ORIGINAL RESEARCH

published: 05 January 2016

doi: 10.3389/fmicb.2015.01464

Isolation and Genetic Analysis of

Multidrug Resistant Bacteria from
Diabetic Foot Ulcers
Shailesh K. Shahi and Ashok Kumar *

School of Biotechnology, Faculty of Science, Banaras Hindu University, Varanasi, India

Severe diabetic foot ulcers (DFUs) patients visiting Sir Sunderlal Hospital, Banaras
Hindu University, Varanasi, were selected for this study. Bacteria were isolated from
swab and deep tissue of 42 patients, for examining their prevalence and antibiotic
sensitivity. DFUs of majority of the patients were found infected with Enterococcus
spp. (47.61%), Escherichia coli (35.71%), Staphylococcus spp. (33.33%), Alcaligenes
spp. (30.95%), Pseudomonas spp. (30.95%), and Stenotrophomonas spp. (30.95%).
Antibiotic susceptibility assay of 142 bacteria with 16 antibiotics belonging to eight
classes showed the presence of 38 (26.76%) isolates with multidrug resistance
(MDR) phenotypes. MDR character appeared to be governed by integrons as class
1 integrons were detected in 26 (68.42%) isolates. Altogether six different arrays of
Edited by:
genes (aadA1, aadB, aadAV, dhfrV, dhfrXII, and dhfrXVII) were found within class 1
Tzi Bun Ng,
The Chinese University of Hong Kong, integron. Gene cassette dhfrAXVII-aadAV (1.6 kb) was present in 12 (3 Gram positive
China and 9 Gram negative) isolates and was conserved across all the isolates as evident
Reviewed by: from RFLP analysis. In addition to the presence of class 1 integron, six β-lactamase
Ashima Kushwaha Bhardwaj,
Indian Institute of Advanced Research,
resistance encoding genes namely blaTEM , blaSHV , blaOXA , blaCTX−M−gp1 , blaCTX−M−gp2 ,
India and blaCTX−M−gp9 and two methicillin resistance genes namely mecA and femA and
Xian-Zhi Li,
vancomycin resistance encoding genes (vanA and vanB) were identified in different
Health Canada, Canada
isolates. Majority of the MDR isolates were positive for blaTEM (89.47%), blaOXA (52.63%),
*Correspondence:
Ashok Kumar and blaCTX−M−gp1 (34.21%). To our knowledge, this is the first report of molecular
[email protected] characterization of antibiotic resistance in bacteria isolated from DFUs from North India. In
conclusion, findings of this study suggest that class-1 integrons and β-lactamase genes
Specialty section:
This article was submitted to contributed to the MDR in above bacteria.
Antimicrobials, Resistance and
Keywords: diabetic foot ulcer, antibiotic resistance, PCR, class 1 integron, β-lactamase, multidrug resistance
Chemotherapy,
a section of the journal
Frontiers in Microbiology
INTRODUCTION
Received: 25 September 2015
Accepted: 07 December 2015
Diabetic foot infections (DFIs) constitute a major clinical and financial burden to the diabetic
Published: 05 January 2016
patients (Bakker et al., 2005; Singh et al., 2005; Turhan et al., 2015). DFIs are one of the most feared
Citation: complications of diabetes that can progress rapidly to irreversible septic gangrene necessitating
Shahi SK and Kumar A (2016)
amputation of the foot. Patients with diabetes are 25 times more likely to lose a leg than those
Isolation and Genetic Analysis of
Multidrug Resistant Bacteria from
without diabetes, and up to 70% of all leg amputations occur in people with diabetes (Singh et al.,
Diabetic Foot Ulcers. 2005). The specific organisms found in DFIs differ not only from patient to patient, but also from
Front. Microbiol. 6:1464. one part of the country to another (Ozer et al., 2010). Individuals with diabetes have higher rates
doi: 10.3389/fmicb.2015.01464 of hospitalization for soft-tissue and bone infections of the foot than patients without diabetes

Frontiers in Microbiology | www.frontiersin.org 1 January 2016 | Volume 6 | Article 1464

Shahi and Kumar Multidrug Resistant Bacteria from DFUs

(Sotto et al., 2012). Microbiological studies have indicated continuous mutation (Dallenne et al., 2010). Different types
polymicrobial nature of DFIs, the most frequently identified of β-lactamases have been described during the 1990s, TEM-
isolates being aerobes including Staphylococcus aureus, and SHV-type ESBLs were dominant (Bradford, 2001). During
Staphylococcus epidermidis, coagulase-negative Staphylococcus the past decade, rapid and massive spread of CTX-M-type of
spp., Enterococcus spp., Escherichia coli, Pseudomonas ESBLs have been reported (Sana et al., 2011). These enzymes are
aeruginosa, Proteus mirabilis, and Klebsiella pneumoniae now the most prevalent ESBLs in Enterobacteriaceae and also
(Turhan et al., 2015). The most common anaerobic isolates are in Pseudomonas spp. and Acinetobacter baumannii (Bradford,
Peptostreptococcus spp, Bacteroides fragilis, and Clostridium spp. 2001; Paterson and Bonomo, 2005) in Europe and other parts of
(Dowd et al., 2008). the world (Coque et al., 2008).
Antibiotic resistance is considered to be a major threat Incidence of antibiotics resistance is becoming a serious
in the treatment of DFIs (Lipsky, 2007). Carriage of MDR problem in India, especially with the DFUs patients where no
microorganisms is mostly due to inappropriate antibiotic systematic study has been made to unravel the occurrence of
treatment, reduced antibiotic concentration in the tissue, chronic MDR bacteria and/or the genetic basis of resistance in these
course of the wound, reduced effect of antibiotics in the bacteria. Infection in DFUs with MDR bacteria is known to
wound environment and frequent hospital admission of DFU increase the duration of hospital stay, cost of management as
patients, where they are likely to be exposed to MDR organisms well as morbidity and mortality. Henceforth, early diagnosis
(Hartemann-Heurtier et al., 2004; Ozer et al., 2010). Available of microbial infections and appropriate antibiotic therapy are
reports suggest that inadequate selection and abuse of antibiotics needed to avoid further complications. In the present study, an
may lead to the development of resistance in various other attempt was made to determine the bacterial prevalence and
bacteria and may make the treatment of bacterial infections reveal the genetic basis of MDR in bacteria isolated from DFUs.
more difficult (Kolár et al., 2001; Sáenz et al., 2004; Lipsky,
2007; Qing et al., 2012; Falcone et al., 2015). The exchange of
resistance genes between bacterial chromosome and the plasmid MATERIALS AND METHODS
(s) and their integration into particular genetic elements, called
integrons, play a major role in acquisition and dissemination of Patients and Sample Collection
resistance genes (Stokes and Hall, 1989). Additionally, natural This study was conducted in the School of Biotechnology
transformation has the potential to promote exchange of DNA in collaboration with the Departments of Endocrinology and
among taxonomically diverse bacteria (Ochman et al., 2000). Metabolism, and General Surgery, Sir Sunderlal Hospital,
Integron is found either as part of transposons or independently Institute of Medical Sciences, Banaras Hindu University,
on several groups of broad-host-range plasmids. Different classes Varanasi. In total, 116 DFUs patients visiting Sir Sunderlal
of integrons are distinguished by their highly conserved class- Hospital between January 2010 and October 2011 were examined
specific integrase genes and their overall genetic structure (Hall and 42 patients suffering from severe DFUs (grades III to V)
et al., 1999; Mazel, 2006). Till date, five classes of integrons were included in the study. The grading of foot ulcers was done
(classes 1, 2, 3, 4, 5) with different Int genes have been reported according to Wagner (1981) (grade 0- hyperkeratosis; grade I
(Mazel, 2006). Gene cassettes integrated into class 1 integrons -superficial ulcers; grade- II deep ulcers; grade- III tendonitis,
in clinically important bacteria most commonly carry antibiotic osteomyelitis, cellulites, or abscess; grade- IV gangrene of a toe
resistance genes, and correlate with host bacterial resistance (El- or forefoot; and grade -V massive gangrene of the whole foot).
Sokkary and Abdelmegeed, 2015). The high prevalence of class 1 The study was approved by the Institutional Ethics Committee
integrons is known in clinically significant bacterial isolates viz. (Ref. No. Dean/2009-10/555 dated July 11, 2009).
Escherichia (Sáenz et al., 2004), Klebsiella (Girlich et al., 2000), For sample collection, each DFU was cleaned with sterile
Salmonella (Gebreyes and Altier, 2002), and Serratia species saline and thereafter superficial swab sample was collected from
(Centrón and Roy, 2002). PCR amplification of highly conserved the center of ulcer by applying a sterile cotton-tipped applicator.
5′ and 3′ sequences of integrons has proved very useful target in Deep tissue samples were obtained from the ulcer using a
epidemiological surveys of bacterial antibiotic resistance (White sterilized punch biopsy needle (6 mm) under local anesthesia
et al., 2001; Chang et al., 2009). after washing the wound with sterile physiological saline. Of two
β-lactamase-producing bacteria (including those producing swab and tissue samples collected from DFU of each patient, one
extended-spectrum β-lactamases), vancomycin-resistant was used for detecting aerobic and anaerobic bacteria through
enterococci (VRE), and methicillin-resistant S. aureus (MRSA) in vitro culture, the second tissue samples were used for detecting
are important nosocomial pathogens in India and other parts anaerobes (Bacteroides spp., Peptostreptococcus productus and
of the world (Mehrotra et al., 2000; Jia et al., 2014; Mobarak- Clostridium spp.) by PCR in a culture-independent approach.
Qamsari et al., 2014). As such the presence of β-lactamase, Briefly, total genomic DNA of tissue samples was extracted
ESBL-producing, VRE, and MRSA in DFUs seems crucial employing a Fast Tissue PCR Kit following the instructions of
(Bradford, 2001; Sáenz et al., 2004). Several researchers have the manufacturer (MBI Fermentas, USA). Genus specific primers
reported antibiotics resistant bacteria from DFUs but there is of 16S rRNA gene (Table 1) corresponding to Bacteroides, P.
a paucity of ESBL, VRE, and MRSA data particularly in India productus, and Clostridium were used for the amplification of
(Shankar et al., 2005; Gadepalli et al., 2006; Shakil and Khan, desired amplicon in PCR assay (Rekha et al., 2006). For in vitro
2010). β-lactamases are remarkably diversified due to their culture all the specimens were transported by sterile containers.

