Advanced Machine Learning Applications in Big Data Analytics
Uploaded by
01kakaebookdigitalAdvanced Machine Learning Applications in Big Data Analytics
Uploaded by
01kakaebookdigitalSpecial Issue Reprint
Advanced Machine
Learning Applications
in Big Data Analytics
Edited by
Taiyong Li, Wu Deng and Jiang Wu
www.mdpi.com/journal/electronics
Advanced Machine Learning
Applications in Big Data Analytics
Advanced Machine Learning
Applications in Big Data Analytics
Editors
Taiyong Li
Wu Deng
Jiang Wu
Basel • Beijing • Wuhan • Barcelona • Belgrade • Novi Sad • Cluj • Manchester
Editors
Taiyong Li Wu Deng Jiang Wu
Southwestern University of Civil Aviation University Southwestern University of
Finance and Economics of China Finance and Economics
China China China
Editorial Office
MDPI
St. Alban-Anlage 66
4052 Basel, Switzerland
This is a reprint of articles from the Special Issue published online in the open access journal Electronics
(ISSN 2079-9292) (available at: https://www.mdpi.com/journal/electronics/special issues/ML
Big Data).
For citation purposes, cite each article independently as indicated on the article page online and as
indicated below:
Lastname, A.A.; Lastname, B.B. Article Title. Journal Name Year, Volume Number, Page Range.
ISBN 978-3-0365-8486-7 (Hbk)
ISBN 978-3-0365-8487-4 (PDF)
doi.org/10.3390/books978-3-0365-8487-4
© 2023 by the authors. Articles in this book are Open Access and distributed under the Creative
Commons Attribution (CC BY) license. The book as a whole is distributed by MDPI under the terms
and conditions of the Creative Commons Attribution-NonCommercial-NoDerivs (CC BY-NC-ND)
license.
Contents
About the Editors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
Taiyong Li, Wu Deng and Jiang Wu
Advanced Machine Learning Applications in Big Data Analytics
Reprinted from: Electronics 2023, 12, 2940, doi:10.3390/electronics12132940 . . . . . . . . . . . . . 1
Zhaohui Li, Lin Wang, Deyao Wang, Ming Yin and Yujin Huang
Short-Term Traffic-Flow Forecasting Based on an Integrated Model Combining Bagging and
Stacking Considering Weight Coefficient
Reprinted from: Electronics 2022, 11, 1467, doi:10.3390/electronics11091467 . . . . . . . . . . . . . 9
Zhaohui Li, Wenjia Piao, Lin Wang, Xiaoqian Wang, Rui Fu and Yan Fang
China Coastal Bulk (Coal) Freight Index Forecasting Based on an Integrated Model Combining
ARMA, GM and BP Model Optimized by GA
Reprinted from: Electronics 2022, 11, 2732, doi:10.3390/electronics11172732 . . . . . . . . . . . . . 31
PanjieWang,JiangWu,YuanWeiandTaiyongLi
CEEMD-MultiRocket:Integrating CEEMD with Improved MultiRocket for Time
SeriesClassification
Reprinted from: Electronics 2023, 12, 1188, doi:10.3390/electronics12051188 . . . . . . . . . . . . . 47
Zineb Bousbaa, Javier Sanchez-Medina and Omar Bencharef
Financial Time Series Forecasting: A Data Stream Mining-Based System
Reprinted from: Electronics 2023, 12, 2039, doi:10.3390/electronics12092039 . . . . . . . . . . . . . 67
XuHanandShicaiGong
LST-GCN:LongShort-TermMemoryEmbeddedGraphConvolutionNetworkforTraffic
FlowForecasting
Reprinted from: Electronics 2022, 11, 2230, doi:10.3390/electronics11142230 . . . . . . . . . . . . . 97
Hongxing Gao, Guoxi Liang and Huiling Chen
Multi-Population Enhanced Slime Mould Algorithm and with Application to Postgraduate
Employment Stability Prediction
Reprinted from: Electronics 2022, 11, 209, doi:10.3390/electronics11020209 . . . . . . . . . . . . . 111
Hanli Bao, Guoxi Liang, Zhennao Cai and Huiling Chen
Random Replacement Crisscross Butterfly Optimization Algorithm for Standard Evaluation of
Overseas Chinese Associations
Reprinted from: Electronics 2022, 11, 1080, doi:10.3390/electronics11071080 . . . . . . . . . . . . . 141
Wenyu Zhang, Donglin Zhu, Zuwei Huang and Changjun Zhou
Improved Multi-Strategy Matrix Particle Swarm Optimization for DNA Sequence Design
Reprinted from: Electronics 2023, 12, 547, doi:10.3390/electronics12030547 . . . . . . . . . . . . . 169
YingjieSong,YingLiu,HuayueChenandWuDeng
AMulti-StrategyAdaptiveParticleSwarmOptimizationAlgorithmforSolving
OptimizationProblem
Reprinted from: Electronics 2023, 12, 491, doi:10.3390/electronics12030491 . . . . . . . . . . . . . 191
HongLi,SichengKe,XiliRao,CaisiLi,DanyanChen,FangjunKuang,etal.
An Improved Whale Optimizer with Multiple Strategies for Intelligent Prediction of
TalentStability
Reprinted from: Electronics 2022, 11, 4224, doi:10.3390/electronics11244224 . . . . . . . . . . . . . 207
v
Jinyin Wang, Shifan Shang, Huanyu Jing, Jiahui Zhu, Yingjie Song, Yuangang Li
and WuDeng
ANovelMultistrategy-BasedDifferentialEvolutionAlgorithmandItsApplication
Reprinted from: Electronics 2022, 11, 3476, doi:10.3390/electronics11213476 . . . . . . . . . . . . . 243
Feng Miu, Ping Wang, Yuning Xiong, Huading Jia and Wei Liu
Fine-Grained Classification of Announcement News Events in the Chinese Stock Market
Reprinted from: Electronics 2022, 11, 2058, doi:10.3390/electronics11132058 . . . . . . . . . . . . . 261
Mingyu Jia, Fang’ai Liu, Xinmeng Li and Xuqiang Zhuang
Hybrid Graph Neural Network Recommendation Based on Multi-Behavior Interaction and
Time Sequence Awareness
Reprinted from: Electronics 2023, 12, 1223, doi:10.3390/electronics12051223 . . . . . . . . . . . . . 279
Nina Fatehi, Qutaiba Alasad and Mohammed Alawad
Towards Adversarial Attacks for Clinical Document Classification
Reprinted from: Electronics 2023, 12, 129, doi:10.3390/electronics12010129 . . . . . . . . . . . . . 295
Lifeng Yin, Menglin Li, Huayue Chen and Wu Deng
An Improved Hierarchical Clustering Algorithm Based on the Idea of Population Reproduction
and Fusion
Reprinted from: Electronics 2022, 11, 2735, doi:10.3390/electronics11172735 . . . . . . . . . . . . . 315
Erbin Yang, Yingchao Wang, Peng Wang, Zheming Guan and Wu Deng
An Intelligent Identification Approach Using VMD-CMDE and PSO-DBN for Bearing Faults
Reprinted from: Electronics 2022, 11, 2582, doi:10.3390/electronics11162582 . . . . . . . . . . . . . 335
Nongtian Chen, Youchao Sun, Zongpeng Wang and Chong Peng
Improved LS-SVM Method for Flight Data Fitting of Civil Aircraft Flying at High Plateau
Reprinted from: Electronics 2022, 11, 1558, doi:10.3390/electronics11101558 . . . . . . . . . . . . . 353
Jiaxin Yu, Wenyuan Liu, Yongjun He and Bineng Zhong
A Hierarchical Heterogeneous Graph Attention Network for Emotion-Cause Pair Extraction
Reprinted from: Electronics 2022, 11, 2884, doi:10.3390/electronics11182884 . . . . . . . . . . . . . 365
YouchenFan,QianlongQiu,ShunhuHou,YuhaiLi,JiaxuanXie,MingyuQin
andFeihuangChu
ApplicationofImprovedYOLOv5inAerialPhotographingInfraredVehicleDetection
Reprinted from: Electronics 2022, 11, 2344, doi:10.3390/electronics11152344 . . . . . . . . . . . . . 383
Antonio Guerrero-Ibañez and Angelica Reyes-Muñoz
Monitoring Tomato Leaf Disease through Convolutional Neural Networks
Reprinted from: Electronics 2023, 12, 229, doi:10.3390/electronics12010229 . . . . . . . . . . . . . 403
Liang Zhang, Ligang Wu and Yaqing Liu
Hemerocallis citrina Baroni Maturity Detection Method Integrating Lightweight Neural Network
and Dual Attention Mechanism
Reprinted from: Electronics 2022, 11, 2743, doi:10.3390/electronics11172743 . . . . . . . . . . . . . 419
NongtianChen,YongzhengManandYouchaoSun
AbnormalCockpitPilotDrivingBehaviorDetectionUsingYOLOv4Fused
AttentionMechanism
Reprinted from: Electronics 2022, 11, 2538, doi:10.3390/electronics11162538 . . . . . . . . . . . . . 435
JinJin,QianZhang,JiaHeandHongnianYu
Quantum Dynamic Optimization Algorithm for Neural Architecture Search on
ImageClassification
Reprinted from: Electronics 2022, 11, 3969, doi:10.3390/electronics11233969 . . . . . . . . . . . . . 447
vi
Lei Yue, Haifeng Ling, Jianhu Yuan and Linyuan Bai
A Lightweight Border Patrol Object Detection Network for Edge Devices
Reprinted from: Electronics 2022, 11, 3828, doi:10.3390/electronics11223828 . . . . . . . . . . . . . 461
Ansheng Ye, Xiangbing Zhou and Fang Miao
Innovative Hyperspectral Image Classification Approach Using Optimized CNN and ELM
Reprinted from: Electronics 2022, 11, 775, doi:10.3390/electronics11050775 . . . . . . . . . . . . . 481
PengheHuang,DongyanLi,YuWang,HuiminZhaoandWuDeng
A Novel Color Image Encryption Algorithm Using Coupled Map Lattice with
PolymorphicMapping
Reprinted from: Electronics 2022, 11, 3436, doi:10.3390/electronics11213436 . . . . . . . . . . . . . 497
Chen Chen, Donglin Zhu, Xiao Wang and Lijun Zeng
One-Dimensional Quadratic Chaotic System and Splicing Model for Image Encryption
Reprinted from: Electronics 2023, 12, 1325, doi:10.3390/electronics12061325 . . . . . . . . . . . . . 513
MihaelaMunteanandFlorinDanielMilitaru
Design Science Research Framework for Performance Analysis Using Machine
LearningTechniques
Reprinted from: Electronics 2022, 11, 2504, doi:10.3390/electronics11162504 . . . . . . . . . . . . . 529
Qingxiao Zheng, Lingfeng Wang, Jin He and Taiyong Li
KNN-Based Consensus Algorithm for Better Service Level Agreement in Blockchain as a Service
(BaaS) Systems
Reprinted from: Electronics 2023, 12, 1429, doi:10.3390/electronics12061429 . . . . . . . . . . . . . 547
Daobing Liu, Zitong Jin, Huayue Chen, Hongji Cao, Ye Yuan, Yu Fan and Yingjie Song
Peak Shaving and Frequency Regulation Coordinated Output Optimization Based on
Improving Economy of Energy Storage
Reprinted from: Electronics 2022, 11, 29, doi:10.3390/electronics11010029 . . . . . . . . . . . . . . 569
Mushtaq Hussain, Akhtarul Islam, Jamshid Ali Turi, Said Nabi, Monia Hamdi,
HabibHamam,etal.
MachineLearning-DrivenApproachforaCOVID-19WarningSystem
Reprinted from: Electronics 2022, 11, 3875, doi:10.3390/electronics11233875 . . . . . . . . . . . . . 591
Jian Xie, Shaolong Xuan, Weijun You, Zongda Wu and Huiling Chen
An Effective Model of Confidentiality Management of Digital Archives in a Cloud Environment
Reprinted from: Electronics 2022, 11, 2831, doi:10.3390/electronics11182831 . . . . . . . . . . . . . 607
Alimasi Mongo Providence, Chaoyu Yang, Tshinkobo Bukasa Orphe, Anesu Mabaire
andGeorgeK.Agordzo
Spatial and Temporal Normalization for Multi-Variate Time Series Prediction Using Machine
LearningAlgorithms
Reprinted from: Electronics 2022, 11, 3167, doi:10.3390/electronics11193167 . . . . . . . . . . . . . 625
vii
About the Editors
Taiyong Li
Taiyong Li received his Ph.D. from Sichuan University, Chengdu, China, in 2009, and he is
currently a Full Professor at the School of Computing and Artificial Intelligence, Southwestern
University of Finance and Economics. His research expertise lies in machine learning, computer
vision, image processing, and evolutionary computation, focusing on clustering, image security, and
time series analysis. He has published over 80 papers in journals and conferences, including ASOC,
NEUROCOM, TVCJ, ECM, MTAP, CVPR, etc. Eight of his papers have been selected as highly cited
in ESI, his Google Scholar H-index is 24, and he has led or participated in multiple national-level and
industry projects. He is an Electronics and Frontiers Artificial Intelligence in Finance guest editor or
review editor, and a reviewer of more than 30 journals, including AI Med, AI Rev, EAAI, ENTROPY,
ESWA, FIN, IJBC, IJIST, SUPERCOM, PR, PLOS ONE, SWARM EVOL COMPUT, and so on.
Wu Deng
Wu Deng received a Ph.D. in computer application technology from Dalian Maritime University,
Dalian, China, in 2012. He is currently a Professor at the College of Electronic Information and
Automation, Civil Aviation University of China, Tianjin, China. His research interests include
artificial intelligence, optimization method, and fault diagnosis. He has published over 120 papers
in journals and conferences, including IEEE T-SMCA, IEEE T-ITS, IEEE TIM, IEEE TR, INS, KBS, etc.
His Google Scholar H-index is 36.
Jiang Wu
Jiang Wu received his Ph.D. from Sichuan University, Chengdu, China, in 2008, and he is
currently a Full Professor at the School of Computing and Artificial Intelligence, Southwestern
University of Finance and Economics. His primary research interests include machine learning and
image processing. He has published more than 60 papers in journals and conferences. He has
led or participated in multiple national-level and industry projects. He reviews some journals and
conferences, such as ENTROPY, J INF SCI, and PACIS.
ix
electronics
Editorial
Advanced Machine Learning Applications in Big Data Analytics
Taiyong Li 1, *, Wu Deng 2 and Jiang Wu 1
1 School of Computing and Artificial Intelligence, Southwestern University of Finance and Economics,
Chengdu 611130, China; [email protected]
2 College of Electronic Information and Automation, Civil Aviation University of China, Tianjin 300300, China;
[email protected]
* Correspondence: [email protected]
1. Introduction
We are currently living in the era of big data. Discovering valuable patterns from big
data has become a very hot research topic, which holds immense benefits for governments,
businesses, and even individuals. Advanced machine learning models and algorithms have
emerged as effective approaches to analyze such data. At the same time, these methods
and algorithms are prompting applications in the field of big data.
Considering advanced machine learning and big data together, we have selected a
series of relevant works in this special issue to showcase the latest research advancements in
this field. Specifically, a total of thirty-three articles are included in this special issue, which
can be roughly categorized into six groups: time series analysis, evolutionary computation,
pattern recognition, computer vision, image encryption, and others.
2. Brief Description of the Published Articles
2.1. Time Series Analysis
Li et al. [1] proposed an integrated model combining bagging and stacking for short-
time traffic-flow prediction. The model incorporates vacation and peak time features, as
well as occupancy and speed information. A stacking model with ridge regression as
the meta-learner was established and optimized using the bagging model to obtain the
Ba-Stacking model. The base learners’ information structure was modified by weighting the
error coefficients to improve utilization, resulting in a DW-Ba-Stacking model. Experiment
Citation: Li, T.; Deng, W.; Wu, J. results showed that the DW-Ba-Stacking model had the highest prediction accuracy for
Advanced Machine Learning short-term traffic flow compared with traditional models.
Applications in Big Data Analytics. Li et al. [2] proposed a nonlinear integrated forecasting model combining auto-
Electronics 2023, 12, 2940. regressive and moving average (ARMA), grey system theory model (GM), and back-
https://doi.org/10.3390/ propagation (BP) model optimized by genetic algorithms (GA) to improve the forecasting
electronics12132940 accuracy of China coastal bulk coal freight index (CBCFI). The predicted values of ARMA
and GM were used as input training samples for the neural network. A genetic algorithm
Received: 29 June 2023
Accepted: 3 July 2023
was used to optimize the BP network to better exploit the prediction accuracy of the
Published: 4 July 2023
combined model. The combined ARMA-GM-GABP model was shown to have improved
prediction accuracy and can effectively solve the CBCFI forecasting problem.
Wang et al. [3] proposed a new time series classification method called CEEMD-MultiRocket.
It combined complementary ensemble empirical mode decomposition (CEEMD) with an im-
Copyright: © 2023 by the authors. proved MultiRocket algorithm to increase classification accuracy. The raw time series was
Licensee MDPI, Basel, Switzerland. first decomposed into three sub-series using CEEMD. The improved MultiRocket was
This article is an open access article applied to the raw time series, the selected decomposed sub-series and the first-order
distributed under the terms and difference of the raw time series to generate the final classification results. Experimental
conditions of the Creative Commons results showed that CEEMD-MultiRocket ranked second in classification accuracy on the
Attribution (CC BY) license (https:// 109 datasets from the UCR repository against a spread of state-of-the-art TSC models, only
creativecommons.org/licenses/by/ behind HIVE-COTE 2.0, but with only 1.4% of the latter’s computing load.
4.0/).
Electronics 2023, 12, 2940. https://doi.org/10.3390/electronics12132940 https://www.mdpi.com/journal/electronics
1
Electronics 2023, 12, 2940
Bousbaa et al. [4] proposed an incremental and adaptive strategy using the online
stochastic gradient descent algorithm (SGD) and particle swarm optimization metaheuristic
(PSO). Two techniques were involved in data stream mining (DSM): adaptive sliding
windows and change detection. The study focused on forecasting the value of the Euro
in relation to the US dollar. Results showed that the flexible sliding window proved
its ability to forecast the price direction with better accuracy compared to using a fixed
sliding window.
Han et al. [5] proposed a model named LST-GCN to improve the accuracy of traffic
flow predictions. They simulated spatiotemporal correlations by optimizing GCN parame-
ters using an LSTM network. This method improved the traditional method of combining
recurrent neural networks and graph neural networks in spatiotemporal traffic flow pre-
diction. Experiments conducted on the PEMS dataset showed that their proposed method
was more effective and outperformed other state-of-the-art methods.
2.2. Evolutionary Computation
Gao et al. [6] introduced an enhanced slime mould algorithm (MSMA) with a multi-
population strategy and proposed a prediction model based on the modified algorithm and
the support vector machine (SVM) algorithm called MSMA-SVM to provide a reference for
postgraduate employment decision and policy formulation. The multi-population strategy
improved the solution accuracy of the algorithm and the proposed model enhanced the abil-
ity to optimize the SVM. Experiments showed that the modified slime mould algorithm had
better performance compared to other algorithms and the optimal SVM model had better
classification ability and more stable performance for predicting employment stability.
Bao et al. [7] introduced two strategies to address the shortcomings of the butterfly
optimization algorithm (BOA): the random replacement strategy and the crisscross search
strategy. These strategies were combined to create the random replacement crisscross
BOA (RCCBOA). In order to evaluate the performance of RCCBOA, the author conducted
comparative experiments with nine other advanced algorithms on the IEEE CEC2014
functional test set, and founded it is effective when combining RCCBOA with support
vector machine (SVM) and feature selection (FS).
Zhang et al. [8] proposed an improved matrix particle swarm optimization algo-
rithm (IMPSO) to optimize DNA sequence design. The algorithm incorporated centroid
opposition-based learning and a dynamic update based on signal-to-noise ratio distance to
search for high-quality solutions. The results showed that the proposed method achieved
satisfactory outcomes and higher computational efficiency.
Song et al. [9] developed a multi-strategy adaptive particle swarm optimization
(APSO/DU) to accelerate the solving speed of the mean-semivariance (MSV) model . A
constraint factor was introduced to control velocity weight and reduce blindness in the
search process. A dual-update (DU) strategy was designed based on new speed and
position update strategies. The experiment results showed that the APSO/DU algorithm
had better convergence accuracy and speed.
Li et al. [10] designed an intelligent prediction model for talent stability in higher
education using a kernel extreme learning machine (KELM) and proposed a differential
evolution crisscross whale optimization algorithm (DECCWOA) for optimizing the model
parameters. The DECCWOA was shown to achieve high accuracy and fast convergence in
solving both unimodal and multimodal functions. The DECCWOA was combined with
KELM and feature selection (DECCWOA-KELM-FS) to achieve efficient talent stability
intelligence prediction for universities or colleges in Wenzhou. The results showed that
the performance of the proposed model outperformed other comparative algorithms. The
created system can serve as a reliable way to predict higher education talent flows.
Wang et al. [11] proposed a new algorithm called SEGDE to solve the capacitated vehi-
cle routing problem (CVRP). It combined the saving mileage algorithm (SMA), sequential
encoding (SE), and gravitational search algorithm (GSA) to address the problems of the
differential evolution (DE) algorithm. The SMA was used to initialize the population of
2
Electronics 2023, 12, 2940
the DE. The SE approach was used to adjust the differential mutation strategy. The GSA
was applied to adjust the evolutionary search direction and improve search efficiency. Four
CVRPs were tested with SEGDE and the results showed that SEGDE effectively solved
CVRPs with better performance.
2.3. Pattern Recognition
Miu et al. [12] proposed a two-step method to more finely classify the event type of
stock announcement news. First, candidate event trigger words and co-occurrence words
were extracted and arranged in order of common expressions. Then, final event types
were determined using three proposed criteria. Based on the real data of the Chinese stock
market, this method constructed 54 event types (p = 0.927, f = 0.946), and included some
types not discussed in previous studies.
Jia et al. [13] proposed a new hybrid graph network recommendation model called
the user multi-behavior graph network (UMBGN) to make full use of multi-behavior
user-interaction information. This model used a joint learning mechanism to integrate
user–item multi-behavior interaction sequences and a user multi-behavior information-
aware layer was designed to focus on the long-term multi-behavior features of users and
learn temporally ordered user–item interaction information through BiGRU and AUGRU
units. Experiments on three public datasets showed that this model outperformed the
best baselines.
Fatehi et al. [14] investigated the effectiveness of adversarial attacks on clinical docu-
ment classification and proposed a defense mechanism to develop a robust neural network
(CNN) model and counteract these attacks. Various black-box attacks based on concatena-
tion and editing adversaries were applied on unstructured clinical text. A defense technique
based on feature selection and filtering was proposed to improve the robustness of the
models. Experimental results showed that small perturbations caused a significant drop in
performance and the proposed defense mechanism avoided this drop and enhanced the
robustness of the CNN model for clinical document classification.
Yin et al. [15] proposed an improved hierarchical clustering algorithm called PRI-MFC
to solve the problems of traditional hierarchical clustering algorithms. The algorithm was
tested on artificial and real datasets and the experimental results showed superiority in
clustering effect, quality, and time consumption.
Yang et al. [16] proposed an intelligent fault diagnosis method for bearings based
on variational mode decomposition (VMD), composite multi-scale dispersion entropy
(CMDE), and deep belief network (DBN) with particle swarm optimization (PSO) algo-
rithm. The number of modal components decomposed by VMD was determined by the
observation center frequency and reconstructed according to the kurtosis. The CMDE of
the reconstructed signal was calculated to form training and test samples for pattern recog-
nition. PSO was used to optimize the parameters of the DBN model for fault identification.
Through experiment comparison, it was proved that the VMD-CMDE-PSO-DBN method
had application value in intelligent fault diagnosis.
Chen et al. [17] proposed an improved least squares support vector machines method
to solve the problem of the abnormality or loss of quick access recorder (QAR) data. This
method used the entropy weight method to obtain index weights, principal component
analysis for dimensionality reduction, and LS-SVM for data fitting and repair. The method
was tested using QAR data from multiple real plateau flights and showed high accuracy
and fit degree. This proved that the improved least squares support vector machines
machine learning model could effectively fit and supplement missing QAR data in the
plateau area through historical flight data.
Yu et al. [18] proposed a novel hierarchical heterogeneous graph attention network to
model global semantic relations among nodes for emotion-cause pair extraction (ECPE).
This method introduced all types of semantic elements involved in ECPE. A pair-level
subgraph was constructed to explore the correlation between pair nodes and their dif-
ferent neighboring nodes. Two-level heterogeneous graph attention networks were used
3
Electronics 2023, 12, 2940
to achieve representation learning of clauses and clause pairs. Experiments on bench-
mark datasets showed that this proposed model achieved significant improvement over
13 compared methods.
2.4. Computer Vision
Fan et al. [19] proposed an infrared vehicle target detection algorithm based on an
improved version of YOLOv5. The algorithm used the DenseBlock module to increase
shallow feature extraction ability, and the Ghost convolution layer replaced the ordinary
convolution layer to improve network feature extraction ability. The detection accuracy of
the whole network was enhanced by adding a channel attention mechanism and modifying
the loss function. Experimental results showed that the addition of DenseBlock and EIOU
modules alone improved detection accuracy by 2.5% and 3%, respectively, compared to the
original YOLOv5 algorithm. The combination of DenseBlock and Ghost convolution had
the best effect, and when adding three modules at the same time, the mAP fluctuation was
smaller, reaching 73.1%, which was 4.6% higher than the original YOLOv5 algorithm.
