International Journal of Biological Macromolecules 242 (2023) 125211

Contents lists available at ScienceDirect

International Journal of Biological Macromolecules

journal homepage: www.elsevier.com/locate/ijbiomac

A CRISPR/Cas12a-based fluorescence aptasensor for the rapid and sensitive

detection of ampicillin
Bong Jing Yee a, Nurul Faizeemah Shafiqah a, Noor Faizah Mohd-Naim b,
Minhaz Uddin Ahmed a, *
a
Biosensors and Nanobiotechnology Laboratory, Chemical Science Programme, Faculty of Science, Universiti Brunei Darussalam, Jalan Tungku Link, Gadong, BE 1410,
Brunei Darussalam
b
PAPRSB Institute of Health Science, Univesiti Brunei Darussalam, Jalan Tungku Link, Gadong, BE 1410, Brunei Darussalam

A R T I C L E I N F O A B S T R A C T

Keywords: This study introduces CRISPR/Cas-based aptasensor for the highly sensitive and specific detection of the anti­
CRISPR/Cas12a biotic, ampicillin. Ampicillin (AMPI) is a commonly used antibiotic for treating pathogenic bacteria and is
Aptamers additionally added to livestock feed in agriculture. This study can enable early detection of antibiotic residues,
Ampicillin
prevent their accumulation in the environment, and ensure compliance with food safety regulations. Herein, the
Aptasensors
aptasensor was developed with the CRISPR/Cas system by utilizing three different ampicillin-specific aptamers,
each conjugated with a biotin at the 5′ -end. The ssDNA activator was bound to the aptamers through comple­
mentary base pairings. The attraction of the aptamers to the ampicillin target released the bound ssDNA, causing
the activation of the CRISPR/Cas system. The DNA reporter probe, labelled with Cy3 and a quencher, turns on
the fluorescence signal when cleaved by the activated Cas12a through trans-cleavage measured using a fluo­
rescence spectrophotometer at 590 nm. The fluorescence signal was linearly proportional to the ampicillin target
concentration with a 0.01 nM limit of detection and a read-out time of 30 min. This aptasensor showed high
sensitivity towards ampicillin even in the presence of other antibiotics. The method was also successfully
implemented for ampicillin detection in spiked food samples.

1. Introduction Cas12a (Cpf1) can cleave both double-stranded DNA (dsDNA) and
single-stranded DNA (ssDNA). In the dsDNA target, asymmetrical cuts
CRISPR-Cas is part of the adaptive (acquired) immune system that were created using a single CRISPR RNA (crRNA) with a T-rich proto­
store memories of interactions between bacterial and viral genetic ma­ spacer adjacent motif (PAM) sequence. Different to Cas9, target
terials, mainly mobile genetic elements (MGE), Unique spacer sequences sequence activation of Cas12a causes it to spontaneously cleave single-
were generated from MGE and introduced into the CRISPR arrays [1–5]. stranded DNA (trans-activity) in vitro [8–12]. CRISPR-Cas is widely used
The CRISPR-Cas systems have been classified into two classes based on in a variety of domains, particularly in therapeutic applications. The
the number of Cas genes and the structure of the interference complex. ability of the CRISPR-Cas system to recognize viral genetic material has
For example, class 1 CRISPR-Cas systems (types I, III, and IV) use multi- revolutionized medical diagnostic applications, providing accurate and
Cas protein complexes, whilst class 2 systems (types II, V, and VI) use a quick recognition of a pathogen in a few minutes with great sensitivity.
single effector protein [6,7]. Among the many Cas proteins that have Viral RNA was discovered by amplification using the nucleic acid
been identified, Cas9 and Cas12a (Cpf1) are the most widely used Cas sequence-based amplification (NASBA) method [13,14]. This study
proteins for genetic engineering, which are RNA-guided endonucleases found that combining NASBA with Cas9 has improved detection ca­
that cleave target DNA. In all CRISPR systems, gRNAs for Cas9 are made pacity and specificity [15]. The exponential amplification reaction
up of two independently expressed RNA elements: a trans-activating- (EXPAR) is another new, highly efficient, and fast isothermal amplifi­
crRNA (tracrRNA), which facilitates the Cas9-crRNA interaction, and a cation approach. The Cas9-initiated isothermal CAS-EXPAR and the
CRISPR RNA (crRNA), which is a 20-nucleotide (nt) bases complemen­ EXPAR amplification technique enable high-sensitivity pathogen iden­
tary to the target sequence. tification [16]. Cas13, on the other hand, has a similar “trans-cleavage

* Corresponding author.
E-mail address: [email protected] (M.U. Ahmed).

https://doi.org/10.1016/j.ijbiomac.2023.125211
Received 28 March 2023; Received in revised form 30 May 2023; Accepted 1 June 2023
Available online 2 June 2023
0141-8130/© 2023 Elsevier B.V. All rights reserved.
B.J. Yee et al. International Journal of Biological Macromolecules 242 (2023) 125211