Frontiers in Microbiology | www.frontiersin.org 2 January 2016 | Volume 6 | Article 1464

Shahi and Kumar Multidrug Resistant Bacteria from DFUs

TABLE 1 | Primers used for amplification of different genes.

Genes Primer sequence (5′ → 3′ ) Amplicon size (bp) References

Class 1 integron F CS: GGCATCCAAGCAGCAAG Variable Lévesque et al., 1995

R CS: AAGCAGACTTGACCTGA
aadA1 F: GCACGACGACATCATTCCG 300 Drum, 2003
R: ACCAAATGCGGGACAACG
aadB F: ACGCAGGTCACATTGATAC 400
R: CGGCATAGTAAGAGTAATCC
dhfrV F: CGATGTTTGATGTTATGG 400
R: TGTTTCTCTGTAAATCTCCC
dhfrXII F: CGAACCGTCACACATTGG 300
R: GCATAAACGGAGTGGGTG
blaTEM F: CATTTCCGTGTCGCCCTTATTC 800 Dallenne et al., 2010
R: CGTTCATCCATAGTTGCCTGAC
blaSHV F: AGCCGCTTGAGCAAATTAAAC 713
R: ATCCCGCAGATAAATCACCAC
blaOXA F: GGCACCAGATTCAACTTTCAAG 564
R: GACCCCAAGTTTCCTGTAAGTG
blaCTX−M−gp1 F: TTAGGAARTGTGCCGCTGYA 688
R: CGATATCGTTGGTGGTRCCAT
blaCTX−M−gp2 F: CGTTAACGGCACGATGAC 404
R: CGATATCGTTGGTGGTRCCAT
blaCTX−M−gp9 F: TCAAGCCTGCCGATCTGGT 561
R: TGATTCTCGCCGCTGAAG
vanA F: GGGAAAACGACAATTGC 732 Jia et al., 2014
R: GTACAATGCGGCCGTTA
vanB F: CATCGCCGTCCCCGAATTTCAAA 297
R: GATGCGGAAGATACCGTGGCT
mecA F: CCAACTGTCGTAGTCGAAACC 145 Mehrotra et al., 2000
R: CTAAGGCACGTCAAAAATGGT
femA F: AAAAAAGCACATAACAAGCG 173
R: GATAAAGAAGAAACCAGCAG
16S rRNA (Bacteroides spp.) F: GGG GTT CTG AGA GGA AG 950 Rekha et al., 2006
R: ACCCCCCATTGTACCAC
16S rRNA (Peptostreptococcus productus) F: GGTGCCGCAGTAAACACAATAGT 539
R: AAGGCCCGGGAACGTATTCA
16S rRNA (Clostridium spp.) F: CTCAACTTGGGTGCTGCATTT 619
R: ATTGTAGTACGTGTGTAGCCC
16S rRNA F: AGAGTT TGA TYM TGG CTC AG 1500 Singh et al., 2009
R: CTACGGCTACCTTGTTACGA

F, Forward; R, Reverse.

Written consent of all the patients was taken before the collection colonies appearing on each plate were picked up and restreaked
of swab/tissue. on respective media. Isolates with distinct morphotypes from
each plate were selected for further characterization. Tentative
Isolation and Identification of identification of different aerobic isolates was made on the
basis of Gram’s staining and morphological characters as well
Aerobic/Anaerobic Bacteria
as biochemical tests namely, catalase, urease, Simmons citrate
Initially, samples were gently macerated and fixed for Gram
utilization and methyl red as per the standard method (Kimberley
staining. Samples were quickly examined for the types of
and Elsa, 2003). For the detection of anaerobic bacteria culture-
bacteria (Gram positive/Gram negative) for empirical therapy.
independent approach was employed as described above.
For isolation, a direct smear was made from each sample
(swab and biopsy) and plated directly onto appropriate aerobic
and anaerobic planting media such as blood agar, MacConkey Antibiotic Susceptibility Testing
agar, Chocolate agar, and Columbia blood agar. The plates Antibiotic susceptibility test of different strains was done by
were immediately transferred to an aerobic or anaerobic jar the disc diffusion using the Kirby-Bauer method (Bauer et al.,
and incubated at 35◦ C for 24 and 48 h, respectively. The 1966). Eighteen antibiotics belonging to nine different classes
plates were examined after 24–48 h of incubation and distinct i.e., (a) cephalosporins: cefazolin 30 µg (1st generation),

Frontiers in Microbiology | www.frontiersin.org 3 January 2016 | Volume 6 | Article 1464

Shahi and Kumar Multidrug Resistant Bacteria from DFUs

cefoxitin 30 µg (2nd generation), cefoperazone 75 µg reverse primer 5′ -AAG CAG ACT TGA CCT GA-3′ as described
(3rd generation) and cefepime 30 µg (4th generation), (b) earlier (Lévesque et al., 1995). Purified genomic DNA of the
aminoglycosides: gentamicin 10 µg, amikacin 30 µg, kanamycin bacteria was used as template. Five microliters of the amplified
30 µg, streptomycin 20 µg, and spectinomycin 100 µg, (c) PCR product was electrophoresed on a 1% agarose gel in TAE
penicillins: methicillin 30 µg, piperacillin/tazobactam 100/10 µg, buffer (40 mM Tris/acetate (pH 8.0), 1 mM EDTA) containing
and ampicillin 10 µg, (d) lincosamide: clindamycin 2 µg, (e) ethidium bromide (0.5 µg ml−1 ). Similarly, other genes namely
tetracycline: tetracycline 30 µg, (f) carbapenem: meropenem aadA1, aadB, dhfrV, and dhfrXII within class 1 integron were
10 µg, (g) dihydrofolate reductase inhibitor: trimethoprim amplified using specific primers (Table 1).
20 µg, and (h) folate pathway inhibitor: co-trimoxazole 25 µg,
(i) glycopeptide: vancomycin 30 µg were selected according Restriction Digestion of Amplified Class 1
to published recommendations and their widespread use in Integron
the treatment of various diseases (Gadepalli et al., 2006). The Amplified product of variable region of class 1 integron
antibiotic disc was purchased from HiMedia Laboratories (1.6 kb) from Pseudomonas spp. DF5TC, Cronobacter spp.
(Mumbai, India) and susceptibility profile (intermediate DF52TC, Alcaligenes spp. DF19TB, Stenotrophomonas spp.
or susceptible) against antibiotics was deduced from the DF3SA, K. pneumoniae DF12SA, E. coli DF30TA, Providencia
manual supplied by the manufacturer. Unless otherwise stated spp. DF1SB, Alcaligenes spp. DF43SB, S. flexneri DF1TA, S.
intermediate susceptible isolates were counted as resistant to aureus DF8TA, Enterococcus spp. DF5SB, and Enterococcus
all the agents tested. Interpretation of result is based according spp. DF16SA was purified and digested with AluI and RsaI
to the Clinical and Laboratory Standards Institute (CLSI)1 following the instructions of the manufacturer (New England
guidelines 2010. Herein, MDR was defined for an isolate showing BioLabs). Restriction digestion was done in a final volume of
resistance to antibiotics belonging to three or more classes. 25 µl containing 1 x restriction enzyme buffer, 0.30 µl (3.0 U)
restriction enzyme and 15 µl PCR product. After mixing, samples
Amplification and Sequencing Of 16S rDNA were incubated for 6 h in a water bath preset at 37◦ C. Reaction
Genomic DNA was extracted employing DNEasy extraction was terminated by heat inactivation of restriction enzymes at
kit (Qiagen, Germany) according to the instructions of 70◦ C for 20 min. The digested products were run in a 3% agarose
manufacturer. 16S rDNA (1.5 kb) was amplified using universal gel at 100 V in TAE buffer for 4–5 h. Cluster analysis of restriction
primers (Table 1). The PCR reaction mix (50 µl) included; 1.5 fragment length polymorphism (RFLP) types was performed by
U of Taq DNA polymerase (Bangalore Genei, India), 1 X PCR the unweighted pair-group method with arithmetic means using
assay buffer with 1.5 mM MgCl2 , 50 pmol of each forward and Quantity One 1-D Analysis Software, version 4.4 (BioRad).
reverse primers (Integrated DNA Technologies, USA), 125 µM of
each dNTPs (Bangalore Genei, India) and 50 ng template DNA. Sequencing of Class 1 Integron
Thermal cycle was set as described earlier (Singh et al., 2009). Variable region of class 1 integron (1.6 kb) amplified from K.
Sequencing of amplified product was done on commercial basis pneumoniae DF12SA was purified by Invitrogen kit (Invitrogen
from Chromous Biotech Pvt. Ltd. (Bangalore, India). All the Corpn, USA) following the instructions of the manufacturer.
sequences were matched against nucleotide sequences present in Purified products were sequenced on commercial basis from
GenBank using the BLASTn program to identify the most similar Chromous Biotech Pvt. Ltd. (Bangalore, India). The sequence
16S rDNA (Altschul et al., 1997; www.ncbi.nlm.nih.gov/blast). was matched against nucleotide sequences present in GenBank
The 16S rDNA sequences of 38 bacterial strains have been using the BLASTn program (Altschul et al., 1997) at website
deposited in the GenBank data base and accession numbers have www.ncbi.nlm.nih.gov/blast. Variable region of class 1 integron
been obtained. sequence of K. pneumoniae DF12SA was submitted to NCBI and
accession number was obtained (HQ114261).
Phylogenetic Analysis
16S rDNA sequences of 37 isolates of this study and 109 Multiplex PCR
sequences of strains reported from different parts of the world Multiplex PCR for blaTEM , blaSHV , blaOXA , and blaCTX−M−gp1 ,
were used to construct phylogenetic trees. Multiple alignments of blaCTX−M−gp2 , and blaCTX−M−gp9 genes was performed by
sequenced nucleotides were carried out using ClustalW2 (version multiplexing of primers (Table 1) of respective genes. Thermal
2.0.10). Neighbor joining tree was constructed in MEGA 5.0 cycles for the amplification were set as: initial denaturation for
(Tamura et al., 2011) using bootstrapping at 1000 bootstrap trials 10 min at 94◦ C, 30 cycles of 40 s at 94◦ C, 40 s at 60◦ C, and 1 min
with the two-parameter model of Kimura. at 72◦ C and final extension for 7 min at 72◦ C (Dallenne et al.,
2010). E. coli ATCC strain 25922 and K. pneumoniae ATCC strain
Amplification of Class 1 Integron and 700603 (HiMedia, Mumbai, India) were used as negative and
Associated Gene Cassettes positive controls respectively for the amplification of ESBL genes.
The variable region of class 1 integron was amplified using S. aureus, S. haemolyticus, and Enterococcus strains were
forward primer 5′ -GGC ATC CAA GCA GCA AG-3,′ and the screened for the presence of mecA (oxacillin resistance), femA
1 ClinicalLaboratory Standard Institute (2010). Performance Standards for
(methicillin resistance), vanA, and vanB (vancomycin resistance)
Antimicrobial Susceptibility Testing. CLSI Approved Standards M100-S20. Wayne, genes using respective primers (Table 1) as described in previous
PA: CLSI. studies (Arakere et al., 2005; Jia et al., 2014).

