BRD7 Regulates XBP1s' Activity and Glucose Homeostasis Through Its Interaction With The Regulatory Subunits of PI3K

NIH Public Access
Author Manuscript
Cell Metab. Author manuscript; available in PMC 2015 July 01.
Published in final edited form as:
NIH-PA Author Manuscript
Cell Metab. 2014 July 1; 20(1): 73–84. doi:10.1016/j.cmet.2014.04.006.
BRD7 regulates XBP1s' activity and glucose homeostasis

through its interaction with the regulatory subunits of PI3K
Sang Won Park1,*, Hilde Herrema1, Mario Salazar1, Isin Cakir1, Serkan Cabi1, Fatma
Basibuyuk Sahin1, Yu-Hsin Chiu2,3, Lewis C. Cantley2,3,4, and Umut Ozcan1,*
1Division
of Endocrinology, Boston Children's Hospital, Harvard Medical School, Boston MA
02115, USA
2Department of System Biology, Harvard Medical School, Boston, MA 02115, USA
3Division of Signal Transduction, Beth Israel Deaconess Medical Center, Boston, MA 02115, USA
4Department of Medicine, Weill Cornell Medical College, New York City, NY 10065, USA
Summary
Bromodomain-containing protein 7 (BRD7) is a member of the bromodomain-containing protein
family that is known to play role as tumor suppressors. Here, we show that BRD7 is a component
of the unfolded protein response (UPR) signaling through its ability to regulate X-box binding
protein1 (XBP1) nuclear translocation. BRD7 interacts with the regulatory subunits of
phosphatidyl-inositol3-kinase (PI3K) and increases the nuclear translocation of both p85α/β and
XBP1s. Deficiency of BRD7 blocks the nuclear translocation of XBP1s. Furthermore, our in vivo
studies have shown that BRD7 protein levels are reduced in the liver of obese mice, and
reinstating BRD7 levels in the liver restores XBP1s nuclear translocation, improves glucose
homeostasis, and ultimately reduces the blood glucose levels in the obese and diabetic mouse
models.
Keywords
Bromodomain-containing protein 7 (BRD7); X-box binding protein1 (XBP1); Endoplasmic

reticulum (ER) stress; Unfolded protein response (UPR); Diabetes
Introduction
Obesity is a fast growing global health problem and is the leading cause for development of
type 2 diabetes, nonalcoholic steatohepatitis, and cardiovascular disease (Hevener and
Febbraio, 2010; Kahn and Flier, 2000; Muoio and Newgard, 2006; Qatanani and Lazar,
© 2014 Elsevier Inc. All rights reserved.

*
To whom correspondence should be address: [email protected], (617-919-4596),
[email protected] (617-919-4684).
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our
customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of
the resulting proof before it is published in its final citable form. Please note that during the production process errors may be
discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Park et al. Page 2
2007; Sun and Karin, 2012). Increased insulin resistance and perturbed glucose tolerance in
obesity are the main underlying pathologies for development of type 2 diabetes (Guilherme
et al., 2008; Kadowaki et al., 2003; Konner and Bruning, 2012). Majority of the patients
diagnosed with type 2 diabetes are obese (de Luca and Olefsky, 2006; Kitamura and Accili,
2004). Despite enormous efforts, the molecular mechanisms of obesity-induced insulin
resistance and glucose intolerance remain incompletely understood. Therefore,
understanding the molecular links between obesity, insulin resistance and type 2 diabetes is
of crucial importance for the development of new therapeutic strategies.
The endoplasmic reticulum (ER) is a cellular organelle in which secretory and membrane-
bound proteins are folded into their three-dimensional structures and lipids and sterols are
synthesized (Palade, 1956). Certain conditions, such as nutrient deprivation, increased
protein trafficking, exposure to free fatty acids, accumulation of unfolded or misfolded
proteins in the lumen of ER, and alterations in calcium homeostasis, interfere with proper
function of the ER (Fonseca et al., 2011; Park et al., 2010b; Schroder and Kaufman, 2005;
Walter and Ron, 2011). Perturbations in ER homeostasis can create a condition defined as
ER stress (Park and Ozcan, 2013; Ron and Walter, 2007; Schroder and Kaufman, 2005;
Walter and Ron, 2011). ER stress activates a cascade of complex signaling networks,
collectively referred to as unfolded protein response (UPR) (Marciniak and Ron, 2006; Park
and Ozcan, 2013; Schroder and Kaufman, 2005; Walter and Ron, 2011; Wang and
Kaufman, 2012). The UPR is initiated by PKR-like endoplasmic reticulum kinase (PERK),
inositol requiring enzyme -1 (IRE1), and activating transcription factor-6 (ATF6).
IRE1 has kinase and endoribonuclease activities. Upon activation, the endoribonuclease
domain of IRE1 cleaves the mRNA of a transcription factor called X-box binding protein1
(XBP1) and removes a 26-bp of intron, resulting in a higher molecular weight protein called
the spliced form of XBP1 (XBP1s) (Calfon et al., 2002; Lee et al., 2002; Yoshida et al.,
2001). While the main function of XBP1s is to increase the folding capacity of the ER, it
also regulates components in the ER-associated degradation (ERAD) pathway (Bernales et
al., 2006; Lee et al., 2003; Merksamer and Papa, 2010; Ron and Walter, 2007; Zhang and
Kaufman, 2008).
Over the last decade, we and others have shown that obesity leads to the development of ER
stress in the liver, brain, and adipose tissues (Nakatani et al., 2005; Ozawa et al., 2005;
Ozcan et al., 2009; Ozcan et al., 2004; Ozcan et al., 2008; Ozcan et al., 2006), which in turn
contributes to the development of insulin resistance and type 2 diabetes. Previous
observations have shown that genetic ablation of even one allele of XBP1 is sufficient to
create insulin resistance and type 2 diabetes (Ozcan et al., 2004). We have recently
demonstrated that reduced XBP1s activity in obesity plays a crucial role in the development
of insulin resistance and type 2 diabetes (Lee et al., 2011; Park et al., 2010a; Zhou et al.,
2011). Consistent with this notion, reinstating the activity of XBP1s in the liver of severely
obese and diabetic mice reduced blood glucose levels to euglycemia and restored glucose
homeostasis (Zhou et al., 2011).
We previously have reported that XBP1s interacts with the regulatory subunits of the class
IA phosphotidyl-inositol3-kinase (PI3K), p85α and p85β, (Park et al., 2010a; Winnay et al.,

Park et al. Page 3
2010), which is one of the main nodules in insulin signaling. The interaction between p85s
and XBP1s is a prerequisite for the nuclear translocation of XBP1s (Park et al., 2010a).
More importantly, we showed that disruption of the interaction between p85s and XBP1s is
a major cause for the development of insulin resistance in obesity (Park et al., 2010a).
Bromodomain-containing protein 7 (BRD7) is a subunit of the polybromo-associated

BRG1-associated factor (PBAF) complex with a molecular weight of about 75 kDa (Kaeser
et al., 2008). It plays a role in transcriptional regulation by binding to acetylated histone
through its bromodomain (Peng et al., 2006). It was shown that the expression level of
BRD7 is significantly decreased in nasopharyngeal carcinoma (NPC) biopsies (Zhou et al.,
2004). Furthermore, BRD7 was reported to participate in tumor suppression, cell cycle, and
cell growth (Kaeser et al., 2008; Peng et al., 2007; Zhou et al., 2004). Recent work
suggested that BRD7 binds to BRCA-1 and p53, and acts as a tumor suppressor (Burrows et
al., 2010; Drost et al., 2010; Harte et al., 2010; Mantovani et al., 2010).
Cantley and his co-workers recently showed that BRD7 binds to p85α and increases its
nuclear translocation (Chiu et al. submitted). Considering the effect of p85s on XBP1s
nuclear translocation (Park et al., 2010a), we investigated whether BRD7 plays a role on
regulation of XBP1s, ER stress, and glucose metabolism.
Results
BRD7 interacts with p85α and increases its nuclear translocation
To confirm the interaction between BRD7 and the regulatory subunit of PI3K, p85α, (Chiu
et al. submitted, 2013), we expressed mouse BRD7 and p85α by infecting the 293HEK cells
with adenoviruses that express BRD7 (Ad-BRD7) and flag-tagged p85α-(Ad-p85α-flag).
Subsequently, we immunoprecipitated p85α using an anti-flag antibody, blotted the
precipitate with an antibody specific for BRD7 and documented that BRD7 exists in p85α
immunoprecipitates (Figure 1A). This result indicates that BRD7 and p85α interact. We also
performed reverse immunoprecipitation, in which BRD7 were pulled down and the
existence of p85α in the precipitates was examined. Results from this experiment confirmed
the interaction of these two proteins (Figure 1B). Next, we investigated whether BRD7
modulates the nuclear migration of p85α. We infected 293HEK cells with increasing doses
of Ad-BRD7 while keeping the expression of p85α constant, and then analyzed p85α levels
in the nuclear fractions. Increasing the expression level of BRD7 led to a higher
translocation of p85α to the nucleus (Figure 1C). We also tested whether BRD7 can increase
the nuclear translocation of p85β by infecting 293HEK cells with increasing doses of Ad-
BRD7 while keeping the expression of p85β constant. BRD7 led to increased nuclear
translocation of p85β as well (Figure S1A).
These observations prompted us to investigate whether BRD7 has any effect on XBP1s,
because we have previously shown that p85α/β binds to XBP1s and increases its nuclear
translocation (Park et al., 2010a). For this purpose, we infected 293HEK cells with XBP1s-
expressing adenovirus (Ad-XBP1s) at a constant dose along with incremental doses of Ad-
BRD7. Indeed, we found that upregulating BRD7 level increases the nuclear translocation of
XBP1s (Figure 1D) without increasing XBP1 mRNA levels (data not shown).