Guerrero-Ibañez et al. [20] proposed a model based on convolutional neural networks
to identify and classify tomato leaf diseases using a public dataset and photographs taken
in the fields to improve crop yields. Generative adversarial networks were used to avoid
overfitting. The proposed model achieved an accuracy greater than 99% in detecting and
classifying diseases in tomato leaves.
Zhang et al. [21] proposed a Hemerocallis citrina Baroni maturity detection method
based on a deep learning algorithm, called the GGSC YOLOv5 algorithm. This method
integrated a lightweight neural network and dual attention mechanism. The improved
GGSC YOLOv5 algorithm reduced the number of parameters and Flops by 63.58% and
68.95%, respectively, and reduced the number of network layers by about 33.12% in terms
of model structure. The detection precision was up to 84.9%, an improvement of about
2.55%, and the real-time detection speed increased from 64.16 FPS to 96.96 FPS.
Chen et al. [22] proposed a method for detecting abnormal pilot behavior during flight
based on an improved YOLOv4 deep learning algorithm and an attention mechanism. The
CBAM attention mechanism was introduced to improve the feature extraction capability
of the deep neural network. The improved YOLOv4 recognition rate was significantly
higher than the unimproved algorithm. The experimental results showed that the improved
YOLOv4 had a high mAP, accuracy, and recall rate.
Jin et al. [23] proposed a quantum dynamic optimization algorithm called quantum
dynamic neural architecture search (QDNAS) to find the optimal structure for a candidate
network. The proposed QDNAS viewed the iterative evolution of the optimization over
time as a quantum dynamic process. Experiments on four benchmarks showed that QDNAS
was consistently better than all baseline methods in image classification tasks.
Yue et al. [24] designed a detection algorithm called TP-ODA for border patrol object
detection. This algorithm improved the detection frame imbalance problem and optimized
the feature fusion module of the algorithm with the PDOEM structure. The TP-ODA
algorithm was tested on the Border Patrol object dataset BDP and showed improvement in
mAP, GFLOPs, model volume, and FPS compared to the baseline model.
Ye et al. [25] proposed an innovative classification method for hyperspectral remote
sensing images (HRSIs) called IPCEHRIC, which utilized the advantages of enhanced PSO
algorithm, convolutional neural network (CNN), and extreme learning machine (ELM).
Experiment conducted on Pavia University data and actual HRSIs after Jiuzhaigou 7.0
earthquake, and results showed that IPCEHRIC could accurately classify these data with
stronger generalization, faster learning ability, and higher classification accuracy.
2.5. Image Encryption
Huang et al. [26] proposed a polymorphic mapping-coupled map lattice with infor-
mation entropy for encrypting color images, improving the traditional one-dimensional-
mapping coupled lattice.The original 4x4 matrix was extended and a new pixel-level
4
Electronics 2023, 12, 2940
substitution method was proposed using the huffman idea. The idea of polymorphism was
employed and the pseudo-random sequence was diversified and homogenized. Experi-
ments were conducted on three plaintext color images, “Lena”, “Peppers” and “Mandrill”,
and the results showed that the algorithm had a large key space, better sensitivity to keys
and plaintext images, and a better encryption effect.
Chen et al. [27] proposed a new digital image encryption algorithm based on the
splicing model and 1D secondary chaotic system. The algorithm divided the plain image
into four sub-parts using quaternary coding, which could be coded separately. The key
space was big enough to resist exhaustive attacks due to the use of a 1D quadratic chaotic
system. Experimental results showed that the algorithm had high security and a good
encryption effect.
2.6. Others
Muntean et al. [28] proposed a methodological framework based on design science
research for designing and developing data and information artifacts in data analysis
projects. They applied several classification algorithms to previously labeled datasets
through clustering and introduced a set of metrics to evaluate the performance of classifiers.
Their proposed framework can be used for any data analysis problem that involves machine
learning techniques.
Zheng et al. [29] proposed a novel KNN-based consensus algorithm that classified
transactions based on their priority. The KNN algorithm calculated the distance between
transactions based on factors that impacted their priority. Experimental results obtained by
adopting the enhanced consensus algorithm showed that the service level agreement(SLA)
was better satisfied in the BaaS systems.
Liu et al. [30] proposed a coordinated output strategy for peak shaving and frequency
regulation using existing energy storage to improve its economic development and benefits
in industrial parks. The strategy included profit and cost models, an economic optimization
model for dividing peak shaving and frequency regulation capacity, and an intra-day model
predictive control method for rolling optimization. The experimental results showed a
10.96% reduction in daily electricity costs using this strategy.
Hussain et al. [31] presented a COVID-19 warning system based on a machine learn-
ing time series model using confirmed, detected, recovered, and death case data. The
author compared the performanceof long short-term memory (LSTM), auto-regressive
(AR), PROPHET and autoregressive integrated moving average (ARIMA) models for pre-
dicting patients’ confirmed, and found the PROPHET and AR models had low error rates
in predicting positive cases.
Xie et al. [32] presented an effective solution for the problem of confidentiality manage-
ment of digital archives on the cloud. The basic concept involved setting up a local server
between the cloud and each client of an archive system to run a confidentiality management
model of digital archives on the cloud. This model included an archive release model and
an archive search model.The archive release model encrypted archive files and generated
feature data for the archive data. The archive search model transformed query operations
on the archive data submitted by a searcher. Both theoretical analysis and experimental
evaluation demonstrated the good performance of the proposed solution.
Providence et al. [33] discussed the influence of temporal and spatial normalization
modules on multi-variate time series forecasts. The study encompassed various neural
networks and their applications. Extensive experimental work on three datasets showed
that adding more normalization components could greatly improve the effectiveness of
canonical frameworks.
3. Future Directions
We believe that advanced machine learning and big data will continue to develop. On
one hand, advanced machine learning algorithms will discover more valuable patterns
from big data, thereby fueling the emergence of new applications for big data. On the
5
Electronics 2023, 12, 2940
other hand, the constantly increasing volume of big data has raised higher demands for
advanced machine learning, leading to the development of more effective and efficient
machine learning algorithms. Therefore, developing new machine learning algorithms
for big data analysis and expanding the application scenarios of big data are important
research directions in the future.
Acknowledgments: We would like to thank all the authors for their papers submitted to this special
issue. We would also like to acknowledge all the reviewers for their careful and timely reviews to
help improve the quality of this special issue. Finally, we would like to thank the editorial team of the
Electronics journal for all the support provided in the publication of this special issue.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Li, Z.; Wang, L.; Wang, D.; Yin, M.; Huang, Y. Short-Term Traffic-Flow Forecasting Based on an Integrated Model Combining
Bagging and Stacking Considering Weight Coefficient. Electronics 2022, 11, 1467. [CrossRef]
2. Li, Z.; Piao, W.; Wang, L.; Wang, X.; Fu, R.; Fang, Y. China coastal bulk (Coal) freight index forecasting based on an integrated
model combining ARMA, GM and BP model optimized by GA. Electronics 2022, 11, 2732. [CrossRef]
3. Wang, P.; Wu, J.; Wei, Y.; Li, T. CEEMD-MultiRocket: Integrating CEEMD with Improved MultiRocket for Time Series
Classification. Electronics 2023, 12, 1188. [CrossRef]
4. Bousbaa, Z.; Sanchez-Medina, J.; Bencharef, O. Financial Time Series Forecasting: A Data Stream Mining-Based System. Electronics
2023, 12, 2039. [CrossRef]
5. Han, X.; Gong, S. LST-GCN: Long Short-Term Memory Embedded Graph Convolution Network for Traffic Flow Forecasting.
Electronics 2022, 11, 2230. [CrossRef]
6. Gao, H.; Liang, G.; Chen, H. Multi-population enhanced slime mould algorithm and with application to postgraduate employment
stability prediction. Electronics 2022, 11, 209. [CrossRef]
7. Bao, H.; Liang, G.; Cai, Z.; Chen, H. Random replacement crisscross butterfly optimization algorithm for standard evaluation of
overseas Chinese associations. Electronics 2022, 11, 1080. [CrossRef]
8. Zhang, W.; Zhu, D.; Huang, Z.; Zhou, C. Improved Multi-Strategy Matrix Particle Swarm Optimization for DNA Sequence
Design. Electronics 2023, 12, 547. [CrossRef]
9. Song, Y.; Liu, Y.; Chen, H.; Deng, W. A Multi-Strategy Adaptive Particle Swarm Optimization Algorithm for Solving Optimization
Problem. Electronics 2023, 12, 491. [CrossRef]
10. Li, H.; Ke, S.; Rao, X.; Li, C.; Chen, D.; Kuang, F.; Chen, H.; Liang, G.; Liu, L. An Improved Whale Optimizer with Multiple
Strategies for Intelligent Prediction of Talent Stability. Electronics 2022, 11, 4224. [CrossRef]
11. Wang, J.; Shang, S.; Jing, H.; Zhu, J.; Song, Y.; Li, Y.; Deng, W. A Novel Multistrategy-Based Differential Evolution Algorithm and
Its Application. Electronics 2022, 11, 3476. [CrossRef]
12. Miu, F.; Wang, P.; Xiong, Y.; Jia, H.; Liu, W. Fine-Grained Classification of Announcement News Events in the Chinese Stock
Market. Electronics 2022, 11, 2058. [CrossRef]
13. Jia, M.; Liu, F.; Li, X.; Zhuang, X. Hybrid Graph Neural Network Recommendation Based on Multi-Behavior Interaction and
Time Sequence Awareness. Electronics 2023, 12, 1223. [CrossRef]
14. Fatehi, N.; Alasad, Q.; Alawad, M. Towards Adversarial Attacks for Clinical Document Classification. Electronics 2023, 12, 129.
[CrossRef]
15. Yin, L.; Li, M.; Chen, H.; Deng, W. An Improved Hierarchical Clustering Algorithm Based on the Idea of Population Reproduction
and Fusion. Electronics 2022, 11, 2735. [CrossRef]
16. Yang, E.; Wang, Y.; Wang, P.; Guan, Z.; Deng, W. An intelligent identification approach using VMD-CMDE and PSO-DBN for
bearing faults. Electronics 2022, 11, 2582. [CrossRef]
17. Chen, N.; Sun, Y.; Wang, Z.; Peng, C. Improved LS-SVM Method for Flight Data Fitting of Civil Aircraft Flying at High Plateau.
Electronics 2022, 11, 1558. [CrossRef]
18. Yu, J.; Liu, W.; He, Y.; Zhong, B. A Hierarchical Heterogeneous Graph Attention Network for Emotion-Cause Pair Extraction.
Electronics 2022, 11, 2884. [CrossRef]
19. Fan, Y.; Qiu, Q.; Hou, S.; Li, Y.; Xie, J.; Qin, M.; Chu, F. Application of Improved YOLOv5 in Aerial Photographing Infrared
Vehicle Detection. Electronics 2022, 11, 2344. [CrossRef]
20. Guerrero-Ibañez, A.; Reyes-Muñoz, A. Monitoring Tomato Leaf Disease through Convolutional Neural Networks. Electronics
2023, 12, 229. [CrossRef]
21. Zhang, L.; Wu, L.; Liu, Y. Hemerocallis citrina Baroni Maturity Detection Method Integrating Lightweight Neural Network and
Dual Attention Mechanism. Electronics 2022, 11, 2743. [CrossRef]
22. Chen, N.; Man, Y.; Sun, Y. Abnormal Cockpit Pilot Driving Behavior Detection Using YOLOv4 Fused Attention Mechanism.
Electronics 2022, 11, 2538. [CrossRef]
6
Electronics 2023, 12, 2940
23. Jin, J.; Zhang, Q.; He, J.; Yu, H. Quantum Dynamic Optimization Algorithm for Neural Architecture Search on Image Classification.
Electronics 2022, 11, 3969. [CrossRef]
24. Yue, L.; Ling, H.; Yuan, J.; Bai, L. A Lightweight Border Patrol Object Detection Network for Edge Devices. Electronics 2022,
11, 3828. [CrossRef]
25. Ye, A.; Zhou, X.; Miao, F. Innovative Hyperspectral Image Classification Approach Using Optimized CNN and ELM. Electronics
2022, 11, 775. [CrossRef]
26. Huang, P.; Li, D.; Wang, Y.; Zhao, H.; Deng, W. A Novel Color Image Encryption Algorithm Using Coupled Map Lattice with
Polymorphic Mapping. Electronics 2022, 11, 3436. [CrossRef]
27. Chen, C.; Zhu, D.; Wang, X.; Zeng, L. One-Dimensional Quadratic Chaotic System and Splicing Model for Image Encryption.
Electronics 2023, 12, 1325. [CrossRef]
28. Muntean, M.; Militaru, F.D. Design Science Research Framework for Performance Analysis Using Machine Learning Techniques.
Electronics 2022, 11, 2504. [CrossRef]
29. Zheng, Q.; Wang, L.; He, J.; Li, T. KNN-Based Consensus Algorithm for Better Service Level Agreement in Blockchain as a Service
(BaaS) Systems. Electronics 2023, 12, 1429. [CrossRef]
30. Liu, D.; Jin, Z.; Chen, H.; Cao, H.; Yuan, Y.; Fan, Y.; Song, Y. Peak Shaving and Frequency Regulation Coordinated Output
Optimization Based on Improving Economy of Energy Storage. Electronics 2021, 11, 29. [CrossRef]
31. Hussain, M.; Islam, A.; Turi, J.A.; Nabi, S.; Hamdi, M.; Hamam, H.; Ibrahim, M.; Cifci, M.A.; Sehar, T. Machine Learning-Driven
Approach for a COVID-19 Warning System. Electronics 2022, 11, 3875. [CrossRef]
32. Xie, J.; Xuan, S.; You, W.; Wu, Z.; Chen, H. An Effective Model of Confidentiality Management of Digital Archives in a Cloud
Environment. Electronics 2022, 11, 2831. [CrossRef]
33. Providence, A.M.; Yang, C.; Orphe, T.B.; Mabaire, A.; Agordzo, G.K. Spatial and Temporal Normalization for Multi-Variate Time
Series Prediction Using Machine Learning Algorithms. Electronics 2022, 11, 3167. [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
7
electronics
Article
Short-Term Traffic-Flow Forecasting Based on an Integrated
Model Combining Bagging and Stacking Considering Weight
Coefficient
Zhaohui Li 1, *, Lin Wang 1 , Deyao Wang 1, *, Ming Yin 2 and Yujin Huang 1
1 School of Maritime Economics and Management, Dalian Maritime University, Dalian 116026, China;
[email protected] (L.W.); [email protected] (Y.H.)
2 Xuzhou Xugong Materials Supply Co., Ltd., Xuzhou 221000, China; [email protected]
* Correspondence: [email protected] (Z.L.); [email protected] (D.W.)
Abstract: This work proposed an integrated model combining bagging and stacking considering
the weight coefficient for short-time traffic-flow prediction, which incorporates vacation and peak
time features, as well as occupancy and speed information, in order to improve prediction accuracy
and accomplish deeper traffic flow data feature mining. To address the limitations of a single
prediction model in traffic forecasting, a stacking model with ridge regression as the meta-learner is
first established, then the stacking model is optimized from the perspective of the learner using the
bagging model, and lastly the optimized learner is embedded into the stacking model as the new base
learner to obtain the Ba-Stacking model. Finally, to address the Ba-Stacking model’s shortcomings
in terms of low base learner utilization, the information structure of the base learners is modified
by weighting the error coefficients while taking into account the model’s external features, resulting
in a DW-Ba-Stacking model that can change the weights of the base learners to adjust the feature
distribution and thus improve utilization. Using 76,896 data from the I5NB highway as the empirical
study object, the DW-Ba-Stacking model is compared and assessed with the traditional model in
Citation: Li, Z.; Wang, L.; Wang, D.;
this paper. The empirical results show that the DW-Ba-Stacking model has the highest prediction
Yin, M.; Huang, Y. Short-Term
accuracy, demonstrating that the model is successful in predicting short-term traffic flows and can
Traffic-Flow Forecasting Based on an
effectively solve traffic-congestion problems.
Integrated Model Combining
Bagging and Stacking Considering
Weight Coefficient. Electronics 2022,
Keywords: short-term traffic-flow forecasting; bagging model; stacking model; ridge regression;
11, 1467. https://doi.org/10.3390/ error coefficient
electronics11091467
Academic Editor: Stefano Ferilli
Received: 23 March 2022
1. Introduction
Accepted: 28 April 2022 In recent years, as the economy has grown and people’s quality of life has improved,
Published: 3 May 2022 people’s demands for transportation has increased, and vehicles have progressively become
Publisher’s Note: MDPI stays neutral
the preferred mode of transportation. However, this has caused an increase in traffic
with regard to jurisdictional claims in
congestion, and a contradiction and an intensification between the supply and demand
published maps and institutional affil- of road traffic. As a result, comprehensive technologies and methods are urgently needed
iations. to properly control and monitor traffic flow, as well as to alleviate traffic congestion and
other issues.
Traffic-flow prediction is fundamental in traffic management and dredging, and its
accuracy is critical in resolving traffic-congestion issues. A vast number of experts have
Copyright: © 2022 by the authors. done extensive research on this in recent years, primarily utilizing a linear or nonlinear
Licensee MDPI, Basel, Switzerland. model to predict the following:
This article is an open access article
(1) Linear model
distributed under the terms and
conditions of the Creative Commons The historical average forecasting methods, the time series forecasting methods, and
Attribution (CC BY) license (https:// the Kalman wave forecasting methods were all used in the early days of traffic flow research.
creativecommons.org/licenses/by/ Some scholars use simple linear models to predict traffic flow, such as the autoregressive
4.0/). moving average model (ARIMA) model, which is suitable for predicting data with time
Electronics 2022, 11, 1467. https://doi.org/10.3390/electronics11091467 https://www.mdpi.com/journal/electronics
9
Electronics 2022, 11, 1467
rules, but the traffic flow has a strong non-linear trend, and its prediction accuracy for
traffic flow is not high and has limitations [1–3]. D. Cvetek et al. used the collected data to
compare some common time series methods such as ARIMA and SARIMA, showing that
the ARIMA model provides better performance in predicting traffic demand [4].
The Kalman wave is also used as a linear theory-prediction method by many scholars.
Okutani firstly applied the Kalman wave to traffic-flow forecasting [5]. According to the
inherent shortcomings of Kalman wave variance, Guo et al. proposed an adaptive Kalman
wave energy update variance, which improved the prediction performance of the original
model [6]. Israr Ullah et al. developed an artificial neural network (ANN)-based learning
module to improve the accuracy of the Kalman filter algorithm [7]. Additionally, in the
experiment of the indoor environment prediction in the greenhouse, good prediction results
were obtained. Therefore, the Kalman wave model can effectively reduce the uncertainty
and noise in the flow change in the prediction process, but it is difficult to predict the
nonlinear change trend of the traffic flow.
(2) Non-linear model
With the recent development of technology, the widespread use of powerful computer
and mathematical models is applied to this field [8]. Among them, the wavelet neural
network, as a representative of the nonlinear theoretical model, has a better traffic-flow
prediction effect. Gao et al. used the network model to predict short-term traffic flow
and achieved good results [9]. Although the wavelet neural network converges faster and
the prediction accuracy is higher, the existence of the wavelet basis function increases the
complexity of the model.
Machine learning models have become research hotspots that have been widely used
in many fields. They are best applied to the field of traffic flow. Qin et al. proposed a
new SoC estimation method on the impact of temperature on SoC estimation, and the use
of limited data to rapidly adjust the estimation model to new temperatures, which not
only reduces the prediction error at a fixed temperature but also improves the prediction
accuracy at a new temperature [10]. Xiong Ting et al. used the random forest model to
predict the traffic flow and achieved high prediction accuracy, based on the combination of
spatio-temporal features [11]. Lu et al. used the XGBoost model to predict the traffic flow
at public intersections in Victoria and achieved high prediction accuracy [12]. Alajali et al.
used the GBDT model to analyze the lane-level traffic flow data on the Third Ring Road in
Beijing on the basis of feature processing and proved that the model has a good prediction
effect and is suitable for the traffic prediction of different lanes [13]. On the basis of
extracting features, Yu et al. used the KNN model to complete the prediction of the traffic
node and route traffic flow, which achieved good prediction results [14].
Therefore, it can be concluded that the integrated model based on the decision tree
is widely used and has high prediction accuracy, while the KNN model can eliminate the
sensitivity to abnormal traffic flow in the prediction. Qin et al. proposed a slow-varying
dynamics-assisted temporal CapsNet (SD-TemCapsNet) that introduced a long short-term
memory (LSTM) mechanism to simultaneously learn slow-varying dynamics and temporal
dynamics from measurements, achieving an accurate RUL estimation [15]. Although LSTM
has been used by many scholars as a network model with high accuracy in terms of time
series prediction, the complexity of the network itself is difficult to avoid. The gate recurrent
unit model (GRU) can effectively solve this problem, which can complete the prediction of
traffic with fewer parameters under the premise of meeting a certain prediction accuracy.
Dai et al. used the GRU model to predict the traffic flow under the condition of making
full use of the features and verified the effectiveness of the model through comparative
analysis with the convolutional neural network [16]. As an evolutionary model of LSTM,
the GRU can predict traffic flow with fewer parameters, under the premise of satisfying a
certain prediction accuracy.
Although machine learning models perform well in traffic-flow prediction, the predic-
tion performance of the single model is limited. Therefore, a model combining multiple
single models has gradually become a trend [17]. Pengfei Zhu et al. integrated the GRU
10
Electronics 2022, 11, 1467
and BP to predict the frequency shift of unknown monitoring points, which effectively
improved the prediction accuracy of a single model [18]. Although the above combined
models can improve the accuracy to a certain extent, they are limited by the number of
single models. The integrated model that mixes multiple models is gradually becoming
favored by scholars and has been applied to various fields [19]. Shuai Wang et al. proposed
a probabilistic approach using stacked ensemble learning that integrates random forests,
long short-term memory networks, linear regression, and Gaussian process regression, for
predicting cloud resources required for CSS applications [20]. Common ensemble models
include bagging [21], boosting [22], and stacking [23]. Compared with other ensemble
models, the stacking model has a high degree of flexibility, which can effectively integrate
the changing characteristics of heterogeneous models to make the prediction results better.
In summary, the single prediction model has limitations, and the combined forecasting
model has gradually become a trend. Common models that can integrate a single model
include the entropy combination method, the inverse error group method, the ensemble
learning method, and other combination methods. [24,25]. Among them, the comprehen-
sive model is more practical. The bagging integration model and the boosting integration
model, generally used for a homogeneous single model, are limited to a single model, while
the stacking integration model is more commonly used for the fusion of heterogeneous
models. Therefore, the first use of the bagging model is to optimize the base learner model
and then optimize the stacking model, to improve the overall performance of the model.
2. Establishment of the DW-Ba-Stacking Model
In this section, a DW-Ba-Stacking model was put forwarded in detail. The DW-Ba-
Stacking model consists of three parts in total, the stacking model (stacking), the bagging
model (Ba), and the dynamic weighting adjustment (DW).
2.1. Stacking Model
Traffic flow trends are complex, and there are various models used in this field, among
which machine learning models are widely used in traffic-flow prediction due to their
good non-linear fitting. In order to obtain a stacking model with high accuracy, machine
learning models with different merits and good applications in this field are selected for
fusion: the random forest model, which is less prone to overfitting; the KNN model, which
is insensitive to outliers; the decision-tree model; the XGBoost and GBDT models; the
GRU model, which can effectively use temporal features; and the K-fold cross validation to
prevent overfitting.
2.1.1. Principle of the Stacking Model
The stacking model obtains the final prediction by linear or non-linear processing of
the sub-learners. The main principle is that the original data are first predicted by the base
learner, and then the prediction is passed to the meta-learner to obtain the final result. To
prevent overfitting, the data are usually trained by K fold cross-validation, as follows.
Let the original data set M = {(yn , xn )}, xn be the feature variables of the n sample,
yn be the predictor variables of the n sample, and the number of base learners be L The
data from the original dataset 1/K are used as the validation set, M1/k ; the rest of the
data M−1/k = M − M1/k are used as the training set; the divided data are fed into the
base learner A−L
1/k
for training, and the prediction results from K are obtained NkL . The
predictions from the base learner and yn are then used as the training set for the meta-
learner, which trains the model and makes predictions.
2.1.2. Machine Learning Models
Random Forest and KNN Models
The Random Forest model is a modified bagging algorithm. When the model is used
for regression, the single model that is integrated is the CART regression tree. First, samples
are drawn by bootstrap sampling with replacement; then, the corresponding regression
11
Electronics 2022, 11, 1467
trees are modelled for the m different samples drawn to form the forest; and, finally, the
average of the predictions from the different regression trees is taken as the final prediction.
The samples and features of the regression trees in the model are chosen randomly. Each
regression tree built through bootstrap sampling is independent and uncorrelated. This
feature increases the variation between models and enhances the generalization ability of
the model. At the same time, the random nature of feature selection reduces the variability
of the models. As the number of regression trees increases, the model error gradually
converges, which reduces the occurrence of overfitting. This is why the model was selected
as one of the base learners.
When the KNN model is used for classification, it determines the k sample types by
searching for k samples in the historical data that are similar to the samples to be classified.
The principle can be expressed as follows:
S = ( X1 , Y1 ), ( X2 , Y2 ) . . . ( X N , YN ) (1)
where X is the feature vector, Y is the category of the example sample, and i = (1, 2, 3 . . . , N ).