activity” as Cas12, cleaving neighbouring non-specific ssDNA/RNA. This detection of biomarkers from various species, vastly increasing the
has been harnessed and applied in SHERLOCK (specific high-sensitivity CRISPR/Cas system's potential in bioanalysis [41].
enzymatic reporter UnLOCKing) and DETECTR (DNA endonuclease- Aptamers are short synthetic single-stranded DNA or RNA oligonu­
targeted CRISPR trans-reporter) technology. Both methods employed cleotides that are chosen from a random sequence library using sys­
fluorescently labelled ssDNA/RNA probes that, when cleaved by the Cas tematic evolution of ligands by exponential enrichment (SELEX)
enzyme will produce a measurable fluorescent signal [17–19]. The procedures [42]. Aptamers have high affinity and specificity towards a
development of SHERLOCK as a highly sensitive, practical, and inex­ range of target molecules, including proteins, enzymes, antigens, anti­
pensive technique provides an alternative for nucleotide identification biotics, toxins, pharmaceutical drugs, and viruses. Nucleic acid aptamers
based on the collateral properties of the CRISPR/Cas system [20,21]. In are becoming more appealing as alternatives to antibodies in applica­
the DETECTR system, the collateral cleavage activity of Cas12a was tions like treatment, imaging, diagnostics, and targeting. Two of the
utilized instead and as in the SHERLOCK method, RPA was used in this main issues with using antibodies in biosensor platforms are high pro­
assay to amplify the pathogen genetic materials [22,23]. duction costs and poor stability, which limits sensor shelf life and creates
RPA is a relatively new method for isothermal nucleic acid replica­ logistical difficulties for transit and storage. In reaction to biochemical
tion [24,25]. Conventionally, before RPA was discovered, polymerase interactions with target molecules, aptamers can assemble into sec­
chain reaction (PCR) was used as an amplification method. PCR is ondary or three-dimensional complexes, creating favourable binding
regarded as the “gold standard” in nucleic acid molecular studies [26], sites for analyte molecules to produce specific and ultrasensitive de­
but the PCR techniques rely on a thermocycler and a stable power tections [43,44].
supply, limiting their application to laboratories. Isothermal nucleic acid The utilization of CRISPR-Cas effectors in aptamer-based biosensing
amplification techniques, provide an alternative to the shortcomings of has undergone notable advancements. Incorporating aptamers for high-
PCR [27–29]. affinity detection of more diverse targets allows for direct measurement
A typical amplification-based workflow involves highly sensitive of the signal output because of aptamer binding to the target molecules
techniques that require sophisticated and costly laboratory equipment, and conveying it in CRISPR-Cas supported signal amplification by
as well as skilled personnel. Moreover, the additional process required collateral cleavage of ssDNA reporter. The integration of aptamers and
for gel detection can create potential sources of contamination in the CRISPR-Cas-based assays has provided a novel approach for detecting
setup area and reagents, thereby leading to false-positive data [30,31]. non-nucleic acid targets. The recent advancements in fluorophore-
In recent years, many novel approaches to addressing these challenges modified aptameric sensors have further augmented the versatility
have been evaluated. and simplicity of performing such assays. These sensors offer improved
CRISPR/Cas-based nucleic acid detection has attained good sensi­ sensitivity and compatibility with a broad range of signal detection
tivity, including at the aM level. The trans-cleavage activity of the devices, making them an ideal choice for streamlining the detection
CRISPR/Cas occurs at a high turnover rate. Typically, the Cas13a pro­ process. Multiple techniques have been developed for constructing
tein cleaves roughly 104 random RNA for every target RNA, resulting in CRISPR-Cas fluorescent sensors using aptamers, including via direct
massive signal amplification. However, the necessary pre-amplification detection, sandwich design, and detection driven by allosteric hairpins
procedures not only restricted its utilization due to the lengthy waiting (AH) [45]. Fluorescent spectroscopy-based detection offers a rapid and
period but also posed a risk of contamination [32,33]. When coupled improved limit of detection. A fluorescent reporter sequence, labelled
with other technologies such as electrochemical, optical, and colori­ with a fluorophore and quencher at each end, is employed for this
metric technologies, CRISPR-Cas systems could be used to develop technique.
amplification-free detection techniques and investigate their utility in β-lactam antibiotics, including Ampicillin (AMPI), have been exten­
diagnostics and beyond. The key feature of creating amplification-free sively used in medicine and agriculture to combat pathogenic bacteria
CRISPR-Cas system is to increase detection sensitivity with limited [46]. However, the overuse and dependence on these antibiotics in both
target nucleic acids. human medicine and the care of farm animals have contributed to the
An effective approach to creating amplification-free systems is to emergence of bacterial strains that are resistant to them. As a result,
decrease the reaction quantity to increase the target and enhance the there has been a rise in risk to customer and patient medical costs due to
limit of detection (LOD). A containment effect, for example, has been the clinical emergence of difficult-to-treat drug-resistant infections
recently introduced for single-molecule target RNA detection inspired (DRIs) [47,48]. Additionally, these residual antibiotics have been found
by the trans-cleavage of Cas13a. In contrast to the bulk reaction mixture, in meat, poultry, fish, and milk, which can pose risks, such as allergic
this developed picoliter-sized Cas13a system improves detection sensi­ reactions, respiratory problems, and seizures. Therefore, it is more
tivity by >10,000 times and allows absolute target quantitation [34,35]. critical than ever to identify these antibiotics rapidly and accurately to
The Cas12a-based amplification-free method is then created using the prevent the global spread of antimicrobial resistance.
same approach to conduct an ultra-localized droplet assay, yielding Here in this study, we demonstrated the first-ever detection of AMPI
single-molecule sensitivity for quantitative target DNA detection antibiotic using a CRISPR-Cas-based aptasensor. Additionally, our
[35–37]. innovative approach has enabled us to successfully characterize and
Sha et al. recently created casCRISPR, a sensitive and specific evaluate three distinct AMPI-based aptamers. We have not only
CRISPR-Cas-based biosensor for fast and precise miRNA detection that demonstrated the feasibility of this approach, but also its practicality by
does not require target amplification [38]. The casCRISPR system rea­ accurately detecting AMPI in food samples, including milk, eggs, and
ches a detection limit of 1.33 fM, which is 1000 times more sensitive honey. Our findings hold great promise for the development of future
than Cas13a by itself [39]. diagnostic tools that can revolutionize the field of antibiotic detection
CRISPR/Cas12a has recently been used to identify small molecules and combat the global threat of antimicrobial resistance.
and proteins to expand its utility. Because Cas12a cannot directly
identify analytes, various recognition components have been incorpo­ 2. Experimental section
rated into the Cas12a-based application. Liang et al., for example, used
bacterial allosteric transcription factors (aTFs) in Cas12a-based detec­ 2.1. Reagents and materials
tion to identify small organic compounds such as uric acid and p-
hydroxybenzoic acid [40]. In another study, Li et al. identified an effi­ The oligonucleotides employed in this experiment were procured
cient approach for establishing a connection between non-nucleic acid from Beijing SBS Genetech Co. Ltd. (China). The sequences of the re­
analytes and the CRISPR/Cas12a system using a set of functionalized, porter and three aptamers were obtained in accordance with their
aptamer-flanked activator DNA strands that allow for the ultrasensitive relevant references [36,37], while crRNA and activator DNA sequences