Park et al. Page 4
The next question we asked was how BRD7 increases the XBP1s nuclear translocation. We
explored whether it is mediated through a direct interaction of BRD7 with XBP1s that is
independent of p85α, or through the ability of BRD7 to regulate p85α and consequent
XBP1s interaction. We first expressed BRD7 and XBP1s in 293HEK cells by infecting the
cells with Ad-BRD7 and Ad-XBP1s and performed XBP1 immunoprecipitation. We blotted
the precipitate with an antibody that is specific for BRD7 and showed that BRD7 and
XBP1s can be co-immunoprecipitated (Figure 1E) indicating that these two proteins either
directly interact or exist in the same protein complex. Considering the fact that both BRD7
and p85α can be immunoprecipitated with XBP1s (Park et al., 2010a), we asked whether
BRD7 could directly bind to XBP1s in the absence of p85α/β . Thus, we knocked down
p85α and p85β in mouse embryonic fibroblasts (MEFs) with an shRNA lentivirus system
specific for p85α and p85β to create p85α-/-β-/- double knock down (DKD) cell line. We also
created a control cell line, PLKO, using an empty lentivirus (PLKO) (Figure 1F). The
interaction between BRD7 and XBP1s was observed in control PLKO cells (Figure 1F).
However, this interaction was reduced in p85α/β-depleted DKD cells (Figure 1F). After
obtaining these results, we investigated the nature of the interaction between BRD7 and
XBP1s in p85α/β double knockout (DKO) cells. Following expression of BRD7 and XBP1s
in p85α/β DKO cells, we performed XBP1s immunoprecipitation and investigated the
presence of BRD7 in these precipitates. The interaction between BRD7 and XBP1s was not
detected at all in p85α/β DKO cells (Figure 1G), indicating that p85α or p85β are necessary
for BRD7-XBP1s interaction.
Since our results have shown that BRD7 interacts with XBP1s only in the presence of
p85α/β, we then asked whether BRD7 is still capable of increasing the nuclear translocation
of XBP1s at the absence of p85α/β. For this purpose, we infected the DKD, DKO, and their
control cells with Ad-XBP1s at a constant dose and increasing doses of Ad-BRD7. We
found that BRD7 could not increase transport of XBP1s to the nucleus in DKD cells as it did
in PLKO cells (Figure 1H). Moreover, XBP1s were not detected in the nucleus of DKO cells
even with overexpression of BRD7 (Figure 1I), indicating that the presence of p85α/β is
required for BRD7 to force XBP1s to the nucleus.
BRD7 and p85α are required for the activity of XBP1s

The above findings indicate that BRD7 plays a role in XBP1s' nuclear migration. To further
investigate the nature of the interaction between p85α, XBP1s, and BRD7, we expressed
p85α and XBP1s in the cells either with or without BRD7 (Figure 2A). Subsequently, we
isolated the cytoplasmic and nuclear fractions and performed XBP1s immunoprecipitation
from both compartments. BRD7 expression reduced the amount of p85α-XBP1s complex in
the cytoplasm (Figure 2A left panel). However, it increased the nuclear amount of p85α-
XBP1s complex (Figure 2A right panel). These results indicate that BRD7 enhances the
binding of p85 to XBP1s and increases its nuclear translocation.
We previously have shown that p85α and p85β form a heterodimer, which can be disrupted
by insulin treatment (Park et al., 2010a). We have reported that insulin promotes the nuclear
translocation of XBP1s by increasing the binding of p85α/β monomers to XBP1s (Park et
al., 2010a). Considering this data, we investigated whether insulin regulates BRD7-p85-

Park et al. Page 5
XBP1s complex. First, we expressed p85α and BRD7 in 293HEK cells by infecting with
Ad-BRD7 and Ad-p85α-flag. Following serum starvation, we stimulated the cells with
insulin (500 nM) for various time points. Subsequently, we immunoprecipitated p85α with
an anti-flag antibody and immunoblotted for BRD7 to investigate whether the interaction
between p85α and BRD7 is affected by insulin treatment. The results showed that insulin
enhances the association of p85α and BRD7 in the nuclear fractions (Figure 2B). We then
investigated the effect of insulin on the formation of BRD7-p85α-XBP1s complex. We
infected 293HEK cells with Ad-BRD7 and Ad-XBP1s-flag and following an overnight
serum deprivation, we stimulated the cells with insulin (500 nM) for 0.5 and 2 hours. XBP1
was then immunoprecipitated and the immunoprecipitates were blotted for BRD7. Insulin
led to increased binding of BRD7 to XBP1s in the nucleus (Figure 2C).
To further understand how BRD7 is regulated, we infected 293HEK cells with increasing
doses of Ad-BRD7 and a constant dose of Ad-p85α-flag and Ad-p85β-myc, and then
immunoprecipitated p85α using an anti-flag antibody, followed by western blot using anti-
myc antibody to analyze whether the association between p85α and p85β is affected by
BRD7 expression. This results showed that increasing BRD7 expression disrupts the p85α/β
heterodimer (Figure 2D).
We next examined whether BRD7 ability to increase nuclear translocation of XBP1s also
has positive modulatory effects on XBP1s activity. For this purpose, we expressed BRD7 in
MEFs and analyzed the mRNA levels of various genes that are the targets of XBP1s, such as
endoplasmic reticulum-localized DnaJ homologues (Erdj4), homocysteine-inducible,
endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 (Herpud1; Herp),
and endoplasmic reticulum oxidoreductin 1α (Ero1α). Quantitative PCR (qPCR) analysis
showed that expression of BRD7 significantly upregulated the transcription of Erdj4, Herp,
and Ero1α (Figure 2E), suggesting that BRD7 increases the activity of XBP1s as a
transcription factor in the nucleus.
In order to address whether BRD7 is required in the nuclear translocation process of XBP1s,
we first identified an shRNA sequence that is specific for BRD7 mRNA, showed the
efficacy of this shRNA and then cloned this sequence into an adenovirus vector (Ad-
BRD7shRNA). Infections of MEFs led to a highly significant reduction in BRD7 mRNA
levels (Figure S2A and S2B). Subsequently, we investigated the nuclear migration pattern of
XBP1s in the absence of BRD7. For this purpose, we expressed BRD7shRNA along with
XBP1s in 293HEK cells. There was a major reduction in the nuclear XBP1s levels in
BRD7-depleted cells when compared to the control cells or cells overexpressing BRD7
(Figure 2F). To further confirm this result in in vivo, we injected eight-week-old male lean
mice with 1.5×108 plaque-forming unit (pfu)/g of Ad-BRD7shRNA or Ad-LacZshRNA via
the tail vein. We previously reported that fasting wild-type mice for 24 hours and refeeding
food ad libitum for one hour markedly increases the XBP1 splicing and nuclear translocation
of XBP1s (Park et al., 2010a). This increased nuclear translocation of XBP1s with refeeding
was also observed in the mice that were injected with Ad-LacZshRNA, but to a comparably
lesser extent in the mice that were injected with Ad-BRD7-shRNA (Figure 2G), without any
change in the splicing of XBP1 mRNA (Figure 2H). This suggests that reduced nuclear
XBP1s levels in the liver of Ad-BRD7shRNA injected mice are not due to a defect in XBP1

Park et al. Page 6
splicing. In parallel to these results, expression of XBP1 target genes were reduced and
expression of CHOP was increased in the liver of Ad-BRD7-shRNA-injected group when
compared to those that were injected with Ad-LacZ-shRNA (Figure 2I).
BRD7 overexpression in the liver of the ob/ob mice establishes euglycemia