Frontiers in Microbiology | www.frontiersin.org 4 January 2016 | Volume 6 | Article 1464

Shahi and Kumar Multidrug Resistant Bacteria from DFUs

RESULTS patients (Table 3, Figures 1A–C). Of the 29 DFUs, 18 had

only one of the above three isolates but 11 contained two or
Isolation and Initial Characterization of three isolates (Table 3). On the other hand, routine culture
Bacteria method showed the presence of anaerobes in DFUs of 12
Altogether 142 aerobic bacteria (69 from swabs and 73 from (28.57%) patients (Table 3). Furthermore, majority of DFUs
tissues) belonging to 17 genera were successfully isolated from showed the presence of only one type of anaerobe contrary
swab and deep tissue of DFUs (Wagner’s grade III to V) to culture-independent method where three genera namely
of 42 diabetic patients. Tentative identification of all the 142 Clostridium spp. P. productus, and Bacteriodes spp. were detected
aerobic isolates was made on the basis of growth features on in DFU of four patients (Table 3). Among all the anaerobes
specific media, morphological characters, Gram’s staining and detected by PCR, the prevalence of Clostridium was maximum,
biochemical tests. Of these, 53 (37.32%) belonged to Gram- being present in DFUs of 19 subjects (45.23%) followed by P.
positive, and 89 (62.67%) to Gram-negative group. It was noted productus in 13 (30.95%) and Bacteroides in 12 (28.57%). Further
that bacteria such as Enterococcus spp., E. coli, Staphylococcus analysis of bacterial prevalence showed as high as eight species
spp., Alcaligenes spp., Pseudomonas spp. and Stenotrophomonas of bacteria (6 aerobic and 2 anaerobic) in DFU of one patient
spp. were the most common in DFUs, the percentage distribution (DF43). Average 3.38 bacteria were detected from the DFU of
being 47.61, 35.71, 33.33, 30.95, 30.95, and 30.95, respectively. each patient.
However, bacteria such as Cronobacter spp. and Achromobacter
xylosoxidans were present in 2.38% of DFUs (Table 2). Antibiotic Susceptibility Test, Identification
Cultivation-independent approach mainly based on the
amplification of genus-specific 16S rRNA gene showed
of MDR Isolates Using 16S rRNA Gene
amplification of the 16S rDNA fragment specific to Bacteriodes Sequencing and Phylogenetic Analysis
spp., P. productus, and Clostridium spp. in DFUs of 29 (69.04%) Antibiotic susceptibility test of 142 aerobic bacteria revealed that
38 (26.76%) were resistant to antibiotics belonging to three or
more classes. Henceforth, these 38 isolates were designated as
TABLE 2 | Tentative identification of aerobic bacteria isolated from swab MDR bacteria. Prevalence of resistance to different antibiotics
and tissue samples of DFUs. among the isolates was; cefazolin (65.78%), cefoxitin (73.68%),
Bacteria Swab Tissue No patients (%)
cefoperazone (34.21%), cefepime (68.42%), gentamycin
(94.73%), amikacin (50%), kanamycin (92.10%), streptomycin
GRAM-POSITIVE AEROBES (65.78%), spectinomycin (73.52%), piperacillin/tazobactam
Enterococcus spp. 10 7 20* (47.61) (26.31%), ampicillin (89%), clindamycin (34.21%), tetracycline
Enterococcus faecalis 1 3 (60.52%), meropenem (76.31%), trimethoprime (63.15%), and
Enterococcus raffinosus 2 2 co-trimoxazole (76.31%). 71.4% of Enterococcus spp. were
Enterococcus gilvus 1 0 resistant to vancomycin whereas all the Staphylococcus spp.
Staphylococcus aureus 7 4 14* (33.33) were resistant to methicillin. Among all the MDR isolates, K.
Staphylococcus haemolyticus 2 4 pneumoniae strain DF12SA showed resistance to as many as 15
Corynebacterium spp. 3 1 4 (9.52) antibiotics and E. coli strain DF39TA and E. faecalis DF43SA to
Paenibacillus spp. 1 2 3 (7.14) 14 antibiotics.
Exiguobacterium mexicanum 0 3 3 (7.14)
As 38 isolates exhibited MDR property, their identification
GRAM-NEGATIVE AEROBES
was confirmed by 16S rDNA sequencing. These isolates belonged
Escherichia coli 7 9 15* (35.71)
to different species/strains of Enterococcus, Staphylococcus,
Alcaligenes spp. 8 6 13* (30.95)
Corynebacterium, Paenibacillus, Exiguobacterium, Escherichia,
Alcaligenes, Stenotrophomonas, Pseudomonas, Klebsiella,
Alcaligenes faecalis 0 2
Providencia, Shigella, Serratia, Psychrobacter, Cronobacter, and
Stenotrophomonas spp. 7 6 13 (30.95)
Achromobacter (Table 4). The nucleotide sequences of the 16S
Pseudomonas spp. 5 2 13*(30.95)
rDNA of all the isolates were submitted to NCBI and accession
Pseudomonas fluorescens 1 5
numbers were obtained (Table 4).
Pseudomonas stutzeri 1 1
Phylogenetic analysis based on 16S rDNA sequences of all
Klebsiella pneumonia 3 5 8 (19.04)
the identified isolates of this study and 110 sequences from
Providencia spp. 3 5 7* (16.66)
the isolates of different parts of the world showed separate
Shigella flexneri 4 2 6 (14.28)
clustering of our isolates. Additionally, significant diversity
Serratia spp. 1 2 3 (7.14)
was evident among these isolates. It is evident from the tree
Psychrobacter faecalis 1 1 2 (4.76)
(Figure 2) that all the isolates could be grouped in seven clusters.
Cronobacter spp. 0 1 1 (2.38)
Clusters A, B, C, D, E, F, and G included 28, 12, 6, 6, 6, 8,
Achromobacter xylosoxidans 1 0 1 (2.38)
and 81 isolates, respectively. Furthermore, phylogenetic analysis
69 73 suggested a high degree of relatedness between certain isolates of
*Certain bacteria present both in swab and tissue. Value in parenthesis represents this study with strains of bacteria reported from different parts
percentage. of the world.

Frontiers in Microbiology | www.frontiersin.org 5 January 2016 | Volume 6 | Article 1464

Shahi and Kumar Multidrug Resistant Bacteria from DFUs

TABLE 3 | Anaerobic bacteria detected by culture-dependent/independent approach from deep tissue of DFU patients.