2
B.J. Yee et al. International Journal of Biological Macromolecules 242 (2023) 125211

were designed in our laboratory. The sequences are listed in Table 1. The recovered from the supernatant. To achieve this, Cas12a enzymes at a
compounds ampicillin sodium salt, chloramphenicol, kanamycin, peni­ concentration of 5 nM and single guide RNA (gRNA) at a concentration
cillin G, sulfadimethoxine, streptomycin, and amoxicillin were procured of 10 nM were added into a separate tube to form a Cas12a-gRNA
from Tokyo Chemical Industry Co., Ltd. (Japan). The Dynabeads™ complex, which was then combined with the supernatant and incu­
MyOne streptavidin magnetic beads (SMBs) were sourced from Invi­ bated at 37 ◦ C. Once the CRISPR-gRNA complex recognized the ssDNA
trogen by Thermo Fisher (U.S.A), while the Cas12a enzyme and NEB activator in the supernatant, it will be activated and cleaved the Cy3
buffer were obtained from New England Biolabs (NEB, U.S.A). For data fluorescence reporters randomly to combine with the Cas12a enzymatic
analysis, the Origin software produced by OriginLab Corporation was reaction. The FLUOStar Omega (BMGlabtech, Germany), a multimode
used and all statistical tests were done in GraphPad Prism software. microplate reader, was utilized to measure the level of fluorescence
emitted by the reporters.
2.2. Ampicillin Aptamer-Streptavidin Magnetic Beads (SMBs) Complex
2.5. Selectivity test of the CRISPR/Cas12a aptasensor
Prior to aptamer immobilization onto the surface of SMBs, washing
of the SMBs with the washing buffer is required. The washing buffer To verify the ability of the aptasensor to detect ampicillin, a selec­
(2×) is a buffered solution of 10 mM Tris-HCl (pH 7.5), 1 mM EDTA and tivity test was conducted. The Cas12a aptasensor system was exposed to
2 M NaCl, which is optimized to minimize non-specific binding of the various antibiotics, including chloramphenicol, kanamycin, penicillin G,
aptamer to the SMBs. This washing procedure is performed according to sulfadimethoxine, streptomycin, and amoxicillin, at a uniform concen­
the manufacturer's instructions. Specifically, 1 mL of SMBs from a stock tration 10× higher than the AMPI, which is at 5 μM. The reaction
solution of 10 mg/mL was subjected to wash with a 1× washing buffer mixture was incubated in a microplate at 37 ◦ C for 30 mins before
that was prepared by diluting from the 2× buffer prepared earlier with fluorescence signals was collected.
an equal volume of distilled water. The washed SMBs were then diluted
to a concentration of 1 mg/mL, and the remaining SMBs were stored at 2.6. Detection of antibiotics in real foods samples
3 ◦ C for future use. To create the ampicillin aptamer-activator ssDNA
complex, 0.5 μM of the ampicillin aptamer and 0.5 μM of the activator The practicality of the biosensor was further evaluated by testing its
ssDNA were mixed in 1× PBS and annealed using a Thermal Cycler effectiveness in detecting ampicillin in real food samples. Three food
(Veriti, Applied Biosystems, USA) at 95 ◦ C for 5 min. The resulting samples, namely fresh milk, raw egg white, and raw honey, were utilized
mixture was then cooled to 4 ◦ C. Subsequently, a 10 μl volume of the and procured from a local supermarket. Milk was subjected to pre-
ampicillin aptamer-activator ssDNA complex was combined with 10 μl treatment using the acid-base method [49]. Specifically, 10 μL of ace­
of SMBs at a concentration of 1 mg/mL. The mixture was then incubated tic acid was added to 1 mL of milk to induce protein coagulation. After
at room temperature for 30 min. Once incubation was completed, the vigorous vortexing for 3 mins, the milk protein was denatured, and the
unbound aptamer-activator ssDNA complexes were eliminated from the solution was centrifuged at 22 ◦ C for 3 mins at 5000 rpm to collect the
solution using magnetic separation. clear supernatant. The pH of the supernatant was neutralized with
NaOH and centrifuged again at 22 ◦ C for 3 mins at 5000 rpm. The
2.3. Ampicillin stock solution remaining supernatant was stored at − 30 ◦ C for future use. For real
sample analysis, the supernatant of the pre-treated milk samples was
To prepare ampicillin stock solutions, ampicillin sodium salt was spiked with different concentrations of ampicillin (1.5 and 3 nM) under
weighed and dissolved in distilled water to obtain a concentration of various dilutions (1:100, 1:1000, 1:1500 and 1:2000) in PBS buffer (1×
500 nM. The resulting stock solution was then stored at 3 ◦ C until further Phosphate Buffered Saline). The egg's yolk was separated from the
analysis. white. The raw egg white was homogenized and kept frozen at − 30 ◦ C.
The honey samples were stored at room temperature to prevent crys­
2.4. Detecting ampicillin using CRISPR/Cas12a powered aptasensor tallization. Both egg white and honey were also diluted with PBS buffer
(1× Phosphate Buffered Saline) without any prior treatment, at the ra­
To detect the presence of ampicillin, the ampicillin aptamer-SMB tios of 1:100, 1:1000, 1:1500, and 1:2000, and were subsequently spiked
complex was employed. The ampicillin stock solution, which had been with two different concentrations of ampicillin (1.5 nM and 3 nM).
previously prepared at a concentration of 500 nM, was mixed with the These spiked samples were subjected to the CRISPR/Cas12a aptasensor
ampicillin aptamer complex in a microcentrifuge tube and incubated at as described above.
room temperature for 30 mins. The ampicillin complexes that formed
were then isolated and collected with a magnet. The subsequent step 3. Results and discussion
involved signal amplification using the released ssDNA activator
3.1. Principle of CRISPR/Cas12a aptasensor
Table 1
List of sequences. An ssDNA activator-induced fluorescent signal was used to adapt and
modify a CRISPR/Cas12a aptasensor for detecting the antibiotic ampi­
No 5′ -Sequences used in the experiment- 3′