Considering the defect in hepatic XBP1s nuclear translocation in obese mice and also our in
vitro results that show BRD7 is involved in the regulation of XBP1s nuclear migration and
activity, we investigated whether BRD7 levels are reduced in the liver of obese mice.
Indeed, we found that there was a significant reduction in the BRD7 protein levels in the
liver of ob/ob mice when compared with the lean controls (Figure 3A). Furthermore, we
showed that BRD7 mRNA levels were increased during refeeding period in wild-type mice,
but this increment was lost in ob/ob mice (Figure 3B).
Obesity is a condition of hyperinsulinemia and elevated ER stress. Therefore, we sought to

investigate whether prolonged insulin stimulation or ER stress is a cause for the reduced
BRD7 expression level in obesity. For this purpose, we first induced ER stress in MEFs by
treating the cells with tunicamycin at various doses (0.1 to 10 μg/ml) for one hour following
overnight starvation and analyzed the endogenous BRD7 protein and mRNA levels by
performing western blot and qPCR, respectively. The results showed no significant
difference in BRD7 expression levels after tunicamycin treatment (Figure S3A and S3B). In
addition, we treated MEFs and Fao cells with tunicamycin at the concentration of 3 μg/ml
for one, two, and three hours. The treatment of the cells with tunicamycin did not alter
BRD7 expression patterns either (Figure S3C-S3F). Next, after overnight starvation, we
stimulated Fao and 293HEK cells with insulin (500 nM) for different time points. Exposure
of the cells to insulin did not affect BRD7 gene expression levels (Figure S3G-S3I).
We previously have reported that overexpression p85α or p85β in the liver of obese and
diabetic mice reinstates the nuclear translocation of XBP1s, reduces ER stress, improves
glucose tolerance and ultimately reduces the blood glucose levels (Park et al., 2010a). Given
that BRD7 has ability to increase the nuclear translocation of both p85α/β and XBP1s, and
that its expression is significantly reduced in the liver of obese mice, we hypothesized that
up-regulating the expression of BRD7 in the liver of obese and diabetic mice would improve
glucose tolerance and reduce blood glucose levels. To test this hypothesis, we overexpressed
BRD7 in the liver of ob/ob mice by tail vein injection of Ad-BRD7 and Ad-LacZ as a
control at a dose of 1×108 pfu/g (Figure S3J and S3K). After three days of injection, we
fasted the mice for six hours and measured the basal blood glucose levels. Ad-BRD7-
injected group had significantly lower blood glucose levels than those in the Ad-LacZ
injected group (Figure 3C). There were no difference in the body weight or the food intake
between Ad-BRD7 and Ad-LacZ injected groups (Figure S3L and S3M). Glucose tolerance
test (GTT) was performed at day five post-injection and the result revealed a major
improvement in the glucose disposal rate in the Ad-BRD7 injected group (Figure 3D).
Insulin tolerance test (ITT) at day seven showed that whole body insulin sensitivity was
improved (Figure 3E).
Next, we investigated whether hepatic insulin receptor signaling is altered after BRD7
expression in the ob/ob mice. To do this, we infused either insulin (0.35 IU/kg) or saline

Park et al. Page 7
through the portal vein into the liver of ob/ob mice on post-injection day eight. The
phospho/total insulin receptor (IR) and insulin receptor substrate 1 (IRS1) values were
slightly increased but did not reach to significant levels in Ad-BRD7-injected group. (Figure
3F). However, AktThr308 and AktSer473 phosphorylations were significantly increased

(Figure 3F), These results indicate that BRD7 expression in the liver leads to an increase in
the sensitivity of IRS1–Akt axes of IR signaling cascade.
Furthermore to investigate whether BRD7 overexpression increases the association of p85

with IRS proteins, we performed p85 immunoprecipitation from the liver tissues that were
infused with insulin or saline, then immunoblotted for IRS1 and IRS2. The results showed
that the interaction between p85s and IRSs are indeed increased after insulin stimulation in
Ad-BRD7-injected group (Figure 3G) when compared to those of Ad-LacZ-injected group.
Next, we sought to investigate whether an increase in BRD7 expression leads to increased

XBP1s nuclear translocation and a corresponding up-regulation of XBP1s target genes in in
vivo settings. For this purpose, we injected eight-week-old male ob/ob mice with Ad-BRD7
and Ad-LacZ at a dose of 1×108 pfu/g through the tail vein. The overexpression of Ad-
BRD7 in the liver of ob/ob mice greatly increased XBP1s nuclear translocation (∼12 fold
upregulation; Figure 4A). In line with the increased nuclear translocation of XBP1s, target
gene expression, such as Erdj4, Herp, and Ero1α, were significantly upregulated at both
mRNA and protein levels (Figure 4B and 4C).
In parallel, we observed decreased PERK phosphorylation in Ad-BRD7 injected ob/ob

mice's liver when compared to those in Ad-LacZ injected group (Figure 4D and S4A).
Accordingly, the levels of phospho-eIF2αSer51, a direct downstream target of phospho-
PERK, were also decreased (Figure 4D and S4B). These results indicate that ER stress is
reduced after BRD7 overexpression in the liver of ob/ob mice. Considering our previously
published results showing that XBP1s leads to FoxO1 degradation (Zhou et al., 2011), we
investigated the nuclear and total levels of FoxO1. BRD7 overexpression led to a major
decrease in both nuclear and total FoxO1 levels in the liver of ob/ob mice. (Figure 4E).
Accordingly, gene expressions of glucose-6-phosphatase (G6P), fructose bisphosphatase
(FbP), and phosphoenolpyruvate carboxykinase (Pepck) were significantly reduced in
BRD7-overexpressing mice's livers (Figure 4F). Furthermore, even macroscopically, BRD7-
overexpressing livers had a healthier appearance than the Ad-LacZ-injected control groups
(Figure 4G). H&E staining of the sections from the liver of Ad-LacZ- and Ad-BRD7-
injected ob/ob mice showed a major decrease in the lipid droplets (Figure 4H). In line with
these observations, analysis of liver triglyceride (TG; mg/dl) content showed a significant
reduction in the liver of Ad-BRD7-injected ob/ob mice (Figure 4I). Analysis of lipogenic
gene expression such as acetyl co-A carboxylase 1 (Acc1,), fatty acid synthase (FasN), and
diacylglycerol acyltransferase 2 (Dgat2) were significantly reduced in BRD7-
overexpressing mice's livers (Figure 4J). Taken together, these results indicate that BRD7
also have anti-lipogenic properties.
Restoration of BRD7 in the liver of DIO mice improves glucose metabolism

Our data thus far showed that BRD7 protein levels are reduced in genetically obese and
diabetic ob/ob mice and that restoration of BRD7 levels re-establishes glucose homeostasis.

Park et al. Page 8
Next, we sought to examine the BRD7 expression levels in diet-induced obese (DIO) mouse
model. For this purpose, wild-type lean C57BL/6 male mice were placed either on high fat
(HFD, 45 kcal% from fat) or normal chow diet (NCD) feeding soon after weaning at the age
of 3.5 weeks and maintained on the same diet for 16 weeks. At the end of 16-week feeding
period, we examined the protein levels of BRD7 in the liver of HFD- and NCD-fed groups.
We observed a marked reduction in the hepatic level of BRD7 in the HFD-fed mice (Figure
5A). We then compared the BRD7 protein levels amongst wild-type mice on NCD,
genetically obese ob/ob mice, and wild-type mice that were kept on HFD for eight weeks.
The expression levels of BRD7 in the liver of eight-week HFD-fed mice were also
significantly reduced, and this reduction was comparable to that seen in ob/ob mice (Figure
5B). Next, we overexpressed BRD7 or LacZ (as a control) in the liver of mice that were fed
either NCD or HFD for eight weeks by tail vein injection of the corresponding adenoviruses
at a dose of 5×107 pfu/g. After three days of injection, we measured the blood glucose levels
and showed that the blood glucose levels of the Ad-BRD7 injected group were significantly
lower compared to those of the Ad-LacZ injected group (Figure 5C). GTT was performed at
day five post-injection and the result revealed a significant improvement in the glucose
disposal rate in the Ad-BRD7 injected group (Figure 5D). In addition, the overexpression of
BRD7 in the liver of HFD mice group restored the ability of XBP1s to translocate to the
nucleus while Ad-LacZ injected mice group could not translocate XBP1s to the nucleus
(Figure 5E). Next, we fasted these two groups for 24 hours and then gave them food ad
libitum for one hour. We collected the liver and determined gene expression profiles of
XBP1s target genes. Refeeding led to significantly higher mRNA levels of Erdj4, Herp, and
Ero1α in the Ad-BRD7-injected group compared to the Ad-LacZ group (Figure 5F-H),
indicating that BRD7, as seen in genetically obese models, also increases XBP1s activity in
the HFD-fed obese mice.
Discussion
Over the last decade, XBP1s has been emerged as a central player in maintenance of glucose
homeostasis due to its ability to reduce ER stress, increase insulin sensitivity, and also
degrade FoxO1 through a direct protein interaction (Lee et al., 2011; Ozcan et al., 2004;
Park et al., 2010a; Zhou et al., 2011). Reduced XBP1s activity in obesity due to impaired
nuclear translocation is a major cause for the development of ER stress and consequently
insulin resistance and type 2 diabetes. Re-instating the activity of XBP1s in obese and
diabetic mice through genetic manipulations greatly improves glucose homeostasis (Zhou et
al., 2011). Therefore, it is important to understand the mechanisms leading to the reduced
XBP1s activity in obesity to create potential targets for the treatment of type 2 diabetes.
Findings presented in this work, for the first time, show a role for BRD7 in metabolic
homeostasis and also in UPR signaling. We previously have reported that p85α and p85β
form heterodimers, which can be disrupted by insulin (Park et al., 2010a). Free monomeric
p85 interacts with XBP1s and imports XBP1s to the nucleus. In this report, we added
another crucial component to this mechanism. We document that BRD7 interacts with
p85α/β and that insulin enhances the interaction between BRD7 and p85. Consequently,
insulin increases the formation of BRD7-p85-XBP1s complex, which in turn leads to
increased nuclear translocation and activity of XBP1s. However, further detailed