The Euclidean distance is used to express the similarity between the sample to be classified
and the feature sample in S. The Euclidean distance between the observed sample and
the feature is calculated. Based on the calculated distances, find the closest K points to the
object to be classified in S and determine the X category. The principle is shown in Figure 1.
There are N samples with the categories Q1 , Q2 , . . . , Q N , which are N different categories.
By testing the Euclidean distance between sample Xi and the N training sets, M samples
that are closer to sample Xi are obtained, and if most of the M samples belong to a certain
type, then sample Xi also belongs to that type. The model can be applied to both discrete
and continuous features and is insensitive to outliers, so it is used as a base learner.
4
4Q
4 [L
4
Figure 1. The KNN schematic diagram.
Decision Trees, and the GBDT and XGBoost Models
A decision tree is a model consisting of nodes and directed edges that allow predictions
to be made by correspondence between attributes and objects. The internal nodes are the
features of the object and the leaf nodes are the classes of the object. The model has a
wide range of applications, and it is efficient and suitable for high-dimensional feature
processing, which is why it has been chosen as one of the traffic-flow prediction models.
It aims to summarize certain rules from the training dataset and eventually achieve the
correct result. The essence is to find the optimal decision tree. The three more important
features in the search process are attribute selection, decision tree generation, and decision
tree pruning. The key to their generation is the division of the optimal attributes. Purity is a
measure based on the assignment of attributes. The evaluation metrics for measuring purity
include information gain, gain rate, and Gini index. The principle is shown in Figure 2.
12
Electronics 2022, 11, 1467
&
& &
& &
& &
Figure 2. The decision tree model.
Both GBDT and XGBoost are algorithms that evolve by boosting. GBDT is formed
by continuously fitting the residual error by updating the learners on the gradient. When
the residual error reaches a certain limit, the model stops iterating and forms the final
learner. The model can be very good at fitting non-linear data. However, the computational
complexity will increase when the dimensionality is high and the traffic flow has fewer
characteristic dimensions, so the model is suitable for prediction in this area. The regulator
model is a linearly weighted combination of different regulators.
N
Fn ( x ) = ∑ R(x; θn ) (2)
n =1
where T ( x; θn ) is a weak regressor. The loss function of the weak regressor is
M
R̂n = argmin ∑ L(yi , Fn−1 ( xi ) + T ( x; θn )) (3)
i =1
where L(·) is the loss function.
XGBoost and GBDT share the same principles and integrated model, with a process
of continuously fitting the residuals and gradually reducing them. During the fitting
process, the learner is updated with first-order derivatives and second-order derivatives.
Specifically, the second-order Taylor expansion of the loss function and the positive term of
the error component are used as the objective function during each round of iterations. It
updates the parameters through the solution of the least significant graph. The positive
term in the objective function controls the complexity of the model, reduces the variance of
the model, and makes the learning process of the model easier, so this model is chosen as
the base learner. The loss function L is
M N
L= ∑ l (yi , ŷi ) + ∑ Ω( f k ) (4)
i =1 n =1
In the formula, the first half is the error between the predicted and actual values; the
second half is the conventional term.
1
Ω( f ) = γT + λω 2 (5)
2
The Equations γ and λ are the penalty coefficients for the model.
GRU Model
A deep-learning model is one of the machine learning models. It can adapt well
to the changing characteristics of data when the amount of data is appropriate. It has
gradually been applied to various fields with good results. Zheng Jianhu et al. relied on
13
Electronics 2022, 11, 1467
deep learning (DL) to predict traffic flow through a time series analysis and carried out
long-term traffic-flow prediction experiments based on the LSTM network-based traffic-
flow prediction model, the ARIMA model, and the BPNN model [26]. It can be seen that
regular sequences have won the favor of various scholars and that GRU is a more mature
network for processing time series in recent years. Additionally, the earliest proposed
network to deal with time series is RNN, but it is prone to gradient disappearance, leading
to network performance degradation. Zhao et al. used long short-time memory (LSTM) to
predict traffic flow under the premise of considering spatial factors in the actual prediction
process and achieved high prediction accuracy [27], but the network model also has the
disadvantage of poor robustness. In order to solve this problem, Li Yuelong et al. realized
the optimization of the prediction performance of the network through the network space
feature fusion rights protection unit [28]. It can be seen that although LSTM is used by many
scholars as a network model with high time series prediction accuracy, the complexity of
the network itself is difficult to avoid. The GRU model, on the other hand, can effectively
reduce the network parameters while ensuring the performance of the model itself. Its
structure is shown in Figure 3.
rt = σ (Wr xt × Ur ht−1 + br ) (6)
zt = σ (Wz xt × Uz ht−1 + bz ) (7)
t = tanh(Wh xt + Uh (ht−1 ⊗ rt ) + br )
h (8)
t = (1 − z t ) ⊗ ht −1 + z t ⊗ h
h t (9)
where ⊗ is the product of the corresponding positions of the two matrices, σ is the activation
function, W and U are the weight parameters of the network, and b is the bias parameter of
the network, which is the state value of the hidden layer at different moments. The reset gate
rt determines the input ratio of the previous state information ht−1 to the current network
cell; the update gate Zt determines the deletion ratio of the previous state information. The
entire network cell is filtered by the two gates to determine the valid information of the
network cell. Compared with the LSTM model, the GRU model reduces one gate unit and
only sets the reset gate and update gate to control the input and output information of the
network unit, which reduces the complexity of the network and improves the network
training speed.
KW KW
,
UW ]W KW
³ ³ WDQK
[
Figure 3. The GRU structure diagram.
2.2. Bagging Model
The overall architecture of the Ba-Stacking model included the bagging model pro-
cessing stage and the stacking model processing stage. Because the bagging was only
embedded as part of the stacking model, the stacking model architecture plays a big role.
The more important processing phases are: the base learner processing phase and the meta
learner processing phase. The base learner processing stage requires different base learners
to obtain the prediction results, so the choice of the base learner plays an important role.
The meta-learner processing stage is more important because it includes a large amount
14
Electronics 2022, 11, 1467
of raw data information, so it is important that the effect of using the base learner infor-
mation affects the final prediction results. However, the output information of different
base learners is duplicated, and the data variability is not strong enough to extract the
effective information of the output data. Therefore, to address the problem that the output
information of base learners cannot be fully utilized, it is necessary to consider how to
effectively utilize its output information and reflect its importance and variability.
To further improve the stacking model, this paper considers the use of the bagging
algorithm to further optimize the base learner and reduce the base learner variance, as two
ways to improve the potential performance of the meta-learner model in the stacking model.
Considering that the prediction effect of the base learner directly affects the final effect
of the integrated model, the prediction effect of the base learner of the stacking-integrated
model is optimized by the bagging algorithm. To better extract the base learner features,
a ridge regression with linearity is used as the meta-learner, and the overall construction
principle is shown in Figure 4.
%DVH
OHDUQHU
WUDLQ
2ULJLQDO
%DVH
0HWDOHDUQHU
OHDUQHU
GDWDVHW
WHVW
%DVH
OHDUQHU
Figure 4. The Ba-Stacking model architecture diagram.
The process of this model is to optimize the data features of the stacking base learner
based on its output information through the bagging algorithm and then further input this
optimized data into the meta-learner in the stacking-integrated model for traffic prediction.
The process consists of three parts: the first part builds the stacking base learner model
by comparing and analyzing different features to obtain the optimal base learner model;
the second part builds the stacking model and obtains the optimal stacking model by
comparing and analyzing different base learner models and meta-learner models; finally,
the bagging model is combined into the stacking model to build the Ba-Stacking model.
2.3. DW Model
The entropy value can be expressed as the uncertainty of each value. The entropy
weighting method in the tradition weights the fixed coefficients of each model, but the
certainty degree of different positions of the base learner can be deduced from the certainty
degree of a specific position in each model.
Where the single model Yij (i = 1, 2, . . . , m; j = 1, 2, · · · , n) is the base learner predic-
tion and Li (i = 1, 2, . . . , m) is the actual value, the entropy value is
eij ln(eij + 0.5)
hij = − (10)
ln( N + 0.5)
The addition of 0.5 to the Ln function in Equation (10) is to accommodate the cal-
culation of zeros in the original series. hij is the entropy value derived from the error
value eij , where eij is the absolute error indicator value. Because the characteristics of the
meta-learner in the stacking-integrated model are the strong information characteristics of
the base learner output, and the uncertainty of the base learner can be known according
to its entropy value at different positions, the variability of the base learner model output
information can be enhanced after the introduction of weights, which in turn improves
the overall performance of the model. The degree of uncertainty of different models is
15
Electronics 2022, 11, 1467
determined by introducing the entropy value after the MSE is calculated, which is used
when the dynamic parameters are calculated.
2.4. Model Construction
2.4.1. Dynamic Weighting Adjustment Model Process
In the stacking model, the degree of data deviation at different locations in the base
learner output information varies, and fixed weighting cannot capture its dynamic change
pattern, so dynamic weighting coefficients are designed in the model.
The coefficient is designed outside the meta-learners, and the dynamic weight coeffi-
cients are first solved according to the degree of deviation at different positions, and then
the dynamic weight coefficients are weighted to adjust the base learner output information
to achieve the extraction of dynamic change patterns. The weighting coefficients here
include error weighting and entropy weighting.
Yij (i = 1, 2, · · · , m; j = 1, 2, · · · , n) is the predicted value of the base learner,
Li (i = 1, 2, · · · , m) is the actual value, m is the number of elements, n is the number of base
learners, and u j is the predicted mean value of each base learner. The adjustment process
of the output information of the base learner is
⎛ ⎞ ⎛ ⎞ ⎛⎞
y11 y12 · · · y1n y11 x11 y12 x12 · · · y1n x1n l1
⎜ y21 y22 · · · y2n ⎟ transform ⎜ y 21 x21 y22 x22 · · · y2n x2n ⎟ prediction ⎜ l2 ⎟
⎜ ⎟ → ⎜ ⎟ → ⎜ ⎟ (11)
⎝ ··· ··· ··· ··· ⎠ ⎝ ··· ··· ··· ··· ⎠ ⎝ ··· ⎠
ym1 ym2 · · · ymn m×n ym1 xm1 ym2 xm2 · · · ymn xmn m×n lm m ×1
In the process of adjustment, the key lies in the solution of dynamic weight coefficients
xij .The solution process is as follows:
⎛ ⎞
|y11 − l1 | |y12 − l1 | · · · |y1n − l1 |
⎜ |y21 − l2 | |y22 − l2 | · · · |y2n − l2 | ⎟
⎜
eij = ⎝ ⎟ (12)
··· ··· ··· ··· ⎠
|ym1 − lm | |ym2 − lm | · · · |ymn − lm | m×n
(1) Calculate the absolute error of each element eij , that is, the degree of deviation of each
element: the absolute value of the difference between the predicted value yij and the
actual value li of the base learner;
⎛ |y −l |−u |y12 −l1 |−u2
⎞
11 1
u1 − u1
1
u2 − u2 · · · |y1nun− −
l1 |−un
un
⎜ |y21 −l2 |−u1 |y22 −l2 |−u2 l2 |−un ⎟
⎜ · · · |y2nun− − ⎟
Eij = ⎜ ⎜
u1 − u1 u2 − u2 un ⎟
⎟ (13)
⎝ ··· ··· ··· ··· ⎠
|ym1 −lm |−u1 |ym2 −lm |−u2
u −u u −u · · · |ymnun− −
lm |−un
un
1 1 2 2 m×n
m m m
∑ |yi1 −li |−mu1 ∑ |yi2 −li |−mu2 ∑ |yin −li |−mun
Eij = (14)
i =1
m ( u1 − u1 )
i =1
m ( u2 − u2 )
··· i =1
m(un −un ) 1× n
(2) Calculate the deviation rate Eij and average deviation rate of each element Eij , the
normalized value of absolute error eij , and the normalized mean value of absolute
error of each column n eij , respectively;
⎛ u1 −|y11 −l1 | u2 −|y12 −l1 | un −|y1n −l1 |
⎞
u1 − u1 u2 − u2 ··· un −un
⎜ u1 −|y21 −l2 | u2 −|y22 −l2 | un −|y2n −l2 | ⎟
⎜ ··· ⎟
Cij = ⎜
⎜
u1 − u1 u2 − u2 un −un ⎟
⎟ (15)
⎝ ··· ··· ··· ··· ⎠
−| y −| y −| y
u1 m1 − lm | u2 m2 − lm | un mn − lm |
u1 − u1 u2 − u2 ··· un −un m×n
16
Electronics 2022, 11, 1467
m m m
mu 1 − ∑ |yi1 −li | mu 2 − ∑ |yi2 −li | mu n − ∑ |yin −li |
Cij = (16)
i =1
m ( u1 − u1 )
i =1
m ( u2 − u2 )
··· i =1
m(un −un ) 1× n
(3) Calculate the contribution rate Cij and the average contribution rate of each element
Cij , the value of 1 minus the deviation rate, and the value of 1 minus the average
deviation rate, respectively.
The contribution rate calculated in Equation (14) is the dynamic weight coefficient
Cij . The adjusted output information reduces the prediction results influenced by errors or
deviation information, making the information characteristics more representative. The
coefficient matrices are used to adjust the training set and test set. The specific process is
as follows:
• Training set
Adjust the change rule of the predicted value of the base learner: use the product of
the predicted value of different positions and the dynamic weight coefficient as the new
data. The specific process is shown in Figure 5.
(OLPHQW\LM
&DOFXODWHWKHHUURU
DFFRUGLQJWR
&DOFXODWHWKHRIIVHW
UDWHDFFRUGLQJWR
&DOFXODWHWKHG\QDPLF
ZHLJKWFRHIILFLHQW
DFFRUGLQJWR
$FFXPXODWH
3UHGLFWRU
WUDLQLQJVHW
0HWDOHDUQHUWUDLQLQJVHW
Figure 5. The meta learner training set adjustment process.
• Test set
Adjust the overall change law of the predicted value of the training set of the base
learner: use the product of the predicted value of different positions and the average
dynamic weight coefficient in the training set as the new data. The specific process is shown
in Figure 6.
2.4.2. Ba-Stacking Model Optimization Process
The principle of the improved stacking ensemble model is shown in Figure 7. As-
suming that the traffic flow data sequence has X records of data, N is the number of
characteristic variables, the original data set is {(Y0X , QiX )}, Y0X ( X = 1, 2, . . . , N ) is the
predictor variable, and QiX is the characteristic variable. The specific steps of the model are
as follows:
(1) Divide the original data into the training set and test set;
(2) Construct the corresponding prediction models, including random forest, XGBoost,
the GBDT, and the decision-tree model;
(3) Use QiX and Y0X to obtain the corresponding predicted values of different models
through the bagging algorithm, denoted as Y1X , Y2X , Y3X , Y4X , Y5X , Y6X ;
17
Electronics 2022, 11, 1467
(4) Using Y1X , Y2X , Y3X , Y4X , Y5X , Y0X , obtain the weight coefficients by different adjust-
ment methods, followed by the flow data of the adjusted base learner model, noted as
, Y , Y , Y , Y ;
Y1X 2X 3X 4X 5X
(5) Using Y1X , Y , Y , Y , Y ,Y , build a meta-learner ridge regression mode to ob-
2X 3X 4X 5X 0X
tain the final traffic prediction values of the improved stacking integration model;
(6) Train the model with the training set. Once trained, the model will be tested using the
test set.
(OHPHQW<LM
&DOFXODWHWKHDYHUDJH
GHYLDWLRQUDWHRIWKHWUDLQLQJ
VHWDFFRUGLQJWR
&DOFXODWH$YHUDJHG\QDPLF
ZHLJKWFRHIILFLHQWDFFRUGLQJ
WR
$FFXPXODWH
3UHGLFWRUWHVWVHW
0HWDOHDUQHUWHVWVHW
Figure 6. The meta learner test set adjustment process.
D
V
5DQGRP IRUHFDVW
V V %DJJLQJ
5HVXOW
IRUHVW UHVXOW
V DQ
1
(
7 E
:
5 V
$ IRUHFDVW
5HVXOW
*%'7 V V %DJJLQJ 7
, UHVXOW
5
1 V EQ $
,
1
F
V
%DJJLQJ IRUHFDVW
5HVXOWP 5
*58 V
V
UHVXOWP ,
'
FQ
*
(
V
IRUHFDVW DQ
V V %DJJLQJ 5HVXOW
UHVXOW
V 1
(
:
7 V
( IRUHFDVW
%DJJLQJ EQ 5HVXOW 7
6 V V UHVXOW
(
7 V 6
7
V
IRUHFDVW
V %DJJLQJ FQ 5HVXOWQ
UHVXOWQ
V
Figure 7. The DW-Ba-Stacking model principle diagram (ridge regression).
18
Electronics 2022, 11, 1467
3. Problem Description and Data Progress
3.1. Overview of Short-Term Traffic Flows
Traffic flow is the volume of traffic formed by vehicles on a roadway. The factors
influencing traffic flow include flow, speed, and occupancy. Traffic flow is an important
indicator to determine traffic congestion, its prediction results are an important parameter
to grasp the city traffic situation, and the selection of the prediction time period is an
important step in the prediction process. There are various types of traffic flow data
recorded by monitoring point detectors, including 30s, 5 min, 15 min, 30 min, and 60 min,
depending on the collection time, and highways and urban roads depending on the type
of road collected. Traffic-flow prediction results are usually obtained from the historical
data function, that is, the historical information within the time of ti− j , ti−1 predicts the
current information of ti .
ti = f ti − j (17)
ti stands for the current time of the indicator value ti− j stands for the historical time
period of the indicator value, and the function indicates the historical time period of the
traffic value to predict the future time period of the traffic value. When the adjacent time
interval Δt is less than or equal to 15 min, the formula represents the short time traffic
flow forecast, so this paper chooses 15 min as the time interval for traffic-flow prediction
and analysis.
In short-term traffic-flow forecasting, occupancy and speed are the important impact
indicators of road traffic; this paper will focus on the two indicators as the flow of the
constraint characteristics, and its historical trend to join the traffic-flow forecasting; the
function relationship is shown as follows:
li = f z i − j , v i − j , li − j (18)
zi− j , vi− j , li− j refers to the values of occupancy, speed, and traffic flow indicators,
respectively, at the historical moment; i is the current time; and j is the historical time
period used. j = 4 is chosen for the prediction analysis in this paper.
3.2. Data Sources and Pre-Processing
3.2.1. Data Sources
The data selected for this paper is from the PORTAL dataset, which provides official
traffic data for Portland, USA and Vancouver, Canada, with monitors recording traffic at
five intervals: 30 s, 5 min, 15 min, 30 min, and 60 min. Traffic data for 15 min intervals
on the I5NB highway in Portland, USA are selected for analysis, and the main data tables
studied are the monitor data tables.
The data set occupancy and speed are data features that can be directly utilized in the
data tables. These two indicators are also the actual indicators that affect the traffic flow,
so these two indicators are used as input features to the model. The timestamp feature is
the time recorded by the detector, which can provide some regular reference for the trend
change of the traffic flow; the specific feature construction analysis is in Section 3.2.3, so
this indicator is also used as an input feature, and the traffic flow is input into the model
as an output feature for prediction. The data analyzed for the example in this paper is
100703 detector data, collected at the specific time of 1 February 2018 00:00:00–12 April 2020
0:00:00, with 96 data per day, comprising a total of 76,896 pieces of data. Seventy percent of
the data set was used as the training set and 30% of the data set was used as the test set.
3.2.2. Feature Construction
According to the analysis in Section 3.1, occupancy and speed can effectively influence
traffic flows, so these two indicators are entered into the forecasting model as intrinsic
characteristics. In addition to the intrinsic characteristics, the trend of traffic flow can be
influenced by certain external characteristics that can affect the accuracy of the forecast,
especially the temporal characteristics: traffic flow has obvious cyclical characteristics, so
19
Electronics 2022, 11, 1467
the cyclical temporal characteristics are important characteristics affecting the traffic flow;
for example, there is more traffic flow during peak hours or holidays, so the extraction of
the temporal characteristics plays an important role. To explore the temporal characteristics
of traffic flow in depth, the trend of traffic flow changes over a period of time is randomly
selected for analysis, as shown in Figure 8.
Traffic Flow
300
250
F 200
L
150
O
100
W
50
0
Number/piece
Figure 8. The traffic flow trend.
It can be seen that the same characteristics of variation occur each day, and it is obvious
that there are two peaks, the peak commuting period and the peak leaving period, which
are in line with the characteristics of real-life variation. This work makes full use of the
historical data of the traffic flow and adds the relevant historical data of occupancy and
speed as features to the prediction of the model as well. The specific construction process is
as follows.
(1) Structured rest day features
Holidays and weekends are days off, and people can choose to stay at home or travel
depending on the situation; therefore, the traffic flow situation is different between rest
days and weekdays, so this feature is used as an important feature for predicting traffic
flow. This work extracts holiday data and weekday data from the temporal features of the
traffic flow collection.
(2) Construction work peak characteristics
The peak information is also used as an important indicator for predicting traffic flow,
considering people’s daily life habits, i.e., there will be normal commuting in the morning
and evening, so there is more traffic flow at this time, which will also affect the prediction
results. In this paper, 6:00–8:00 am and 17:00–19:00 pm are taken as the peak time periods.
If this time is the peak hour, it is set to 1; otherwise, it is set to 0.
(3) Constructing historical indicator characteristics
Speed is the distance travelled by vehicles per unit of time, and occupancy is time
occupancy and space occupancy, respectively, indicating the density of vehicles; these two
indicators have a strong correlation with traffic flow, and this paper sets the sliding window
to 4, i.e., occupancy and speed in 4 time periods as historical indicator features, aiming to
extend the feature structure of the traffic-flow prediction model and improve the overall
performance of the model.
(4) One-hot encoding processing
One-hot encoding, also known as one-hot encoding or one-valid encoding, is a method
of encoding N states using N-bit state registers, each of which has its own register and only
one of which is valid at any given time. The method uses N-bit status registers to encode N
states, each of which has its own independent register bits and only one of which is valid at
any given time. One-hot is a method for processing discrete data and converting different
20
Electronics 2022, 11, 1467
discrete data into continuous data, and this paper uses this method to convert temporal
features into continuous temporal features.
Occupancy, speed, and traffic flow are all features of the original data table, while
holidays, weekends, and peaks are expanded features of the original data table and are
discrete data features. Therefore, this paper uses one-hot to process this discrete data and
uses this data and the historical occupancy, speed, and traffic flow as features to input
into the model. The time features are interpreted in detail as follows: a holiday feature of
0 means this time is not a holiday; a weekend feature of 1 means the time is a weekend;
and a peak information feature of 0 means this time is not a peak time period.
3.2.3. Data Pre-Processing
In the process of traffic flow detection, the recorder of the detection data may be
affected by some random factors to produce missing data, such as weather and climate,
road driving conditions, the recorder itself, etc., and these data are important parts of
the model prediction. The way the data are processed plays a key role in the accuracy
of the prediction, so it is necessary to effectively deal with the missing part of the data.
The difference in the data size will also cause an error in the prediction, and as the data
size required for each monitoring point is different, some processing needs to be done to
eliminate the error.
Missing Value Handling
There are two types of data loss: the first is the loss of an entire record, which can be
caused by the failure of a logger, but this is uncommon; the second is the loss of part of
a record, where a value is not recorded during the monitoring of the logger for reasons
external to the logger, and thus part of the data is missing.
The traffic flow data in this paper have a low missing rate, and for the continuous
variation characteristic of the missing values, this paper uses mean filling, specifically with
the mean of the last five values of the same time attribute in history.
Data Normalization
Data normalization is an important step in data processing, where a certain amount of
data is scaled down to a certain range so that the input features of the model vary within a
smaller range, thereby eliminating the error generated in the model by the variability of the
feature magnitudes. In this paper, we use the maximum-minimum normalization method
to vary the original data features to within [0, 1], as a function of
x − min
x = (19)
max − min
where min is the minimum value of each feature and max is the maximum value of each
feature; the larger the value of the metric in each feature, the closer to 1 it will be after the
change.
4. Experiment
4.1. Evaluation Indicators
This work selects the mean squared error (MSE) and mean absolute error (MAE) to
evaluate the prediction effect of each model. The formula is shown as follows:
n
1
MSE =
n ∑ [Y (i) − Y (i)]2 (20)
i =1
n
1
MAE =
n ∑ |Y (i) − Y (i)| (21)
i =1
21
Electronics 2022, 11, 1467
where Y (i ) is the predictor variable, Y (i ) is the actual variable, and n is the number of
records of the data.
4.2. Model Prediction
In order to verify the effectiveness of the algorithm, this paper adds a comparative
analysis with other models, including single models such as random forest, GBDT, other
single models before and after feature optimization, stacking ensemble models before and
after improvements, and other combined models.
4.2.1. Analysis of Feature Prediction Effect
In this paper, considering the correlation between historical data and future data, the
first four periods of the time data of the occupancy rate and the speed are added to the
characteristics of the model. In the actual model prediction, the addition of features has a
more obvious optimization effect on the random forest. In order to analyze the effects of
historical related characteristics, some single models such as XGBoost, DBDT, and decision
tree are selected for comparative analysis, shown as Table 1.
Table 1. A comparative analysis of the prediction effects of different characteristics.
