (2012): Characterization
IbEXP1 gene enhanced storage root development in sweet potato. of lateral root development at the onset of storage root initiation in
J. Exp. Bot. 64, 129–142. ‘Beauregard’ sweet potato adventitious roots. HortSci. 47,
Pan, Q.-H., Zhang, D.-P. (2004): Isoforms, characteristics and roles 961–968.
of plant invertases. Plant Physiol. Commun. 40, 275–280. Wang, C.-J., Shi, C.-Y., Na, L., Liu, S.-R., Yu, X.-D. (2016):
Ruan, Y.-L., Jin, Y., Yang, Y.-J., Li, G.-J., Boyer, J. S. (2010): Sugar Comparison of root characteristics and sugar components in root
input, metabolism, and signaling mediated by invertase: roles in and leaf at early growth phase of sweet potato varieties with signif-
development, yield potential, and response to drought and heat. icant difference in valid storage root number. Acta Agron. Sin. 42.
Mol. Plant 3, 942–955. DOI: 10.3724/SP.J.1006.2016.00131.
Seifter, S., Dayton, S., Novic, B., Muntwyler, E. (1950): The esti- Weber, H., Borisjuk, L., Wobus, U. (1997): Sugar import and metab-
mation of glycogen with the anthrone reagent. Arch. Biochem. olism during seed development. Trends Plant Sci. 2, 169–174.
Biophys. 25, 191–200. Wilson, L. A. (1973): Effect of different levels of nitrate-nitrogen
Shi, C., Zhang, X., Zhang, C., Chen, X. (2010): Absorption and supply on early tuber growth of two sweet potato cultivars. Trop.
utilization of different nitrogen forms by sweet potato. Plant Nutr. Agr. St. Augustine 50, 53–54.
Fertil. Sci. 16, 389–394. Zhang, X.-M., Wang, W., Du, L.-Q., Xie, J.-H., Yao, Y.-L., Sun, G.-M.
Somogyi, M. (1952): Notes on sugar determination. J. Biol. Chem. (2012): Expression patterns, activities and carbohydrate-metabo-
195, 19–23. lizing regulation of sucrose phosphate synthase, sucrose synthase
and neutral invertase in pineapple fruit during development and
Tanaka, M., Kato, N., Nakayama, H., Tanaka, M., Kato, N.,
ripening. Int. J. Mol. Sci. 13, 9460–9477.
Nakayama, H., Nakatani, M., Takahata, Y. (2008): Expression of
class I knotted1-like homeobox genes in the storage roots of sweet Zhao, F.-C., Jing, L.-Q., Yan, F.-B., Lu, D., Wang, G., Lu, W. (2013):
potato (Ipomoea batatas). J. Plant Physiol. 165, 1726–1735. Effect of heat stress during grain filling on sugar accumulation and
enzyme activity associated with sucrose metabolism in sweet corn.
Tao, X., Gu, Y.-H., Wang, H.-Y., Zheng, W., Li, X., Zhao, C.-W.,
Acta Agron. Sin. 39, 1644–1651.
Zhang, Y.-Z. (2012): Digital gene expression analysis based on
integrated de novo transcriptome assembly of sweet potato

ª 2018 The Authors. Journal of Plant Nutrition and Soil Science published by Wiley-VCH Verlag GmbH & Co. KGaA www.plant-soil.com