Park et al. Page 9
investigation is needed to understand the exact molecular mechanism by which insulin

modulates BRD7-p85 complexes to regulate the nuclear translocation of XBP1s.
Here, we document that decreased BRD7 levels in obesity is a critical pathology for reduced
XBP1s activity and consequently for the development of ER stress, glucose intolerance, and
type 2 diabetes. Our observations indicate that increasing BRD7 levels in the liver of obese
and diabetic mice reinstates XBP1s nuclear translocation, reduces ER stress, and
significantly improves glucose homeostasis. Furthermore, our results are the first to
document the requirement for BRD7 in XBP1s' action, which is one of the master regulators
of UPR signaling. This indicates that BRD7 is also an important element in UPR signaling.
In the mean time, BRD7 has been shown to interact with p53 and plays a role as a tumor
suppressor. It is possible that it might have other functions inside the cells. Therefore, we
can not completely rule out the possibility that the improvement in glucose homeostasis
could also have been affected by other effects of BRD7 in addition to its regulatory effects
on XBP1s. Future studies are required to answer this question and to understand the detailed
role of BRD7 in UPR signaling and diseases, pathology of which is contributed by UPR.
It is interesting to note that installment of BRD7 levels in the liver of obese and diabetic
mice, while increasing the insulin-stimulated Akt activation (IRS1→PI3K→Akt axis), it

does not increase the sensitivity of IR→IRS1 axis. Our previous observations have shown
that XBP1s reduces glucose intolerance and establishes metabolic homeostasis through both
insulin-dependent and -independent mechanisms (Zhou et al., 2011). High levels XBP1s
expression enhances insulin receptor signaling in the liver. However, in the mean time,
hepatic overexpression of XBP1s in the liver-specific IRS1 and IRS2 double knockout mice
can also improve glucose homeostasis through increasing FoxO1 degradation, without
changing its mRNA levels (Zhou et al., 2011). Gain of function studies for BRD7 in the
liver increased XBP1s nuclear translocation and led to highly significant reductions in
FoxO1 protein levels, without decreasing its mRNA levels. These results together with
increased Akt activation would explain how BRD7 improved glucose tolerance in obese and
diabetic mice.
However, how BRD7 expression increases the sensitivity of IRS1→PI3K→Akt axis without
an increase in the sensitivity of IR→IRS1 axis remains unclear and future experiments are
needed for further understanding of BRD7 effect on Akt activation. One possible
explanation could be that BRD7, by increasing the availability of either p85s (p85a α or
p85β) to XBP1s, making the other isoform more available to p110, and increasing the
interaction of p85/p110 complex with IRS1. In addition, the liver has p85α/β in excess over
the p110 catalytic subunits (Brachmann et al., 2005; Ueki et al., 2002; Ueki et al., 2003). It
was reported that the p85 monomers competes with p85-p110 heterodimers for binding to
IRS proteins and suppress PI3K signaling (Luo et al., 2005). Therefore, importing p85α/β
into the nucleus with BRD7 overexpression may enhance Akt signaling by reducing the
sequestration of IRS1 by monomeric p85.
In addition, p85s and its other isoforms might have different functions in different tissues or
cell lines depending on the ratio of the different subunits. As recently reported, down
regulation of p85 in Akita diabetic mice delays the onset and severity of complications, this

Park et al. Page 10
has been suggested to be due to a reduction in ER stress-induced apoptosis (Winnay et al.,

2014).
Insulin is a crucial hormone for life. Insulin resistance in obesity, despite leading to the
development of type 2 diabetes, could have evolved to protect organism from possible
detrimental site effects of prolonged exposure to high levels of circulating insulin (Accili
and Arden, 2004; Kenyon, 2010; Russell and Kahn, 2007). Indeed, several insulin resistance
models, such as adipocyte specific insulin receptor (Bluher et al., 2003) or brain specific
IRS2 knock out mice have extended life spans (Taguchi et al., 2007). One of the main side
effects of insulin action is upregulating the lipogenesis in various tissues. In this sense
BRD7-mediated regulation of glucose homeostasis could be a new and exciting therapeutic
target, through which glucose homeostasis can be established without increasing lipogenesis
both in the liver and also adipose tissues. Our results indicate that BRD7 expression in the
liver of obese mice significantly reduces hepatosteatosis, which is one of the leading causes
for the development of cirrhosis in obese population. Furthermore, obesity is related to
increased risk of various cancers and increased insulin action could be contributing to the
development of cancers in obesity. Considering the anti-tumorigenic effect of BRD7,
activators of this molecule might be effective in reducing the cancer risk, while re-
establishing the metabolic homeostasis.
In summary, our current work introduces a protein with anti-diabetic effects, which holds a
potential to be targeted for the treatment of type 2 diabetes in obesity.
Experimental Procedures
Cell culture—Mouse Embryonic Fibroblast (MEF), 293A, 293T, and 293HEK cells were
maintained in DMEM with 10% FBS, 10 U/ml penicillin, and 1 μg/ml streptomycin. Fao
cells were maintained in RPMI with 10% FBS, 10 U/ml penicillin, and 1 μg/ml
streptomycin. Cells were split at a density of 3.5×105 in 10 cm dish or 2×105 in 6 cm dish 16
hours prior to the experiments. Cells were maintained at 37°C in a 5% CO2 humidified
atmosphere.
Western blotting—For total cell lysates, cells were lysed in lysis buffer which contained
25 mM Tris (pH 7.4), 2 mM NaVo4, 10 mM NaF, 10 mM Na4P2O7, 1 mM EGTA, 1 mM
EDTA, and 1% NP-40. Protease inhibitor cocktail and PhosSTOP were added fresh to the
lysis buffer before each experiment. Equivalent concentration of protein (ranging 1–3 μg/μl)
from each sample was placed in 1.5 ml tubes. Protein was denatured in 1×Laemmlie buffer
by boiling at 100°C for five minutes, except the samples for BRD7 analysis from tissues;
these samples were not boiled after adding laemmlie buffer. The tubes were kept at room
temperature for 15 minutes before loading to SDS-PAGE gel. After resolving in SDS-
PAGE, the proteins were transferred onto polyvinylidene fluoride (PVDF) membrane. The
membrane was blocked in Tris-Buffered Saline (TBS, pH 7.4) with 10% blocking reagent
provided with BM Chemiluminescence blotting substrate (POD) assay system for one hour,
followed by incubation with primary antibody in Tris-Buffered Saline-Tween (TBST, pH
7.4) with 5% blocking reagent for overnight at 4°C. After the incubation, the membrane was
washed three times in TBST, followed by incubation with secondary antibody in TBST-10%

Park et al. Page 11
blocking reagent for one hour and washed again in TBST (three times for 20 min).
Immunoblots were developed using a chemiluminescence assay system, and bands were
visualized using Kodak exposure films. For stripping, the membranes were vigorously shook
in stripping buffer (2% SDS, 100 mM 2-mercaptoethanol in TBS) at 50°C for 20 minutes
followed by three washes with TBST. Densitometry was performed with Image J (NIH) for
quantifications.
Nuclear protein extraction—For nuclear protein extraction from cells in 6 cm plate,

cells were removed from dishes by scraping with 300 μl of cytoplasmic lysis buffer (10 mM
Hepes (pH 7.5), 2 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 10 mM KCl, 10 mM NaF, 0.1
mM Na3VO4, Protease inhibitor cocktail, and PhosSTOP). Following 15 minutes of
incubation on ice, 25 μl of 10% NP-40 were added and vortexed for 10 seconds. The cells
were centrifuged for one minute at 16,000 xg, and supernatants were collected to obtain the
cytoplasmic fractions. The pellets were resuspended in 200 μl of nuclear lysis buffer (25
mM Hepes (pH 7.5), 500 mM NaCl, 10 mM NaF, 10% Glycerol, 0.2% NP-40, 5 mM
MgCl2, and 10 mM DTT). RIPA buffer was used instead of nuclear lysis buffer for
immunoprecipitation experiments. The suspension was incubated on ice for 30 minutes.
During this incubation, lysates were vortexed every 10 minutes. Finally, cells were
centrifuged for 10 minutes at 16,000 xg to obtain nuclear proteins. For nuclear extraction
from liver tissues, 50 mg of liver tissue were cut in small pieces and washed once with ice-
cold PBS. Nuclear proteins were isolated using a commercially available kit from Pierce
according to the manufacturer's instructions with no modifications.
Immunoprecipitation—Lysates in RIPA buffer were incubated with antibody (0.3–0.6