Historical Time
Base Learner MSE MAE
Characteristics Characteristics
+ + 662.11 17.38
Random forest + - 745.40 18.08
- - 761.44 18.26
+ + 649.15 17.27
XGBoost + - 762.76 18.40
- - 773.18 18.40
+ + 648.21 17.25
GBDT + - 760.87 18.32
- - 778.18 18.44
+ + 754.31 18.45
Decision tree + - 778.73 18.70
- - 789.33 18.81
+ + 754.37 18.63
KNN + - 776.90 18.36
- - 789.40 18.50
+ - 744.73 18.54
GRU
- - 768.01 18.72
Note: + having this characteristic; - not having this characteristic.
It can be clearly seen from Table 1 that the selection of features has improved the
overall model prediction performance. From the perspective of MSE and MAE, for all
models, the structure of time features has different degrees of improvement for different
models and determines whether the deep learning or the representative machine learning
model is used. The more obvious are the GBDT model and the random forest model of
the integrated tree model. The MSE has been improved by more than 20, followed by the
XGBoost model and the GRU model, and the last is a relatively single KNN model and the
decision-tree model. This conclusion shows that the single model is not as sensitive as the
integrated mode.
For learners other than deep learning, after adding historical features and time features,
each machine learning model experiences a greater degree of improvement: the accuracy
of a single model is limited and the improved MSE is within 50. For the integrated model,
the addition of this feature makes a greater contribution to the improvement: the MSE’s
improvement space is about 100, of which the boosting integrated model constitutes the
largest improvement and the GBDT accuracy improvement is the largest, followed by
22
Electronics 2022, 11, 1467
XGBoost. Therefore, from the analysis of the fusion of the two features, it can be analyzed
that the integrated model is more sensitive to the model features.
In order to analyze part of the effect of model prediction, add Figures 9–11 for a more
detailed analysis, i.e., to select one day’s traffic flow data for analysis randomly, with the
aim to analyze the prediction effects of different characteristics. It can be seen from the
figure that the change trend of different models after adding features is roughly the same,
and the prediction effect is better than that without adding features. The more features are
integrated, the closer the prediction curve is to the original data line.
450
400
Historical feature information
350
No feature information
F 300
Dual feature information
l 250
Original information
o 200
w
150
100
50
0
1 11 21 31 41 51 61 71 81 91
Number/piece
Figure 9. The GBDT feature-analysis diagram.
450
400 Historical feature information
350 No feature information
300 Dual feature information
F
250 Original information
l
o 200
w 150
100
50
0
1 11 21 31 41 51 61 71 81 91
Number/piece
Figure 10. The decision tree feature-analysis diagram.
4.2.2. Single Model Parameter Setting
The grid search is a method of adjusting parameters. First, set a set of candidate
values for the parameters you want to adjust, and then the grid search will exhaust various
parameter combinations and find the best set of settings according to the set scoring
mechanism. In the actual machine model, there are many parameters, so it is impossible to
manually adjust the parameters in a timely and effective manner. Therefore, the parameters
of different learning models can be automatically adjusted through the grid search method
to obtain the parameters with the highest prediction accuracy. In this paper, the grid search
is applied to the base learner, with the aim to find the parameter features when the accuracy
is optimal.
23
Electronics 2022, 11, 1467
450
400 No feature inforation
350
Dual feature information
F 300
Original information
l 250
o 200
w
150
100
50
0
1 11 21 31 41 51 61 71 81 91
Number/piece
Figure 11. The GRU feature-analysis diagram.
In the model building process, other variables in the data table except the volume
variable are used as the input variables, and the volume variable is used as the dependent
variable to construct the following single predictive model. Among them, random forest,
XGBoost, GBDT, KNN, and the decision tree use the network search method to adjust the
parameters, and the GRU model adopts manual parameter adjustment. The parameter
settings of each single model and the error after parameter adjustment are shown in Table 2.
The prediction effects of different models are shown in the Figure 12.
Table 2. The single model prediction.
Base Learner Parameter Setting MSE MAE
The tree depth is 10, the number of trees is 160, the minimum number of
Random forest samples for leaf nodes is 2, and the minimum number of samples for the 662.11 17.38
node division is 5
The number of trees is 390, the minimum leaf node sample weight is 8, the
XGBoost random sampling ratio is 0.9, the number of columns randomly sampled in 649.15 17.27
each tree accounts for 0.8, and the learning rate is 0.12
The tree depth is 3, the number of trees is 470, the minimum number of
GBDT samples for leaf nodes is 6, and the minimum number of samples for node 648.21 17.25
division is 10
KNN Take the number of adjacent points: 48 754.37 18.63
The tree depth is 7, the minimum number of samples for leaf nodes is 2, and
Decision tree 754.31 18.45
the minimum number of samples for node division is 7
GRU has two layers of neurons, of which the number in the first layer is 64
GRU 744.73 18.54
and that in the second layer is 32. The dropout is 0.1
It can be seen that among many models, the integrated model performs well in this
traffic-flow prediction. The GBDT model performs best, followed by the bagging algorithm,
represented by random forest model. The deep-learning model GRU performs moderately
well. The single-model KNN and decision tree perform poorly. It can be seen that, compared
to the single model, the integrated model is more suitable for traffic-flow prediction, and
the boosting integrated tree model performs better.
Figure 12 shows an error map of selected different models in a day. It can be seen
that the error variation characteristics of six single models are the same. Among them,
the fluctuation error of the KNN model and the decision-tree model is larger; the error
fluctuation of the other models are smaller, indicating that the prediction stability of these
four models is better. From Table 2, it can be seen that the prediction effects of the six models
24
Electronics 2022, 11, 1467
are distributed in two sets, of which GBDT has the best prediction effect, and its MSE is
648.21, which is 7.8% less than the MSE of KNN, with a larger error, while the prediction
effect of Random forest, GDBT, and XGBoost is better. Therefore, from the perspective of
overall or partial predictive analysis results, the stability and accuracy of integrated model
prediction are higher than that of a single model.
180
Random forest
160
Xgboost
140 GBDT
120 Decision tree
M 100 KNN
A GRU
80
E
60
40
20
0
1 11 21 31 41 51 61 71 81 91
Number/piece
Figure 12. The error graphs of different models.
4.2.3. Pearson Characteristic Coefficient Analysis
The coefficients that measure the degree of correlation between variables include
the Pearson correlation coefficient, the Spearman’s correlation coefficient, and Kendall’s
correlation coefficient. Among them, the Pearson correlation coefficient can represent
the linear coefficient value between variables. In recent years, it has been used by major
models to screen the features of competitions, and it has good applicability. In the overall
architecture of the stacking model, the output information of the base learner model is used
as the important feature information of the prediction information, and the degree of its
association with the prediction information affects the final prediction result. In this paper,
the Pearson correlation coefficient is used to measure the correlation and screening process
between the output information and prediction information of the base learner model. The
coefficients obtained are shown in the Table 3.
Table 3. The Pearson coefficient analysis table.
R X GB D K G Y
R 1 0.9962 0.9964 0.9890 0.9932 0.9895 0.9441
X 0.9962 1 0.9988 0.9869 0.9898 0.9891 0.9444
GB 0.9964 0.9988 1 0.9870 0.9900 0.9891 0.9442
D 0.9890 0.9869 0.9870 1 0.9829 0.9849 0.9354
K 0.9932 0.9898 0.9901 0.9829 1 0.9877 0.9355
G 0.9895 0.9891 0.989123 0.9849 0.9877 1 0.9357
Y 0.9441 0.9444 0.9442 0.9354 0.9354 0.9357 1
Note: R is the random forest model, X is the XGBoost model, GB is the GBDT model, D is the decision-tree model,
K is the KNN model, G is the GRU model, and Y is the actual traffic flow variable.
In Table 3, the fourth column is the correlation degree between the features of the
corresponding base learner and the predictor variables. The closer it is to 1, the greater the
correlation. The correlation coefficients of all base learner variables and predictor variables
are bigger than 0.9, indicating that the degree of correlation is greater, and its use effect will
affect the final result. Under the premise that the base model is known, knowing how to
25
Electronics 2022, 11, 1467
choose an effective model plays a key role in the accuracy of the prediction results. Next,
the selection of the model is analyzed in detail.
In order to analyze the effects of different base learners in the stacking model, this
paper takes the ridge regression meta-learner as an example to establish the final predic-
tion effect under different base learner combinations. The prediction results are shown
in Table 4.
Table 4. The model selection analysis table.
Model Selection Y/N Y/N Y/N Y/N Y/N Y/N
Random forest 1 1 1 1 1 1
GBDT 1 1 0 1 1 1
XGBoost 1 0 1 1 1 1
KNN 1 1 0 0 0 0
Decision tree 1 1 1 0 1 0
GRU 1 1 1 1 1 1
MSE 638.15 638.92 638.71 643.67 638.63 643.01
MAE 17.07 17.06 17.07 17.17 17.08 17.15
Note: This applies to situations in which yes is 1; in other situations, it is 0.
The base learner in the stacking model selected in this paper has different characteris-
tics, and knowing how to combine effective models has a greater impact on the final result.
The above table is the MSE and MAE index values that combine different models. It can be
seen that the smallest values of MSE and MAE indicators are achieved when the six models
are combined. From Table 3, it can be seen that the correlation coefficient of each model
is greater than 0.92, so the output information of the model-based learner and the actual
information have a great correlation. After removing the models with small or large correla-
tions, their accuracy is reduced to varying degrees. Therefore, the stacking model requires
a certain degree of difference. When the integrated model represents all models with better
base learner accuracy, its accuracy is not the highest, and after removing part of the model
information in this table, its accuracy is reduced. Therefore, the stacking-integrated model
of the six machine models proposed in this paper can make predictions more effectively.
4.2.4. Ba-Stacking Model Prediction
In order to analyze the improvement effect of the bagging algorithm integrated with
different base learner models on the stacking integration algorithm, the Ba-Stacking model
of different base learner models is established, and the final MSE and MAE are used to
specifically evaluate the prediction effect, as shown in Table 5.
Table 5. The Ba-Stacking model prediction effect of different meta-learners.
Bagging Evaluation Index
Meta-Learner
Random Forest XGBoost GBDT Decision Tree KNN MSE MAE
- - - - - 638.15 17.07
+ - - - - 641.15 17.11
- + - - - 637.33 17.06
- - + - - 637.51 17.06
Ridge regression
- - - + - 638.14 17.07
- - - - + 633.83 17.00
+ + + + + 634.95 17.00
- + + + + 632.85 16.99
Note: + using this model; - not using this model
It can be seen from Table 5 that the prediction accuracy of the overall stacking model
has decreased after the integration of the random forest optimized by bagging. The
integration of other machine learning models optimized by bagging has improved the
overall stacking model. The random forest model optimized by the bagging algorithm
26
Electronics 2022, 11, 1467
is not as good as the original random forest model, which affects the performance of
the ensemble model. After bagging with the integration of other optimized models, the
prediction accuracy of the stacking ensemble model has been improved compared to the
original stacking ensemble model, and the base learner model that has been optimized
by the bagging algorithm is integrated, namely, the optimized XGBoost, GBDT, decision-
tree, and the stacking-integrated models after the KNN-based learner model make more
accurate predictions. Therefore, whether from the horizontal or vertical angle of the
table, it can be seen that the accuracy of the stacking model optimized by the bagging
algorithm has improved the accuracy of the original model to varying degrees. We can know
that this method optimizes the overall performance under the premise of optimizing the
base learner.
4.2.5. DW-Ba-Stacking Model Prediction
In order to verify the effectiveness of this model, take the mentioned optimal single
model prediction result as input and actual traffic flow as output; ridge regression is
established as the original stacking ensemble model and the DW-Ba-Stacking model of the
meta-learner. The prediction effect of each single model and each combination model is
shown in Table 6, and the prediction effect is shown in the Figure 13.
Table 6. A performance analysis of each combination model.
Method MSE MAE
Random forest 662.11 17.38
XGBoost 649.15 17.27
GBDT 648.21 17.25
KNN 754.37 18.63
Decision tree 754.31 18.45
GRU 744.73 18.54
Stacking model 638.15 17.07
Ba-Stacking model 632.85 16.99
DW-Ba-Stacking model 619.59 16.87
Reciprocal error method
659.31 17.28
combination
450
Reciprocal error method combination
400
350 Ridge regression
300 Error weighting
F
l 250
Original information
o 200
w 150
100
50
0
1 11 21 31 41 51 61 71 81 91
Number/piece
Figure 13. The single model error diagram.
Table 6 shows the prediction results of different combination models. From the
prediction results, it can be seen that the prediction effect of other combination models
is poor. Because there are many single models in this paper, the advantages of the single
models cannot be well integrated; the stacking ensemble model has better prediction results
than other combination models, among which is stacking. The base learners of the ensemble
27
Electronics 2022, 11, 1467
model are XGBoost, GBDT, decision tree, random forest, and GRU. The stacking model,
whose meta-learner is ridge regression, is weighted by entropy; the MSE of the original
model is reduced; and the MAE index value is reduced. The improved stacking model
after error weighting is less than the MSE of the original model, and the MAE index value
is reduced. Compared with the improved stacking ensemble model of the GRU meta-
learner, the improved effect of the meta-learner is the ridge regression; obviously, it can be
seen that the stacking ensemble models improved by different weights have optimization
effects, and the stacking ensemble model of error-weighted ridge regression has the best
optimization effect.
4.2.6. Comparative Analysis of Experimental Results
The model comparison analysis includes the basic learner model under different
characteristics in the literature [9–12,15], the Ba-Stacking model optimized by the bagging
algorithm, and the DW-Ba-Stacking model; the prediction results analysis as shown in the
Table 7. The comparative analysis further verifies that the model proposed in this paper
has higher prediction accuracy and stronger applicability.
Table 7. The comparison table of different models.
Models MSE MAE
Random forest [9] 706.68 18.72
XGBoost [10] 694.99 18.54
Single model GBRT [11] 691.63 18.51
KNN [12] 830.83 20.40
GRU [15] 773.54 19.89
Stacking 689.79 18.46
Meta-learner for ridge
Ba-Stacking 688.35 18.45
regression
DW-Ba-Stacking 681.39 18.22
5. Conclusions
With socio-economic improvements, traffic congestion will occur more frequently.
Traffic-flow prediction can effectively manage and monitor traffic flow, and its prediction
accuracy plays a crucial role in solving traffic-congestion problems. Machine learning
algorithms have long been applied to the field of traffic-flow prediction, but individual
models are greatly limited in terms of their predictive powers. Therefore, this paper applies
the stacking-integrated learning model, which has been widely used in various fields in
recent years, to traffic-flow prediction and provides a new idea for its prediction. A series
of improvement measures are carried out to address the shortcomings of the traditional
stacking-integrated learning model. The main objectives of this paper are as follows:
(1) In order to improve the shortcomings of the traffic prediction model with a single
feature, temporal features such as holidays and historical features such as speed
are constructed. Traffic flow is always recorded in the detector, so the time for the
recorded parameters is clearer. In this paper, different time-feature information is
extracted according to the specific time of the record: holiday information, weekend
information features, and peak information; historical speed and occupancy features
related to traffic flow are constructed according to the original data features, and the
rationality of the introduced features is verified through the comparative analysis of
different features. Thus, the best effect is obtained.
(2) The stacking integration model with the highest accuracy is obtained by filtering
and optimizing the learners. First, we build machine learning models with different
merits; then, we analyze the correlation coefficient between each model and the actual
information by using the Pearson correlation coefficient; next, we select the stacking-
integrated model with the highest prediction accuracy based on the weight of each
model; and, finally, we embed the bagging model in this model to further improve
the prediction accuracy of the model.
28
Electronics 2022, 11, 1467
(3) According to the shortcomings of the stacking-integrated model, the stacking model
two-layer is used as the object of improvement. With the goal of enhancing the
variability between models and the correlation between predicted and actual informa-
tion, the weights of different base learner models are adjusted so that the prediction
accuracy is higher.
The main innovative work of this paper is to achieve the following:
(1) Realize the effective combination of the stacking model and bagging model, i.e.,
the construction of Ba-Stacking. The bagging model is used to optimize the output
information features of the base learner in the stacking model, and the construction of
the Ba-Stacking model is completed.
(2) Based on the Ba-Stacking model, the DW-Ba-Stacking model is constructed by weight-
ing coefficients. The Ba-Stacking model with the meta-learners as ridge regression
optimizes the base learner feature information by error coefficient.
In summary, this paper not only introduces the stacking-integrated model, which can
effectively improve the accuracy of traffic-flow prediction, but also proposes an improved
DW-Ba-Stacking model, which further improves the prediction accuracy of traffic flow
while adjusting the internal structure, and provides a reference for the development of
traffic-management strategies and implementation plans. In the future, the improved
method can be applied to other fields with practical significance. However, in the process
of improving the stacking ensemble model, this paper only pays attention to the prediction
accuracy and does not consider the time efficiency, so there are some limitations in its level
of improvement. In the future, the improved method can be applied to other fields with
practical significance.
Author Contributions: Conceptualization, Z.L. and M.Y.; Data curation, M.Y. and D.W.; Formal anal-
ysis, Y.H.; Investigation, D.W.; Methodology, Z.L. and L.W.; Project administration, Z.L.; Validation,
L.W. and D.W.; Writing – original draft, M.Y.; Writing – review & editing, Z.L., L.W., D.W. and Y.H.
All authors have read and agreed to the published version of the manuscript.
Funding: This research was funded by the National Key R&D Program of China (no.2019YFD1101104).
Data Availability Statement: The data were obtained from portal (https://new.portal.its.pdx.edu/
downloads/, 22 March 2022).
Conflicts of Interest: The authors declare that they have no conflict of interest.
References
1. Alghamdi, T.; Elgazzar, K.; Bayoumi, M.; Sharaf, T.; Shah, S. Forecasting Traffic Congestion Using ARIMA Modeling. In
Proceedings of the 2019 15th International Wireless Communications & Mobile Computing Conference (IWCMC), Tangier,
Morocco, 24–28 June 2019; pp. 1227–1232.
2. Min, X.; Hu, J.; Zhang, Z. Urban traffic network modeling and short-term traffic flow forecasting based on GSTARIMA model. In
Proceedings of the 13th International IEEE Conference on Intelligent Transportation Systems, Funchal, Portugal, 19–22 September
2010; pp. 1535–1540.
3. Liu, X.W. Research on Highway Traffic Flow Prediction and Comparison based on ARIMA and Long-Short-Term Memory Neural
Network. Master’s Thesis, Southwest Jiaotong University, Chengdu, China, 2018. (In Chinese).
4. Cvetek, D.; Muštra, M.; Jelušić, N.; Abramović, B. Traffic Flow Forecasting at Micro-Locations in Urban Network using Bluetooth
Detector. In Proceedings of the 2020 International Symposium ELMAR, Zadar, Croatia, 14–15 September 2020; pp. 57–60.
5. Iwao, J.; Stepphanedes Yorgos, J. Dynamic prediction of traffic volume through Kalman filtering theory. Pergamon 1984, 18, 1–11.
6. Guo, J.; Huang, W.; Williams, B.M. Adaptive Kalman filter approach for stochastic short-term traffic flow rate prediction and
uncertainty quantification. Transp. Res. Part C Emerg. Technol. 2014, 43, 50–64. [CrossRef]
7. Ullah, I.; Fayaz, M.; Naveed, N.; Kim, D. ANN Based Learning to Kalman Filter Algorithm for Indoor Environment Prediction in
Smart Greenhouse. IEEE Access 2020, 8, 159371–159388. [CrossRef]
8. Vlahogianni, E.I.; Karlaftis, M.G.; Golias, J.C. Short-term traffic forecasting: Where we are and where we’re going. Transp. Res.
Part C Emerg. Technol. 2014, 43, 3–19. [CrossRef]
9. Gao, J.; Leng, Z.; Qin, Y.; Ma, Z.; Liu, X. Short-term traffic flow forecasting model based on wavelet neural network. In Proceedings
of the Control and Decision Conference (CCDC), Guiyang, China, 25–27 May 2013; pp. 5081–5084.
10. Qin, Y.; Adams, S.; Yuen, C. Transfer Learning-Based State of Charge Estimation for Lithium-Ion Battery at Varying Ambient
Temperatures. IEEE Trans. Ind. Inform. 2021, 17, 7304–7315. [CrossRef]
29
Electronics 2022, 11, 1467
11. Xiong, T.; Qi, Y.; Zhang, W.B.; Li, Q.M. Short-term traffic flow prediction model based on spatiotemporal correlation. Comput. Eng.
Des. 2019, 40, 501–507. (In Chinese)
12. Lu, W.; Rui, Y.; Yi, Z.; Ran, B.; Gu, Y.A. Hybrid Model for Lane-Level Traffic Flow Forecasting Based on Complete Ensemble
Empirical Mode Decomposition and Extreme Gradient Boosting. IEEE Access 2020, 8, 42042–42054. [CrossRef]
13. Alajali, W.; Zhou, W.; Wen, S.; Wang, Y. Intersection Traffic Prediction Using Decision Tree Models. Symmetry 2018, 10, 386.
[CrossRef]
14. Yu, S.; Li, Y.; Sheng, G.; Lv, J. Research on Short-Term Traffic Flow Forecasting Based on KNN and Discrete Event Simulation. In
Proceedings of the 15th International Conference on Advanced Data Mining and Applications, Foshan, China, 12–15 November
2019; pp. 853–862.
15. Qin, Y.; Yuen, S.C.; Qin, M.B.; Li, X.L. Slow-varying Dynamics Assisted Temporal Capsule Network for Machinery Remaining
Useful Life Estimation. arXiv 2022, arXiv:2203.16373. [CrossRef] [PubMed]
16. Dai, G.W.; Ma, C.X.; Xu, X.C. Short-Term Traffic Flow Prediction Method for Urban Road Sections Based on Space Time Analysis
and GRU. IEEE Access 2019, 7, 143025–143035.
17. Hu, H.; Yan, W.; Li, H.M. Short-term traffic flow prediction of urban roads based on combined forecasting method. Ind. Eng.
Manag. 2019, 24, 107–115.
18. Zhu, P.F.; Liu, Y. Prediction of distributed optical fiber monitoring data based on GRU-BP. In Proceedings of the 2021 International
Conference on Intelligent Transportation, Big Data & Smart City (ICITBS), Xi’an, China, 27–28 March 2021; pp. 222–224.
19. Barboza, F.; Kimura, H.; Altman, E. Machine learning models and bankruptcy prediction. Expert Syst. Appl. 2017, 83, 405–417.
[CrossRef]
20. Wang, S.; Yao, Y.; Xiao, Y.; Chen, H. Dynamic Resource Prediction in Cloud Computing for Complex System Simulatiuon: A
Probabilistic Approach Using Stacking Ensemble Learning. In Proceedings of the 2020 International Conference on Intelligent
Computing and Human-Computer Interaction (ICHCI), Sanya, China, 4–6 December 2020; pp. 198–201.
21. Liu, Y.; Yang, C.; Gao, Z.; Yao, Y. Ensemble deep kernel learning with application to quality prediction in industrial polymerization
processes. Chemom. Intell. Lab. Syst. 2018, 174, 15–21. [CrossRef]
22. Zhang, X.M.; Wang, Z.J.; Liang, L.P. A Stacking Algorithm for Convolutional Neural Networks. Comput. Eng. 2018, 44, 243–247.
23. Li, B.S.; Zhao, H.Y.; Chen, Q.K.; Cao, J. Prediction of remaining execution time of process based on Stacking strategy. Small
Microcomput. Syst. 2019, 40, 2481–2486. (In Chinese)
24. Sun, X.J.; Lu, X.X.; Liu, S.F. Research on combined traffic flow forecasting model based on entropy weight method. J. Shandong
Univ. Sci. Technol. (Nat. Sci. Ed.) 2018, 37, 111–117. (In Chinese)
25. Gong, Z.H.; Wang, J.N.; Su, C. A weighted deep forest algorithm. Comput. Appl. Softw. 2019, 36, 274–278. (In Chinese)
26. Zheng, Z.H.; Huang, M.F. Traffic Flow Forecast Through Time Series Analysis Based on Deep Learning. IEEE Access 2020,
8, 82562–82570. [CrossRef]
27. Zhao, Z.; Chen, W.; Wu, X.; Chen, P.C.; Liu, J. LSTM network: A deep learning approach for short-term traffic forecast. IET Intell.
Transp. Syst. 2017, 11, 68–75. [CrossRef]
28. Li, Y.L.; Tang, D.H.; Jiang, G.Y.; Xiao, Z.T.; Geng, L.; Zhang, F.; Wu, J. Residual LSTM Short-Term Traffic Flow Prediction Based on
Dimension Weighting. Comput. Eng. 2019, 45, 1–5. (In Chinese)
30
electronics
Article
China Coastal Bulk (Coal) Freight Index Forecasting Based on
an Integrated Model Combining ARMA, GM and BP Model
Optimized by GA
Zhaohui Li 1, *, Wenjia Piao 1, *, Lin Wang 1 , Xiaoqian Wang 2 , Rui Fu 3 and Yan Fang 1
1 School of Maritime Economics and Management, Dalian Maritime University, Dalian 116026, China
2 Zhejiang Provincial Military Command, Hangzhou 310002, China
3 ZCCE, Faculty of Sciences and Engineering, Swansea University, Bay Campus, Fabian Way,
Swansea SA1 8EN, UK
* Correspondence: [email protected] (Z.L.); [email protected] (W.P.)