cillin. Data were recorded using a fluorescent probe, Cy3. The whole
1 Aptamer 1 CACGGCATGGTGGGCGTCGTG mechanism consisted of two main mechanisms: (1) An aptamer detec­
2 Aptamer 2 GCGGGCGGTTGTATAGCGG
tion system which was designed to specifically capture ampicillin con­
3 Aptamer 3 TTAGTTGGGGTTCAGTTGG
4 Aptamer 1 15nt GCCCACCATGCCGTG taining an ssDNA activator that was complementary to a part of the
ssDNA ampicillin aptamer, and (2) a reporter system consisting of a CRISPR/
5 Aptamer 2 15nt TATACAACCGCCCGC Cas12a complex, gRNA and a fluorescent ssDNA probe labelled with a
ssDNA pair of fluorophores (Cy3) and a quencher (BHQ). The modification of
6 Aptamer 3 15nt CTGAACCCCAACTAA
ssDNA
the aptamer was at the 3′ -end in which it had a biotin so that it was able
7 Aptamer 1 gRNA UAAUUUCUACUAAGUGUAGAUCACGGCAUGGUGGGC to interact and bind to the SMB.
8 Aptamer 2 gRNA UAAUUUCUACUAAGUGUAGAUGCGGGCGGUUGAUAU In the presence of ampicillin, the aptamer would recognize and bind
9 Aptamer 3 gRNA UAAUUUCUACUAAGUGUAGAUUUAGUUGGGGUUCAG to the target ampicillin via strong affinities through hydrogen bonding,
10 Reporter Cy3- TTTTAAAATTATA -BHQ2
electrostatic forces, and spatial matching [50]. As a result, the ssDNA
*Sequences in bold and underline: Sequence of gRNA. activator was dehybridized from the aptamer and released into the

3
B.J. Yee et al. International Journal of Biological Macromolecules 242 (2023) 125211

surroundings as freed ssDNA. After that, the released ssDNA was activities of CRISPR/Cas12a-guided fluorescent signal output. In this
recognized by the CRISPR/Cas12a complex, and in turn, triggered trans- case, different ssDNA activator analogues with varied complementarity
cleavage activity. In this case, the ssDNA fluorescent probes labelled to the gRNA (Table 1) were created and analyzed. The fluorescence
with Cy3 and BHQ-2 were cleaved to produce a significant increase in intensities induced by ssDNA activator of 15 nt length showed a
fluorescent signal. The fluorescence change in the system can determine significantly high signal, suggesting that activator 15 nt was likely
the presence and concentration of the target, as the emitted fluorescence recognized and in turn triggered trans-cleavage of CRISPR/Cas12a to cut
signal and intensity are directly proportional to the presence and con­ the DNA probe as shown in Fig. 2B (mean and SD fluorescent data of the
centration of activated Cas12a in the solution. This activation is strongly different ssDNA complementarity are shown in Supplementary Mate­
dependent on the amount of released ssDNA activator by the target rials Table S2). Additionally, this also proved that activator 15 nt is
ampicillin. In the absence of the ampicillin target, the aptamer directly highly specific to the gRNA designed in this experiment. Furthermore,
binds to the ssDNA activator, preventing its interaction with the the effect on the trans-cleavage abilities of other mutated ssDNA acti­
CRISPR/Cas12a complex. This prevents the Cas12a collateral cleavage vator analogues (10 nt, 5 nt and 2 nt) was also investigated. These
activity of the fluorescent probe, resulting in only a modest fluorescence mutated ssDNA activators had 10 nt, 5 nt and 2 nt bases identical to the
increment of the ssDNA fluorescent reporter. bases of activator 15 nt, respectively. The result showed that when the
Therefore, we can use this method to turn the CRISPR/Cas12a sys­ activator DNA has less complementarity, the fluorescence signal also
tem into a generic and rapid biosensor capable of quantifying ampicillin decreased dramatically. The responsiveness of the trans-cleavage activ­
targets. Fig. 1 depicts the schematic of the CRISPR/Cas12a aptasensor ities of the Cas12a to cleave the fluorescence probe fell as we observed
system. that the signal intensity was <50 % of the signal for the full comple­
mentary activator DNA when the number of base deletions reached 5 nt.
3.2. Verification of the CRISPR/Cas12a aptasensor It was obvious that to achieve signal amplification using ssDNA, the
integrity of ssDNA with gRNA was a crucial factor to trigger full CRISPR/
The proposed CRISPR/Cas12a aptasensor signal output comprised of Cas12a activation.
Cas12a, gRNA, ssDNA activator, and DNA probe. To validate the feasi­
bility of the aptasensor, the trans-cleavage ability of CRISPR/Cas12a was 3.3. Optimisation of the conditions for CRISPR/Cas12a aptasensor
evaluated. The results are presented in Fig. 2A, whereby a strong fluo­ detection
rescence signal was observed only when Cas12a, gRNA, ampicillin
target, ssDNA activator, and DNA probe were all present together. This To evaluate the detection efficacy and obtain optimum biosensor
indicates that the intact fluorescent DNA probe was cleaved by activated response, parameters such as (1) Cas12a concentration; (2) gRNA con­
Cas12a, leading to the separation of the Cy3 and BHQ-2 quencher. centration; (3) the molar ratio between gRNA and Cas12a; and (4) re­
Conversely, in the absence of any one of these components, the fluo­ porter concentration, were evaluated. We investigated the optimization
rescence intensity of the sample was low, indicating that Cas12a was not conditions of the CRISPR/Cas12a aptasensor with three different
activated, and the ssDNA probe's integrity was retained. The mean and aptamers. Each of the aptamers was modified at the 5′ -end to contain a
standard deviation fluorescent data of the different samples are shown in biotin molecule. The concentration of Cas12a was an important measure
Supplementary Materials, Table S1. that control not only the fluorescence intensity of the CRISPR/Cas12a-
As one of the main components in activating CRISPR/Cas12a, we dependent signal output but also the outcome of optimal ssDNA acti­
studied the influence of the ssDNA activator on the trans-cleavage vator degradation. From Fig. S1, the fluorescence intensity for the three