μg) overnight at 4 °C with gentle rotation. 80 μl of pro tein A-Sepharose CL-4B beads (for
rabbit IgG) or protein G-Sepharose CL-4B beads (for mouse IgG) were added to the tubes
and rotated at 4 °C for two hours. Beads were precipitated by centrifugation at 16,000 xg for
30 seconds and washed them three times with cold RIPA buffer containing 150 mM NaCl.
The pellet were resuspended in 2x Laemmlie buffer and incubated at 100°C for 5 minutes.
The supernatants were used for western blot.
Lysis of liver tissue—For direct immunoblotting, 50 mg of liver tissue was homogenized

with Tissue Lyser II (Qiagen) in 1 ml of ice-cold tissue lysis buffer (25 mM Tris-HCl (pH
7.4), 10 mM Na3VO4, 100 mM NaF, 50 mM Na4P2O7, 10 mM EGTA, 10 mM EDTA, 1%
NP-40, 2 mM PMSF, Protease inhibitor cocktail, and PhosSTOP). Homogenized tissue was
incubated at 4 °C for one hour and centrifuged a t 16,000 xg for 30 minutes. The lipid layer
was carefully removed using cotton swab, and the supernatant was centrifuged again for one
hour at 16,000 xg and 4 °C before coll ecting proteins for western blot.
XBP1 splicing assay—The splicing of XBP1 from cDNA was analyzed by performing
PCR using Taq DNA polymerase. The PCR conditions were as follows: 94°C for 3 minutes;
29 cycles of 94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 30 seconds; and 72°C
for 3 minutes. The primer sequenc es are as follow:
Forward: 5′ACA CGC TTG GGA ATG GAC AC3′
Reverse: 5′CCA TGG GAA GAT GTT CTG GG3′

Park et al. Page 12
Production and transduction of shRNA lentivirus—293T cells were split in 10 cm

dish and transfected with pLKO, pLP1, pLP2, and pVSV-G using Lipofectamine according
to manufacturer's instruction. The shRNA sequences carried in pLKO vector for p85α and
p85β were as follows:
p85α:
5′CCGGCAACCGAAACAAAGCGGAGAACTCGAGTTCTCCGCTTTGTTTCGGT
TGTTTTTG3′
p85β:
5′CCGGCCTGTGTCCAAGTACCAACAACTCGAGTTGTTGGTACTTGGACACA
GGTTTTT3′
Media was replaced with fresh media 16 hours after the transfection. Cells were incubated at
37°C in a 5% CO2 humidified atmosphere for 48 hours. The viral particles were harvested
by passing the supernatant through a 0.45 μm filter. Viruses were concentrated by
ultracentrifugating for 1.5 hours at a speed of 50,000 xg. The viral pellet was resuspended in
a small volume of medium and left at 4 °C for overnight. To transduce cells with viruses,
viral supernatants were added to the cells in the presence of polybrene at a final
concentration of 2 μg/ml.
Production of adenoviral vectors—Mouse BRD7 was obtained from performing PCR

with cDNA synthesized from MEFs using following primer pairs.
Forward: 5′ATG GGC AAG AAG CAC AAG AA3′
Reverse: 5′TCA GCT CGC GTC AGG CCC AC3′
PCR was performed with the following conditions: 94°C for 10 minutes; 18 cycles of 94°C
for 30 seconds, 65°C for 30 seconds, and 72°C for 6 minute; and 72°C for 15 minutes. After
PCR, products were cleaned with PCR purification kit and cloned into pENTR3C vector to
create pENTR3C-mBRD7, which was recombined to pAd to create adenoviral vector pAd-
BRD7. The shRNA sequences for BRD7shRNA were as follows:
5′CCGGGCCAAGATTACCCGTATGTTACTCGAGTAACATACGGGTAATCTTGGCT
TTTT3′
Adenovirus production—Adenovirus vector that contain a gene of p85α, p85β, BRD7,

XBP1s, and BRD7shRNA were constructed using gateway recombination system from
Invitrogen. Adenovirus vectors were digested with PacI and used to transfect the 293A
producer cell line in a 6-well-plate. The media were replaced with DMEM containing 10%
FBS and 1% penicillin/streptomycin the next day, and the cells were transferred to 10 cm
tissue culture dishes 24 hours after the transfection. The culture media were replaced with
fresh media every 2–3 days until cytopathic effect (CPE) was observed. Cells were
harvested when 80% CPE were observed, and the freezing and thawing cycles at −80°C and
37°C were repeated four times. The cell lysate was centrifuged at 1,200 xg for 30 minutes at
room temperature, and the supernatants containing the adenovirus particles were stored at
−80°C.

Park et al. Page 13
Adenovirus transduction—To infect cells with adenoviruses, cells in 6 cm plates were

washed with culture medium containing 1% FBS and incubated with 2.5 ml of media
containing 1% FBS and adenoviruses. Cells were carefully rotated every 15 minutes for one
hour, and incubated for 16 hours after adding 1.5 ml of media containing 1% FBS.
Glucose tolerance test (GTT)—Mice were fasted overnight (6 pm–9 am) and D-glucose
(2 g/kg for lean wild-type mice; 0.5 g/kg for ob/ob; and 1 g/kg for DIO mice) was
administrated intraperitoneally. Blood glucose levels were measured from the tail before
glucose administration and at 15, 30, 60, 90, 120 minutes following glucose administration.
Insulin tolerance test (ITT)—Mice were fasted for six hours (8 am–2 pm) and
recombinant human insulin from Eli Lilly was administrated intraperitoneally (1 IU/kg for
lean wild-type mice and 1.5 IU/kg for ob/ob and DIO mice). Blood glucose levels were
measured from the tail before glucose administration and at 15, 30, 60, 90, 120 minutes
following insulin administration.
Adenovirus injection—Adenovirus was thawed at room temperature immediately before

injection and diluted with saline to a final volume of 100 μl per mouse. Mice were restrained
in a restrainer and the tail was mildly heated with a heating lamp to achieve vasodilatation.
Adenovirus was injected through the tail vein slowly with a 30-gauge needle. After
injection, mild pressure was applied at the spot of injection until no bleeding was achieved
to prevent the backflow of viral solution.
Analysis of in vivo insulin receptor signaling—Mice for fasted for six hours (8 am –
2 pm) and anesthetized with xylazine-ketamine. Insulin (0.35 IU/kg) or saline was infused
into the liver of mice through the portal vein. Four minutes after infusion, the liver was
extracted, flash frozen in liquid nitrogen, and stored in −80°C until processing.
Animal experiments—All the performed animal experiments were approved by Boston

Children Hospital, IACUC.
Statistical analyses—Error bars represent the SEM. Statistical significance was

determined by Student's t test or multifactor ANOVA with the factor of time. When
ANOVA indicated a significant difference between the groups, we compared the groups
using a stricter criterion for statistical significance according to the Bonferroni rule as
follows: corrected P value = pairwise P value × number of comparisons. Significance was
accepted at *P < 0.05, **P < 0.01, ***P < 0.001.
Supplementary Material
Refer to Web version on PubMed Central for supplementary material.
Acknowledgments
We thank Dr. Morris F. White (Boston Children's Hospital, Harvard Medical School) for providing us with anti-
IRS1 and IRS2 antibodies. This work was supported by National Institutes of Health R01 grant (R01DK081009)
provided to U.O., the Timothy Murphy funds provided to the Division of Endocrinology, Boston Children's

Park et al. Page 14
Hospital, and National Institutes of Health K99 grant (K99DK093788) provided to S.W.P. U.O is a scientific
founder, SAB member, and share holder of ERX Pharmaceuticals.
References
Accili D, Arden KC. FoxOs at the crossroads of cellular metabolism, differentiation, and
transformation. Cell. 2004; 117:421–426. [PubMed: 15137936]
Bernales S, Papa FR, Walter P. Intracellular signaling by the unfolded protein response. Annu Rev
Cell Dev Biol. 2006; 22:487–508. [PubMed: 16822172]
Bluher M, Kahn BB, Kahn CR. Extended longevity in mice lacking the insulin receptor in adipose
tissue. Science. 2003; 299:572–574. [PubMed: 12543978]
Brachmann SM, Ueki K, Engelman JA, Kahn RC, Cantley LC. Phosphoinositide 3-kinase catalytic
subunit deletion and regulatory subunit deletion have opposite effects on insulin sensitivity in mice.
Mol Cell Biol. 2005; 25:1596–1607. [PubMed: 15713620]
Burrows AE, Smogorzewska A, Elledge SJ. Polybromo-associated BRG1-associated factor
components BRD7 and BAF180 are critical regulators of p53 required for induction of replicative
senescence. Proc Natl Acad Sci U S A. 2010; 107:14280–14285. [PubMed: 20660729]
Calfon M, Zeng H, Urano F, Till JH, Hubbard SR, Harding HP, Clark SG, Ron D. IRE1 couples
endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 2002;
415:92–96. [PubMed: 11780124]
de Luca C, Olefsky JM. Stressed out about obesity and insulin resistance. Nat Med. 2006; 12:41–42.
discussion 42. [PubMed: 16397561]
Drost J, Mantovani F, Tocco F, Elkon R, Comel A, Holstege H, Kerkhoven R, Jonkers J, Voorhoeve