Anaerobic bacteria Detection of anaerobes No of patients Detection of anaerobes No of patients (%)

by culture- dependent using culture-
approach independent approach

GRAM-NEGATIVE ANAEROBES
Bacteroides spp. DF20, DF24, DF43 3 (7.14)* DF8, DF18, DF38 3 (7.14)
GRAM-POSITIVE ANAEROBES
Peptostreptococcus productus DF1, DF13, DF36 3 (7.14) DF6, DF11, DF15 3 (7.14)
Clostridium spp. DF4, DF14, DF29, DF32, 5 (11.90) DF3, DF7, DF9, DF12, 12 (28.57)
DF40 DF14, DF19, DF23, DF29,
DF32, DF34, DF39, DF44
ANAEROBES COMBINATION IN DFUs TISSUE
Clostridium spp. 0 0 DF20 1 (2.38)
Bacteroides spp.
Clostridium spp. Peptostreptococcus productus DF27 1 (2.38) DF1, DF36, 2 (4.76)
Bacteroides spp. Peptostreptococcus productus 0 0 DF5, DF13, DF22, DF43 4 (9.52)
All above three isolates 0 0 DF4, DF24, DF27, DF40 4 (9.52)
12 29

*Value in parenthesis represents percentage.

DF, diabetic foot. Number represents serial number of patients.

FIGURE 1 | Amplification of genus specific amplicon of anaerobic bacteria by PCR. (A) Amplified amplicon of Bacteroides sp., lanes 1–8: 1-DF4, 2-DF5,
3-DF8, 4-DF13, 5-DF18, 6-DF20, 7-DF22, and 8-DF24. (B) Clostridium sp., lanes 1–8: 1-DF1, 2-DF3, 3-DF4, 4-DF7, 5-DF9, 6-DF12, 7-DF14, and 8-DF19, and (C)
Peptostreptococcus productus, Lanes1–8:1-DF1, 2-DF4, 3-DF5, 4-DF6, 5-DF11, 6-DF13, 7-DF15, and 8-DF24. M- 100 bp ladder (New England Biolabs, USA).

Occurrence of Class 1 Integrons of class 1 integron (1.6 kb) of K. pneumoniae DF12SA was done
PCR amplification of variable regions of class 1 integrons and its analysis showed 99% homology with class 1 integron
repeatedly showed variable sizes (0.3–4.0 kb) in different isolates. sequence of K. pneumoniae (FJ876827), E. coli (HQ880272),
Notably, the size of amplicon showed significant variations S. flexneri (FJ895301), Staphylococcus epidermidis (AB291061),
among different species/strains. Among 26 integron positive P. aeruginosa (DQ838665), and Stenotrophomonas maltophilia
isolates, 13 types of gene cassette with size of 0.3, 0.5, 0.7, (GQ924479) available in NCBI GenBank. Additionally, varying
0.85, 0.9, 1.2, 1.4, 1.6, 1.7, 2.0, 2.4, 2.5, and 4 kb were observed region of class 1 integron of 1.6 kb size amplified from all the 12
(Table 4). However, 12 isolates namely Pseudomonas spp. isolates was digested with AluI and RsaI. Results of restriction
DF5TC, Cronobacter spp. DF52TC, Alcaligenes spp. DF19TB, analysis revealed identical banding pattern in all the 12 isolates.
Stenotrophomonas spp. DF3SA, K. pneumoniae DF12SA, E. coli Sequencing of the 1.6 kb amplicon suggested presence of
DF30TA, Providencia spp. DF1SB, Alcaligenes spp. DF43SB, S. two ORFs (Figure 3). The first ORF (ORF1) was identified
flexneri DF1TA, S. aureus DF8TA, Enterococcus spp. DF5SB, as dhfrAXVII which confers resistance to trimethoprim, and
and Enterococcus spp. DF16SA showed the presence of only one the second (ORF2) as AadAV which confers resistance to
amplicon of 1.6 kb size. Sequencing of amplified variable region streptomycin and spectinomycin. Gene cassettes dhfrXVII and

Frontiers in Microbiology | www.frontiersin.org 6 January 2016 | Volume 6 | Article 1464

Shahi and Kumar Multidrug Resistant Bacteria from DFUs

TABLE 4 | Occurrence of class-1 integron and β- lactamase genes in MDR bacteria.

Bacteria Accession Resistance phenotype Class 1 integron Gene cassette (s) β- lactamase genes
No* size (kb)

Enterococcus sp. DF5SB HQ163798 GEN, KAN, STR, SPX, AMP, TET, 1.6 dhfrAXVII, aadAV blaTEM , vanA, vanB
TMP, CTZ, VAN
Enterococcus sp. DF19SA HQ163796 CFP, FEP, GEN, AMK, KAN, AMP, NA NA blaTEM , vanA, vanB
TET, CTZ, VAN
Enterococcus sp. DF16SA HQ163795 CXT, GEN, AMK, KAN, STR, SPX, 1.6 dhfrAXVII, aadAV blaTEM, vanA, vanB
AMP, MEM, TMP, CTZ, VAN
Enterococcus faecalis JN642255 CXT, FEP, GEN, KAN, AMP, TET, NA NA blaTEM , vanB
DF30TB MEM, CTZ, VAN
Enterococcus faecalis JN642254 CEZ, FEP, GEN, AMK, KAN, STR, 4.0 and 2.5 aadB, dhfrV blaTEM , vanB
DF43SA SPX, PTZ, AMP, TET, MEM, TMP,
CTZ, VAN
Enterococcus raffinosus JN642264 CEZ, CXT, GEN, KAN, CLD, TET, NA NA NA
DF11TA MEM, CTZ
Enterococcus gilvus JN642251 CXT, FEP, GEN, KAN, STR, SPX, 0.5 aadB blaTEM,
DF11SD AMP, CLD, MEM
Staphylococcus aureus JN642261 CXT, GEN, AMK, KAN, STR, SPX, 1.6 dhfrAXVII, aadAV blaTEM, mecA, femA
DF8TA PTZ, AMP, TET, TMP, CTZ, MTC
Staphylococcus HQ163797 CEZ, CXT, FEP, AMP, TET, MEM, 0.3 dfhrXII blaTEM ,, mecA, femA
haemolyticus DF5TA TMP, CTZ, MTC
Corynebacterium sp. JN642257 CXT, FEP, GEN, AMK, KAN, AMP, NA NA blaTEM , blaOXA
DF26SB CLD, TET, MEM
Paenibacillus sp. DF9SA JN642249 CXT, GEN, KAN, STR, SPX, PTZ, 0.9 aadB blaTEM
AMP, CLD, TET
Exiguobacterium JN642268 CEZ, FEP, GEN, AMK, KAN, STR, 2.5 dfhrXII, aadB, dhfrV blaTEM , blaOXA
mexicanum DF43TB SPX, AMP, TET, MEM, TMP, CTZ
E. coli DF30TA JN642269 CEZ, CXT, GEN, FEP, AMK, KAN, 1.6 dhfrAXVII, aadAV blaTEM ,
STR, SPX, AMP, MEM, TMP, CTZ blaSHV, blaCTX−M−gp1
E. coli DF30TD JN642266 CEZ, CXT, CFP, FEP, GEN, AMK, NA NA blaTEM , blaSHV ,
AMP, PTZ, CLD blaCTX−M−gp1
E. coli DF39TA HQ163793 CEZ, CXT, CFP, FEP, GEN, AMK, 2.4 aadB, dhfrV, aadA1 blaTEM , blaSHV , blaOXA ,
KAN, STR, SPX, AMP, TET, MEM, blaCTX−Mgp1
TMP, CTZ
Alcaligenes sp. DF3TA HQ163791 CXT, CFP, KAN, AMP, CLD, TET, PTZ, NA NA blaTEM
MEM
Alcaligenes sp. DF18SC HQ163792 CFP, CEZ, CLD, GEN, KAN, STR, 1.2 aadA1 NA
SPX, MEM, TMP, CTZ
Alcaligenes sp. DF19TB JN642262 CEZ, CXT, FEP, GEN, KAN, STR, 1.6 and 0.5 dhfrAXVII, aadAV, aadB blaTEM , blaOXA
SPX, AMP, TMP, CTZ
Alcaligenes sp. DF29SB JN642259 CEZ, CXT, FEP, GEN, KAN, STR, 1.7 and 0.7 aadB, dhfrV blaTEM , blaSHV , blaOXA
SPX, AMP, PTZ, CLD, MEM, TMP,
CTZ
Alcaligenes sp. DF34SB JX869134 CEZ, CXT, GEN, AMK, KAN, AMP, NA NA blaTEM
TET, MEM
Alcaligenes sp. DF36TC HQ163794 FEP, GEN, KAN, STR, SPX, MEM, 0.85 aadB blaTEM , blaOXA
TMP, CTZ
Alcaligenes sp. DF43SB JN642256 CEZ, CXT, GEN, KAN, STR, SPX, 1.6 dhfrAXVII, aadAV blaTEM , blaOXA ,
AMP, CLD, TET, TMP, CTZ blaCTX−M−gp1
Alcaligenes faecalis DF45TB JX869135 CEZ, CXT, FEP, GEN, AMK, KAN, NA NA blaOXA , blaCTX−M−gp1
CLD, AMP, MEM
Stenotrophomonas sp. JN642253 CEZ, CXT, FEP, GEN, AMK, KAN, 1.6 dhfrAXVII, aadAV blaTEM , blaOXA ,
DF3SA STR, SPX, AMP, PTZ, TET, TMP, CTZ blaCTX−M−gp1
Stenotrophomonas sp. JX869133 CEZ, CFP, FEP, GEN, KAN, AMP, 0.3 dhfrXII blaTEM , blaCTX−M−gp2
DF9SD TET, MEM, TMP, CTZ
Stenotrophomonas sp. JN642265 CEZ, CXT, FEP, GEN, AMP, CLD, TET, NA NA blaTEM, blaCTX−M−gp2
DF17TA MER