Abstract: The China Coastal Bulk Coal Freight Index (CBCFI) is the main indicator tracking the coal
shipping price volatility in the Chinese market. This index indicates the variable performance of
current status and trends in the coastal coal shipping sector. It is critical for the government and
shipping companies to formulate timely policies and measures. After investigating the fluctuation
patterns of the shipping index and the external factors in light of forecasting accuracy requirements
of CBCFI, this paper proposes a nonlinear integrated forecasting model combining ARMA (Auto-
Regressive and Moving Average), GM (Grey System Theory Model) and BP (Back-Propagation)
Model Optimized by GA (Genetic Algorithms). This integrated model uses the predicted values of
ARMA and GM as the input training samples of the neural network. Considering the shortcomings
of the BP network in terms of slow convergence and the tendency to fall into local optimum, it
Citation: Li, Z.; Piao, W.; Wang, L.;
innovatively uses a genetic algorithm to optimize the BP network, which can better exploit the
Wang, X.; Fu, R.; Fang, Y. China
prediction accuracy of the combined model. Thus, establishing the combined ARMA-GM-GABP
Coastal Bulk (Coal) Freight Index
prediction model. This work compares the short-term forecasting effects of the above three models
Forecasting Based on an Integrated
Model Combining ARMA, GM and
on CBCFI. The results of the forecast fitting and error analysis show that the predicted values of the
BP Model Optimized by GA. combined ARMA-GM-GABP model are fully consistent with the change trend of the actual values.
Electronics 2022, 11, 2732. The prediction accuracy has been improved to a certain extent during the observation period, which
https://doi.org/10.3390/ can better fit the CBCFI historical time series and can effectively solve the CBCFI forecasting problem.
electronics11172732
Keywords: CBCFI; combined prediction model; ARMA; GM; GA; BP
Academic Editor: Alberto Fernandez
Hilario
Received: 31 July 2022
Accepted: 25 August 2022 1. Introduction
Published: 30 August 2022
The China (Coastal) Bulk Coal Freight Index (CBCFI) published by the Shanghai
Publisher’s Note: MDPI stays neutral Shipping Exchange reflects the pricing of coastal coal shipping in China [1]. It includes
with regard to jurisdictional claims in the daily complex index and spot ratios relating to various routes/kinds of vessels in the
published maps and institutional affil- coastal coal service market [2]. CBCFI is used to reflect the changes in the level of bulk
iations. freight in China’s coastal bulk transport market [3]. It can not only reflect the changes in
the level of shipping rates in the coastal bulk market but also objectively reflect the degree
of fluctuations in the transport market. So, it can, to a certain extent, reflect the economic
development of China and the trend of coastal bulk trade. The release of CBCFI helps
Copyright: © 2022 by the authors.
the development of the shipping index system in the China coastal coal transportation
Licensee MDPI, Basel, Switzerland.
market [4]. As the “barometer” of the coastal coal transportation market, the index can
This article is an open access article
accurately and timely reflect the dramatic and frequent price fluctuations in the coastal
distributed under the terms and
coal transportation market [5]. So, it is essential for shipping operators and investors to
conditions of the Creative Commons
Attribution (CC BY) license (https://
use an effective model to forecast CBCFI accurately when developing relevant strategies.
creativecommons.org/licenses/by/
However, there is a scarcity of analytical studies on the volatility of China’s coastal bulk
4.0/). cargo market. At the same time, although the existing studies can provide guidance for
Electronics 2022, 11, 2732. https://doi.org/10.3390/electronics11172732 https://www.mdpi.com/journal/electronics
31
Electronics 2022, 11, 2732
CBCFI prediction, the prediction accuracy of the models is not high enough to accurately
predict CBCFI data with volatility. All of these make it worthwhile and meaningful to
propose an effective method for the accurate prediction of CBCFI.
Scholars worldwide have conducted studies on the potential volatility patterns and
trend forecasting of the shipping index. For example, Chen [6] developed a grey system
theory based on the Baltic dry bulk shipping index forecasting model; Liang et al. [7]
presented a neural network based on the export container shipping index estimation
model; Lian et al. [8,9] constructed the ARMA model to forecast the shipping index,
and demonstrated the applicability of the time series model in index forecasting; Zhou
et al. [10] developed a GARCH model to analyze the seasonality, cyclicality, persistence
and asymmetry patterns of the fluctuations of the coastal container shipping index; Adland
et al. [11] used a nonlinear randomness model to explore the trend of the international
market shipping index; Shan et al. [12] used wavelet analysis and ARIMA model to
forecast China’s export container shipping index. In addition, Li et al. [13] created a
prediction model with BP neural network improved by genetic algorithm and verified that
the improved BP neural network gets higher prediction accuracy and faster convergence
speed than the traditional BP neural network. By analyzing the research methods of the
above scholars, we find that the forecasting methods for CBCFI mainly including: the
ARIMA model, GARCH model, neural network, SVM model, wavelet analysis and so on.
The above models have good guiding significance for CBCFI forecasting research, but there
are also certain shortcomings. First, the GARCH model is based on statistics and theory.
Before building these forecasting models, the non-linear and non-stationary shipping
index need to be smoothed, which will inevitably destroy the intrinsic characteristics
of the shipping index to a certain extent. Second, wavelet analysis is not free from the
constraint of pre-selected basis functions, there is too much subjectivity in the selection of
parameters, and the selection of different parameters produces results that vary greatly and
lack adaptability. Third, the above scholars mostly use a single linear or a nonlinear model
to forecast the shipping index. However, because of the complexity of CBCFI series, these
models are easily influenced by their own characteristics, which can result in a decrease in
forecast credibility.
Considering the shortcomings mentioned above, this paper proposes a combined
ARMA-GM-BP model based on GA optimization for short-term forecasting of CBCFI,
and then presents a BP network optimized by genetic algorithm to simulate nonlinear
combination functions and creates an ARMA-GM-GABP combined forecasting model. First,
we use the ARMA model and GM (1,1) model to take the prediction value of CBCFI for the
given time respectively. Then, these two values are two-dimensionally input into a GA-BP
neural network, the GA-BP neural network model then combines these two predicted
values nonlinearly, predicts its fitting error and further corrects the predicted values, finally
outputs the predicted CBCFI value. In this paper, we innovatively use a genetic algorithm
to optimize the BP network, allowing it to avoid the defects of the BP model and improve
the combined model’s prediction accuracy. The combined model compensates well for
the slow error correction of the ARMA model and the fact that the GM model is only
suitable for predicting sequences that grow monotonically at an approximately exponential
rate. Furthermore, the combined model has a high prediction accuracy and fits the CBCFI
historical time series better.
The paper is organized as follows. Section 1 introduces the research background, liter-
ature review and the significance of this work, including research motivation, knowledge
gap, problem statement and a brief introduction to combinatorial model building. Section 2
provides a theoretical introduction of the models used in this paper and introduces the con-
struction principle of the combined forecasting model. Section 3 builds the models and uses
the ARMA model, the GM (1,1) model and the ARMA-GM-GABP combined forecasting
model to predict the CBCFI values respectively, and then compares the predicting results of
these three models through the error evaluation index. Section 4 reviews the whole paper
and proposes directions for future improvement.
32
Electronics 2022, 11, 2732
2. Combination Construction of the Forecasting Model
The CBCFI sequence’s extreme volatility proves the coal transportation market’s
considerable risk. According to data volatility research, CBCFI has complicated nonlinear
properties. And the typical single prediction model has limits in data prediction. Therefore,
on the basis of in-depth research on ARMA, GM and BP models, this paper establishes the
ARMA-GM-GABP nonlinear combination model to predict CBCFI.
2.1. ARMA Model
American statisticians Box and Jenkins proposed the Autoregressive Moving Average
Model as a time series forecasting method [14]. A time series is a collection of continuous
observations of a single variable over a period of time, organized in a time sequence. We
mainly use the autoregressive model (AR model) and moving average model (MA model)
to statistically describe the stochastic nature of time series [15]. Although both the ARMA
and ARIMA models are a hybrid of AR and MA models, their application objects are
different. The ARMA model is used to model stationary time series, while the ARIMA
model is used to model non-stationary time series [16,17]. The term “stationarity of time
series” refers to the fact that the statistical law of time series does not vary over time [18]. It
means that the statistical properties of the random process of time series data that generate
variables do not change. A stationary time series can be regarded as a curve moving up
and down around its mean value [19]. In practical applications, it is necessary to check
whether the time series is stable first. If it is a non-stationary series, it must be smoothed.
After stationary processing, ARMA can analyze these data. The most common expression
of ARMA (p,q) is:
χ t = c + ϕ1 χ t −1 + ϕ2 χ t −2 + ϕ3 χ t −3 + . . . + ϕ p χ t − p + ε t + θ1 ε t −1 + θ2 ε t −2 + . . . + θ q ε t − q (1)
In the formula, the first half is the autoregressive part and the non-negative integer
p is the autoregressive order, ϕ1 , . . . , ϕ p is the autoregressive coefficient, the second half
is the moving average part, the non-negative integer q is the moving average order and
θ1 , . . . , θq is the moving average coefficient.
In summary, the ARMA model is built on a smooth time series. Before using the
ARMA model for forecasting, the data used should be pre-processed first to eliminate
periodicity and trendiness and make it meet the smoothness requirements. Then, the
truncated and trailing tails of the autocorrelation and partial correlation functions are
judged to make pattern recognition [20]. The model structure that is most similar to the
change process of the pre-processed data series is selected. After determining the order
of the model by the fixed-order method, use the least squares estimation method to find
the model parameters ϕ and θ. Finally, the model is tested for suitability by determining
whether the residual series of the model is a white noise series. If it passes the test, we can
use this model to predict the value.
2.2. GM Model
In grey system theory, the GM (1,1) model is the most widely used grey dynamic
prediction model. The grey model accumulates the original data to generate a new series
in order to weaken the random terms and increase their regularity. It is mainly used to
fit and estimate the eigenvalues of a single principal element in a complex system [21].
CBCFI has obvious dynamic characteristics and uncertainties, which is consistent with the
characteristics of the gray system [22]. The GM (1,1) model typically uses newly generated
data sequences. Taking the cumulative generation as an example:
1. Suppose the original time series data: X (0) = X1 (0) , X2 (0) , . . . , Xj (0) , . . . , Xn (0) ;
2. Data accumulation generates a new sequence: X (1) = X1 (1) , X2 (1) , . . . , X j (1) , . . . , Xn (1) ,
j
where x(j) (1) = ∑i=1 x(i) (0) ;
33
Electronics 2022, 11, 2732
3. Grade ratio test: Generally, the level ratio of σk (0) to X (0) and its range are used
to judge whether a high precision GM (1,1) model can be established for a given
x ( k −1) (0)
, If σk (0) ∈ (e− n+1 , e n+1 ) is satisfied,
2 2
sequence. Grade ratio definition: σk (0) =
x ( k ) (0)
X (0) can be regarded as the modeling object of GM (1,1);
4. The change trend of the new series is approximately described by the following
differential equation, where a is the development gray level and u is the endogenous
control gray level:
dx (1)
+ ax (1) = u (2)
dt
5. Using the ratio of mean square error and the probability of small error to test the
prediction accuracy of the GM (1,1) model.
As a very important grey forecasting model, the GM (1,1) model has a number of
significant modeling advantages [23]. For example, the theoretical principles of the model
are relatively simple, the model requires fewer sample data and does not require the
sample data to meet specific probability distribution characteristics. At the same time, the
parameter solution of the model is relatively simple, the prediction precision is relatively
high, and the prediction test of the model is relatively simple. As a result, the GM (1,1)
model has now been applied with some success in a number of areas.
2.3. BP Model Improved by GA
There are many unknown variables in the change process of CBCFI, and the neural
network does not need to consider the relationship among variables. As long as the nodes
of the input layer and the output layer are defined, the network system can be trained
continuously until the test accuracy reaches the set value [24].
BP neural networks, also known as back propagation neural networks, are trained
with sample data to continuously modify the network weights and thresholds so that the
error function decreases in the negative gradient direction, approximating the desired
output [25]. The BP neural network model topology consists of an input layer, a hidden
layer and an output layer. The input layer receives the sample and calculates it through
the hidden layer and outputs it through the output layer. When the output value differs
significantly from the expected value, the error is propagated backward and the weights of
each layer are modified by the output layer through the hidden layer. This process repeats
alternately until the error is reduced to an acceptable range or a predetermined number of
training periods are performed. The main components of a predictive model using the BP
neural network algorithm include: the determination of the input samples, the number of
input and output layers and the number of hidden layers [26].
The initial weights and biases of a single BP neural network are completely random.
Although the BP network corrects the initial weights and biases during the training process,
they have a significant impact on the outcome. The basic idea of genetic algorithms is to
simulate the process of biological evolution [27]. It starts from a population that represents
a potential set of solutions to a problem and uses fitness as a basis for evaluating the merits
of individuals. Then, it repeatedly uses selection, crossover and variation operators on
the population so that the population gradually approaches the optimal solution. Genetic
algorithms have strong environmental self-adaptation and self-learning capabilities, and
their highly parallel global search algorithms can overcome the shortcomings of BP neural
networks [28,29]. The combination of genetic algorithms and BP neural network not only
helps to avoid BP neural networks from falling into local minima but also accelerates the
convergence speed of the network and enhances the learning ability and the generalization
ability of the model [30]. Therefore, we use a genetic algorithm to optimize the BP network
to achieve the purpose of efficient solution and global optimization search.
The GA-BP neural network model uses a genetic algorithm to perform a global search
on the range of weights to find the optimal initial weight values and thresholds for the
BP neural network model first. Then the BP neural network model begins the training
34
Electronics 2022, 11, 2732
process with the optimal initial weight values and thresholds provided by the genetic
algorithm and approximates the optimal solution to the prediction problem. Finally, this
model outputs the prediction values that achieve the desired prediction accuracy of the
initial setting.
Steps of improving the BP neural network by GA.
• Initialize the population.
• We encode all the weights and thresholds in the network as real numbers. Each
individual is represented by a set of chromosomes with the following chromosome
form: w11 , w12 . . . , wij , a1 , a2 . . . , al , w11 , w12 . . . , w jk , b1 , b2 . . . , bm . wij is the connec-
tion weight between the input and hidden layers; a = { a1 , a2 , . . . , al } is the hid-
den layer threshold; w jk is the hidden layer and output layer connection weight;
b = {b1 , b2 , . . . , bm } is the output layer threshold. This experiment started with a
population of 100 persons.
• Choose a fitness function.
• The less the absolute value of the error in the BP neural network, the better. The higher
the fitness score in the genetic algorithm, the better. As a result, the fitness function is
the inverse of the BP neural network goal function.
−1
m m
q 2
∑ ∑
q
F(x) = yk − Vk (3)
k =1 k =1
• Select genes.
• Using the roulette method to choose individuals in the population. Those with high
fitness are chosen to be passed down to the next generation.
• Operation of crossover mutation.
• The basic action of a genetic algorithm is to generate new individuals. The goal is
to improve the coding structure of the individual. The mutation process includes
changing the gene value at some sites of an individual string in the population, which
can lead to the generation of new individuals and allow the genetic algorithm to
perform a local random search.
• Operation on a cyclic basis.
• If the fitness of an individual reaches a certain threshold, or if the fitness of the
individual and group no longer rises, the algorithm can terminate. Otherwise, the
loop will restart at the second stage. We use the connection weights and thresholds
optimized by the genetic algorithm as the initial weights and thresholds. The GA-
BP neural network is trained until the error requirements are met or the maximum
number of training times is reached.
2.4. ARMA-GM-GABP Combined Model Construction
In recent years, combined forecasting models have been increasingly used in forecast-
ing problems because of their general advantage of higher forecasting accuracy compared
to single forecasting models. Normally, there are limitations to the practical application
of a single forecasting model. For example, although the GM (1,1) model is very good at
reducing the volatility of the original modeled data series, there are certain disadvantages
relative to other models in terms of portraying the periodicity and trend of the original
modeled data series. Combined models can be a good way to overcome the shortcomings
of individual prediction models.
In this paper, we consider the construction of the combination model from the follow-
ing aspects. First of all, the success of the combination model depends largely on the choice
of the model. Considering the volatility and periodicity of CBCFI, our work chooses the
ARMA model, which is suitable for linear prediction and has high short-term prediction
accuracy and the GM (1,1) model, which can effectively reduce the volatility of the data.
These two models provide better prediction results than other machine learning models.
The ARMA model captures the periodicity and trend information in the original modeling
35
Electronics 2022, 11, 2732
data series, and the GM (1,1) model can effectively reduce the volatility of the original
modeling data series. Then, considering the defects of slow convergence speed and the easy
falling into a local optimum of the BP network, the genetic algorithm is used to optimize the
BP network. This operation significantly improves the convergence speed and convergence
performance of the model and at the same time, it greatly reduces the prediction error
of the model and better exploits the prediction accuracy of the model. Considering the
characteristics of the three models above, we finally choose to combine these three models,
the combined ARMA-GM-GABP prediction model is obtained.
The principle of the nonlinear combination forecasting model refers to the nonlinear
combination of different forecasting methods. The nonlinear function f ( x ) is:
ŷ = f ( x ) = f (t1 , t2 , . . . , tn ) (4)
where t( x ) (i = 1, 2, . . . , n) represents the prediction results of i-th prediction methods.
The combined forecasting model makes comprehensive use of the advantages of each
single model, so the forecast accuracy of f ( x ) is higher than that of ti ( x ). Since a single
hidden layer BP network can arbitrarily approximate a continuous nonlinear function, this
paper attempts to use BP neural networks to model the nonlinear combinatorial prediction
function f ( x ), so as to achieve the purpose of nonlinear combinatorial modeling and
prediction using the ARMA model and GM (1,1) model. The basic idea of the ARMA-
GM-BP combined forecasting model: First, we obtain the CBCFI prediction values of the
ARMA and grey GM (1,1) models for the given date. Then, we two-dimensionally input
the predicted values into the BP neural network model optimized by the genetic algorithm,
the GA-BP neural network model then combines these two predicted values nonlinearly,
predicts its fitting error and further corrects the predicted values, finally outputs the
predicted CBCFI value. Figure 1 shows the specific process of the combined ARMA-GM-BP
forecasting model.
The specific implementation steps of the combined forecasting model are as follows:
1. Establish an ARMA single-term forecast model to obtain the forecast value t1 = (t11 ,
t12 , ..., t1n ) (t1i is the predicted value in the i-th day).
2. Establish a GM (1,1) single prediction model to obtain the predicted value t2 = (t21 ,
t22 , ..., t2n ) (t2i is the predicted value in the i-th day).
3. Determine the BP neural network structure according to the number of input and
output parameters of the fitting function: Use the predicted value (t11 , t21 ), (t12 ,t22 )
. . . , (t1m , t2m ) of ARMA model and GM (1,1) model as the two-dimensional input
training sample of the BP neural network (m < n), the number of input nodes is 2. Use
ri = (r1 , r2 , . . . , rm ) as an output target (where ri is the true CBCFI value at day i), the
number of the output node is 1.
4. Attempt to use genetic algorithms to improve the weight and threshold of the BP
neural network. First, we use the fitness function to calculate the individual fitness
value, then use selection, crossover and mutation operations to determine the optimal
fitness value corresponding to persons.
5. Initial weight and threshold assignment to the network using a genetic algorithm to
obtain the optimal individual, and then we use the trained combination model to
predict the test sample (t1m+1 , t2m+1 ) . . . , (t1n , t2n ). Predict the CBCFI for the test date
and compare it with the true value to test the prediction ability of the network.
36
Electronics 2022, 11, 2732
6WDUW
/RJGLIIHUHQFHSURFHVVLQJ
(QWHUWKHDFWXDOYDOXHRI&%&),
$QGVLQJOHSUHGLFWHGYDOXH
'HWHUPLQH%3WRSRORJ\
6WDWLRQDULW\WHVW
$50$
)RUHVHH *$HQFRGHVWKHLQLWLDO
0HDVXUH YDOXH ,QLWLDO%3WKUHVKROG
$&)DQG3$&)RUGHULQJ
PHQW $QGZHLJKWOHQJWK
.QRW
IUXLW
,QIRUPDWLRQFULWHULRQ %3WUDLQLQJJHWVWKHHUURU
$VILWQHVVYDOXH 2EWDLQWKHRSWLPDOWKUHVKROG
WZR *$ DQGZHLJKW
5HVLGXDOHUURUDQG':WHVW GLPH RSWLP
QVLRQ L]DWLR
ORVH Q 6HOHFWLRQFURVVRYHU
HQWHU %3 PXWDWLRQ 7KUHVKROGDQGZHLJKWXSGDWH
8SGDWHVDPSOHVL]H
&DOFXODWHILWQHVV
*HQHUDWH$*2VHTXHQFH 1R
*0 7RPHHWWKHFRQGLWLRQV
)RUHVHH
0HDVXUH 1R
6ROYLQJSDUDPHWHUVDX
PHQW 0HHWWKHHQGFRQGLWLRQ <HV
.QRW
IUXLW 6LPXODWLRQSUHGLFWLRQJHWWKH
&XPXODWLYHUHGXFWLRQ <HV UHVXOW
3RVWHULRUHUURUWHVW )LQLVK
Figure 1. Structure of the ARMA-GM-GABP combined model.
3. Empirical Analysis
In this paper, we use the China Coastal Bulk Coal Freight Index from January 2014
to November 2019 as the sample. This work set the data from January 2014 to July 2019
as the training set and the data from August to October 2019 as the test set. The training
set contains 2038 data and the test set contains 61 data. Then, we use November 2019 data
as the forecast set to conduct a comparative analysis of forecast accuracy based on three
models, the ARMA model, GM model and ARMA-GM-GABP combination model.
3.1. Data Volatility Analysis
Figure 2 depicts the trend of CBCFI in the sample range. The figure shows that
the CBCFI data fluctuate greatly and there is a phenomenon of sharp rise and fall.
In addition, the data show obvious fluctuation clustering characteristics, the larger
changes are relatively concentrated in one period, while the smaller changes are relatively
concentrated in another period.
37
Electronics 2022, 11, 2732
&%&),
6KLSSLQJ,QGH[3RLQW
-$1
0$<
$8*
0$<
129
-$1
-81
$8*
0$5
2&7
'(&
0$5
-8/
6(3
'(&
)(%
$35
-8/
6(3
129
)(%
$35
-81
6(3
129
-$1
$35
-81
$8*
0$5
2&7
7LPH)UDPH'D\
Figure 2. Historical data of CBFI.
The large volatility of CBCFI data is mainly caused by comprehensive changes in
the shipping market’s capacity and turnover in different periods. Since 2014, the growth
rate of coal demand has slowed down, leading to oversupply in the charter market. The
overall trend of the domestic coastal coal shipping market is sluggish, and CBCFI continues
to bottom out. Coal transport prices remained low in 2015, shipping rates were able to
rebound sharply in May due to a significant reduction in coal imports and a significant
reduction in domestic coal prices. In December 2017, due to the accelerated pace of coal
reserves in power plants in winter and the obstacles to shipping capacity in the northern
region, shipping rates have jumped, reaching their highest value in recent years, which is
1706.2. The increase in hydropower squeezed coastal thermal power production in July
2019, prompting a reduction in coal consumption by high-energy-consuming enterprises,
making coal pulling less active, but then, affected by typhoons and a lack of capacity supply
in the market, supporting higher freight prices.
Table 1 shows the descriptive statistical characteristics of the mean, standard deviation,
kurtosis and JB statistic of the CBCFI data within the sample interval. The skewness is
1.046825 > 0, the kurtosis is 4.349061 > 3 and the probability p corresponding to the JB
statistic is 0, which shows that the data have a clear spike-right skew, a large deviation
from the normal distribution, and a spike and fall situation.
Table 1. Statistics characteristics of sample.
Parameter Eigenvalues
Mean 719.7643
Standard deviation 231.9314
Skewness 1.046825
Kurtosis 4.349061
JB statistics 371.9415
p value 0.000000
3.2. Predicting from ARMA Model
First, we establish the ARMA prediction model. It can be seen from Figure 2 that the
CBCFI data fluctuate greatly in the selected sample interval, and the changing trend shows
a non-stationary state. In order to eliminate the instability of the coal shipping index, we
choose the daily return rate of the index as the research object. The daily return rate of the
38
Electronics 2022, 11, 2732
index adopts the calculation formula of the logarithmic return rate, and the daily return
rate of CBCFI is expressed as:
RCBCFI = lnCBCFIt − lnCBCFIt−1 (5)
In the above formula, RCBCFI is the daily return on CBCFI after first order logarithmic
differencing, CBCFIt is the daily coal freight index corresponding to day t, and CBCFIt−1 is
the daily coal shipping index corresponding to day t − 1. After the first-order logarithmic
difference processing, the change trend of CBCFI’s daily return is shown in Figure 3.
5&%&),
6KLSSLQJ,QGH[3RLQW
-DQ
0DU
$SU
-XQ
$XJ
6HS
1RY
-DQ
0DU
0D\
-XO
$XJ
-DQ
0DU
0D\
-XO
$XJ
)HE
$SU
-XQ
-XO
6HS
1RY
)HE
$SU
-XQ
$XJ
6HS
1RY
-DQ
0DU
0D\
-XQ
$XJ
2FW
'HF
2FW
'HF
'HF
2FW
7LPH)UDPH'D\
Figure 3. Historical data of CBFI return series.
We use the ADF method to test whether RCBCFI is stationary. The T statistic is
−15.97711 less than the critical value of 1% of the significance level −2.566702. The
concomitant probability is 0.0000, indicating that the RCBCFI sequence does not have a
unit root and is a stationary sequence, which is suitable for constructing the ARMA forecast
model. By analyzing the statistical characteristics of the autocorrelation function and partial
autocorrelation function, we preliminarily determine that there are two preselected models,
ARMA (1,1) and ARMA (1,2).
