Scribd
Upload
87 views3 pages

Molecular Basis of Inheritance Ws-2

Uploaded by

p8105274
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
87 views3 pages

Molecular Basis of Inheritance Ws-2

Uploaded by

p8105274
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 3

Molecular basis of Inheritance

Worksheet - 2
I. MCQs (Multiply choice questions)

1.The DNA of a certain organism has cytosine as 20% of its bases. What percentage of its bases
would be thymine?
a) 80% b) 30% c) 20% d) 10%

2. Pyrimidines in DNA are:


a) Adenine and guanine b) Cytosine and thymine
c) Adenine and thymine d) Thymine and uracil

3. Each new amino acid is added to a growing protein by


a) an ionic bond b) an RNA bond c) a peptide bond d) a hydrogen bond

4.In a DNA strand the two nucleotides are linked together by:
a. glycosidic bonds b. phosphodiester bonds
c. peptide bonds d. hydrogen bonds

5.A nucleoside differs from a nucleotide. It lacks the:


a. base b. sugar c. phosphate group d. hydroxyl group

6.Both deoxyribose and ribose belong to a class of sugars called:


a. trioses b. hexoses c. pentoses d. polysaccharides

7.The fact that a purine base is always paired through hydrogen bonds with a pyrimidine base leads to, in the DNA
double helix:
a. the antiparallel nature b. the semiconservative nature
c. uniform width throughout DNA d. uniform length in all DNA

8.The net electric charge on DNA and histones is:


a. both positive b. both negative c. negative and positive, respectively d. zero

9.The promoter site and the terminator site for transcription are located at:
a. 3′ (downstream) end and 5′ (upstream) end, respectively of the transcription unit
b. 5′ (upstream) end and 3′ (downstream) end, respectively of the transcription unit
c. the 5′ (upstream) end d. the 3′ (downstream) end

10. In which year, the mechanism for genetic inheritance reached the molecular level?
a) 1986 b) 1999 c) 1926 d) 1945

II.Fill in the blanks


1.
DNA

mRNA G G U G U A A U U
anticodon
amino acid
2. In a DNA molecule, the phosphate group is attached to carbon ........... of the sugar residue of its own nucleotide and
carbon .................. B ............. of the sugar residue of the next nucleotide............C.........by bonds.

3. The fully processed hnRNA, called..........A.............. is transported out of the ............ B............... into the .....C..... for
translation

4. The strand which do not code for any protein is called........

5. In bacteria, the transcription and translation takes place in the same compartment because.......

III. Assertion and Reasoning


a. Both assertion and reason are true, and the reason is the correct explanation of the assertion.
b. Both assertion and reason are true, but the reason is not the correct explanation of the assertion.
c. Assertion is true but reason is false. d. Both assertion and reason are false

1.Assertion: A codon is unambiguous


Reason: Some amino acids are coded by more than one codon

2. Assertion: Amino acids are added one by one and translated into a polypeptide.
Reason: The ribosome moves from codon to codon along the Mrna
3.Assertion: Replication and transcription occur in the nucleus but translation occurs in the cytoplasm.
Reason : mRNA is transferred from the nucleus into the cytoplasm where ribosomes and amino acids are
available for protein synthesis.

4. Assertion : If the sequence of bases in one strand is known then the sequence in other strand can be
predicted.
Reason : Both the strands of DNA are complementary of each other.

5. Assertion : If each strand from a parental DNA acts as template for synthesis of a new strand, the two double
stranded daughter DNA thus produced would be indentical to the parental DNA molecule.
Reason : The length of DNA double helix in a typical mammalian cell is calculate simply by multiplying the total
number of bp with distance two consecutive bp.

IV. Write Short Answer

1. (a) Draw a schematic representation of the structure of a transcription unit and show the following in it:
(i) Direction in which the transcription occurs (ii) Polarity of the two strands involved
(iii) Template strand (iv)Terminator gene

2. The base sequence in one of the strands of DNA is 5’ TAGCATGAT 3’.


(i) Give the base sequence of its complementary strand.
(ii) How are these base pairs held together in a DNA molecule ?
(iii) Explain the base complementarity rules. Name the scientist who framed this rule.

3. From the following DNA sequence representing a part of gene, derive,


a. The RNA transcript
b. The processed mRNA( assuming that all the codons contain a C represent the intron DNA
c. The number of amino acid it can code for.
TACCCCCACGAGTTATATACGGGGGCATCATATGAA
V. CASE STUDY
1.The diagram given below illustrates the Lac operon.

a.The inducer in the figure is


a) Beta-galactosidase b) Permease c) Lactose d) Glucose
b. Identify the incorrect statement about the lac operon
a) i gene codes for the activator of the lac operon. b) The z gene codes for beta-galactosidase (β-gal)
c) The y gene codes for permease. d) The a gene encodes a transacetylase
c. The RNA polymerase binds to the----------- in the presence of the inducer
a) Operator b) Structural genes c) Promoter d) i gene

d. The elucidation of the lac operon was also a result of a close association between a geneticist
a) Francois Jacob and Jacque Monod b) Watson and Crick
c) Marshall Nirenberg’s d) Frederick Griffith
2. Two blood samples of suspects ‘A’ and ‘B’ were sent to the Forensic Department along with sample ‘C’ from the
crime scene. The Forensic Department was assigned the responsibility of running the samples and matching the
samples of the suspects with that of the sample from the scene of the crime and thereby identifying the culprit.

a. In genetic fingerprinting, the ‘probe’ refers to –

1. A radioactively labelled double stranded RNA molecule.


2. A radioactively labelled double stranded DNA molecule.
3. A radioactively labelled single stranded DNA molecule.
4. A radioactively labelled single stranded RNA molecule.

b. What does ‘minisatellite’ and ‘microsatellite’ mean in relation to DNA Fingerprinting?

c. How does polymorphism arise in a population?

d. State the steps involved in DNA Fingerprinting in a sequential manner.

You might also like