(Continued)

Frontiers in Microbiology | www.frontiersin.org 7 January 2016 | Volume 6 | Article 1464

Shahi and Kumar Multidrug Resistant Bacteria from DFUs

TABLE 4 | Continued

Bacteria Accession Resistance phenotype Class 1 integron Gene cassette (s) β- lactamase genes
No* size (kb)

Pseudomonas sp. DF5TC HQ163790 CEZ, CXT, FEP, GEN, KAN, STR, 1.6 dhfrAXVII, aadAV blaTEM , blaOXA ,
SPX, CLD, MEM, TMP, CTZ blaCTX−M−gp1 ,
blaCTX−M−gp9
Pseudomonas fluorescens JN642246 CXT, FEP, GEN, AMK, KAN, STR, 2.4 aadB, dhfrV, aadA1 blaTEM , blaSHV , blaOXA
DF7SB SPX, AMP, TET, MEM, TMP, CTZ
Pseudomonas fluorescens JN642252 CFP, FEP, GEN, KAN, AMP, PTZ, NA NA blaTEM , blaOXA ,
DF41TB MER, TET, CTZ blaCTX−M−gp1
Pseudomonas stutzeri JN642263 CEZ, CXT, GEN, AMK, KAN, STR, 1.2 aadA1 blaTEM
DF1SA SPX, AMP, MEM
Klebsiella pneumoniae HQ114261 CEZ, CXT, CFP, FEP, GEN, AMK, 1.6 dhfrAXVII, aadAV blaTEM , blaCTX−M−gp9
DF12SA KAN, STR, SPX, PTZ, AMP, TET,
MEM, TMP, CTZ
Providencia sp. DF1SB HQ163789 CEZ, CXT, CFP, FEP, GEN, KAN, 1.6 dhfrAXVII, aadAV blaTEM , blaOXA ,
STR, SPX, AMP, MEM, TMP, CTZ blaCTX−M−gp1
Providencia sp. DF14SA JN642260 CEZ, CXT, FEP, GEN, KAN, STR, 2 dfhrXII, aadB, dhfrV blaTEM , blaOXA
SPX, AMP, CLD, TMP, CTZ
Shigella flexneri DF1TA JN642248 CEZ, CXT, FEP, GEN, KAN, STR, 1.6 dhfrAXVII, aadAV blaTEM blaOXA ,
SPX, AMP, TET, MEM, TMP, CTZ blaCTX−M−gp1
Serratia sp. DF15SB JN642247 CEZ, CXT, CFP, FEP, GEN, AMK, 2.4 and 1.4 aadB, dhfrV, aadA1 blaTEM , blaCTX−M−gp1 ,
KAN, STR, SPX, AMP, MEM,TMP, blaCTX−M−gp2
CTZ
Psychrobacter faecalis JN642258 CEZ, FEP, GEN, AMK, KAN, AMP, NA NA blaTEM , blaOXA
DF30TC TET, MER
Cronobacter sp. DF52TC JN642250 CXT, CFP, GEN, AMK, KAN, STR, 1.6 dhfrAXVII, aadAV blaTEM
SPX, AMP, TET, MEM, TMP, CTZ
Achromobacter JN642267 CXT, CFP, FEP, GEN, AMK, KAN, NA NA blaTEM , blaSHV , blaOXA
xylosoxidans DF33SA PTZ, AMP, MEM

*Accession no. based on 16S r RNA sequence.

AMK, Amikacin; AMP, Ampicillin; CEZ, cefazolin; CFP, Cefoperazone; FEP, Cefepime; CLD, Clindamycin; CTZ, Co-trimoxazole; CXT, cefoxitin; GEN, Gentamycin; KAN, Kanamycin;
MEM, Meropenem; MTC, methicillin; PTZ, Piperacillin/tazobactam; SPX, Spectinomycin; STR, Streptomycin; TET, Tetracycline; TMP, Trimethoprim; VAN, Vancomycin; R, resistant; S,
susceptible; NA, no amplification of any gene.

aadAV were common in all the 12 isolates. In addition to namely Stenotrophomonas spp. DF9SD and Stenotrophomonas
dhfrXVII and aadAV, other gene cassettes namely, aadA1, spp. DF17TA had the gene for CTX-M-gp2 type enzyme. Gene
aadB, dhfrV, and dhfrXII were detected in a number of encoding CTX-M-gp9 enzyme was found in K. pneumoniae
isolates (Table 4). Altogether six genes encoding resistance to DF12SA. Both CTX-M-gp1 and CTX-M-gp2 were present in
aminoclycoside (aadA1, aadB, and aadAV), and trimethoprim Serratia spp. DF15SB. Likewise, CTX-M-gp1 and CTX-M-gp9
(dhfrV, dhfrXII, and dhfrXVII) were detected in different isolates. were noted in Pseudomonas spp. DF5TC.
Interestingly, occurrence of class 1 integron in E. mexicanum All the 38 MDR isolates were further screened for the presence
DF43TB was also noted which appears to be a rare finding. of certain other β-lactamase genes viz. blaTEM , blaSHV , and
blaOXA by multiplex PCR. Among all the isolates amplification
Occurrence of blaTEM , blaSHV , blaOXA , of blaTEM -like gene was attained in 34 isolates, blaOXA in
blaCTX-M (β-lactamase Genes), and mecA 18, and blaSHV in 6 isolates (Table 4). Seventeen isolates were
found positive for both blaTEM and blaOXA type β-lactamases
(Oxacillin), femA (Methicillin) vanA, and
(Table 4). blaTEM , vanA, and vanB were present in Enterococcus
vanB (Vancomycin) Resistance Genes sp. DF5SB, Enterococcus spp. DF19SA, and Enterococcus sp.
All the 38 isolates showing MDR phenotype were also screened DF16SA whereas blaTEM, mecA, and femA were present in
for the presence of cefotaxime hydrolyzing β-lactamase (CTX- S. aureus DF8TA and S. haemolyticus DF5TA. Distribution of
M) by multiplex PCR. Fourteen isolates showed alleles encoding various β-lactamases and methicillin, and vancomycin resistance
CTX-M enzymes belonging to the phylogenetic groups 1, genes in different isolates is presented in Table 4.
2, and 9 (CTX-M-gp1, CTXM-gp2, and CTX-M-gp9 related
enzymes). Among these, nine isolates namely E. coli DF30TA,
E. coli DF30TD, E. coli DF39TA, Alcaligenes spp. DF43SB, A. DISCUSSION
faecalis DF45TB, Stenotrophomonas spp. DF3SA, P. fluorescens
DF41TB, Providencia spp. DF1SB, and S. flexneri DF1TA showed DFIs seem to be polymicrobial in nature as aerobic bacteria
gene for CTX-M-gp1 enzyme only (Table 4). Two isolates (Enterococcus spp., E. coli, Staphylococcus spp., Alcaligenes

Frontiers in Microbiology | www.frontiersin.org 8 January 2016 | Volume 6 | Article 1464

Shahi and Kumar Multidrug Resistant Bacteria from DFUs

FIGURE 2 | Phylogenetic analysis based on the sequences of 16S rRNA gene sequence of 37 DFUs isolates and 110 sequences retrieved from NCBI.
The evolutionary history was inferred using the Neighbor-joining method. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the
evolutionary history of the taxa analyzed. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The tree is drawn to
scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed
using the Kimura 2-parameter method and are in the units of the number of base substitutions per site. The accession number of each strain is mentioned in tree.
Thirty eight isolates identified by 16S rDNA sequencing are highlighted in red.