Our work sequentially tests the two preselected models from the low level. It can
be seen from the comparison of model statistics and T test results in Table 2 that the
ARMA (1,2) model has passed the T test, and all indicators are overall better than the
ARMA (1,1). Therefore, the ARMA (1,2) model is determined as the optimal prediction
model. Then we perform an autocorrelation test on the estimated ARMA (1,2) model
residuals. It is found that the autocorrelation functions of the samples are all within the
95% confidence interval, and the corresponding probability p values of the Q statistic
are far greater than the test level of 0.05. Therefore, it is considered that there is no
autocorrelation in the residual sequence of the model ARMA (1,2) estimation results,
that is, the model construction is reasonable.
39
Electronics 2022, 11, 2732
Table 2. Parameter estimation results of ARMA model.
Preselected Model Variable Coefficient Standard Error t Value p Value R2 AIC Value SC Value
ARMA AR(1) 0.708 0.034 31.298 0.000
(1,1) MA(1) 0.389 0.041 13.056 0.000 0.708 −5.796 −5.788
AR(1) 0.632 0.033 18.396 0.000
ARMA
(1,2)
MA(1) 0.489 0.040 11.952 0.000 0.711 −5.801 −5.793
MA(2) 0.141 0.037 3.786 0.000
3.3. Predicting from GM Model
According to the modeling steps of the GM model, we first test the original CBCFI
sequence for extreme ratios. The test results find that the extreme ratios of the sequence
are included in the required range and meet the modeling requirements. Then we use
MATLAB software to write a program and train the model to obtain the GM (1,1) model
parameters a = 0.0393, μ = 758.8001. The model prediction formula is:
x (1) k+1 = −18605.2106e−0.0393k + 19307.8906 (6)
To test the prediction accuracy of the above model, we use the formula C = SS2 , S2 =
2 1
∑nk=1 xk (0) − x and S2 2 = n−
2
1
n
1
∑ n
1 k =2 ( ε ( k ) − ε ) to calculate the mean square error
ratio C of the model, where ε(k) is the difference between the original sequence and the
predicted sequence; ε is the average of the residual sequence ε(k); S1 and S2 are the standard
deviations of the original series and the residual series respectively. The calculation result
shows the mean squared error ratio C = 0.02097 < 0.35. Then we continue to use the
formula P = {|ε(k ) − ε| < 0.6745S1 } to calculate the probability of small error p = 1 > 0.95.
Finally, we refer to the gray prediction accuracy test grade standard table to know that the
above model has passed the test, which is the better model with level 1.
3.4. ARMA-GM-GABP Combined Model Prediction
According to the previous analysis, we use the BP neural network optimized by GA
to simulate the nonlinear function. The number of nodes in the input layer is 2 and the
number of nodes in the output layer is 1. In this paper, the number of hidden layer neurons
affects
√ the model fitting effect and calculation time. According to the empirical formula
h = m + n + α, the number of hidden layer neurons h is preliminarily determined, where
m is the number of input layer nodes, n is the number of output layer nodes and α is an
adjustment constant between 1–10. After calculation, it is found that h is between 2 and 11.
After investigating the effect of BP training with different hidden layers, we check the effect
for each BP prediction result with the test group data and calculate the difference between
the fitted value and the corresponding actual value. The results show that when the number
of neurons is 5, the fitting effect of the neural network is better and the calculation time is
shorter. Therefore, our work selects the 2-5-1 BP network prediction model. The activation
function of the hidden layer is the tansig function, and the activation function of the output
layer is the purelin function. The number of training times is 1000, and the error setting
is 0.0001.
GA uses real number coding. Based on Equation l = n1 × n2 + n2 × m + n2 + m, where
n1 is the number of neurons in the input layer, m is the number of neurons in the output
layer, and n2 is the number of neurons in the hidden layer, we can calculate the length of
each individual code l is 21.The initial population size of the experiment is 100. We select
the inverse of the BP neural network objective function as the fitness function. The selection
operation uses the roulette method, the crossover operation uses the two-point arithmetic
crossover method, the mutation operation uses the basic bit mutation method, and the
number of iterations is 600. Finally, the 2-5-1 BP neural network with the best fit is found
through iterative training and is used to predict the CBCFI values for November 2019.
40
Electronics 2022, 11, 2732
3.5. Analysis of the Predicting Results
Figure 4 shows the prediction results of the ARMA model, Figure 5 shows the GM
model prediction results and Figure 6 shows the prediction results of the combined model.
It can be seen from the prediction fitting that the prediction result of the ARMA model can
reflect the changing trend of the actual CBCFI value to a certain extent, but when the data
change greatly, a big error will occur. At the same time, after an error occurs, it takes at
least two units of time to correct it. For data with large fluctuations, the ARMA model will
cause the predicted data to be too big or too small. The prediction of the GM model shows
that it is suitable for approximating the prediction of exponential growth, so the prediction
value is credible under the premise of no large data fluctuations. Therefore, the GM model
is suitable for data prediction of wavelet motion. For data with large fluctuations, there
is a big error between the predicted results and actual values in most cases. Through the
ARMA-GM-GABP combined model, the trend of the predicted sequence is close to the
actual sequence, and the correction time after an error in the forecast is no more than 1
time unit. Compared with the ARMA model and the GM model, the prediction accuracy is
greatly improved.
Figure 4. Comparison between forecasting result of ARMA model and real value.
Figure 5. Comparison between forecasting result of GM model and real value.
41
Electronics 2022, 11, 2732
$FWXDO YDOXH
ᇎ䱵٬
$50$*0*$%3 PRGHO
$5,0$*0*$%3⁑ර
)UHLJKW,QGH[3RLQW
7LPH)UDPH'D\
Figure 6. Comparison between forecasting result of ARMA-GM-GABP model and real value.
In order to comprehensively assess the forecasting performance of the ARMA-GM-
GABP combined model, we use the following four indicators as the assessment criteria:
Mean Absolute Error (MAE), Root Mean Square Error (RMSE), Hill Inequality Coefficient
(TIC) and Absolute Error (AE). MAE is used to evaluate the predictive effect of the smooth
part of the CBCFI, RMES is used to evaluate the predictive effect of the high values in the
CBCFI, and TIC and AE are used to evaluate the predictive power of the model and the
degree of model fit. These four indicators are used to test the prediction accuracy of each
model. The lower these four values, the lower the prediction error. Compared to other
evaluation indicators, these four indicators can provide a more accurate assessment of the
model’s prediction of the high part, the smooth part and the overall trends of the CBCFI.
Therefore, it is very suitable to use these assessment indicators for evaluating the predictive
effectiveness of the volatile CBCFI. The calculation formula is as follows:
E AE = | x̂t − xt | (7)
1
n t∑
E MAE = | x̂t − xt | (8)
=N
∑ ( x̂t − xt )2
t= N
ERMSE = (9)
N
2
∑ ( x̂t − xt )
t= N
N
ETIC = (10)
∑ x̂t 2 ∑ xt 2
t= N
N + t= N
N
In the above formula: xˆt is the predicted value of CBCFI; xt is the actual value of
CBCFI; N is the data sample size.
The comparative analysis of predictive indicators of these three models ARMA, GM
and ARMA-GM-GABP is shown in Table 3 and Figure 7. The test results show that:
• The MAE of the combined ARMA-GM-GABP forecasting model is 5.8780, a decrease
of 44.16% compared to the ARMA model and 67.37% compared to the GM (1,1) model.
This suggests that the ARMA-GM-GABP model has improved the prediction of the
smooth part of the CBCFI series.
• The RMSE of the combined ARMA-GM-GABP forecasting model is 8.5889, a decrease
of 42.25% compared to the ARMA model and 60.1% compared to the GM (1,1) model.
42
Electronics 2022, 11, 2732
It shows that the prediction accuracy of the high-value part of the model is then
significantly improved.
• The combined ARMA-GM-GABP forecasting model has improved the predictive
ability and fits of the CBCFI with a TIC of 0.0053, a decrease of 42.4% compared to
the ARMA model and 60.15% compared to the GM (1,1) model. It shows that the
combined ARMA-GM-GABP forecasting model has better forecasting ability compared
to other models.
• From Figure 7, we can find that the AE curve of the combined model is the lowest in
the vast majority of cases. There are only four instances where it is not the lowest and
will correct to be the lowest within a unit of time.
Table 3. Forecasting index of three models.
Predictive Model EMAE ERMSE ETIC
ARMA 10.5260 14.8729 0.0092
GM 18.0132 21.5242 0.0133
Combined 5.8780 8.5889 0.0053
Figure 7. EAE of three prediction models.
All of the above suggests that the ARMA-GM-GABP combined model is more suitable
for CBCFI forecasting than the ARMA model and the GM (1,1) model.
4. Conclusions
In this paper, we select CBCFI as the research object. First of all, our work uses ARMA
model prediction. ARMA model is the most commonly used model to deal with time series.
By fitting the linear characteristics of the time series, it can often get good results. However,
for the CBCFI, which is a noisy and non-smooth series, the linear analysis alone does not
give a good result. Second, we use the GM (1,1) model, which is the most widely used
grey dynamic prediction model in grey system theory. Only a few prediction values of
this model have relatively small errors, but the other prediction values can only reflect
the growth trend of the data series to a certain extent, and the prediction accuracy is
relatively low.
In response to the large fluctuations in the CBCFI, which contains noise and the series
itself is non-linear and non-stationary. This paper establishes a combined ARMA-GM-
GABP forecasting model to forecast the CBCFI. The empirical analysis results show that the
43
Electronics 2022, 11, 2732
ARMA-GM-GABP combined model has the following advantages compared to traditional
forecasting models:
• Effective capture of trend information.
• ARMA model can capture the periodicity and trend information of the original data
series well. Therefore, using the predicted data from the ARMA model as input to
the GABP model allows the combined model to more accurately predict trends of the
CBCFI.
• Noise reduction.
• The GM (1,1) model allows for effective noise reduction of the original CBCFI series,
providing stable input data for the GA-BP prediction model.
• Better prediction and accuracy.
• Compare to the ARMA model and GM (1,1) model, the MAE and RMESE of the
combined ARMA-GM-GABP forecasting model decreased by 67.37% and 60.09%,
respectively. Its prediction error is significantly smaller than that of the ARMA model
and GM (1,1) model.
• General predictive applicability.
• The combined ARMA-GM-GABP forecasting model is constructed based on the CBCFI
series in the years since 2014. Due to the extreme volatility of CBCFI over this time
period, the ARMA-GM-GABP combined forecasting model is trained to have general
predictive applicability to CBCFI over different time periods.
Above all, the ARMA-GM-GABP combined model can make up for the deficiency of
the single prediction models. It has good modeling and prediction advantages for dealing
with the original modeling data with volatility, periodicity and trend, so the model has good
prediction performance. The ARMA-GM-GABP combined model provides scientifically
accurate forecasts of the CBCFI, which can support the government and relevant depart-
ments in better macroeconomic regulation and control and enable relevant enterprises and
participants in the coastal shipping market to better obtain market information and grasp
market dynamics. The areas for improvement of the combined forecasting model include:
(1) Optimization of single-term models ARMA and GM; (2) Considering the selection of
models with better forecasting effects as single-term forecasting models. In the future, as
our research progresses, we will try to improve the combined model and extend it to other
shipping indices, in order to further verify the validity and practicality of the model in
practical applications, and provide support for shipping market operators and investors to
better grasp market trends and formulate strategies.
Author Contributions: Conceptualization, W.P. and L.W.; methodology, Z.L.; software, W.P. and L.W.
and Y.F.; validation, W.P. and L.W.; formal analysis, X.W.; investigation, X.W. and Y.F.; resources, Z.L.;
data curation, X.W and W.P.; writing—original draft preparation, W.P. and L.W.; writing—review and
editing, Z.L. and R.F.; project administration, Y.F. All authors have read and agreed to the published
version of the manuscript.
Funding: This work was funded by the National Natural Science Foundation of China under Grant
71801028, the Social Science Planning Fund of Liaoning Province Grant L18CTQ004, and China
Postdoctoral Science Foundation Grant 2015M571292.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: The data presented in this study are available upon request.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Tan, H.; Yang, J. An Empirical Analysis of the Correlation between China’s Coastal and Yangtze River Coal Freight Price Volatility
Based on VAR. J. Wuhan Univ. Technol. 2021, 45, 161–165.
2. Wang, S.; Chen, J.; Yu, S. China’s coastal and international dry bulk freight rates linkage. China Navig. 2016, 39, 114–118.
44
Electronics 2022, 11, 2732
3. Liu, C.; Liu, J.; Yang, J. Evaluation of Volatility of Coastal Coal Freight Index Based on ARCH Family Models. J. Wuhan Univ.
Technol. 2012, 3, 445–449.
4. Xiao, W.; Xu, C.; Liu, A. Hybrid LSTM-Based Ensemble Learning Approach for China Coastal Bulk Coal Freight Index Prediction.
J. Adv. Transp. 2021, 2021, 5573650. [CrossRef]
5. Wang, S. Analyzing the Influence of Each Influencing Factor on the Freight Rate of Coastal Coal Based on Analytic Hierarchy
Process. Int. Core J. Eng. 2020, 6, 256–261.
6. Chen, Y. Forecasting Baltic dry index with unequal-interval grey wave forecasting model. J. Dalian Marit. Univ. 2015, 41, 96–101.
7. Liang, W.; Lu, C. Export Containerized Freight Index Estimation Model Based on Neural Network. Comput. Simul. 2013, 30,
421–425.
8. Lian, Y. Crude Oil Tanker Freight Rate Forecasting Based on ARMA and Artificial Neural Network; Shanghai Jiao Tong University:
Shanghai, China, 2015.
9. Yuan, Y.; Wang, B. Forecast on highway logistics freight price index of China by ARIMA model. Math. Pract. Theory 2017, 47,
52–57.
10. Zhou, Y.; Yang, J. A study on the fluctuation characteristics of China’s coastal container shipping index. J. Wuhan Univ. Technol.
2022, 44, 32–39.
11. Adland, R.; Cullinane, K. The nonlinear dynamics of spot freight rates in tanker markets. Transp. Res. Part E Logist. Transp. Rev.
2006, 42, 211–224. [CrossRef]
12. Shan, F. China Export Container Freight Index Forecast Based on Wavelet Analysis and ARIMA Model. Master’s thesis, Dalian
Maritime University, Dalian, China, 2013.
13. Li, C. Price Forecasting Analysis of BP Neural Network Based on Improved Genetic Algorithm. Comput. Technol. Dev. 2018, 28,
144–151.
14. Wang, Y. Analysis and Forecast of Stock Price Based on ARMA Model. Product. Res. 2021, 09, 124–127.
15. Xu, D.; Zhou, C.; Guan, C. Prediction method of equipment failure rate based on ARMA-BP combined model. Agriculture 2022,
12, 793.
16. Wu, D.; Wu, C. Research on the Time-Dependent Split Delivery Green Vehicle Routing Problem for Fresh Agricultural Products
with Multiple Time Windows. Agriculture 2022, 12, 793. [CrossRef]
17. Xu, Y.; Chen, X. Comparison of Seasonal ARIMA Model and LSTM Neural Network Forecast. Stat. Decis. 2021, 37, 46–50.
18. Liu, Z.; Ding, Y.; Yan, J. Frequency prediction of SVR-ARMA combined model based on particle swarm optimization. Vib. Test.
Diagn. 2020, 40, 374–380.
19. Wang, H. Multi-objective optimization design of ARMA control chart considering both efficiency and cost. Oper. Res. Manag.
2021, 30, 80–86.
20. Chen, H.Y.; Miao, F.; Chen, Y.J.; Xiong, Y.J.; Chen, T.A. Hyperspectral image classification method using multifeature vectors and
optimized KELM. IEEE J. Sel. Top. Appl. Earth Obs. Remote Sens. 2021, 14, 2781–2795. [CrossRef]
21. Gao, C.; Kong, X.; Shen, X. Evaluation of Frost Resistance of Stress-damaged Lightweight Aggregate Concrete Based on GM (1,1).
Eng. Sci. Technol. 2021, 53, 184–190.
22. Wang, H.; Jing, W.; Zhao, G. Fatigue life prediction of hydraulic support base based on gray system model GM (1, 1) improved
Miner criterion. J. Shanghai Jiao Tong Univ. 2020, 54, 106–110.
23. Kang, C.; Gong, L.; Wang, Z. Predicting the deterioration of hydraulic concrete by using grey residual GM (1,1)-Markov model. J.
Water Resour. Water Transp. Eng. 2021, 1, 95–103.
24. Zhou, X.B.; Ma, H.J.; Gu, J.G.; Chen, H.L.; Deng, W. Parameter adaptation-based ant colony optimization with dynamic hybrid
mechanism. Eng. Appl. Intell. 2022, 114, 105139. [CrossRef]
25. Qian, K.; Hou, Z.; Sun, D. Sound Quality Estimation of Electric Vehicles Based on GA-BP Artificial Neural Networks. Appl. Sci.
2020, 10, 5567. [CrossRef]
26. Wu, D.; Hong, N.; Yi, L.; Hui, C.; Hui, Z. An adaptive different evolution algorithm based on belief space and generalized
opposition=based learning for resource allocation. Appl. Soft Comput. 2022, 127, 1568–4946.
27. Chen, Y.; Hu, Y.; Zhang, S.; Mei, X.; Shi, Q. Optimized Erosion Prediction with MAGA Algorithm Based on BP Neural Network
for Submerged Low-Pressure Water Jet. Appl. Sci. 2020, 10, 2926. [CrossRef]
28. Zhang, G.; Zheng, Y.; Liao, K. Research on Ink Color Matching Based on GABP Algorithm. J. Xi’an Univ. Technol. 2019, 35,
113–119.
29. Yao, R.; Guo, C.; Deng, W.; Zhao, H.M. A novel mathematical morphology spectrum entropy based on scale-adaptive techniques.
ISA Trans. 2022, 126, 691–702. [CrossRef]
30. Yu, Q.; Zhang, Z.; Qu, Y. Prediction of Lost Load of Power Grid Blackout Based on ARMA-GABP Combined Model. China Power
2018, 51, 38–44.
45
electronics
Article
CEEMD-MultiRocket: Integrating CEEMD with Improved
MultiRocket for Time Series Classification
Panjie Wang, Jiang Wu, Yuan Wei and Taiyong Li ∗
School of Computing and Artificial Intelligence, Southwestern University of Finance and Economics,
Chengdu 611130, China
* Correspondence: [email protected]
Abstract: Time series classification (TSC) is always a very important research topic in many real-
world application domains. MultiRocket has been shown to be an efficient approach for TSC, by
adding multiple pooling operators and a first-order difference transformation. To classify time
series with higher accuracy, this study proposes a hybrid ensemble learning algorithm combining
Complementary Ensemble Empirical Mode Decomposition (CEEMD) with improved MultiRocket,
namely CEEMD-MultiRocket. Firstly, we utilize the decomposition method CEEMD to decompose
raw time series into three sub-series: two Intrinsic Mode Functions (IMFs) and one residue. Then, the
selection of these decomposed sub-series is executed on the known training set by comparing the
classification accuracy of each IMF with that of raw time series using a given threshold. Finally, we
optimize convolution kernels and pooling operators, and apply our improved MultiRocket to the
raw time series, the selected decomposed sub-series and the first-order difference of the raw time
series to generate the final classification results. Experiments were conducted on 109 datasets from
the UCR time series repository to assess the classification performance of our CEEMD-MultiRocket.
The extensive experimental results demonstrate that our CEEMD-MultiRocket has the second-best
average rank on classification accuracy against a spread of the state-of-the-art (SOTA) TSC models.
Specifically, CEEMD-MultiRocket is significantly more accurate than MultiRocket even though it
Citation: Wang, P.; Wu, J.; Wei, Y.; Li, requires a relatively long time, and is competitive with the currently most accurate model, HIVE-
T. CEEMD-MultiRocket: Integrating COTE 2.0, only with 1.4% of the computing load of the latter.
CEEMD with Improved MultiRocket
for Time Series Classification Keywords: time series classification; complementary ensemble empirical mode decomposition
CEEMD-MultiRocket: Integrating (CEEMD); MultiRocket; feature selection; hybrid model
CEEMD with Improved MultiRocket
for Time Series Classification.
Electronics 2023, 12, 1188. https://
doi.org/10.3390/electronics12051188 1. Introduction
Academic Editor: Daniel A time series is a set of data arranged in chronological order, which is widely applied
Gutiérrez Reina in different domains in real life. With the fast advancement of information acquisition
equipments and improvement of acquisition methods, time series have gotten more so-
Received: 30 January 2023
phisticated, and their application involves a wide variety of fields, such as traffic [1],
Revised: 23 February 2023
Accepted: 28 February 2023
energy [2,3], finance [4], medical diagnosis [5–7] and social media [8]. By classifying time
Published: 1 March 2023
series into groups based on their underlying stochastic process, we can gain insights into the
underlying phenomenon being measured and potentially make predictions. This involves
identifying features in the time series data that are indicative of the underlying process,
such as the autocorrelation structure, the distribution of values, or the frequency spectrum.
Copyright: © 2023 by the authors. Therefore, time series classification (TSC), as a task of characterizing a series of values
Licensee MDPI, Basel, Switzerland. observed at a continuous time as belonging to one of two or more categories, has always
This article is an open access article been the focus of research [9].
distributed under the terms and Several TSC algorithms have been presented over the years. These algorithms are
conditions of the Creative Commons
generally separated into traditional approaches and deep learning approaches. The main
Attribution (CC BY) license (https://
groups of traditional TSC algorithms are introduced as follows: (1) Distance-based classi-
creativecommons.org/licenses/by/
fiers use distance metrics to determine class membership, and their representatives include
4.0/).
Electronics 2023, 12, 1188. https://doi.org/10.3390/electronics12051188 https://www.mdpi.com/journal/electronics
47
Electronics 2023, 12, 1188
a combination of K-Nearest Neighbors (KNN) and Dynamic Time Warping (DTW) [10] and
Proximity Forest [11]. (2) Frequency-based classifiers are based on frequency data extracted
from time series, and their representative is Random Interval Spectral Ensemble (RISE) [12],
which is viewed as a popular Time Series Forest (TSF) [13] variation. (3) Interval-based
classifiers rely their classification on information contained in distinct series intervals, and
their representatives include TSF and Diverse representation Canonical Internal Forest
(DrCIF) [14]. DrCIF builds on RISE and TSF, and uses the catch22 [15] to expand the
original features. (4) Dictionary-based classifiers first convert discrete “words” from real-
valued time series. The distribution of the retrieved symbolic terms is used as the basis
for classification. Their representatives include Bag of Symbolic-Fourier-Approximation
Symbols (BOSS) [16] and Temporal Dictionary Ensemble (TDE) [17]. (5) Shapelets are
short subsequences of time series that are typical of their class. It is possible to utilize
them to discover the similarity between two time series belonging to the same class [18].
Their representatives include Shapelet Transformation (ST) [19] and Shapelet Transform
Classifier (STC) [20].
An ensemble classifier is a meta ensemble based on the previously described classifiers,
and the typical representatives include HIVE-COTE [21], HIVE-COTE 2.0 [22], Inception-
Time [23] and Time Series Combination of Heterogeneous and Integrated Embedding
Forest (TS-CHIEF) [24]. HIVE-COTE 2.0 is a meta ensemble consisting of four components:
STC, TDE, DrCIF and Arsenal [22]. InceptionTime is a collection of five TSC deep learning
models generated by cascading numerous inception modules [23]. Each model has the
same design but distinct random initialization weight values. TS-CHIEF builds on an en-
semble tree-structured classifier that incorporates the most efficient time series embeddings
created in the previous ten years of study [24].
On the other hand, deep learning methods for TSC are generally classified into two
types: generative models and discriminative models [25].
The most common generative models include Stacked Denoising Auto-Encoders
(SDAE) [26,27] and Echo State Networks (ESN) [28]. To model the time series, SDAE is
preceded by an unsupervised pre-training stage [26,27]. As Recurrent Neural Networks
(RNN) frequently experience the vanishing gradient problem as a result of training on
lengthy time series [29], ESNs were created to ameliorate the difficulties of RNNs [30].
Discriminative models are classifiers that can quickly figure out how to transfer a time
series’ original input to a dataset’s output, which is a probability distribution over the
class variables. These models may be further classified into two types: (1) deep learning
models using hand-engineered features and (2) end-to-end deep learning models [30].
The translation of series into images utilizing specialized imaging approaches is the most
common feature extraction algorithm for hand-engineered approaches, such as recurrence
plots [31,32] and Gramian fields [33]. In contrast, end-to-end deep learning tries to include
the feature learning procedure while optimizing the discriminative classifier [34]. Convolu-
tional Neural Networks (CNN) are the most extensively used for the TSC issue due to their
robustness and training efficiency [30].
Overall, the state-of-the-art (SOTA) TSC models in terms of classification accuracy
mainly include HIVE-COTE and its variants, TS-CHIEF, InceptionTime, Rocket, MiniRocket,
MultiRocket, etc. [35]. Among them, Rocket, MiniRocket, and MultiRocket are not only
accurate, but also ensure scalability. Rocket employs lots of randomly initialized convo-
lution kernels for feature extraction, and uses a linear classifier for classification, without
training the kernels [36]. MiniRocket is about 75 times faster than Rocket, and it employs
a limited number of kernels and just one pooling operation [37]. MultiRocket is built on
MiniRocket and uses the same set of convolution kernels that are used in MiniRocket [35].