PM, Agami R, et al. BRD7 is a candidate tumour suppressor gene required for p53 function. Nat
Cell Biol. 2010; 12:380–389. [PubMed: 20228809]
Fonseca SG, Gromada J, Urano F. Endoplasmic reticulum stress and pancreatic beta-cell death. Trends
Endocrinol Metab. 2011; 22:266–274. [PubMed: 21458293]
Guilherme A, Virbasius JV, Puri V, Czech MP. Adipocyte dysfunctions linking obesity to insulin
resistance and type 2 diabetes. Nat Rev Mol Cell Biol. 2008; 9:367–377. [PubMed: 18401346]
Harte MT, O'Brien GJ, Ryan NM, Gorski JJ, Savage KI, Crawford NT, Mullan PB, Harkin DP. BRD7,
a subunit of SWI/SNF complexes, binds directly to BRCA1 and regulates BRCA1-dependent
transcription. Cancer Res. 2010; 70:2538–2547. [PubMed: 20215511]
Hevener AL, Febbraio MA. The 2009 stock conference report: inflammation, obesity and metabolic
disease. Obes Rev. 2010; 11:635–644. [PubMed: 20002885]
Kadowaki T, Hara K, Yamauchi T, Terauchi Y, Tobe K, Nagai R. Molecular mechanism of insulin
resistance and obesity. Exp Biol Med (Maywood). 2003; 228:1111–1117. [PubMed: 14610248]
Kaeser MD, Aslanian A, Dong MQ, Yates JR 3rd, Emerson BM. BRD7, a novel PBAF-specific
SWI/SNF subunit, is required for target gene activation and repression in embryonic stem cells. J
Biol Chem. 2008; 283:32254–32263. [PubMed: 18809673]
Kahn BB, Flier JS. Obesity and insulin resistance. J Clin Invest. 2000; 106:473–481. [PubMed:
10953022]
Kenyon CJ. The genetics of ageing. Nature. 2010; 464:504–512. [PubMed: 20336132]
Kitamura Y, Accili D. New insights into the integrated physiology of insulin action. Rev Endocr
Metab Disord. 2004; 5:143–149. [PubMed: 15041790]
Konner AC, Bruning JC. Selective insulin and leptin resistance in metabolic disorders. Cell Metab.
2012; 16:144–152. [PubMed: 22883229]
Lee AH, Iwakoshi NN, Glimcher LH. XBP-1 regulates a subset of endoplasmic reticulum resident
chaperone genes in the unfolded protein response. Mol Cell Biol. 2003; 23:7448–7459. [PubMed:
14559994]
Lee J, Sun C, Zhou Y, Gokalp D, Herrema H, Park SW, Davis RJ, Ozcan U. p38 MAPK-mediated
regulation of Xbp1s is crucial for glucose homeostasis. Nat Med. 2011; 17:1251–1260. [PubMed:
21892182]
Lee K, Tirasophon W, Shen X, Michalak M, Prywes R, Okada T, Yoshida H, Mori K, Kaufman RJ.
IRE1-mediated unconventional mRNA splicing and S2P-mediated ATF6 cleavage merge to

Park et al. Page 15
regulate XBP1 in signaling the unfolded protein response. Genes Dev. 2002; 16:452–466.
[PubMed: 11850408]
Luo J, Field SJ, Lee JY, Engelman JA, Cantley LC. The p85 regulatory subunit of phosphoinositide 3-
kinase down-regulates IRS-1 signaling via the formation of a sequestration complex. J Cell Biol.
2005; 170:455–464. [PubMed: 16043515]
Mantovani F, Drost J, Voorhoeve PM, Del Sal G, Agami R. Gene regulation and tumor suppression by
the bromodomain-containing protein BRD7. Cell Cycle. 2010; 9:2777–2781. [PubMed: 20647772]
Marciniak SJ, Ron D. Endoplasmic reticulum stress signaling in disease. Physiol Rev. 2006; 86:1133–
1149. [PubMed: 17015486]
Merksamer PI, Papa FR. The UPR and cell fate at a glance. J Cell Sci. 2010; 123:1003–1006.
[PubMed: 20332117]
Muoio DM, Newgard CB. Obesity-related derangements in metabolic regulation. Annu Rev Biochem.
2006; 75:367–401. [PubMed: 16756496]
Nakatani Y, Kaneto H, Kawamori D, Yoshiuchi K, Hatazaki M, Matsuoka TA, Ozawa K, Ogawa S,
Hori M, Yamasaki Y, et al. Involvement of endoplasmic reticulum stress in insulin resistance and
diabetes. J Biol Chem. 2005; 280:847–851. [PubMed: 15509553]
Ozawa K, Miyazaki M, Matsuhisa M, Takano K, Nakatani Y, Hatazaki M, Tamatani T, Yamagata K,
Miyagawa J, Kitao Y, et al. The endoplasmic reticulum chaperone improves insulin resistance in
type 2 diabetes. Diabetes. 2005; 54:657–663. [PubMed: 15734840]
Ozcan L, Ergin AS, Lu A, Chung J, Sarkar S, Nie D, Myers MG Jr, Ozcan U. Endoplasmic reticulum
stress plays a central role in development of leptin resistance. Cell Metab. 2009; 9:35–51.
[PubMed: 19117545]
Ozcan U, Cao Q, Yilmaz E, Lee AH, Iwakoshi NN, Ozdelen E, Tuncman G, Gorgun C, Glimcher LH,
Hotamisligil GS. Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes.
Science. 2004; 306:457–461. [PubMed: 15486293]
Ozcan U, Ozcan L, Yilmaz E, Duvel K, Sahin M, Manning BD, Hotamisligil GS. Loss of the tuberous
sclerosis complex tumor suppressors triggers the unfolded protein response to regulate insulin
signaling and apoptosis. Mol Cell. 2008; 29:541–551. [PubMed: 18342602]
Ozcan U, Yilmaz E, Ozcan L, Furuhashi M, Vaillancourt E, Smith RO, Gorgun CZ, Hotamisligil GS.
Chemical chaperones reduce ER stress and restore glucose homeostasis in a mouse model of type
2 diabetes. Science. 2006; 313:1137–1140. [PubMed: 16931765]
Palade GE. The endoplasmic reticulum. J Biophys Biochem Cytol. 1956; 2:85–98. [PubMed:
13357527]
Park SW, Ozcan U. Potential for therapeutic manipulation of the UPR in disease. Semin
Immunopathol. 2013; 35:351–373. [PubMed: 23572207]
Park SW, Zhou Y, Lee J, Lu A, Sun C, Chung J, Ueki K, Ozcan U. The regulatory subunits of PI3K,
p85alpha and p85beta, interact with XBP-1 and increase its nuclear translocation. Nat Med. 2010a;
16:429–437. [PubMed: 20348926]
Park SW, Zhou Y, Lee J, Ozcan U. Sarco(endo)plasmic reticulum Ca2+-ATPase 2b is a major
regulator of endoplasmic reticulum stress and glucose homeostasis in obesity. Proc Natl Acad Sci
U S A. 2010b; 107:19320–19325. [PubMed: 20974941]
Peng C, Liu HY, Zhou M, Zhang LM, Li XL, Shen SR, Li GY. BRD7 suppresses the growth of
Nasopharyngeal Carcinoma cells (HNE1) through negatively regulating beta-catenin and ERK
pathways. Mol Cell Biochem. 2007; 303:141–149. [PubMed: 17458518]
Peng C, Zhou J, Liu HY, Zhou M, Wang LL, Zhang QH, Yang YX, Xiong W, Shen SR, Li XL, et al.
The transcriptional regulation role of BRD7 by binding to acetylated histone through
bromodomain. J Cell Biochem. 2006; 97:882–892. [PubMed: 16265664]
Qatanani M, Lazar MA. Mechanisms of obesity-associated insulin resistance: many choices on the
menu. Genes Dev. 2007; 21:1443–1455. [PubMed: 17575046]
Ron D, Walter P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev
Mol Cell Biol. 2007; 8:519–529. [PubMed: 17565364]
Russell SJ, Kahn CR. Endocrine regulation of ageing. Nat Rev Mol Cell Biol. 2007; 8:681–691.
[PubMed: 17684529]