FIGURE 3 | Representation of class 1 integron (1.6 kb) organization in K. pneumoniae DF12SA. Blue color indicates the gene, green color shows the base
elements, and the red color represents 5’conserved segment (5′ -CS) and 3′ -CS of class 1 integron.

spp., Pseudomonas spp., and Stenotrophomonas spp.), and Enterobacteriaceae), anaerobic bacteria (Bacteroides spp.,
anaerobic bacteria (Bacteroides spp., Clostridium spp., and Clostridium spp., and Peptostreptococcus spp.) and fungi
Peptostreptococcus spp.) were isolated from the severe DFUs (Candida albicans, and Candida tropicalis) were isolated from
(Wagner’s grade, III-V) patients in this study. Our findings DFUs (Candel et al., 2003; Turhan et al., 2015). Enterococci are
are similar to the study conducted by other groups wherein the most common cause of DFIs. Higher incidence of MDR
aerobic bacteria (Staphylococcus spp., Streptococcus spp., and enterococci in DFIs is expected in view of their well-documented

Frontiers in Microbiology | www.frontiersin.org 9 January 2016 | Volume 6 | Article 1464

Shahi and Kumar Multidrug Resistant Bacteria from DFUs

role in several other infections. This is a tentative explanation, Since a plasmid or transposon can carry several resistance
exact cause is not known to us. Though earlier studies showed determinants, simultaneous resistance to multiple antibiotics
Gram-positive aerobes as predominant in DFIs (Dang et al., may be attained. It would have been worthwhile to isolate
2003; Spichler et al., 2015), our findings revealed dominance plasmid from different isolates as their presence cannot be
of Gram-negative aerobic bacteria. The ratio of Gram-positive ruled out.
aerobes to Gram-negative aerobes was 1:1.67, which is contrary Resistance to β-lactam antibiotics in Gram-negative bacteria
to earlier report (Tentolouris et al., 1999). The differences in is primarily mediated by β-lactamases, which hydrolyze the β-
the age, gender, ulcer grades, study setting, etc. in our study lactam ring and thus inactivate the antibiotic (Livermore and
population as compared to other studies might be responsible Woodford, 2006). Different β-lactamases have been described,
for differences. However, our results are similar to the study but blaTEM , blaSHV , blaOXA , and blaCTX−M like genes are the
conducted in other parts of India (Gadepalli et al., 2006) where most predominant in Gram-negative bacteria (Livermore and
Gram-negative bacteria were more common than Gram-positive Woodford, 2006; Ahmed et al., 2007; Shahi et al., 2013). Our
bacteria in DFIs. findings are in agreement with above reports as β-lactamase genes
Conventional culture methods for anaerobes have been mostly conferring resistance to β-lactam antibiotics were noted in 35 out
used to identify bacteria in DFUs. Culture methods usually of 38 MDR isolates. Among the identified genes blaTEM , blaSHV ,
revealed a single organism (Shankar et al., 2005) and sometimes blaOXA , and blaCTX−M−gp1 , blaCTX−M−gp2 , and blaCTX−M−gp9 ,
even failed to demonstrate organisms despite other clinical blaTEM were the most common being present in majority of the
evidences of infection. However, in recent years PCR methods MDR isolates and blaOXA , blaCTX−M−gp1 , blaSHV , blaCTX−M−gp9 ,
have made it possible to detect most species of pathogens in and blaCTX−M−gp2 in certain isolates. Additionally, prevalence of
the wound in a matter of hours rather than days. We employed methicillin resistant S. aureus (MRSA), and vancomycin resistant
culture-independent method mainly based on PCR amplification Enterococcus species was also noted which is at par with the
of genus-specific amplicon (16S rRNA) and the results obtained reports of other researchers (Mehrotra et al., 2000; Hartemann-
were encouraging. Desired amplicons from a few anaerobic Heurtier et al., 2004; Gadepalli et al., 2006; Janifer et al., 2013; Jia
bacteria were successfully amplified using genus-specific primers. et al., 2014). TEM type β-lactamase has been reported in earlier
Herein, application of PCR assay using template DNA extracted studies which also support our findings (Jia et al., 2014; Farid
from the tissue of DFUs allowed to gain a better insight of et al., 2015).
anaerobic bacteria as compared to culture-dependent method. Of 38 isolates showing resistance to more than eight
This was evident from the fact that Clostridium was frequently antibiotics, 26 (68.42%) isolates were positive for class 1 integron.
identified in DFUs followed by P. productus and Bacteroides This suggests that integrons are widely distributed in bacteria
whereas certain other studies showed higher prevalence of infecting DFUs. This is supported from the results of PCR
Peptostreptococcus spp. (Colayco et al., 2002). It is concluded amplification of 11 variable regions of class 1 integron in
that PCR assay may be useful to unravel the complexity different isolates. Two types of class 1 integrons of varying sizes
of bacterial occurrence especially anaerobes in DFUs of (0.5–4.0 kb) were detected in 4 MDR bacteria and 22 isolates
diabetic patients. possessed one integron of varying sizes (0.3–2.5 kb). It was also
It was evident from the results that majority of the isolates noted that variable region of class 1 integron carried one to
were resistant to a number of antibiotics but certain isolates three resistance genes. Altogether, 12 different gene cassettes
were sensitive to cefoperazone, piperacillin/tazobactam, and encoding resistance to aminoglycosides and trimethoprim
clindamycin. Altogether, our findings clearly suggest that the were detected. Presence of these two gene cassettes in MDR
prevalence of MDR bacteria is fairly common in severe bacteria isolated from different sources has been reported
DFUs and support the findings of earlier studies (Hartemann- (Antunes et al., 2006). Interestingly, our results showed that
Heurtier et al., 2004; Gadepalli et al., 2006; Djahmi et al., aminoglycoside adenyltransferase gene (aadA), which confers
2013). It has been reported that about one-third of patients resistance to streptomycin and/or spectinomycin, was the most
with a history of previous hospitalization for the same common among all the gene cassettes. Widespread resistance
wound, and 25% of patients with osteomyelitis, had MDR to aminoglycoside viz. streptomycin and/or spectinomycin may
bacteria in the specimens (Hartemann-Heurtier et al., 2004). be due to the fact that they are extensively used for treating
Gadepalli et al. (2006) reported 44.7 and 56.0% β-lactamase- various infectious diseases including urinary tract infection
producing and methicillin resistant bacteria, respectively in and DFUs. Lately the therapeutic uses of streptomycin and
DFUs from North India (New Delhi). Incidence of relatively spectinomycin are avoided but they are widely used in agriculture
higher frequency of antibiotic resistance in this study could and livestock. The dhfr gene cassettes that confer resistance
be due to the fact that Sir Sunderlal Hospital of Banaras to trimethoprim were also detected frequently. Similar to our
Hindu University, Varanasi, is a tertiary care hospital with findings high prevalence of the aminoglycoside resistance (aadA)
widespread usage of broad spectrum antibiotics leading to and trimethoprim resistance determinants (dhfrA) have been
selective survival advantage of bacteria. Additionally, increase reported in E. coli, K. pneumoniae and S. aureus from Asia
in antibiotic resistance might be the result of irrational use and Europe (Sáenz et al., 2004; Gadepalli et al., 2006; Chang
of antibiotics, and horizontal transfer of antibiotic resistant et al., 2009; El-Najjar et al., 2010). Additionally, clinical isolates
genes among bacteria by mobile genetic elements including namely E. coli, S. haemolyticus, Enterococcus spp., Pseudomonas
plasmids, transposons, and integrons (Domingues et al., 2012). spp., and Alcaligenes spp. have also been reported to carry

Frontiers in Microbiology | www.frontiersin.org 10 January 2016 | Volume 6 | Article 1464

Shahi and Kumar Multidrug Resistant Bacteria from DFUs

resistance to trimethoprim, streptomycin and spectinomycin CONCLUSION

(White et al., 2001; Lindstedt et al., 2003; Nógrády et al.,
2005). The dhfrAXVII- aadAV gene cassette was present in In conclusion, the occurrence of multiple-antibiotic resistant
the variable region of 12 integron-positive isolates, where the bacteria seems widespread in DFUs. Findings of this study clearly
location of aadAV was close to the 3′ CS and dhfrAXVII to indicate that resistance to antibiotics is mediated mainly due
the 5′ CS region. Strong association between the presence of to the presence of class 1 integrons. Furthermore, certain β-
gene cassettes and resistance to specific antibiotics have been lactamases are specifically induced upon growth of MDR strains
demonstrated in several studies (Chang et al., 2000; Roe and with antibiotics and may be important in conferring resistance
Pillai, 2003; Rao et al., 2008). On the contrary, in our study to antibiotics. As the worldwide prevalence of antibiotic-resistant
certain isolates were found to carry integron gene cassettes bacteria is on increase and may cause serious threat to human
but the corresponding antibiotic resistance phenotype was health, further study of integrons and their associated gene
absent. This might be due to the inefficient expression of cassettes is needed to understand the mechanisms of acquisition
the inserted gene cassettes by the integron promoter. Result of MDR genes in clinical isolates. Findings of the present
showing the occurrence of integrons with identical cassettes study may provide useful insights for the selection of potential
(dhfrAXVII, aadAV) in a number of isolates is an interesting antibiotics and management of DFUs in diabetic patients.
finding of this study. It seems that certain species may have
identical mechanism (s) for the acquisition of multi-resistance ACKNOWLEDGMENTS
to antibiotics. To our knowledge, occurrence of class 1 and
2 integrons in clinical isolates of Enterococcus spp has been SS is grateful to ICMR, New Delhi (India), for the award of Senior
reported only recently (Xu et al., 2010; Yan et al., 2010) and Research Fellowship (80/622/2009-ECD-1). This study was partly
therefore occurrence of integron in Eneterococcus spp. in this supported by a research grant sanctioned to AK by the Indian
study is new addition and supports the findings of earlier Council of Agricultural Research, Government of India, New
researchers. Delhi, (NBAIM/AMAAS/2014-17/PF/4).