Fig. 1. Schematic diagram of CRISPR/Cas12a aptasensor for the detection of the antibiotic AMPI.
(a) Formation of the streptavidin-biotin aptamer ssDNA complex. (b) Recognition of the ampicillin by the aptamer. (c) Bound ssDNA activator was released from the
complex as freed ssDNA. (d)-(e) The ssDNA activator bound to the gRNA and activated the Cas12a trans-cleavage ability. The fluorescent probe (Cy3) was cleaved by
Cas12a and emitted a fluorescent signal. (f)-(h) The reaction was carried out in a microplate and the fluorescent signal was detected using a microplate reader.

4
B.J. Yee et al. International Journal of Biological Macromolecules 242 (2023) 125211

Fig. 2. A. Validation of the feasibility of CRISPR/Cas12a aptasensor under different conditions at 37 ◦ C for 1 h. In the absence of AMPI and gRNA, the fluorescence
intensities remained low (b-e). In contrast, upon the presence of AMPI and gRNA, the Cas12a-mediated cleavage was activated, generating a significantly high
fluorescent signal. n = 3 technical replicates (a). The means of samples are significantly different (One way ANOVA, **** P ≤ 0.0001).
B. The ability to activate the trans-cleavage of Cas12a of four activator ssDNA sequences (2 to 15 nt) that had 15, 10, 5 and 2 bases complementary to the gRNA bases
of the CRISPR/Cas12a aptasensor system. n = 3 technical replicates. The means of different ssDNA are significantly different (One way ANOVA, **** P ≤ 0.0001).

aptamers was optimized at the highest signal gain observed at a specific Apt 2 showed negligible fluorescence signal output, hence, we increased
Cas12a concentration (Mean and SD fluorescent data of the different the starting concentration of Cas12a and tested 10 nM, 20 nM, 30 nM,
Cas12a concentrations are shown in Supplementary Materials Table S7, 40 nM and 50 nM. At 20 nM of Cas12a, the fluorescence of the Cy3 DNA
S13, and S19). Various concentrations of Cas12a (5, 10, 20, 30, 40 and probe showed comparatively higher fluorescence intensity than the
50 nM) were added to the mixture of reaction solutions at fixed con­ other concentrations and the optimal Cas12a concentration with Apt 2
centrations (0.5 μM activator, 10 nM gRNA, 1.0 μM reporter). For Apt 1 was determined to be 20 nM. For all the experiments, the optimal con­
and Apt 3, when >5 nM of Cas12a was added into the mixture, the ditions of fluorescence intensities were determined by F–F0, where F
fluorescence intensities of the Cy3 DNA probe were reduced drastically, and F0 were the fluorescence intensities of the Cas12a aptasensor signal
with the signal at almost zero, particularly at 20 nM. However, at 5 nM output with and without the CRISPR/Cas12a, respectively.
of Cas12a, the fluorescence signal was at the highest (Fig. S1A, S1C). The optimal Cas12a-gRNA ratio plays an important role in achieving
Additionally, increasing Cas12a concentration did not further increase satisfactory performance in generating an optimal fluorescent signal.
the signal output even at 50 nM of Cas12a. As a result, in the following This is supported by published studies, whereby the following ratios of
experiments, the concentration of Cas12a was chosen as 5 nM for Apt 1 Cas12a: gRNA = 1:1.25 in the DETECTR strategy [51], Cas12a: gRNA =
and Apt 3. As for Apt 2, the concentration of Cas12a required was found 1:2 in the HOLMES strategy [52] and Cas12a: gRNA = 1:1 in the E-
to be higher than that of Apt 1 and Apt 3 (Fig. S1B). At 5 nM of Cas12a, CRISPR strategy were utilized [53]. We further investigated the ratio of

Fig. 3. Optimization of the experimental condi­

tions of the CRISPR/Cas12a aptasensor for the
three aptamers for the trans-cleavage activity of
ssDNA reporter probe. n = 3 technical replicates.
All fluorescent readings shown were carried out
in ambient room temperature (22 ◦ C) after 1 h of
incubation at 37 ◦ C. The means of each optimi­
zation are significantly different (p < 0.05).
Optimization of the molar ratio of gRNA to
Cas12a of (A) Apt1, (B) Apt2 and (C) Apt3. (D)
Optimization of the fluorescent probe concentra­
tion for the CRISPR/Cas12a aptasensor (One way
ANOVA, *P ≤ 0.05, **P ≤ 0.01, **** P ≤ 0.0001).