MultiRocket differs in two ways from MiniRocket. On one hand, MultiRocket uses the
first-order difference of raw time series, along with the raw time series, as the inputs to the
classification model. On the other hand, MultiRocket includes three extra pooling operators
in addition to PPV to derive more discriminative features.
48
Electronics 2023, 12, 1188
Although Rocket and its improved versions MiniRocket and MultiRocket have achieved
satisfactory classification performance, there is certainly room for improvement in series
transform, the design of convolution kernels and feature extraction. To solve the exist-
ing defects and enhance classification performance, this study proposes a novel hybrid
ensemble leaning model incorporating Complementary Ensemble Empirical Mode Decom-
position (CEEMD) and improved MultiRocket, namely CEEMD-MultiRocket, to enhance
the classification performance of time series. Raw time series is firstly divided into three
sub-series utilizing CEEMD [38–40]. The sub-series refer to the individual Intrinsic Mode
Functions (IMFs) that make up the decomposition of the raw time series into its oscillatory
components. Since the decomposition is performed using a sifting process that extracts
the highest frequency component first and continues with lower frequency components
until the residual is obtained, these three sub-series represent high-, medium- and low-
frequency portions of the original time series, respectively. Since not every decomposed
sub-series as the input has a positive contribution to the performance of the classification
model, the selection of the more crucial sub-series and pruning the redundant and less
important ones are necessary to enhance the final classification performance and reduce
computational complexity. The selection of these decomposed sub-series is executed on
the known training set by comparing the classification accuracy of each sub-series with
that of the raw time series using a given threshold. Finally, we improve the original
MultiRocket and apply it to the raw time series and the selected decomposed sub-series
to derive features and generate the final classification results. In improved MultiRocket,
the convolution kernels are modified, and one additional pooling operator is applied to
convolution outputs. CEEMD-MultiRocket has been empirically tested with 109 datasets
from the UCR time series repository. Compared with some SOTA classification models,
the experiments demonstrate that our proposed CEEMD-MultiRocket achieves promis-
ing classification performance. Specifically, our proposed CEEMD-MultiRocket is more
accurate than MultiRocket even though it takes a relatively long time, and is competitive
with the HIVE-COTE 2.0 which ranks the best at present in terms of classification accuracy,
only with a small fraction of the training time of the latter. One of the main theoretical
and technical implications of CEEMD-MultiRocket is that it is the first time that CEEMD
has been integrated with convolution kernel transform for the feature extraction of time
series, making it outperform almost all of the previous SOTA methods. Furthermore,
CEEMD-MultiRocket improves convolution kernel and pooling operator design and is
demonstrated to be a fast, effective and scalable method for time series classification tasks,
showing that the optimization of convolution kernels and pooling operator is a promising
field worth studying for improving classification performance. The main contributions of
this research lie in five aspects:
(1) A novel hybrid TSC model that integrates CEEMD and improved MultiRocket is
proposed. Raw time series is decomposed into high-, medium- and low-frequency
portions, and convolution kernel transform is utilized to derive features from the
raw time series, the decomposed sub-series and the first-order difference of raw time
series. This kind of transformation is able to obtain more detailed and discriminative
information of time series from various aspects.
(2) A sub-series selection method is proposed based on the whole known training data.
This method selects the more crucial sub-series and prunes the redundant and less
important ones, which helps to further enhance classification performance and also
reduce computational complexity.
(3) The length and number of convolution kernels are modified, and one additional
pooling operator is applied to convolutional outputs in our improved MultiRocket.
These improvements contribute to the enhancement of classification accuracy.
(4) Extensive experiments demonstrate that the proposed classification algorithm is more
accurate than most SOTA algorithms for TSC.
49
Electronics 2023, 12, 1188
(5) We further analyze some characteristics of the proposed CEEMD-MultiRocket for TSC,
including the CEEMD parameter settings, the selection of decomposed sub-series, the
design of convolution kernel and pooling operators.
The rest of this paper is organized as follows. Section 2 briefly introduces CEEMD
and MultiRocket. Section 3 gives the description of the proposed CEEMD-MultiRocket
algorithm in detail, including CEEMD and sub-series selection, improved MultiRocket
and feature extraction. Section 4 reports experimental results and assesses the proposed
algorithm in terms of accuracy and training time. Section 5 discusses the impact of the
CEEMD parameters, the threshold setting for sub-series selection, the convolution kernel
length and an additional pooling operator on the classification performance of CEEMD-
MultiRocket, followed by conclusions in Section 6.
2. Related Works
2.1. Complementary Ensemble Empirical Mode Decomposition
CEEMD [38] is an extension built on Ensemble Empirical Mode Decomposition
(EEMD) [41] and Empirical Mode Decomposition (EMD) [42]. EMD is a time-frequency
analysis approach which is created for nonlinear and nonstationary signals or time
series [43]. EMD applies local extreme points of the raw time series to form the enve-
lope step by step, separates fluctuations or trends at diverse scales and generates a group
of relatively stable components, including IMFs and one residue. Specifically, the EMD
algorithm involves iteratively extracting local oscillations from the signal by means of a
sifting process. The extracted oscillations are called IMFs, and they represent the underly-
ing oscillatory modes that make up the signal. The remaining signal after extracting the
IMFs is called the residue, which contains the trends and other non-oscillatory components.
The main disadvantage of mode mixing in EMD is that the significantly diverse scales may
appear in the same IMF component [44]. To reduce mode mixing, EEMD was proposed [41].
In EEMD, IMFs are defined as a combination of time series and white noise with a limited
amplitude, which can significantly reduce mode mixing. Despite the fact that EEMD has
effectively handled the mode mixing problem, the residual noise in signal reconstruction
has increased. Therefore, CEEMD was proposed, where a specific type of white noise was
introduced at each stage of the decomposition [45]. It not only suppresses the mode mixing
but also reduces the reconstruction signal errors caused by residue noise. The CEEMD is
described as follows:
(1) Add two equal-amplitude, opposite-phase white noises to the signal x (t), to obtain
the following sequences.
Pi (t) = x (t) + ni (t)
(1)
Ni (t) = x (t) − ni (t)
where ni (t) is the white noise superimposed in the ith stage, Pi (t) and Ni (t) denote
the sequence after adding noise in the ith stage .
(2) CEEMD firstly breaks down the sequence’s noise to generate the components I MF,
C1j and the trend surplus r1 .
(3) In the same way, process the white noise with opposing symbols in step (1) to generate
the components C−1j and r−1 .
(4) Repeat steps (1)∼(3) n times to obtain n sets.
(5) The ultimate result is chosen as the average of the components of two sets of residual
positive and negative white noise acquired by repeated decomposition, i.e.,
Ci (t) = 2n
1
∑nj=1 (Cn j + C−n j )
(2)
rn (t) = 2n ∑nj=1 (r j + r− j )
1
50
Electronics 2023, 12, 1188
2.2. MultiRocket
Rocket employs lots of randomly initialized convolution kernels for transform, applies
pooling operators to convolutional outputs and uses a linear classifier, without training the
kernels [36]. For Rocket, a time series is convolved using 10 k random convolution kernels,
whose weights are sampled from N (−1, 1); length is selected from {7, 9, 11} with equal
probability; padding is alternating; dilation is exponentially scaled; and bias is sampled
from U (−1, 1). Additionally, the Proportion of Positive Values (PPV) and global max
pooling (Max) pooling operators are applied to each convolutional output to generate two
features, and to generate 20 K features in total for each input series. Finally, for a larger
dataset, the derived features are employed to train a logistic regression classifier, while for
a relatively small dataset, a ridge regression classifier is trained. Rocket has been proved to
be a efficient, fast and novel algorithm for the feature extraction of time series [36].
MiniRocket is built on Rocket and becomes further deterministic by pre-defining a set
of convolution kernels with fixed lengths and weights. MiniRocket retains the dilation and
PPV, while it discards the max pooling which is of no benefit for enhancing the classification
accuracy [37]. It performs a convolution operation on the input series using a fixed group
of 84 kernels with each kernel generating multi-dilation (74 by default) and using different
bias which are obtained by sampling on the convolutional output from a randomly selected
instance in the training set. Since only PPV is used in MiniRocket, the number of features
(84 × 119 = 9996 by default) generated by MiniRocket is only about half of the number of
features generated by Rocket.
The kernels used in MultiRocket are the same as MiniRocket. Unlike MiniRocket,
MultiRocket injects the diversity of features by adding the first-order difference of raw
time series and three additional pool operators to enhance the performance of MiniRocket.
Inspired by DrCIF, MultiRocket uses the first-order difference of raw time series as the
input to offer more diverse information related to the transformation of raw time series.
MultiRocket has 84 fixed convolution kernels and each convolutional kernel will produce
74 kinds of dilation. Firstly, MultiRocket performs a convolution operation on the input
series and the first-order difference of the input series using the kernels with dilations
to obtain the convolutional outputs. Next, four features (PPV and an additional three
pooling operators) are calculated for each convolutional output and then about 50 k (more
accurately, 84 × 74 × 2 × 4 = 49,728) features are generated. Finally, a linear regression
classifier is trained on the features. MultiRocket is faster than all TSC algorithms (except for
MiniRocket) and more accurate than all TSC algorithms (except for HIVE-COTE 2.0) [35].
In summary, Rocket, MiniRocket and MultiRocket are representations of the scalable
and most accurate algorithms on the UCR time series repository. As a series of algorithms,
their differences can be seen in Table 1.
Table 1. Summary of changes from Rocket to MiniRocket and then to MultiRocket.
Rocket MiniRocket MultiRocket
kernel length 7, 9, 11 9 9
weights N (0, 1) −1, 2 −1, 2
bias U (−1, 1) from convolutional
output from convolutional
output
dilation random fixed (range 20 , · · · , 2max ) fixed (range 20 , · · · , 2max )
padding random fixed fixed
pooling operators PPV, MAX PPV PPV, MPV, MIPV, LSPV
num. features 20 K 10 K 50 K
3. The Proposed CEEMD-MultiRocket
This research proposes a hybrid ensemble model that combines CEEMD and improved
MultiRocket, termed CEEMD-MultiRocket, for TSC. The proposed model includes three
steps which are decomposition, sub-series selection and feature extraction and classification,
as demonstrated in Figure 1.
Step 1: Decomposition. Each time series in a dataset is decomposed into three sub-
series using CEEMD: I MFi (i = 1, 2) and one residual.
51
Electronics 2023, 12, 1188
Step 2: Sub-series selection. In order to enhance the final classification accuracy and
decrease computational load, the selection of these decomposed sub-series is executed
on the whole known training dataset by comparing the classification accuracy of each
decomposed sub-series with that of the raw time series using a pre-set threshold.
Step 3: Feature extraction and classification.The convolution kernel transform is
applied to the raw time series, the selected sub-series and the first-order difference of raw
series. Then, five pooling operators are designed to extract features from the convolutional
output. Finally, a ridge regression classifier is trained using these extracted features. In our
improved MultiRocket, the length and number of convolution kernels are modified, and
one additional pooling operator is applied to the convolutional output.
Figure 1. The flowchart of the proposed CEEMD-MultiRocket.
Firstly, the proposed CEEMD-MultiRocket applies CEEMD to decompose raw time
series into three sub-series (two IMFs and one residue), each of which contains information
about the different frequency of raw time series. In general, the first and second IMF
represent the high- and medium-frequency portions and the residue represents the low-
frequency portion of raw time series. Secondly, in order to enhance the final classification
performance and decrease computational complexity, it is necessary to select the most
crucial sub-series and discard less important ones. The selection of these sub-series is
executed on the whole known training set which is further subdivided into training and
testing sets using stratified sampling. Improved MultiRocket is used for the raw time series
and each sub-series on the newly generated training and testing sets, and the appropriate
sub-series is selected when its testing accuracy is higher than a given threshold, which is
set to a percentage of the testing accuracy of raw time series. Finally, convolution operation
52
Electronics 2023, 12, 1188
is performed on the raw time series, the selected sub-series and the first-order difference of
raw time series, respectively. It should be specially noted that the transform is only applied
to the raw time series and its first-order difference when there is a dataset without any
selected sub-series. Feature extraction is conducted on each convolutional output, and these
extracted features are eventually applied to train a ridge regression classifier. In improved
MultiRocket, the length and number of convolution kernels are modified, and five pooling
operators are used in each convolutional output to derive features. The combination of these
modifications has the potential to enhance the classification performance of MultiRocket.
Overall, this hybrid ensemble learning paradigm, CEEMD-MultiRocket, can diversify the
input series and comprehensively extract more extensive features from the raw series
and the decomposed sub-series for classification, which makes it possible to enhance
classification performance.
3.1. CEEMD and Sub-Series Selection
The CEEMD algorithm is usually applied in the field of signal processing, which
decomposes raw time series into several components to obtain better classification perfor-
mance [46]. The proposed CEEMD-MultiRocket firstly uses the CEEMD decomposition
algorithm to decompose raw time series into two IMFs and a residue. Figure 2 illustrates a
decomposition of a time series from the electricity consumption dataset ScreenType from
the UCR repository [47] using CEEMD. The length of each series in the ScreenType dataset
is 720 (24 h of readings taken every 2 min). The x-axis represents the time (every 2 min)
and the y-axis represents the electricity consumption in Figure 2.
Figure 2. A raw time series and its corresponding sub-series decomposed by CEEMD in the Screen-
Type dataset.
It is a challenging issue to select the appropriate sub-series for extracting discriminative
characteristics of the raw time series for time series analysis correctly [48]. To select the
appropriate sub-series (two IMFs or one residue) as the inputs to our classification model,
we propose a novel approach to select the appropriate sub-series generated by CEEMD
using the known training data. The main idea is to subdivide the original training dataset
into two parts including a new training dataset and a new testing dataset, then train a
classification model using improved MultiRocket and obtain the testing accuracy, and
finally select the sub-series with satisfactory testing accuracies. This kind of selection
53
Electronics 2023, 12, 1188
approach is based on the inference that the sub-series with relatively high testing accuracy
may contain more potentially useful characteristics as the input to improve MultiRocket.
The decomposition and sub-series selection are described as follows:
(1) Utilize CEEMD to decompose raw time series into two IMFs and a residue. For
convenience, we refer to three of them as IMFs.
(2) Perform stratified sampling to subdivide the original training set and its correspond-
ing three IMFs into new training sets and testing sets, respectively, and ensure that
the new training and testing sets contain all labels (the split ratio is 1:1).
(3) Apply improved MultiRocket to the newly generated training set of original training
time series, and then obtain the testing classification accuracy accoriginal on the newly
generated testing set. Perform the corresponding operations for each IMF and obtain
the testing classification accuracy acci , i = 1, 2, 3.
(4) Select the IMFs whose testing accuracies acci are more than accoriginal × threshold as the
inputs of improved MultiRocket. We refer to the selected IMFs as I MFs∗ throughout
the paper, which may contain 0–3 sub-series generated by CEEMD. The threshold is
set to 0.9 by default.
By comparing the testing accuracy of each sub-series with that of raw time series, we
can select the most crucial sub-series and discard the redundant and less important ones
as the inputs to classification model, thereby enhancing classification performance and
reducing computational cost.
3.2. Improved MultiRocket
This section provides a comprehensive explanation of improved MultiRocket which
retains the basic architecture as the original MultiRocket [35]. The main difference between
the improved MultiRocket and the original MultiRocket lies in two aspects. The first
is the modification of convolution kernel length, and the second involves an addition
pooling operator for feature extraction. We expect that these modifications are able to
significantly enhance classification ability. The comparison of original MultiRocket and
improved MultiRocket is listed in Table 2.
Table 2. Comparison of MultiRocket and improved MultiRocket.
MultiRocket Improved MultiRocket
kernel length 9 6
num. kernels 84 15
weights −1, 2 −1, 2
bias from convolutional
output from convolutional
output
dilation fixed (range 20 , · · · , 2max ) fixed (range 20 , · · · , 2max )
padding fixed fixed
pooling operators PPV, MPV, MIPV, LSPV PPV, MPV, MIPV, LSPV, NSPV
num. features 50 K 50 K
3.2.1. Convolution Kernels
Improved MultiRocket employs 15 fixed convolution kernels with length 6 and has
fixed weights. Except for the length of convolution kernel, the dilation, the padding and
bias of the improved MultiRocket are the same as those of MultiRocket. The detailed kernel
design, dilation, bias and padding are described as follows.
• Kernel length and weight setting: To simplify the computation complexity as much
as possible, the number of convolution kernels ought to be as small as possible [37].
Therefore, our proposed CEEMD-MultiRocket tries to employ 15 convolution kernels
with length 6 instead of the 84 kernels with length 9 in the original MultiRocket.
The convolution kernel weights are restricted to two values, α and β, and there are
26 = 64 possible dual-valued kernels with a length of 6. Improved MultiRocket
employs the subset of convolution kernels that have two values of β, and this provides
a total of C62 = 15 fixed kernels, which strikes a good balance between computing
54
Electronics 2023, 12, 1188
efficiency and classification accuracy. In the improved MultiRocket, we set the weight
α = −1 and β = 2. As long as α and β increase by multiples, equivalently, that is
β = −2α, it has no effect on the results, because bias and features are extracted
from the output of convolution [37]. Since the original MultiRocket uses 84 kernels
with length 9, the number of kernels used in our improved MultiRocket is less than
a fifth of the number of kernels in the original MultiRocket, effectively decreasing
computing load.
• Dilation: The dilations used by each kernel are the same and fixed. The total number
of dilations of each kernel n depends on the number of features, where n = f /3/15
and f represent
the totalnumber of features (50 k by default). Dilations are specified in
range 20 , . . . , 2max , where the exponent obeys a uniform distribution between
l −1
0 and max = min ( l input −1 , 64), where lkernel is the length of the kernel and linput is the
kernel
length of input time series.
• Bias: Bias values are determined by the convolutional outputs for each kernel/dilation
combination. For a kernel/dilation combination, we randomly select a training
example and calculate its convolutional output, then sample from the convolutional
output based on many quantiles to obtain bias, in which the quantiles are drawn from
a low-discrepancy sequence.
• Padding: Each combination of kernel and dilation alternates between using and not
using padding, with half of the combinations using padding.
We refer to the feature vector extracted by the convolution operation as Z and the
length of the input time series as l. According to [36], the result of applying a kernel to a
time series, X, from index i in X can be obtained using Equation (3):
lkernel −1
Z = Xi × w = b + ( ∑ Xi+( j×d) × w j ) (3)
j =0
where ω is weights, d is dilation and b is bias of the kernel.
3.2.2. Pooling Operators
MultiRocket injects diversity through two main aspects: the first-order difference of
raw time series and an additional three pooling operators. In order to enhance the diversity
of derived features, we propose an additional pooling operator, Number of Stretch of
Positive Values (NSPV), to extract more comprehensive features from the convolutional
output. Thus, we employ five pooling operators together to derive features, including the
four existing pooling operators used in the original MultiRocket [35]. Table 3 summarizes
the pooling operators in the improved MultiRocket, including Proportion of Positive Values
(PPV), Mean of Positive Values (MPV), Mean of Indices of Positive Values (MIPV), Longest
Stretch of Positive Values (LSPV) and NSPV.
Table 3. The summary of pooling operators in improved MultiRocket uses a virtual example to
illustrate that the four pooling operators in original MultiRocket cannot distinguish different sce-
narios with different convolutional outputs. Each convolutional output contains 6 zeros and 6 ones,
MPV = 1, PPV = 0.5, MIPV = 5.5, LSPV = 2.
Convolutional Outputs PPV MPV MIPV LSPV NSPV
A = [1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, 1] 0.5 1 5.5 2 3
B = [1, 0, 1, 0, 0, 1, 1, 0, 0, 1, 0, 1] 0.5 1 5.5 2 1
C = [1, 1, 0, 0, 1, 0, 0, 1, 0, 0, 1, 1] 0.5 1 5.5 2 2
PPV was first used in Rocket. It uses Equation (4) to compute the proportion of
positive value of Z.
1 l
PPV(Z) = ∑ [ z > 0] (4)
l i =1 i
55
Electronics 2023, 12, 1188
MPV, MIPV and LSPV were used in MultiRocket. The MPV value is calculated using
Equation (5), where m is the number of positive values in Z.
∑il=1 zi [zi > 0]
MPV(Z) = (5)
m
MIPV is calculated by Equation (6), where i+ is the index of positive value and m is
the number of positive values in Z.
−1 otherwise
MIPV(Z) = + (6)
1 m
m ∑ j =1 ij if m > 0
LSPV is calculated using Equation (7) and represents the maximum length of any
subsequence of positive values in Z.
LSPV( Z ) = max j − i | ∀i≤k≤ j zk > 0 (7)
We propose NSPV to calculate the number of continuous subsequences with positive
values in Z, as defined in Equation (8). It can offer a distinctive kind of information
compared with the other four pooling operators provided in the original MultiRocket. As
shown in Table 3, NSPV is the key to distinguishing between three time series, A to C.
NSPV( Z ) = ∑nk=1 j − i > 1 | ∀i≤k≤ j zk > 0 (8)
3.3. Feature Extraction
Original MultiRocket produces 50 k features by default. For a fair comparison, the
improved MultiRocket extracts five aggregate features from each convolutional output and
also generates about 50 k (more accurately, 15 × 222 × 3 × 5 = 49,950) features for each
time series by default. Specifically, it has 15 fixed convolution kernels and each convolution
kernel produces 222 kinds of dilation, making the length of the convolution kernel from 6 to
the input time series’ length. The input data consists of three parts: (1) the raw time series;
(2) the selected I MFs∗ ; and (3) the first-order difference of raw time series. Firstly, the three
parts as the inputs are convolved by each combination of kernel and dilation in turn to
obtain the convolutional output. Next, a total of 49,950 features are eventually derived by
calculating five features for each convolutional output using five pooling operators. Finally,
a ridge regression classifier is trained on the extracted features.
4. Experimental Results
4.1. Datasets
To better assess the performance of the proposed CEEMD-MultiRocket, the experi-
ments were conducted on 109 univariate time series classification datasets from the UCR
time series repository [47], which includes datasets from many different fields and has been
used to evaluate various TSC models.
4.2. Experimental Settings
From the perspective of classification accuracy and runtime analysis, the proposed
CEEMD-MultiRocket was contrasted with some SOTA algorithms for classifying time
series, including MultiRocket, HIVE-COTE 2.0, InceptionTime, MiniRocket, Arsenal, STC,
TS-CHIEF, DrCIF, TDE and ProximityForest. In order to directly compare the classification
accuracy with other most accurate algorithms as mentioned above, we assessed the pro-
posed CEEMD-MultiRocket on 30 resamples of 109 datasets from the UCR univariate time
series repository used in [22,35] and adopted exactly the same resampling method as used
in MultiRocket [35]. Thus, on the basis of the same data sets and stratified split, we exam-
ined the effectiveness of our proposed CEEMD-MultiRocket in enhancing classification
56
Electronics 2023, 12, 1188
accuracy, and compared the runtime of CEEMD-MultiRocket with that of the above time
series classification algorithms.
In addition, the noise standard deviation was set to 0.4 and the number of realizations
was set to 30 in CEEMD. The threshold of sub-series selection was set to 0.9 of the testing
accuracy of raw time series. We performed CEEMD using MATLAB R2016a and improved
MultiRocket using pycharm IDE on a cluster with an Intel Xeon Gold 5218 CPU @2.30 GHz
using a single thread.
4.3. Results and Analysis
4.3.1. Classification Results
We compared CEEMD-MultiRocket with the 10 SOTA TSC algorithms mentioned
above to examine the effectiveness of our proposed method. Figure 3 illustrates the
mean rank of CEEMD-MultiRocket in comparison to the 10 TSC algorithms. According
to a two-sided Wilcoxon signed-rank test with Holm correction (as a post hoc test to
the Friedman test), algorithms connected with a black line have no pairwise statistical
difference in their accuracy [49]. The Wilcoxon signed-rank test is a nonparametric statistical
hypothesis test used to determine if two related samples have the same distribution, which
is often used to compare the significance of the differences between two related samples.
From Figure 3, we can see that CEEMD-MultiRocket is significantly more accurate than
MultiRocket and other TSC algorithms, and only marginally less accurate than HIVE-COTE
2.0. Note that the accuracy difference between CEEMD-MultiRocket and HIVE-COTE 2.0
is statistically insignificant, showing that CEEMD-MultiRocket achieves almost the same
level of classification performance as the latter.
Figure 3. Mean rank of CEEMD-MultiRocket in terms of accuracy over 30 resamples of 109 datasets
from the UCR time series repository, against 10 other SOTA algorithms.
Figure 4 shows the pairwise difference of the CEEMD-MultiRocket and 10 other SOTA
TSC algorithms in terms of statistical significance. The first row of each cell in the matrix
indicates the wins, draws and losses of the algorithm in the Y-axis versus the algorithm
in the X-axis, and the second row shows the p-value of the Holm-corrected two-sided
Wilcoxon signed-rank test between the pairwise algorithms. The bold numbers in the
cells represent that significant differences do not exist in the classification accuracy of
the pairwise algorithms after applying the Holm correction. As shown in Figure 4, our
proposed CEEMD-MultiRocket is significantly more accurate than all SOTA classification
algorithms except for HIVE-COTE 2.0, where the p-values for most of algorithms are close
to 0. CEEMD-MultiRocket outperforms MultiRocket with 70 wins and only 31 losses out
of 109 datasets. Compared with HIVE-COTE 2.0, CEEMD-MultiRocket achieves higher
accuracy on 51 datasets, lower on 50 datasets and is the only algorithm with a p-value close
to 1 after applying Holm correction.