Park et al. Page 16
Schroder M, Kaufman RJ. The mammalian unfolded protein response. Annu Rev Biochem. 2005;
74:739–789. [PubMed: 15952902]
Sun B, Karin M. Obesity, inflammation, and liver cancer. J Hepatol. 2012; 56:704–713. [PubMed:
22120206]
Taguchi A, Wartschow LM, White MF. Brain IRS2 signaling coordinates life span and nutrient
homeostasis. Science. 2007; 317:369–372. [PubMed: 17641201]
Ueki K, Fruman DA, Brachmann SM, Tseng YH, Cantley LC, Kahn CR. Molecular balance between
the regulatory and catalytic subunits of phosphoinositide 3-kinase regulates cell signaling and
survival. Mol Cell Biol. 2002; 22:965–977. [PubMed: 11784871]
Ueki K, Fruman DA, Yballe CM, Fasshauer M, Klein J, Asano T, Cantley LC, Kahn CR. Positive and
negative roles of p85 alpha and p85 beta regulatory subunits of phosphoinositide 3-kinase in
insulin signaling. J Biol Chem. 2003; 278:48453–48466. [PubMed: 14504291]
Walter P, Ron D. The unfolded protein response: from stress pathway to homeostatic regulation.
Science. 2011; 334:1081–1086. [PubMed: 22116877]
Wang S, Kaufman RJ. The impact of the unfolded protein response on human disease. J Cell Biol.
2012; 197:857–867. [PubMed: 22733998]
Winnay JN, Boucher J, Mori MA, Ueki K, Kahn CR. A regulatory subunit of phosphoinositide 3-
kinase increases the nuclear accumulation of X-box-binding protein-1 to modulate the unfolded
protein response. Nat Med. 2010; 16:438–445. [PubMed: 20348923]
Winnay JN, Dirice E, Liew CW, Kulkarni RN, Kahn CR. p85alpha deficiency protects beta-cells from
endoplasmic reticulum stress-induced apoptosis. Proc Natl Acad Sci U S A. 2014; 111:1192–1197.
[PubMed: 24395790]
Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K. XBP1 mRNA is induced by ATF6 and spliced
by IRE1 in response to ER stress to produce a highly active transcription factor. Cell. 2001;
107:881–891. [PubMed: 11779464]
Zhang K, Kaufman RJ. From endoplasmic-reticulum stress to the inflammatory response. Nature.
2008; 454:455–462. [PubMed: 18650916]
Zhou J, Ma J, Zhang BC, Li XL, Shen SR, Zhu SG, Xiong W, Liu HY, Huang H, Zhou M, et al.
BRD7, a novel bromodomain gene, inhibits G1-S progression by transcriptionally regulating some
important molecules involved in ras/MEK/ERK and Rb/E2F pathways. J Cell Physiol. 2004;
200:89–98. [PubMed: 15137061]
Zhou Y, Lee J, Reno C, Sun C, Park S, Chung J, Lee J, Fisher S, White M, Biddinger S, et al.
Regulation of glucose homeostasis through a XBP-1–FoxO1 interaction. Nature Medicine.
201110.1038/nm.2293

Park et al. Page 17
Highlights
• BRD7 interacts with p85α and p85β and increases their nuclear translocation.
• BRD7 increases the nuclear translocation of XBP1s in a p85-dependent manner.
• BRD7 levels are reduced in the liver of obese and diabetic mice.
• BRD7 re-establishes glucose homeostasis in obese and diabetic mice.


Park et al. Page 18
Figure 1. BRD7 binds to p85α and increases its nuclear translocation

(A) Immunoblotting for BRD7 and flag-tagged p85α proteins after immunoprecipitation of
p85α from 293HEK cells that were infected with Ad-BRD7 alone; or Ad-p85α-flag alone;
or Ad-BRD7 and Ad-p85α-flag. Total lysates were immunoblotted for BRD7 and tubulin.
(B) Immunoblots of flag-p85α and BRD7 after BRD7 immunoprecipitation from 293HEK
cells that were infected with the indicated adenoviruses. (C) Nuclear protein levels of p85α
in 293HEK cells infected with increasing doses of Ad-BRD7 and a constant dose of Ad-
p85α-flag. LaminA/C was used as a control for nuclear protein level. (D) Nuclear protein
levels of XBP-1s in 293HEK cells infected with increasing doses of Ad-BRD7 and a
constant dose of XBP1s. (E) Immunoblotting for BRD7 and XBP1s following
immunoprecipitation with XBP1-specific antibody. Total protein levels of BRD7 and

tubulin are shown below. (F) BRD7 immunoblotting after XBP1 immunoprecipitation from
DKD (p85α and p85β double knock down) and PLKO (control) cells that were infected with
Ad-BRD7 and Ad-XBP1s. Total protein amounts of p85s, BRD7, XBP1s, and tubulin are
shown below. (G) Immunoblotting for BRD7 protein after XBP1 immunoprecipitation from
DKO (p85α and p85β double knock out) and its control cells that were infected with Ad-
BRD7 and Ad-XBP1s. Total protein amounts of p85s, BRD7, XBP1 and tubulin are shown
below. (H) Nuclear protein amounts of XBP1s in PLKO and DKD cells infected with
increasing doses of Ad-BRD7 and a constant dose of XBP1s. NUP98 was used as a control
for nuclear protein level. (I) Western blot for XBP1s in PLKO and DKO cells infected with
Ad-BRD7 and Ad-XBP1s. LaminA/C was used as a control. Each experiments was
independently repeated three times.

Park et al. Page 19
Figure 2. BRD7 increases the nuclear translocation of XBP1s

(A) Flag-p85α and flag-XBP1s immunoblots after XBP1 immunoprecipitation from
cytoplasmic and nuclear protein fractions of 293HEK cells that were infected with Ad-
p85α-flag and Ad-XBP1s-flag; or together with Ad-BRD7. Total lysates were
immunoblotted for BRD7 and p85α. NUP98 and tubulin were used as a control for nuclear
and cytoplasmic protein levels, respectively. (B) BRD7 and flag-p85α immunoblots after
flag immunoprecipitation from cytoplasmic and nuclear protein fractions of 293HEK cells
that were infected with Ad-p85α-flag and Ad-BRD7, followed by insulin treatment at 500

Park et al. Page 20
nM for indicated times. Each cytoplasmic and nuclear protein lysates was immunoblotted
for BRD7, flag, and tubulin/or NUP98. (C) BRD7 immunoblotting in XBP1
immunoprecipitates after insulin (500 nM) stimulation. Protein lysates were immunoblotted
for indicated antibodies. (D) Nuclear protein amounts of p85α and p85β in 293HEK cells
infected with a constant dose of Ad-85α-flag and Ad-p85β-myc and increasing doses of Ad-
BRD7. (E) Expression levels of XBP1 target genes, Erdj4, Herp, and Ero1α in MEFs
infected with Ad-LacZ or Ad-BRD7. (F) Western blot analysis for nuclear XBP1s proteins
in 293HEK cells that were infected with the indicated adenoviruses. (G-I) Eight-week-old
male wild-type mice were injected with Ad-LacZshRNA or Ad-BRD7shRNA (1.5×108
pfu/g, n=6 for each group) through the tail vein. (G) Nuclear XBP1s protein amounts at 24
hours of fasting and during one hour of refeeding on day seven post-injection (left). NUP98
was used as a control. Quantification of the western blot showing the ratio of XBP1s to
NUP98 (right). (H) XBP1 mRNA splicing assay in Ad-LacZshRNA or Ad-BRD7shRNA
injected mice at 24 hours of fasting and one hour after refeeding. (I) Relative mRNA levels
of Erdj4, Herp, and CHOP in the liver of Ad-LacZshRNA or Ad-BRD7shRNA injected
mice after six hours of fasting. Error bars are represented as mean ± SEM., P values were
determined by Student's t-test. *P<0.05, **P <0.01, ***P <0.001. Each experiments was
independently repeated three times.

Park et al. Page 21
Figure 3. Restoration of BRD7 in the liver of the ob/ob mice improves glucose tolerance and
establishes euglycemia
(A) Total BRD7 protein amounts in the liver of lean wild-type and ob/ob mice at six hours
of fasting (top). Quantification of the western blot showing the ratio of BRD7 to tubulin
(bottom). (B) BRD7 mRNA levels in the wild-type and ob/ob mice's livers during 24 hours
of fasting and one and three hours of refeeding states. (C-G) Eight-week-old male ob/ob
mice were injected with Ad-BRD7 or Ad-LacZ (1×108 pfu/g, n=6 for each group) as a
control through the tail vein. (C) Blood glucose levels (mg/dl) after six hours fasting on day
three of the injections. (D) Glucose tolerance test (GTT) on day five post-injection (left).