5
B.J. Yee et al. International Journal of Biological Macromolecules 242 (2023) 125211

gRNA to Cas12a ranging from 1:1 to 2:1 in combination with each ampicillin target within the given range. Fig. 4A presented a calibration
aptamer (Mean and SD fluorescent data of the gRNA to Cas12a ratios are curve for Apt 1, 2 and 3 plotted over a concentration range of 0 to 500
shown in Supplementary Materials, S3, S10 and S16). From Fig. 3A and nM of ampicillin. As can be seen in Fig. 4A, the fluorescence intensity of
C, it was observed that both Apt 1 and Apt 3 showed optimized fluo­ Apt 1 and 2 was proportional to the concentrations of ampicillin and R2,
rescence signal for gRNA: Cas12a at a molar ratio of 2:1, whereas Apt 2 which presented a value of 0.9567 and 0.981, respectively (Mean and SD
displayed the best performance at gRNA: Cas12a molar ratio of 2:2 fluorescent data of LOD are shown in Supplementary Materials Table S5,
(Fig. 3C). It was noted that both Apt 1 and Apt 3 required a higher S11, and S17). However, for Apt 3, the data points did not fit well into
concentration of gRNA to perform at the optimal level, which could be the linear range and showed a clustered distribution of the data points at
due to Apt 1 and 3 having better binding affinity when more gRNA was the lower concentration. Hence, for Apt 3, the distribution showed a
available compared to Cas12a. In the CRISPR/Cas12a aptasensor, the non-linear behaviour with an R2 observed as 0.5373. Taking into
efficiency of the CRISPR/Cas12a trans-cleavage activities highly consideration the results of the curve, a shorter calibration range of data
depended on the hybridization of the Cas12a enzyme with the gRNA to can be applied to obtain more accurate and reliable results.
form the Cas12a-crRNA ribonucleoprotein (RNP) complex [52]. The The limit of detection (LOD) was observed as 0.01 nM for Aptamer 1,
complex in turn determined the number of RuvC active sites for nuclei 2 and 3. Based on the yield of LOD at 0.01 nM, the concentration of the
acid target binding and the trans-cleavage performance of the system. ampicillin detected in all three aptamers is well below the recommended
Following the evaluation of the molar ratio for each of the aptamers, threshold limit set by the European Union (4 ppb) of foods for ampi­
the optimisation for the concentration of gRNA was investigated to cillin. This aptasensor also proved useful for the monitoring of ampicillin
achieve a satisfactory overall performance. This parameter was impor­ at the clinical level, as the highest concentration of ampicillin allowed in
tant because each aptamer would require a different concentration of humans is approximately 236 to 322 M [54,55].
gRNA for the trans-cleavage of the CRISPR/Cas12a system. Referring to In addition, a heat map is plotted for a more visual representation of
Fig. S2 (A, B and C), the evaluation of the optimal gRNA concentration the relationship between ampicillin concentrations and fluorescence
was performed with the Cas12a concentrations kept constant at 5 nM, signal generated by all three aptamers (Fig. 4B). Generally, the trend of
20 nM and 5 nM for Apt 1, 2 and 3, respectively. Having a constant fluorescence signal decreased as the ampicillin concentration decreased,
concentration of Cas12a would eliminate any bias in data and fairer which was indicated by the colour scale gradient for each aptamer.
comparison of results. Therefore, after comprehensive consideration, Furthermore, it was observed that Apt 1 and Apt 3 showed the highest
the concentration of gRNA needed to perform optimally for all aptamers fluorescence signal at higher concentrations of ampicillin, in comparison
was decided as (a) 10 nM of gRNA for Apt 1, (b) 20 nM of gRNA for Apt to Apt 2.
2, and (c) 10 nM of gRNA for Apt 3. (Mean and SD fluorescent data of the Table 2 summarized the different assays used to detect ampicillin
gRNA concentration are shown in Supplementary Materials Table S8, and compared the sensitivity of the different assays with this study. In
S14, and S20). Therefore, with this investigation of optimal gRNA comparison to the FET assay, this study has a relatively lower sensitivity
concentration, the result supported and correlated well with the opti­ but still performed better than other assays such as SERS, LC-MS/MS,
mization for the molar ratio of gRNA and Cas12a which was 2:1, 2:2 and and so on. More importantly, this study, in comparison to others, was
2:1 for Apt 1, 2 and 3, respectively. relatively simple to perform, rapid, and required a minimal number of
For the optimization of the probe concentration, the fluorescence steps and machines for detection.
response of the Cy3 fluorescence probe increased as the concentration of
the probe increased, and the optimal concentration of the probe was 3.5. Selectivity performance of the CRISPR/Cas12a aptasensor
determined as 1 μM, as shown in Fig. 3D.
Selectivity is another important factor to consider in designing
3.4. Determination of the quantification performance target-specific aptasensor. To evaluate the specificity of the aptasensor
in this experiment, a variety of five antibiotics such as amoxicillin,
Under the optimal conditions determined in the above sections, the chloramphenicol, sulfadimethoxine, streptomycin, and an analogue of
CRISPR/Cas12a aptasensor was exposed to different concentrations of penicillin G were applied to the aptasensor at the same concentration of
ampicillin to examine the linearity and sensitivity performance. A series ampicillin [56]. The results in Fig. 5 showed that in the presence of these
of different amounts of ampicillin (0.01–500 nM) was serially diluted compounds, the aptasensor showed a significantly low fluorescence
from stock solution and were added into the CRISPR/Cas12a aptasensor signal in comparison to when ampicillin was present (Mean and SD
system. The linearity explained the ability of the CRISPR/Cas12a apta­ fluorescent data of selectivity are shown in Supplementary Materials
sensor to be able to produce a directly proportional relationship of the Table S6, S12, and S18). This confirmed that the proposed aptasensor

Fig. 4. A. The fluorescence response obtained between the three aptamers and AMPI concentrations showed a linear regression. n = 3 technical replicates.
B. Heat Map corresponds to the relationship between AMPI concentration and fluorescence signal. The quantification of AMPI could be conveniently visualized for
each aptamer. Each colour block represents the fluorescent signal of the AMPI detected. n = 3 technical replicates.

6
B.J. Yee et al. International Journal of Biological Macromolecules 242 (2023) 125211

Table 2
Summary of the different methods for ampicillin detection.
Comparison of the different methods for ampicillin detection

No Assay Detection method Dynamic range LOD Real sample Response Ref
time

1 Liquid chromatography-tandem mass spectrometry (LC-MS/ Mass Spectrometry 4 × 105–25 × 0.14–59.8 Jawbone NR [57]
MS) 106 nM μM
2.0–1000 μM
1.0–495 μM
2 Field-effect transistor (FET) FET NR 5.56 × 10− 7 River water 3 min [58]
μM
3 Micellar electrokinetic chromatography with ultraviolet UV–Vis NR 0.22–0.48 Water 30 min [59]
(MEKC-UV) μM
4 Surface-enhanced Raman scattering (SERS) Handheld Raman NR 1.3 μM Water NR [60]
5 Liquid chromatographic with ultraviolet (HPLC-UV) and UV & Tandem Mass 100 nM– 0.091 μM Bovine milk 1.3 min [61]
Tandem mass spectrometry (LC-MS/MS) Spectrometry 105 nM 8.7 × 10− 3 0.63 min
μM
6 CRISPR/Cas12a Aptasensor Fluorescence 0.01 nM – 500 1 × 10− 5 μM Milk, Eggs & 30 min This
Spectroscopy nM Honey study

*LC-MS/MS- Liquid chromatography–mass spectrometry (LC–MS)- Mass spectrometry (MS).

*FET- The Field-Effect Transistor.
*SERS- Surface-Enhanced Raman Spectroscopy/ Surface-Enhanced Raman Scattering (SERS).