REFERENCES clinical isolates of Escherichia coli from Taiwan, ROC. Antimicrob. Resist. 49,
1097–1102. doi: 10.1099/0022-1317-49-12-1097
Ahmed, A. M., Motoi, Y., Sato, M., Maruyama, A., Watanabe, H., Fukumoto, Y., Chang, C. Y., Fang, Y. T., Tsai, S. M., Chang, L. L., and Yu, W. L. (2009).
et al. (2007). Zoo animals as reservoirs of Gram-negative bacteria harboring Characterization of class 1 integrons and gene cassettes in clinical isolates of
integrons and antimicrobial resistance genes. Appl. Environ. Microbiol. 73, Klebsiella pneumoniae from Taiwan. Diag. Microbiol. Infect. Dis. 65, 214–216.
6686–6690. doi: 10.1128/AEM.01054-07 doi: 10.1016/j.diagmicrobio.2009.06.005
Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W., et al. Colayco, C. A. S., Mendoza, M. T., Alejandria, M. M., and Ang, C. F. (2002).
(1997). Gapped BLAST and PSI-BLAST: a new generation of protein database Microbiologic and clinical profile of anaerobic diabetic foot infections. Phil. J.
search programs. Nucleic Acids Res. 25, 3389–3402. doi: 10.1093/nar/25.17.3389 Microbiol. Infect. Dis. 31, 151–160.
Antunes, P., Machad, J., and Peixe, L. (2006). Characterization of antimicrobial Coque, T. M., Baquero, F., and Canton, R. (2008). Increasing prevalence of
resistance and class 1 and 2 integrons in Salmonella enterica isolates from ESBL-producing Enterobacteriaceae in Europe. Euro. Surveill. 13, 1–11.
different sources in Portugal. J. Antimicrob. Chemother. 58, 297–304. doi: Dallenne, C., Da Costa, A., Decré, D., Favier, C., and Arlet, G. (2010). Development
10.1093/jac/dkl242 of a set of multiplex PCR assays for the detection of genes encoding important
Arakere, G., Nadig, S., Swedberg, G., Macaden, R., Amarnath, S. K., and beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 65, 490–495.
Raghunath, D. (2005). Genotyping of methicillin-resistant Staphylococcus doi: 10.1093/jac/dkp498
aureus strains from two hospitals in Bangalore, South India. J. Clin. Microbiol. Dang, C. N., Prasad, Y. D., Boulton, A. J., and Jude, E. B. (2003). Methicillin-
43, 3198–3202. doi: 10.1128/JCM.43.7.3198-3202.2005 resistant Staphylococcus aureus in the diabetic foot clinic: a worsening problem.
Bakker, K., Van Houtum, W. H., and Riley, P. C. (2005). 2005: the international Diabet. Med. 20, 159–161. doi: 10.1046/j.1464-5491.2003.00860.x
diabetes federation focuses on the diabetic foot. Curr. Diab. Rep. 5, 436–440. Djahmi, N., Messad, N., Nedjai, S., Moussaoui, A., Mazouz, D., Richard, J. L.,
doi: 10.1007/s11892-005-0051-y et al. (2013). Molecular epidemiology of Staphylococcus aureus strains isolated
Bauer, R. W., Kirby, M. D. K., Sherris, J. C., and Turck, M. (1966). Antibiotic from inpatients with infected diabetic foot ulcers in an Algerian University
susceptibility testing by standard single disc diffusion method. Am. J. Clin. Hospital. Clin. Microbiol. Infect. 19, E398–E404. doi: 10.1111/1469-0691.
Pathol. 45, 493–496. 12199
Bradford, P. A. (2001). Extended-spectrum β-lactamases in the 21st century: Domingues, S., Nielsen, K. M., and da Silva, G. J. (2012). Various pathways leading
characterization, epidemiology, and detection of this important resistance to the acquisition of antibiotic resistance by natural transformation. Mob.
threat. Clin. Microbiol. Rev. 14, 933–951. doi: 10.1128/CMR.14.4.933- Genet. Elements 2, 257–260. doi: 10.4161/mge.23089
951.2001 Dowd, S. E., Wolcott, R. D., Sun, Y., McKeehan, T., Smith, E., and
Candel, G. F. J., Alramadan, M., Matesanz, M., Diazb, A., Gonzalez-Romoa, F., Rhoads, D. (2008). Polymicrobial nature of chronic diabetic foot ulcer
Candelc, I., et al. (2003). Infections in diabetic foot ulcers. Eur. J. Intern. Med. biofilm infections determined using bacterial tag encoded FLX amplicon
14, 341–343. doi: 10.1016/S0953-6205(03)00107-9 pyrosequencing (bTEFAP). PLoS ONE 3:e3326. doi: 10.1371/journal.pone.
Centrón, D., and Roy, P. H. (2002). Presence of a group II intron in a multiresistant 0003326
Serratia marcescens strain that harbors three integrons and a novel gene fusion. Drum, D. J. V. (2003). Ecology of Antimicrobial Resistance among Domestic and
Antimicrob. Agents Chemother. 46, 1402–1409. doi: 10.1128/AAC.46.5.1402- Free Range Fowl Populations. PG Thesis, The University of Georgia, Athens,
1409.2002 USA.
Chang, C. Y., Chang, L. L., Chang, Y. H., and Lee, T. M. (2000). Characterization El-Najjar, N. G., Farah, M. J., Hashwa, F. A., and Tokajian, S. T. (2010).
of drug resistance gene cassettes associated with class 1 integrons in Antibiotic resistance patterns and sequencing of class I integron from

Frontiers in Microbiology | www.frontiersin.org 11 January 2016 | Volume 6 | Article 1464