Park et al. Page 22
Area under the curve of GTT (right). (E) Insulin tolerance test (ITT) on day seven post-
injection (left). Area under the curve of ITT (right). (F) In vivo insulin receptor signaling in
the liver of Ad-LacZ or Ad-BRD7 injected ob/ob mice on day eight after injection (left).
Quantifications of the western blots (right). (G) Immunoblots of IRS1, IRS2, and p85 after
p85 immunoprecipitation of the liver tissues that were infused with insulin in Ad-LacZ and
Ad-BRD7 injected ob/ob mice (left). Quantifications of the western blots (right). Error bars
are represented as mean ± SEM., P values in (B) and (C) were determined by Student's t-
test. Significance in (D) and (E) was determined by two-way ANOVA with Bonferroni
multiple-comparison analysis. *P<0.05, **P <0.01, ***P <0.001. Experiments were
repeated in three independent cohorts.

Park et al. Page 23
Figure 4. Restoration of BRD7 in the liver of the ob/ob mice releases ER stress and displays
improved phenotypes
Eight-week-old male ob/ob mice were injected with Ad-BRD7 or Ad-LacZ (1×108 pfu/g,
n=6 for each group) as a control through the tail vein. (A) Western blots for nuclear XBP1s
protein on day eight post-injection (top). Quantification of the western blot showing the ratio
of BRD7 to tubulin (bottom). (B-C) mRNA and protein levels of XBP1s target genes in the
liver of Ad-LacZ and Ad-BRD7 injected mice after six hours of fasting were analyzed by
qPCR (B) and western blot (C, left). Quantifications of the western blots (C, right). (D)
PERK phosphorylation on Thr980, total PERK, eIF2α phosphorylation on Ser51, and total
eIF2α protein levels in the liver of Ad-LacZ and Ad-BRD7 injected ob/ob mice were
analyzed by western blot. (E) Total and nuclear amounts of FoxO1 protein in the liver of
Ad-LacZ- or Ad-BRD7-injected ob/ob mice. (F) Relative mRNA levels of G6p, Fbp, and
Pepck. (G) Macroscopic view of the liver of Ad-LacZ injected (top) and Ad-BRD7 injected
(bottom) ob/ob mice. (H) H&E staining of liver sections in 4x (left) and 10x (right)
magnifications. (I) Triglyceride contents (mg/g) in the liver. (J) Relative mRNA levels of
Acc1, FasN, and Dgat2. Error bars are represented as mean ± SEM., P values were

Park et al. Page 24
determined by Student's t-test. (*p<0.05, **p<0.01, ***p<0.001). Experiments were

repeated in three independent cohorts.

Park et al. Page 25
Figure 5. Restoration of BRD7 in the liver of the diet-induced obese (DIO) mice improves glucose
tolerance and increases XBP1s nuclear translocation
(A) Total BRD7 protein amounts in the liver of lean wild-type that were fed either on
normal chow diet (NCD) or high fat diet (HFD) at six hours of fasting (left). Quantification
of the western blot showing the ratio of BRD7 to tubulin (right). (B) Western blot for BRD7
protein levels from the total lysates of wild-type (NCD), ob/ob, and HFD mice (left).
Tubulin was used as a control. Quantification of the western blot showing the ratio of BRD7
to tubulin (right). (C-H) Mice that were fed either on NCD or HFD were injected with Ad-
BRD7 or Ad-LacZ (5×107 pfu/g, n=6 for each group) through the tail vein. (C) The graph
shows the blood glucose levels (mg/dl) after six hour fasting on day three of the injections.
(D) Glucose tolerance test (GTT) on post-injection day five post-injection (left). Area under
the curve of GTT (right). (E) XBP1s nuclear protein amounts in the liver lysates (top).
Quantification of the western blot showing the ratio of XBP1s to tubulin (bottom). (F-H)
Mice were fasted for 24 hours and refed for 0 and 1 hour. Relative mRNA levels of Erdj4,

Park et al. Page 26
Herp, and Ero1α were determined by qPCR. Error bars are represented as mean ± SEM., P
values in (A-C and E-H) were determined by Student's t-test. Significance in (D) was
determined by two-way ANOVA with Bonferroni multiple-comparison analysis. *P<0.05,
**P <0.01, ***P <0.001. Experiments were repeated in three independent cohorts.

BRD7 Regulates XBP1s' Activity and Glucose Homeostasis Through Its Interaction With The Regulatory Subunits of PI3K

Uploaded by

Copyright:

Available Formats

BRD7 Regulates XBP1s' Activity and Glucose Homeostasis Through Its Interaction With The Regulatory Subunits of PI3K

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

BRD7 Regulates XBP1s' Activity and Glucose Homeostasis Through Its Interaction With The Regulatory Subunits of PI3K

Uploaded by

Copyright:

Available Formats

NIH Public Access

Cell Metab. 2014 July 1; 20(1): 73–84. doi:10.1016/j.cmet.2014.04.006.

BRD7 regulates XBP1s' activity and glucose homeostasis

Bromodomain-containing protein 7 (BRD7); X-box binding protein1 (XBP1); Endoplasmic

© 2014 Elsevier Inc. All rights reserved.

Cell Metab. Author manuscript; available in PMC 2015 July 01.

Bromodomain-containing protein 7 (BRD7) is a subunit of the polybromo-associated

regulation of XBP1s, ER stress, and glucose metabolism.

Cell Metab. Author manuscript; available in PMC 2015 July 01.

BRD7 and p85α are required for the activity of XBP1s

Cell Metab. Author manuscript; available in PMC 2015 July 01.

Cell Metab. Author manuscript; available in PMC 2015 July 01.

BRD7 overexpression in the liver of the ob/ob mice establishes euglycemia

Obesity is a condition of hyperinsulinemia and elevated ER stress. Therefore, we sought to

Cell Metab. Author manuscript; available in PMC 2015 July 01.

3F). However, AktThr308 and AktSer473 phosphorylations were significantly increased

Furthermore to investigate whether BRD7 overexpression increases the association of p85

Next, we sought to investigate whether an increase in BRD7 expression leads to increased

In parallel, we observed decreased PERK phosphorylation in Ad-BRD7 injected ob/ob

Restoration of BRD7 in the liver of DIO mice improves glucose metabolism

Cell Metab. Author manuscript; available in PMC 2015 July 01.

Cell Metab. Author manuscript; available in PMC 2015 July 01.

investigation is needed to understand the exact molecular mechanism by which insulin

mice, while increasing the insulin-stimulated Akt activation (IRS1→PI3K→Akt axis), it

Cell Metab. Author manuscript; available in PMC 2015 July 01.

has been suggested to be due to a reduction in ER stress-induced apoptosis (Winnay et al.,

establishing the metabolic homeostasis.

Cell Metab. Author manuscript; available in PMC 2015 July 01.

Nuclear protein extraction—For nuclear protein extraction from cells in 6 cm plate,

Immunoprecipitation—Lysates in RIPA buffer were incubated with antibody (0.3–0.6

Lysis of liver tissue—For direct immunoblotting, 50 mg of liver tissue was homogenized

Forward: 5′ACA CGC TTG GGA ATG GAC AC3′

Reverse: 5′CCA TGG GAA GAT GTT CTG GG3′

Cell Metab. Author manuscript; available in PMC 2015 July 01.

Production and transduction of shRNA lentivirus—293T cells were split in 10 cm

p85β were as follows:

Production of adenoviral vectors—Mouse BRD7 was obtained from performing PCR

Forward: 5′ATG GGC AAG AAG CAC AAG AA3′

Reverse: 5′TCA GCT CGC GTC AGG CCC AC3′

Adenovirus production—Adenovirus vector that contain a gene of p85α, p85β, BRD7,

Cell Metab. Author manuscript; available in PMC 2015 July 01.

Adenovirus transduction—To infect cells with adenoviruses, cells in 6 cm plates were

Adenovirus injection—Adenovirus was thawed at room temperature immediately before

Animal experiments—All the performed animal experiments were approved by Boston

Statistical analyses—Error bars represent the SEM. Statistical significance was

Cell Metab. Author manuscript; available in PMC 2015 July 01.

Drost J, Mantovani F, Tocco F, Elkon R, Comel A, Holstege H, Kerkhoven R, Jonkers J, Voorhoeve

Cell Metab. Author manuscript; available in PMC 2015 July 01.

Cell Metab. Author manuscript; available in PMC 2015 July 01.

Cell Metab. Author manuscript; available in PMC 2015 July 01.

• BRD7 increases the nuclear translocation of XBP1s in a p85-dependent manner.

• BRD7 re-establishes glucose homeostasis in obese and diabetic mice.

Cell Metab. Author manuscript; available in PMC 2015 July 01.

Figure 1. BRD7 binds to p85α and increases its nuclear translocation

immunoprecipitation with XBP1-specific antibody. Total protein levels of BRD7 and

Cell Metab. Author manuscript; available in PMC 2015 July 01.

Figure 2. BRD7 increases the nuclear translocation of XBP1s

Cell Metab. Author manuscript; available in PMC 2015 July 01.

Cell Metab. Author manuscript; available in PMC 2015 July 01.

determined by Student's t-test. (p<0.05, p<0.01, p<0.001). Experiments were