Fig. 5. The selectivity of the CRISPR/

Cas12a aptasensor was assessed using three
aptamers against various antibiotics,
including chloramphenicol, sulfadimethox­
ine, streptomycin, amoxicillin, and penicillin
G. n = 3 technical replicates. The antibiotics
analogues were prepared at 10× times
higher concentration than AMPI. The results
indicated that all three aptamers exhibited
specificity towards AMPI. (A). Apt1, (B)
Apt2 and (C) Apt3. All the means of the
fluorescent data of each aptamer in the
selectivity test are compared to the fluores­
cence signal of AMPI and are significantly
different. (One way ANOVA, **** P ≤
0.0001).

has superior specificity for ampicillin, making it suitable for the quan­ following formula shown below and the RSD was in the range of 1.7 %–
tification and monitoring of ampicillin levels and hinted at its potential 9.5 %. The recovery % data was given in Table 3. (Mean and SD fluo­
application in real sample testing. rescent data of real sample analysis are shown in Supplementary Ma­
terials Table S21, S22, and S23).
3.6. Real sample analysis Spiked concentration
Recovery (%) = × 100%
Expected concentration
The recoveries of AMPI for different matrices were calculated using
different food samples. The presence of matrix effects allowed us to Therefore, the CRISPR-Cas aptasensor could be adopted for the quanti­
evaluate the described biosensor which plays a crucial role in the ac­ fication of AMPI residues in complex food samples.
curacy of quantitative data obtained by this technique. The spike re­
covery was used to evaluate the accuracy and precision of this method 4. Conclusion
by carrying out two different spike levels. The recovery of AMPI in
different matrices was calculated using spiked food samples at 1.5 and 3 In this study, ampicillin was successfully detected with a rapid
nM. The average recovery percentage was calculated to be between aptasensor based on the CRISPR/Cas12a system. The fluorescence signal
109.3 ± 4.9 %. The recovery percentage was calculated using the was produced from the trans-cleavage of ssDNA reporter probes when

7
B.J. Yee et al. International Journal of Biological Macromolecules 242 (2023) 125211

Table 3
Mean recovery (%) and RSD (%) of the selected spiked food samples using the Aptamer 1.
No Samples Dilution Spiked concentration (nM) Concentration found (nM) Recovery (%) R.S.D1 (%)

1 Fresh Milk 1:1000 1.5 1.9 125.6 5.8

3 3.0 101.6 3.6
2 Honey 1:1000 1.5 1.7 113.8 1.7
3 2.7 90.0 9.5
3 Raw Egg white 1:100 1.5 1.9 125.6 5.8
3 3.0 99.2 3.2

R.S.D1 = Relative standard deviation.

the Cas12a was activated by the target ssDNA sequence upon aptamer References
interaction with AMPI. The fluorescence signal response showed a
strong linear relationship with the concentration AMPI at as low as 0.01 [1] F. Hille, E. Charpentier, CRISPR-Cas: biology, mechanisms and relevance, Phil.
Trans. R. Soc. B 371 (1707) (Nov. 2016) 20150496, https://doi.org/10.1098/
nM. Moreover, the aptasensor demonstrated specificity for ampicillin in rstb.2015.0496.
comparison to other antibiotics targets. Additionally, it has the potential [2] D. Rath, L. Amlinger, A. Rath, M. Lundgren, The CRISPR-Cas immune system:
to be used for assessing AMPI in real sample analysis. The specificity of biology, mechanisms and applications, Biochimie 117 (Oct. 2015) 119–128,
https://doi.org/10.1016/j.biochi.2015.03.025.
the aptamers and CRISPR-Cas system complement each other perfectly [3] T. Dimitriu, M.D. Szczelkun, E.R. Westra, Evolutionary ecology and interplay of
for it to be easily adapted for the development of highly sensitive and prokaryotic innate and adaptive immune systems, Curr. Biol. 30 (19) (Oct. 2020)
rapid biosensors. By utilizing their respective aptamers without R1189–R1202, https://doi.org/10.1016/j.cub.2020.08.028.
[4] J.E. Egido, A.R. Costa, C. Aparicio-Maldonado, P.-J. Haas, S.J.J. Brouns,
complicated chemical modifications, other small molecules can be Mechanisms and clinical importance of bacteriophage resistance, FEMS Microbiol.
detected, thereby providing a reliable and simplified detection system in Rev. 46 (1) (2022), https://doi.org/10.1093/femsre/fuab048.
clinical, agricultural, and environmental monitoring. [5] E.v. Koonin, K.S. Makarova, Origins and evolution of CRISPR-Cas systems, Phil.
Trans. R. Soc. B 374 (1772) (May 2019) 20180087, https://doi.org/10.1098/
Throughout this study, it was determined that different aptamers
rstb.2018.0087.
targeting the same molecules, in this case, ampicillin, have different [6] K.S. Makarova, et al., An updated evolutionary classification of CRISPR–Cas
binding properties under various conditions such as concentration of systems, Nat. Rev. Microbiol. 13 (11) (Nov. 2015) 722–736, https://doi.org/
target analyte, Cas12a and gRNA, affecting the sensitivity and selectivity 10.1038/nrmicro3569.
[7] K.S. Makarova, et al., Evolution and classification of the CRISPR–Cas systems, Nat.
of the aptamers. In this study, Aptamer 1 had the most satisfactory Rev. Microbiol. 9 (6) (Jun. 2011) 467–477, https://doi.org/10.1038/nrmicro2577.
performance under the optimized conditions in terms of sensitivity [8] N.S. McCarty, A.E. Graham, L. Studená, R. Ledesma-Amaro, Multiplexed CRISPR
because it has the highest fluorescent signal and the most linear corre­ technologies for gene editing and transcriptional regulation, Nat. Commun. 11 (1)
(Mar. 2020) 1281, https://doi.org/10.1038/s41467-020-15053-x.
lation with AMPI concentration with an R2 value of 0.957. In the future, [9] A.R. Krysler, C.R. Cromwell, T. Tu, J. Jovel, B.P. Hubbard, Guide RNAs containing
researchers developing novel aptasensor integrating the CRISPR/Cas12a universal bases enable Cas9/Cas12a recognition of polymorphic sequences, Nat.
platform can take into consideration these factors in the assessment of Commun. 13 (1) (Mar. 2022) 1617, https://doi.org/10.1038/s41467-022-29202-x.
[10] F. Jiang, K. Zhou, L. Ma, S. Gressel, J.A. Doudna, A Cas9–guide RNA complex
the efficacy of an aptamer to ensure more effective resource manage­ preorganized for target DNA recognition, Science 348 (6242) (Jun. 2015)
ment [63]. With this, the effort to screen for more novel aptamers in the 1477–1481, https://doi.org/10.1126/science.aab1452.
future is necessary. Also, approaches to developing CRISPR-based bio­ [11] S.-Y. Li, Q.-X. Cheng, J.-K. Liu, X.-Q. Nie, G.-P. Zhao, J. Wang, CRISPR-Cas12a has
both cis- and trans-cleavage activities on single-stranded DNA, Cell Res. 28 (4)
sensors that offer low-cost, portable, and readily scaled methods are (Apr. 2018) 491–493, https://doi.org/10.1038/s41422-018-0022-x.
encouraged because fluorescent signal output usually requires bulky and [12] R. Banakar, M. Schubert, M. Collingwood, C. Vakulskas, A.L. Eggenberger,
expensive machines. Other outputs such as colorimetric that require less K. Wang, Comparison of CRISPR-Cas9/Cas12a ribonucleoprotein complexes for
genome editing efficiency in the rice phytoene desaturase (OsPDS) gene, Rice 13
consumption of sample and reagent for the detection provide an alter­
(1) (Dec. 2020) 4, https://doi.org/10.1186/s12284-019-0365-z.
native for detecting a wide range of targets with excellent sensitivity and [13] A.K. Singh, S. Naskar, P.W. Ramteke, R. Kumar, Nucleic Acid Sequence-Based
specificity, but at a lower cost [65]. Therefore, considering the pros and Amplification (NASBA) Methods and CRISPR/Cas13 System to Detect Pig Viral
cons of different detection methods is a crucial factor in the development Diseases, 2022, pp. 151–157, https://doi.org/10.1007/978-1-0716-2043-4_10.
[14] A. Rajan, S. Shrivastava, Janhawi, A. Kumar, A.K. Singh, P.K. Arora, CRISPR-Cas
of novel biosensors [62], [64]. system: from diagnostic tool to potential antiviral treatment, Appl. Microbiol.
Biotechnol. 106 (18) (Sep. 2022) 5863–5877, https://doi.org/10.1007/s00253-
Declaration of competing interest 022-12135-2.
[15] F. Jia, X. Li, C. Zhang, X. Tang, The expanded development and application of
CRISPR system for sensitive nucleotide detection, Protein Cell 11 (9) (Sep. 2020)
The authors declare that they have no known competing financial 624–629, https://doi.org/10.1007/s13238-020-00708-8.
interests or personal relationships that could have appeared to influence [16] M. Huang, X. Zhou, H. Wang, D. Xing, Clustered regularly interspaced short
palindromic repeats/Cas9 triggered isothermal amplification for site-specific
the work reported in this paper. nucleic acid detection, Anal. Chem. 90 (3) (Feb. 2018) 2193–2200, https://doi.
org/10.1021/acs.analchem.7b04542.
Acknowledgement [17] J.S. Chen, et al., CRISPR-Cas12a Target Binding Unleashes Indiscriminate Single-
stranded DNase activity vol. 360, no. 6387, Apr. 2018, pp. 436–439, https://doi.
org/10.1126/science.aar6245.
This work was partly supported by the Universiti Brunei Dar­ [18] J.S. Gootenberg, et al., Nucleic acid detection with CRISPR-Cas13a/C2c2, Science
ussalam's research grant UBD/RSCH/1.4/FICBF(b)/2020/025, UBD/ 356 (6336) (Apr. 2017) 438–442, https://doi.org/10.1126/science.aam9321.
[19] F. Safari, M. Afarid, B. Rastegari, A. Borhani-Haghighi, M. Barekati-Mowahed,
RSCH/1.4/FICBF(b)/2022/047, and Brunei Research Council BRC-10.
A. Behzad-Behbahani, CRISPR systems: novel approaches for detection and
combating COVID-19, Virus Res. 294 (Mar. 2021) 198282, https://doi.org/
Appendix A. Supplementary data 10.1016/j.virusres.2020.198282.
[20] M.J. Kellner, J.G. Koob, J.S. Gootenberg, O.O. Abudayyeh, F. Zhang, SHERLOCK:
nucleic acid detection with CRISPR nucleases, Nat. Protoc. 14 (10) (Oct. 2019)
Supplementary data to this article can be found online at https://doi. 2986–3012, https://doi.org/10.1038/s41596-019-0210-2.
org/10.1016/j.ijbiomac.2023.125211. [21] J.S. Gootenberg, O.O. Abudayyeh, M.J. Kellner, J. Joung, J.J. Collins, F. Zhang,
Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and
Csm6, Science 360 (6387) (Apr. 2018) 439–444, https://doi.org/10.1126/science.
aaq0179.
[22] J.-H. Tsou, Q. Leng, F. Jiang, A CRISPR test for detection of circulating nuclei acids,
Transl. Oncol. 12 (12) (Dec. 2019) 1566–1573, https://doi.org/10.1016/j.
tranon.2019.08.011.