Shahi and Kumar Multidrug Resistant Bacteria from DFUs

uropathogenic Escherichia coli in Lebanon. Lett. Appl. Microbiol. 51, 456–461. Ochman, H., Lawrence, J. G., and Groisman, E. A. (2000). Lateral gene transfer
doi: 10.1111/j.1472-765X.2010.02926.x and the nature of bacterial innovation. Nature 405, 299–304. doi: 10.1038/35
El-Sokkary, M. M. A., and Abdelmegeed, E. S. (2015). Characterisation of class 1 012500
integron among Escherichia coli isolated from Mansoura University Hospitals Ozer, B., Kalaci, A., Semerci, E., Duran, N., Davul, S., and Yanat, A. N. (2010).
in Egypt. Adv. Microbiol. 5, 269–277. doi: 10.4236/aim.2015.54025 Infections and aerobic bacterial pathogens in diabetic foot. Afr. J. Microbiol.
Falcone, M., Russo, A., Giannella, M., Cangemi, R., Scarpellini, M. G., Res. 4, 2153–2160.
Bertazzoni, G., et al. (2015). Individualizing risk of multidrug-resistant Paterson, D. L., and Bonomo, R. A. (2005). Extended-spectrum β-lactamases: a
pathogens in community-onset pneumonia. PLoS ONE 10:e0119528. doi: clinical update. Clin. Microbiol. Rev. 18, 657–686. doi: 10.1128/CMR.18.4.657-
10.1371/journal.pone.0119528 686.2005
Farid, A., Naz, I., Ashraf, A., Ali, A., Rehman, A. U., Sarwar, Y., et al. Qing, Y., Wenxia, S., Qingqing, W., Xuejun, C., Jianping, L., and Mingming, Z.
(2015). Molecular detection of antimicrobial resistance in local isolates of (2012). Emergence of carbapenem-resistant Enterobacter cloacae carrying IMP-
Staphylococcus epidermidis from urinary tract infections in Faisalabad region 26 metallo-β lactamase in class 1 integron and TEM-104 extended-spectrum
of Pakistan. EXCLI J. 14, 697–705. doi: 10.17179/excli2015-294 β- lactamase in conjugative plasmid. Afr. J. Microbiol. Res. 6, 3186–3191. doi:
Gadepalli, R., Dhawan, B., Sreenivas, V., Kapil, A., Ammini, A. C., and Chaudhry, 10.5897/AJMR11.1477
R. (2006). Clinico-microbiological study of diabetic foot ulcers in an Indian Rao, S., Maddox, C. W., Hoien-Dalen, P., Lanka, S., and Weigel, R. M. (2008).
tertiary care hospital. Diabet. Care 29, 1727–1732. doi: 10.2337/dc06-0116 Diagnostic accuracy of class 1 integron PCR method in detection of antibiotic
Gebreyes, W. A., and Altier, C. (2002). Molecular characterization of multidrug resistance in Salmonella isolates from swine production systems. J. Clin.
resistant Salmonella enterica serovar Typhimurium in swine. J. Clin. Microbiol. Microbiol. 46, 916–920. doi: 10.1128/JCM.01597-07
40, 2813–2822. doi: 10.1128/JCM.40.8.2813-2822.2002 Rekha, R., Rizvi, M. A., and Jaishree, P. (2006). Designing and validation of genus-
Girlich, D., Karim, A., Poirel, L., Cavin, M. H., Verny, C., and Nordmann, specific primers for human gut flora study. Electron. J. Biotechnol. 9, 505–511.
P. (2000). Molecular epidemiology of an outbreak due to IRT-2 beta- doi: 10.2225/vol9-issue5-fulltext-2
lactamase-producing strains of Klebsiella pneumonia in a geriatric department. Roe, M. T., and Pillai, S. D. (2003). Monitoring and identifying antibiotic resistance
J. Antimicrob. Chemother. 45, 467–473. doi: 10.1093/jac/45.4.467 mechanisms in bacteria. Poult. Sci. 82, 622–626. doi: 10.1093/ps/82.4.622
Hall, R. M., Collis, C. M., Kim, M. J., Partridge, S. R., Racchia, G. D., and Stokes, H. Sáenz, Y., Briñas, L., Domínguez, E., Ruiz, J., Zarazaga, M., Vila, J., et al.
W. (1999). Mobile gene cassettes and integrons in evolution. Ann. N.Y. Acad. (2004). Mechanisms of resistance in multiple-antibiotic-resistant Escherichia
Sci. 870, 68–80. doi: 10.1111/j.1749-6632.1999.tb08866.x coli strains of human, animal, and food origins. Antimicrob. Agents Chemother.
Hartemann-Heurtier, A., Robert, J., Jacqueminet, S., Ha Van, G., Golmard, J. L., 48, 3996–3901. doi: 10.1128/AAC.48.10. 3996-4001.2004
Jarlier, V., et al. (2004). Diabetic foot ulcer and multidrug-resistant organisms: Sana, T., Rami, K., Racha, B., Fouad, D., Marcel, A., Hasan, M., et al.
risk factors and impact. Diabet. Med. 21, 710–715. doi: 10.1111/j.1464- (2011). Detection of genes TEM, OXA, SHV and CTX-M in 73 clinical
5491.2004.01237.x isolates of Escherichia coli producers of extended spectrum β-lactamases and
Janifer, J., Sekkizhar, G., Kumpatla, S., and Viswanathan, V. (2013). Bioburden determination of their susceptibility to antibiotics. Int. Arab. J. Antimicrob.
vs. bntibiogram of diabetic foot infection. Clin. Res. Foot Ankle 1:121. doi: Agent. 1, 1–6.
10.4172/2329-910X.1000121 Shahi, S. K., Singh, V. K., and Kumar, A. (2013). Detection of Escherichia coli
Jia, W., Li, G., and Wang, W. (2014). Prevalence and antimicrobial resistance of and associated β-lactamases genes from diabetic foot ulcers by multiplex PCR
Enterococcus species: a hospital-based study in China. Int. J. Environ. Res. Public and molecular modelling and docking of SHV-1, TEM-1, and OXA-1 β-
Health 11, 3424–3442. doi: 10.3390/ijerph110303424 lactamases with clindamycin and piperacillin-tazobactam. PLoS ONE 8:e68234.
Kimberley, C., and Elsa,. B. (2003). Identification of Bacterial Species. Association doi: 10.1371/journal.pone.0068234
for Biology Laboratory Education (ABLE). Available online at: http://www.zoo. Shakil, S., and Khan, A. U. (2010). Infected foot ulcers in male and female diabetic
utoronto.ca/able patients: a clinico-bioinformative study. Ann. Clin. Microbiol. Antimicrob. 9:2.
Kolár, M., Urbánek, K., and Látal, T. (2001). Antibiotic selective pressure and doi: 10.1186/1476-0711-9-2
development of bacterial resistance. Int. J. Antimicrob. Agents 17, 357–363. doi: Shankar, E. M., Mohan, V., Premalatha, G., Srinivasan, R. S., and Usha, A. R.
10.1016/S0924-8579(01)00317-X (2005). Bacterial etiology of diabetic foot infections in South India. Europ. J.
Lévesque, C., Piché, L., Larose, C., and Paul, R. (1995). PCR mapping of integrons Intern. Med. 16, 567–570. doi: 10.1016/j.ejim.2005.06.016
reveals several novel combinations of resistance genes. Antimicrob. Agents Singh, N., Armstrong, D. G., and Lipsky, B. A. (2005). Preventing foot
Chemother. 39, 185–191. doi: 10.1128/AAC.39.1.185 ulcers in patients with diabetes. J. Am. Med. Ass. 293, 217–228. doi:
Lindstedt, B. A., Heir, E., Nygard, I., and Kapperud, G. (2003). Characterization 10.1001/jama.293.2.217
of class I integrons in clinical strains of Salmonella enterica subsp. enterica Singh, S. K., Gupta, K., Tiwari, S., Shahi, S. K., Kumar, S., Kumar, A., et al. (2009).
serovars Typhimurium and Enteritidis from Norwegian hospitals. J. Med. Detecting aerobic bacterial diversity in patients with diabetic foot wounds using
Microbiol. 52, 141–149. doi: 10.1099/jmm.0.04958-0 ERIC-PCR: a preliminary communication. Int. J. Lower Extrem. Wounds 8,
Lipsky, B. A. (2007). Empirical therapy for diabetic foot infections: are there 203–209. doi: 10.1177/1534734609353080
clinical clues to guide antibiotic selection. Clin. Microbiol. Infect. 13, 351–353. Sotto, A., Richard, J. L., Messad, N., Molinari, N., Jourdan, N., Schuldiner, S., et al.
doi: 10.1111/j.1469-0691.2007.01697.x (2012). Distinguishing colonization from infection with Staphylococcus aureus
Livermore, D. M., and Woodford, N. (2006). The β-lactamase threat in in diabetic foot ulcers with miniaturized oligonucleotide arrays. Diabet. Care
Enterobacteriaceae, Pseudomonas and Acinetobacter. Trends Microbiol. 14, 35, 617–623. doi: 10.2337/dc11-1352
413–420. doi: 10.1016/j.tim.2006.07.008 Spichler, A., Hurwitz, B. L., Armstrong, D. G., and Lipsky, B. A. (2015).
Mazel, D. (2006). Integrons: agents of bacterial evolution. Nat. Rev. Microbiol. 4, Microbiology of diabetic foot infections: from Louis Pasteur to crime scene
608–620. doi: 10.1038/nrmicro1462 investigation. BMC Med. 13:2. doi: 10.1186/s12916-014-0232-0
Mehrotra, M., Wang, G., and Johnson, W. M. (2000). Multiplex PCR for detection Stokes, H. W., and Hall, R. M. (1989). A novel family of potentially mobile
of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock DNA elements encoding site-specific gene-integration functions: integrons.
syndrome toxin 1, and methicillin resistance. J. Clin. Microbiol. 38, 1032–1035. Mol. Microbiol. 3, 1669–1683. doi: 10.1111/j.1365-2958.1989.tb00153.x
Mobarak-Qamsari, M., Ashayeri-Panah, M., Eftekhar, F., and Feizabadi, M. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. (2011).
M. (2014). Integron mediated multidrug resistance in extended spectrum MEGA 5: molecular evolutionary genetics analysis using maximum likelihood,
beta-lactamase producing clinical isolates of Klebsiella pneumoniae. Braz. J. evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28,
Microbiol. 44, 849–854. doi: 10.1590/S1517-83822013000300028 2731–2739. doi: 10.1093/molbev/msr121
Nógrády, N., Gadó, I. T. A., and Pászti, J. (2005). Antibiotic resistance and class Tentolouris, N., Jude, E. B., Smirnof, I., Knowles, E. A., and Boulton, A. J.
1 integron patterns of non-typhoidal human Salmonella serotypes isolated (1999). Methicillin-resistant Staphylococcus aureus: an increasing problem in
in Hungary in 2002 and 2003. Int. J. Antimicrob. Agents 26, 126–132. doi: a diabetic foot clinic. Diabet. Med. 16, 767–771. doi: 10.1046/j.1464-5491.1999.
10.1016/j.ijantimicag.2005.04.015 00132.x

Frontiers in Microbiology | www.frontiersin.org 12 January 2016 | Volume 6 | Article 1464

Shahi and Kumar Multidrug Resistant Bacteria from DFUs

Turhan, V., Mutluoglu, M., Acar, A., Hatipoglu, M., Onem, Y., Uzun, G., et al. Yan, H., Li, L., Zong, M., Alam, M. J., Shinoda, S., and Shi, L. (2010). Occurrence
(2015). Increasing incidence of Gram-negative organisms in bacterial agents and characteristics of class 1 and class 2 integrons in clinical bacterial isolates
isolated from diabetic foot ulcers. J. Infect. Dev. Ctries. 15, 707–712. doi: from patients in south China. J. Health Sci. 56, 442–450. doi: 10.1248/jhs.56.442
10.3855/jidc.2967
Wagner, F. W. (1981). The dysvascular foot: a system for diagnosis and treatment. Conflict of Interest Statement: The authors declare that the research was
Foot Ankle 2, 64–122. doi: 10.1177/107110078100200202 conducted in the absence of any commercial or financial relationships that could
White, P. A., McIver, C. J., and Rawlinson, W. D. (2001). Integrons be construed as a potential conflict of interest.
and gene cassettes in the Enterobacteriaceae. Antimicrob.
Agents Chemother. 45, 2658–2661. doi: 10.1128/AAC.45.9.2658- Copyright © 2016 Shahi and Kumar. This is an open-access article distributed
2661.2001 under the terms of the Creative Commons Attribution License (CC BY). The use,
Xu, Z., Li, L., Shirtliff, M. E., Peters, B. M., Peng, Y., Alam, M. J., et al. (2010). First distribution or reproduction in other forums is permitted, provided the original
report of class 2 integron in clinical Enterococcus faecalis and class 1 integron in author(s) or licensor are credited and that the original publication in this journal
Enterococcus faecium in South China. Diagn. Microbiol. Infect. Dis. 68, 315–317. is cited, in accordance with accepted academic practice. No use, distribution or
doi: 10.1016/j.diagmicrobio.2010.05.014 reproduction is permitted which does not comply with these terms.

Frontiers in Microbiology | www.frontiersin.org 13 January 2016 | Volume 6 | Article 1464