8
B.J. Yee et al. International Journal of Biological Macromolecules 242 (2023) 125211

[23] M.I. Mustafa, A.M. Makhawi, SHERLOCK and DETECTR: CRISPR-Cas systems as [45] U.S. Kadam, Y. Cho, T.Y. Park, J.C. Hong, Aptamer-based CRISPR-Cas powered
potential rapid diagnostic tools for emerging infectious diseases, J. Clin. Microbiol. diagnostics of diverse biomarkers and small molecule targets, Appl. Biol. Chem. 66
59 (3) (Feb. 2021), https://doi.org/10.1128/JCM.00745-20. (1) (Feb. 2023) 13, https://doi.org/10.1186/s13765-023-00771-9.
[24] O. Piepenburg, C.H. Williams, D.L. Stemple, N.A. Armes, DNA detection using [46] B. Yang, D. Fang, Q. Lv, Z. Wang, Y. Liu, Targeted therapeutic strategies in the
recombination proteins, PLoS Biol. 4 (7) (Jun. 2006), e204, https://doi.org/ battle against pathogenic bacteria, Front. Pharmacol. 12 (May 2021), https://doi.
10.1371/journal.pbio.0040204. org/10.3389/fphar.2021.673239.
[25] I.M. Lobato, C.K. O’Sullivan, Recombinase polymerase amplification: basics, [47] M.D. Barton, Antibiotic use in animal feed and its impact on human healt, Nutr.
applications and recent advances, TrAC Trends Anal. Chem. 98 (Jan. 2018) 19–35, Res. Rev. 13 (2) (Dec. 2000) 279–299, https://doi.org/10.1079/
https://doi.org/10.1016/j.trac.2017.10.015. 095442200108729106.
[26] B.B. Oliveira, B. Veigas, P.V. Baptista, Isothermal amplification of nucleic acids: the [48] M.D. Simmons, L.M. Miller, M.O. Sundström, S. Johnson, Aptamer-based detection
race for the next ‘gold standard’, Front. Sensors 2 (Sep. 2021) https://doi.org/ of ampicillin in urine samples, Antibiotics 9 (10) (Sep. 2020) 655, https://doi.org/
10.3389/fsens.2021.752600. 10.3390/antibiotics9100655.
[27] H. Deng, Z. Gao, Bioanalytical applications of isothermal nucleic acid amplification [49] Z. Qie, et al., Pretreatment-integration for milk protein removal and device-
techniques, Anal. Chim. Acta 853 (Jan. 2015) 30–45, https://doi.org/10.1016/j. facilitated immunochromatographic assay for 17 items, Sci. Rep. 9 (1) (Aug. 2019)
aca.2014.09.037. 11630, https://doi.org/10.1038/s41598-019-47692-6.
[28] Y. Zhao, F. Chen, Q. Li, L. Wang, C. Fan, Isothermal amplification of nucleic acids, [50] S. Cai, J. Yan, H. Xiong, Y. Liu, D. Peng, Z. Liu, Investigations on the interface of
Chem. Rev. 115 (22) (Nov. 2015) 12491–12545, https://doi.org/10.1021/acs. nucleic acid aptamers and binding targets, Analyst 143 (22) (2018) 5317–5338,
chemrev.5b00428. https://doi.org/10.1039/C8AN01467A.
[29] J. Glökler, T.S. Lim, J. Ida, M. Frohme, Isothermal amplifications – a [51] J.S. Chen, et al., CRISPR-Cas12a target binding unleashes indiscriminate single-
comprehensive review on current methods, Crit. Rev. Biochem. Mol. Biol. 56 (6) stranded DNase activity, Science 360 (6387) (Apr. 2018) 436–439, https://doi.
(Nov. 2021) 543–586, https://doi.org/10.1080/10409238.2021.1937927. org/10.1126/science.aar6245.
[30] J.J. Maurer, Rapid detection and limitations of molecular techniques, Annu. Rev. [52] S.-Y. Li, Q.-X. Cheng, J.-K. Liu, X.-Q. Nie, G.-P. Zhao, J. Wang, CRISPR-Cas12a has
Food Sci. Technol. 2 (1) (Apr. 2011) 259–279, https://doi.org/10.1146/annurev. both cis- and trans-cleavage activities on single-stranded DNA, Cell Res. 28 (4)
food.080708.100730. (Apr. 2018) 491–493, https://doi.org/10.1038/s41422-018-0022-x.
[31] R. Martzy, C. Kolm, R. Krska, R.L. Mach, A.H. Farnleitner, G.H. Reischer, [53] Y. Dai, et al., Exploring the trans-cleavage activity of CRISPR-Cas12a (cpf1) for the
Challenges and perspectives in the application of isothermal DNA amplification development of a universal electrochemical biosensor, Angew. Chem. Int. Ed. 58
methods for food and water analysis, Anal. Bioanal. Chem. 411 (9) (Mar. 2019) (48) (Nov. 2019) 17399–17405, https://doi.org/10.1002/anie.201910772.
1695–1702, https://doi.org/10.1007/s00216-018-1553-1. [54] M.D. Simmons, L.M. Miller, M.O. Sundström, S. Johnson, Aptamer-based detection
[32] J. Zhang, et al., Recent improvements in CRISPR-based amplification-free pathogen of ampicillin in urine samples, Antibiotics 9 (10) (Sep. 2020) 655, https://doi.org/
detection, Front. Microbiol. 12 (Sep. 2021), https://doi.org/10.3389/ 10.3390/antibiotics9100655.
fmicb.2021.751408. [55] B.R. Meyers, P. Wilkinson, M.H. Mendelson, S. Walsh, C. Bournazos, S.
[33] S. Qian, et al., Advances in amplification-free detection of nucleic acid: CRISPR/ Z. Hirschman, Pharmacokinetics of ampicillin-sulbactam in healthy elderly and
Cas system as a powerful tool, Anal. Biochem. 643 (Apr. 2022), 114593, https:// young volunteers, Antimicrob. Agents Chemother. 35 (10) (Oct. 1991) 2098–2101,
doi.org/10.1016/j.ab.2022.114593. https://doi.org/10.1128/AAC.35.10.2098.
[34] T. Tian, et al., An Ultralocalized Cas13a assay enables universal and nucleic acid [56] B.A. Cunha, Aminopenicillins in urology, Urology 40 (2) (Aug. 1992) 186–190,
amplification-free single-molecule RNA diagnostics, ACS Nano 15 (1) (Jan. 2021) https://doi.org/10.1016/0090-4295(92)90525-2.
1167–1178, https://doi.org/10.1021/acsnano.0c08165. [57] M. Stapf, A. Straub, M. Fischer, C. Linz, S. Hartmann, O. Scherf-Clavel, A liquid
[35] J. Zhang, et al., Recent improvements in CRISPR-based amplification-free pathogen chromatography-tandem mass spectrometry method for the quantification of
detection, Front. Microbiol. 12 (Sep. 2021), https://doi.org/10.3389/ ampicillin/sulbactam and clindamycin in jawbone, plasma, and platelet-rich fibrin:
fmicb.2021.751408. application to patients with osteonecrosis of the jaw, J. Pharm. Biomed. Anal. 224
[36] H. Yue, et al., Droplet Cas12a assay enables DNA quantification from unamplified (Feb. 2023), 115167, https://doi.org/10.1016/j.jpba.2022.115167.
samples at the single-molecule level, Nano Lett. 21 (11) (Jun. 2021) 4643–4653, [58] X. Wei, et al., Fast, specific, and ultrasensitive antibiotic residue detection by
https://doi.org/10.1021/acs.nanolett.1c00715. monolayer WS2-based field-effect transistor sensor, J. Hazard. Mater. 443 (Feb.
[37] Y. Dai, et al., Exploring the trans-cleavage activity of CRISPR-Cas12a (cpf1) for the 2023), 130299, https://doi.org/10.1016/j.jhazmat.2022.130299.
development of a universal electrochemical biosensor, Angew. Chem. 131 (48) [59] A. Šlampová, P. Kubáň, Micro-electromembrane extraction through volatile free
(Nov. 2019) 17560–17566, https://doi.org/10.1002/ange.201910772. liquid membrane for the determination of β-lactam antibiotics in biological and
[38] J.T. Granados-Riveron, G. Aquino-Jarquin, CRISPR/Cas13-based approaches for environmental samples, Talanta 252 (Jan. 2023), 123831, https://doi.org/
ultrasensitive and specific detection of microRNAs, Cells 10 (7) (Jul. 2021) 1655, 10.1016/j.talanta.2022.123831.
https://doi.org/10.3390/cells10071655. [60] K. Karn-orachai, A. Ngamaroonchote, A label-free and selective SERS-based sensor
[39] Y. Sha, et al., Cascade CRISPR/cas enables amplification-free microRNA sensing for determination of ampicillin contamination in water using a fabric gold–silver
with fM-sensitivity and single-base-specificity, Chem. Commun. 57 (2) (2021) alloy substrate with a handheld Raman spectrometer, New J. Chem. 47 (6) (2023)
247–250, https://doi.org/10.1039/D0CC06412B. 2758–2770, https://doi.org/10.1039/D2NJ05346B.
[40] M. Liang, et al., A CRISPR-Cas12a-derived biosensing platform for the highly [61] I. Kiszkiel-Taudul, B. Starczewska, M. Jarosz, Microextraction of ampicillin from
sensitive detection of diverse small molecules, Nat. Commun. 10 (1) (Aug. 2019) bovine milk using ionic liquids and deep eutectic solvents prior to its
3672, https://doi.org/10.1038/s41467-019-11648-1. chromatographic determination with ultraviolet and tandem mass spectrometry
[41] H. Li, M. Li, Y. Yang, F. Wang, F. Wang, C. Li, Aptamer-linked CRISPR/Cas12a- detection, J. Food Compos. Anal. 115 (Jan. 2023), 104944, https://doi.org/
based immunoassay, Anal. Chem. 93 (6) (Feb. 2021) 3209–3216, https://doi.org/ 10.1016/j.jfca.2022.104944.
10.1021/acs.analchem.0c04687. [62] B. Purohit, P.R. Vernekar, N.P. Shetti, P. Chandra, Biosensor nanoengineering:
[42] C. Padmakumari Kurup, S. Abdullah Lim, M.U. Ahmed, Nanomaterials as signal design, operation, and implementation for biomolecular analysis, Sensors Int. 1
amplification elements in aptamer-based electrochemiluminescent biosensors, (2020), 100040, https://doi.org/10.1016/j.sintl.2020.100040.
Bioelectrochemistry 147 (Oct. 2022), 108170, https://doi.org/10.1016/j. [63] T.K. Sharma, et al., Aptamer-mediated ‘turn-off/turn-on’ nanozyme activity of gold
bioelechem.2022.108170. nanoparticles for kanamycin detection, Chem. Commun. 50 (100) (2014)
[43] V. Thiviyanathan, D.G. Gorenstein, Aptamers and the next generation of diagnostic 15856–15859, https://doi.org/10.1039/C4CC07275H.
reagents, Proteomics Clin. Appl. 6 (11–12) (Dec. 2012) 563–573, https://doi.org/ [64] K. Mahato, P.K. Maurya, P. Chandra, Fundamentals and commercial aspects of
10.1002/prca.201200042. nanobiosensors in point-of-care clinical diagnostics, 3 Biotech 8 (3) (Mar. 2018)
[44] C.P. Kurup, N.F. Mohd-Naim, N.A. Keasberry, S.N.A. Zakaria, V. Bansal, M. 149, https://doi.org/10.1007/s13205-018-1148-8.
U. Ahmed, Label-free electrochemiluminescence nano-aptasensor for the [65] P. Chandra, Nanobiosensors for Personalized and Onsite Biomedical Diagnosis,
ultrasensitive detection of ApoA1 in human serum, ACS Omega 7 (43) (Nov. 2022) 2016.
38709–38716, https://doi.org/10.1021/acsomega.2c04300.