As we can see, there are many different SOTA algorithms that can be used for time
series classification, and the suitability of a particular algorithm depends on various factors
such as the length of the time series, the sampling frequency, the number of classes and
the complexity of underlying patterns. In general, if the time series are very short, with
only a few data points, then simpler algorithms, such as nearest neighbor or decision trees,
may be more appropriate. These algorithms can be effective for small datasets and can
quickly classify time series based on their similarity to other time series in the training set.
57
Electronics 2023, 12, 1188
On the other hand, if the time series are very long and have a high sampling frequency,
then more complex algorithms, such as RNN or CNNs, may be more suitable. Through the
experiments on 109 datasets, we find that our CEEMD-MultiRocket algorithm performs
well in classification and outperforms the vast majority of existing classification algorithms.
Among these 109 datasets, the shortest time series length is 15 (SmoothSubspace), and the
longest is 2844 (Rock), indicating that our algorithm is effective for both short and long
time series.
Figure 4. Pairwise difference between CEEMD-MultiRocket and 10 other SOTA algorithms in terms
of statistical significance.
Figure 5 illustrates the pairwise accuracy of CEEMD-MultiRocket versus MultiRocket
over 30 resamples of the 109 datasets from the UCR time series repository. Overall, we can
find that most points are scattered above the dotted line, showing that CEEMD-MultiRocket
achieves significantly better classification accuracy than MultiRocket.
Figure 5. Pairwise accuracy of CEEMD-MultiRocket versus MultiRocket over 30 resamples of
109 datasets from the UCR time series repository.
58
Electronics 2023, 12, 1188
4.3.2. Runtime Analysis
Although CEEMD-MultiRocket significantly outperforms MultiRocket in terms of
accuracy, the additional decomposition operation, the sub-series selection and one extra
pooling operator increase computational complexity. Fortunately, the reduction in the
number of convolution kernels decreases the runtime of our proposed CEEMD-MultiRocket
algorithm. We evaluated the overall training time of 10 other SOTA algorithms to train a
single resample on 112 UCR datasets and compared the training time of these algorithms
with our proposed CEEMD-MultiRocket, as shown in Table 4. From Table 4, we can find
that CEEMD-MultiRocket is obviously faster than most TSC algorithms. All the SOTA
algorithms, except the Rocket family, take lots of time to train, as reported by [22]. As for
the Rocket family, MiniRocket, unsurprisingly, is the fastest, with a training time of under
4 min. After that is MultiRocket, which can be trained in under 24 min. Next is Rocket,
with a training time of over 4 h, followed by our CEEMD-MultiRocket, taking under 5 h for
training. Arsenal is an ensemble of Rocket, with a training time of about 28 h. The training
time of six non-Rocket algorithms running on a high-performance computing (HPC) cluster
with a single thread was reported in [22], which used higher-level hardware than ours.
DrCIF takes about 2 days and the ensemble algorithms, including STC, HIVE-COTE 1.0/2.0
and TS-CHIEF, take at least 4 days. By comparison, the Rocket family algorithms use
lots of randomly initialized convolution kernels for feature extraction, and only use one
linear classifier for classification, without training the kernels, while non-Rocket algorithms,
such as HIVE-COTE 2.0, TS-CHIEF, etc., integrate many classifiers with a large number of
parameters and therefore require a lot of time for training. As a result, we can find that these
non-Rocket algorithms are clearly more time-consuming than our algorithm. Specifically,
the training time of CEEMD-MultiRocket consists of three parts: CEEMD (4.11 h), the IMFs
selection (26.3 min) and model training using the improved MultiRocket (20.3 min). Due to
the decomposition cost of raw time series, the proposed CEEMD-MultiRocket is slower
than original MultiRocket, but it significantly outperforms MultiRocket in classification
accuracy. Compared with HIVE-COTE 2.0, our proposed CEEMD-MultiRocket achieves
almost the same level of classification accuracy but only costs 1.4% of the training time,
showing that our proposed CEEMD-MultiRocket is an effective algorithm in TSC.
Table 4. Runtime to train single resample of 112 UCR datasets. The runtime of Rocket family and
CEEMD-MultiRocket algorithm is calculated by running with a single thread on Intel Xeon Gold
5218 CPU. The runtime of the others is cited from [22].
TSC Algorithm Total Training Time
MiniRocket (10 k features) 3.61 min
MultiRocket (50 k features) 23.65 min
Rocket (20 k features) 4.25 h
CEEMD-MultiRocket (50 k features) 4.88 h
Arsenal 27.91 h
DrCIF 45.40 h
TDE 75.41 h
STC 115.88 h
HIVE-COTE 2.0 340.21 h
HIVE-COTE 1.0 427.18 h
TS-CHIEF 1016.87 h
5. Discussion
For a more comprehensive evaluation of CEEMD-MultiRocket, we continue to discuss
several characteristics of the proposed algorithm on 109 datasets from the UCR time series
repository in detail, including the parameter setting of CEEMD, the sub-series selection,
the convolution kernel design and pooling operators.
59
Electronics 2023, 12, 1188
5.1. CEEMD Parameter Settings
During the procedure of decomposing raw time series, CEEMD adds a specific white
noise to the time series. The addition of white noise is an important step in the CEEMD
method that can eliminate the mode mixing problem and help to improve the accuracy and
reliability of the decomposition results. The decomposition contains two main parameters:
the number of realizations R and the noise signal intensity N. Different numbers of
realizations and noise signal intensities may produce different IMFs. Experiments were
conducted on 109 datasets from the UCR time series repository to assess the impact of these
two parameters for classification performance. Figure 6 shows the mean rank of different
noise intensities (N = 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7) applied on CEEMD-MultiRocket with a
fixed number of realizations R = 30. Figure 7 shows the mean rank of different numbers
of realizations (R = 10, 20, 30, 40, 50, 60, 70) applied on CEEMD-MultiRocket with a fixed
noise intensity N = 0.4.
As shown in Figure 6, CEEMD-MultiRocket obtains the best mean rank in classification
accuracy on the 109 datasets when N = 0.4. This indicates that a too high or too low noise
intensity leads to a reduction in classification accuracy, though there is not a statistically
significant difference in classification accuracy. The findings of the experiment reveal that
the intensity of noise has only a marginal impact on the classification performance and an
optimum value for the intensity of added noise is somewhere around 0.4.
Figure 7 shows that CEEMD-MultiRocket achieves the best classification accuracy
when the number of realizations R = 70, but the difference of classification performance
between R = 70 and R = 30 is relatively small and statistically insignificant. As shown in
Section 4.3.2, the decomposition of raw time series takes up most of the runtime (about
84%) of CEEMD-MultiRocket, it is necessary to reduce the decomposition time as much as
possible. Since the number of realizations R = 30 takes less than half of the time of R = 70,
we adopt 30 as the number of realizations in our CEEMD-MultiRocket to achieve a balance
between the classification accuracy and time cost.
Figure 6. Mean rank of different noise intensities applied on CEEMD-MultiRocket with a fixed
number of realizations.
Figure 7. Mean rank of different numbers of realizations applied on CEEMD-MultiRocket with a
fixed noise intensity.
5.2. Sub-Series Selection
Integrating all decomposed sub-series as the input to the classification model is not
necessarily a guarantee of improvement of classification performance. Therefore, it is
necessary to select the most important sub-series and discard less important ones to en-
hance the overall classification performance and decrease the computational complexity.
The selection is executed on the whole known training set which is further divided into
training and testing sets by stratified sampling, by comparing the testing accuracy (using
improved MultiRocket) of each IMF with that of the raw time series, respectively, using
60
Electronics 2023, 12, 1188
a predetermined threshold. When the ratio of the testing accuracy of the IMF to that of
the raw time series is more than the given threshold, this IMF is selected as the input to
the classification model. We set different thresholds and the corresponding classification
results are shown in Figure 8.
From Figure 8, we can find that CEEMD-MultiRocket achieves the best classification
accuracy when the value of the threshold is 0.9, although the difference by setting different
thresholds is negligible and statistically insignificant in terms of the classification accuracy.
Table 5 shows the number of datasets with 0, 1, 2 or 3 IMFs which are selected using different
thresholds on 109 datasets. When the threshold is set to 0, all three IMFs are unconditionally
selected for each dataset, and the classification accuracy is the worst because some of these
IMFs may produce negative impacts on the performance of the classification algorithm.
When the threshold is set to 1, more than half of the datasets do not have any IMFs selected.
Although this can decrease the computational complexity, it may also lose many crucial
sub-series and reduce the classification performance. We find that when the threshold is set
to 0.9, 93 datasets out of all 109 datasets select at least one decomposed IMF, and our model
achieves the best classification accuracy due to the addition of appropriate I MFs∗ .
Figure 8. Mean rank of CEEMD-MultiRocket using different threshold.
Table 5. Number of datasets of selecting different number of IMFs using different thresholds on
109 datasets from the UCR time series repository.
Number of IMFs Selected
Threshold
0 1 2 3
0 0 0 0 109
0.3 0 3 3 103
0.5 0 14 7 88
0.7 0 31 13 65
0.8 1 40 22 46
0.9 16 48 17 28
1 60 31 11 7
5.3. Convolution Kernel Design
In CEEMD-MultiRocket, we decrease the length of the convolution kernel to 6. Figure 9
demonstrates the effectiveness of different kernel lengths on classification accuracy. In
Figure 9, 6_2 means the kernel length is 6, in which two weights are one value and the
remaining weights are another value. Thus, it gives C62 = 15 fixed kernels in total. As can be
seen from Figure 9, convolution kernels of length 5, 6 or 7 significantly outperform other
convolution kernels with a length of 8, 9 or 11 in terms of classification accuracy.
It is also worth mentioning that the entire set of kernels of length 6 produces higher ac-
curacy than the 6_2 kernel subset, but the classification accuracy is statistically insignificant.
Since the 6_2 kernel subset only has about a quarter of the number of convolution kernels
of the entire set of kernels with length 6, it is particularly suitable for the optimizations of
avoiding multiplications, which can significantly shorten training time but achieve almost
the same level of classification accuracy. Therefore, the convolution kernel of length 6_2 is
applied in the proposed CEEMD-MultiRocket.
61
Electronics 2023, 12, 1188
Figure 9. Mean rank of CEEMD-MultiRocket using different convolution kernel lengths.
5.4. Pooling Operators
In CEEMD-MultiRocket, we add an extra pooling operator NSPV (Number of Stretch
of Positive Values) to enrich the discriminatory power of derived features. Figure 10
compares the effectiveness of using all five pooling operators (PPV, MPV, MIPV, LSPV,
NSPV), four pooling operators (PPV, MPV, MIPV, LSPV), two pooling operators (PPV and
NSPV) and only PPV in CEEMD-MultiRocket with 50k features. The experimental result
shows that compared with four pooling operators, an additional NSPV pooling operator is
able to significantly increase classification accuracy, indicating that NSPV contributes to the
improvement of classification performance in CEEMD-MultiRocket. Furthermore, we also
find that using four pooling operators (PPV + MPV + MIPV + LSPV) is not significantly
better than only using two pooling operators (PPV + NSPV).
Figure 10. Mean rank of CEEMD-MultiRocket using different combinations of pooling operators.
5.5. Summary
From the above results and analysis, some findings can be summarized as follows:
(1) Decomposing raw time series into sub-series and extracting features from them can
obtain more detailed and discriminative information from various aspects, which
significantly contributes to the enhancement of classification accuracy.
(2) Selecting the more crucial sub-series and pruning the redundant and less important ones
can both enhance classification performance and reduce computational complexity.
(3) The optimization in convolution kernel design can generate more efficient transform,
which helps to improve the overall classification accuracy.
(4) The additional pooling operator NSPV enriches the discriminatory power of derived features.
6. Conclusions
To enhance the classification performance of the original MultiRocket, this study
proposes a hybrid classification model CEEMD-MultiRocket which integrates CEEMD
and improved MultiRocket. Firstly, the CEEMD algorithm is employed to decompose raw
time series into two IMFs and one residue, which represent the high-, medium- and low-
frequency portions of raw time series, respectively. Then, the selection of these decomposed
sub-series is conducted on the whole known training set which is further divided into
new training and testing sets using stratified sampling, by comparing the classification
accuracy of each sub-series with that of the raw time series using a given threshold. Finally,
we improve the convolutional kernel and pooling operators of the original MultiRocket,
apply the improved MultiRocket to the raw time series, the selected decomposed sub-
series and the first-order difference of raw time series to extract features, and build a
ridge regression classifier. The experimental results demonstrate that: (1) in comparison
to all SOTA classification algorithms except for HIVE-COTE 2.0, the proposed algorithm
62
Electronics 2023, 12, 1188
can significantly enhance the classification accuracy on 109 datasets from the UCR time
series repository; (2) CEEMD-MultiRocket achieves almost the same level of classification
accuracy as HIVE-COTE 2.0, with a fraction of the computing cost of the latter; (3) the
CEEMD algorithm has the ability to generate a variety of representations of raw time
series as the inputs of the algorithm, which contributes to the improvement of classification
accuracy; (4) the improvement of convolution kernel length and the reduction in the
number of convolution kernels can enhance classification performance while reducing
computational load; and (5) the additional pooling operator contributes to enhancing the
classification accuracy.
There are two main limitations in our work: (1) CEEMD is a relatively time-consuming
decomposition method; (2) the values of weights in the convolution kernel are pre-defined
and cannot be dynamically adjusted in line with increases in the dilation. The main
directions for future research could be extended in two aspects: (1) continuing to im-
prove MultiRocket to build the hybrid ensemble classification algorithm for time series;
(2) considering faster decomposition algorithms and sub-series selection algorithms to
improve the runtime and classification accuracy of the algorithm.
Author Contributions: Conceptualization, P.W., J.W. and Y.W.; Formal analysis, P.W. and J.W.;
Investigation, P.W. and Y.W.; Methodology, P.W. and J.W.; Project administration, J.W.; Resources,
J.W. and T.L.; Software, P.W. and J.W.; Supervision, T.L.; Validation, P.W. and Y.W.; Writing—original
draft, P.W., J.W. and Y.W.; Writing—review and editing, J.W., Y.W. and T.L. All authors have read and
agreed to the published version of the manuscript.
Funding: This work was supported by the Ministry of Education of Humanities and Social Sci-
ence Project (grant no. 19YJAZH047) and the Social Practice Research for Teachers of Southwestern
University of Finance and Economics (grant no. 2022JSSHSJ11).
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: All the data in this paper are publicly available. They can be accessed
at https://www.cs.ucr.edu/~eamonn/time_series_data/ (all accessed on 20 October 2022).
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Rezaei, S.; Liu, X. Deep learning for encrypted traffic classification: An overview. IEEE Commun. Mag. 2019, 57, 76–81. [CrossRef]
2. Susto, G.A.; Cenedese, A.; Terzi, M. Time-series classification methods: Review and applications to power systems data. Big Data
Appl. Power Syst. 2018, 179–220. [CrossRef]
3. Li, T.; Qian, Z.; Deng, W.; Zhang, D.; Lu, H.; Wang, S. Forecasting crude oil prices based on variational mode decomposition and
random sparse Bayesian learning. Appl. Soft Comput. 2021, 113, 108032. [CrossRef]
4. Chao, L.; Zhipeng, J.; Yuanjie, Z. A novel reconstructed training-set SVM with roulette cooperative coevolution for financial time
series classification. Expert Syst. Appl. 2019, 123, 283–298. [CrossRef]
5. Ebrahimi, Z.; Loni, M.; Daneshtalab, M.; Gharehbaghi, A. A review on deep learning methods for ECG arrhythmia classification.
Expert Syst. Appl. X 2020, 7, 100033. [CrossRef]
6. Wu, J.; Zhou, T.; Li, T. Detecting epileptic seizures in EEG signals with complementary ensemble empirical mode decomposition
and extreme gradient boosting. Entropy 2020, 22, 140. [CrossRef]
7. Craik, A.; He, Y.; Contreras-Vidal, J.L. Deep learning for electroencephalogram (EEG) classification tasks: A review. J. Neural Eng.
2019, 16, 031001. [CrossRef]
8. Liu, Y.; Wu, Y.F. Early detection of fake news on social media through propagation path classification with recurrent and
convolutional networks. In Proceedings of the AAAI Conference on Artificial Intelligence, New Orleans, LA, USA, 2–7 February
2018; Volume 32.
9. Pantiskas, L.; Verstoep, K.; Hoogendoorn, M.; Bal, H. Taking ROCKET on an efficiency mission: Multivariate time series
classification with LightWaves. arXiv 2022, arXiv:2204.01379.
10. Nishikawa, Y.; Sannomiya, N.; Itakura, H. A method for suboptimal design of nonlinear feedback systems. Automatica 1971,
7, 703–712.
11. Lucas, B.; Shifaz, A.; Pelletier, C.; O’Neill, L.; Zaidi, N.; Goethals, B.; Petitjean, F.; Webb, G.I. Proximity forest: An effective and
scalable distance-based classifier for time series. Data Min. Knowl. Discov. 2019, 33, 607–635. [CrossRef]
63
Electronics 2023, 12, 1188
12. Flynn, M.; Large, J.; Bagnall, T. The contract random interval spectral ensemble (c-RISE): The effect of contracting a classifier
on accuracy. In Proceedings of the International Conference on Hybrid Artificial Intelligence Systems; Springer: Berlin/Heidelberg,
Germany, 2019; pp. 381–392.
13. Deng, H.; Runger, G.; Tuv, E.; Vladimir, M. A time series forest for classification and feature extraction. Inf. Sci. 2013, 239, 142–153.
[CrossRef]
14. Middlehurst, M.; Large, J.; Bagnall, A. The canonical interval forest (CIF) classifier for time series classification. In Proceedings of
the 2020 IEEE International Conference on Big Data (Big Data), Atlanta, GA, USA, 10–13 December 2020; pp. 188–195.
15. Lubba, C.H.; Sethi, S.S.; Knaute, P.; Schultz, S.R.; Fulcher, B.D.; Jones, N.S. catch22: CAnonical Time-series CHaracteristics:
Selected through highly comparative time-series analysis. Data Min. Knowl. Discov. 2019, 33, 1821–1852. [CrossRef]
16. Schäfer, P. The BOSS is concerned with time series classification in the presence of noise. Data Min. Knowl. Discov. 2015,
29, 1505–1530. [CrossRef]
17. Middlehurst, M.; Large, J.; Cawley, G.; Bagnall, A. The temporal dictionary ensemble (TDE) classifier for time series classification.
In Proceedings of the Machine Learning and Knowledge Discovery in Databases: European Conference, ECML PKDD 2020,
Ghent, Belgium, 14–18 September 2020; Part I; Springer: Berlin/Heidelberg, Germany, 2021; pp. 660–676.
18. Bagnall, A.; Lines, J.; Bostrom, A.; Large, J.; Keogh, E. The great time series classification bake off: A review and experimental
evaluation of recent algorithmic advances. Data Min. Knowl. Discov. 2017, 31, 606–660. [CrossRef]
19. Lines, J.; Davis, L.M.; Hills, J.; Bagnall, A. A shapelet transform for time series classification. In Proceedings of the 18th ACM
SIGKDD International Conference on Knowledge Discovery and Data Mining, Beijing, China, 12–16 August 2012; pp. 289–297.
20. Bostrom, A.; Bagnall, A. Binary shapelet transform for multiclass time series classification. In Transactions on Large-Scale Data-
and Knowledge-Centered Systems XXXII: Special Issue on Big Data Analytics and Knowledge Discovery; Springer: Berlin/Heidelberg,
Germany, 2017; pp. 24–46.
21. Bagnall, A.; Flynn, M.; Large, J.; Lines, J.; Middlehurst, M. On the usage and performance of the hierarchical vote collective
of transformation-based ensembles version 1.0 (hive-cote v1.0). In Proceedings of the Advanced Analytics and Learning on
Temporal Data: 5th ECML PKDD Workshop, AALTD 2020, Ghent, Belgium, 18 September 2020; Revised Selected Papers 6;
Springer: Berlin/Heidelberg, Germany, 2020; pp. 3–18.
22. Middlehurst, M.; Large, J.; Flynn, M.; Lines, J.; Bostrom, A.; Bagnall, A. HIVE-COTE 2.0: A new meta ensemble for time series
classification. Mach. Learn. 2021, 110, 3211–3243. [CrossRef]
23. Ismail Fawaz, H.; Lucas, B.; Forestier, G.; Pelletier, C.; Schmidt, D.F.; Weber, J.; Webb, G.I.; Idoumghar, L.; Muller, P.A.; Petitjean, F.
Inceptiontime: Finding alexnet for time series classification. Data Min. Knowl. Discov. 2020, 34, 1936–1962. [CrossRef]
24. Shifaz, A.; Pelletier, C.; Petitjean, F.; Webb, G.I. TS-CHIEF: A scalable and accurate forest algorithm for time series classification.
Data Min. Knowl. Discov. 2020, 34, 742–775. [CrossRef]
25. Längkvist, M.; Karlsson, L.; Loutfi, A. A review of unsupervised feature learning and deep learning for time-series modeling.
Pattern Recognit. Lett. 2014, 42, 11–24. [CrossRef]
26. Bengio, Y.; Yao, L.; Alain, G.; Vincent, P. Generalized denoising auto-encoders as generative models. Adv. Neural Inf. Process. Syst.
2013, 26.
27. Hu, Q.; Zhang, R.; Zhou, Y. Transfer learning for short-term wind speed prediction with deep neural networks. Renew. Energy
2016, 85, 83–95. [CrossRef]
28. Gallicchio, C.; Micheli, A. Deep echo state network (deepesn): A brief survey. arXiv 2017, arXiv:1712.04323.
29. Pascanu, R.; Mikolov, T.; Bengio, Y. Understanding the exploding gradient problem. arXiv 2012, arXiv:1211.5063.
30. Ismail Fawaz, H.; Forestier, G.; Weber, J.; Idoumghar, L.; Muller, P.A. Deep learning for time series classification: A review. Data
Min. Knowl. Discov. 2019, 33, 917–963. [CrossRef]
31. Hatami, N.; Gavet, Y.; Debayle, J. Classification of time-series images using deep convolutional neural networks. In Proceedings
of the Tenth International Conference on Machine Vision (ICMV 2017); Vienna, Austria, 13–15 November 2017; SPIE: Bellingham,
WA, USA, 2018; Volume 10696, pp. 242–249.
32. Tripathy, R.; Acharya, U.R. Use of features from RR-time series and EEG signals for automated classification of sleep stages in
deep neural network framework. Biocybern. Biomed. Eng. 2018, 38, 890–902. [CrossRef]
33. Wang, Z.; Oates, T. Imaging time-series to improve classification and imputation. In Proceedings of the Twenty-Fourth
International Joint Conference on Artificial Intelligence, Buenos Aires, Argentina, 25–31 July 2015.
34. Nweke, H.F.; Teh, Y.W.; Al-Garadi, M.A.; Alo, U.R. Deep learning algorithms for human activity recognition using mobile and
wearable sensor networks: State of the art and research challenges. Expert Syst. Appl. 2018, 105, 233–261. [CrossRef]
35. Tan, C.W.; Dempster, A.; Bergmeir, C.; Webb, G.I. MultiRocket: Multiple pooling operators and transformations for fast and
effective time series classification. Data Min. Knowl. Discov. 2022, 36, 1623–1646. [CrossRef]
36. Dempster, A.; Petitjean, F.; Webb, G.I. ROCKET: Exceptionally fast and accurate time series classification using random
convolutional kernels. Data Min. Knowl. Discov. 2020, 34, 1454–1495. [CrossRef]
37. Dempster, A.; Schmidt, D.F.; Webb, G.I. Minirocket: A very fast (almost) deterministic transform for time series classification. In
Proceedings of the 27th ACM SIGKDD Conference on Knowledge Discovery & Data Mining, Singapore, 14–18 August 2021;
pp. 248–257.
64
Electronics 2023, 12, 1188
38. Torres, M.E.; Colominas, M.A.; Schlotthauer, G.; Flandrin, P. A complete ensemble empirical mode decomposition with adaptive
noise. In Proceedings of the 2011 IEEE International Conference on Acoustics, Speech and Signal Processing (ICASSP), Prague,
Czech Republic, 22–27 May 2011; pp. 4144–4147.
39. Zhou, Y.; Li, T.; Shi, J.; Qian, Z. A CEEMDAN and XGBOOST-based approach to forecast crude oil prices. Complexity 2019,
2019, 1–15. [CrossRef]
40. Li, T.; Qian, Z.; He, T. Short-term load forecasting with improved CEEMDAN and GWO-based multiple kernel ELM. Complexity
2020, 2020, 1–20. [CrossRef]
41. Wu, Z.; Huang, N.E. Ensemble empirical mode decomposition: A noise-assisted data analysis method. Adv. Adapt. Data Anal.
2009, 1, 1–41. [CrossRef]
42. Huang, N.E.; Shen, Z.; Long, S.R.; Wu, M.C.; Shih, H.H.; Zheng, Q.; Yen, N.C.; Tung, C.C.; Liu, H.H. The empirical mode
decomposition and the Hilbert spectrum for nonlinear and non-stationary time series analysis. Proc. R. Soc. London. Ser. A Math.
Phys. Eng. Sci. 1998, 454, 903–995. [CrossRef]
43. Li, S.; Zhou, W.; Yuan, Q.; Geng, S.; Cai, D. Feature extraction and recognition of ictal EEG using EMD and SVM. Comput. Biol.
Med. 2013, 43, 807–816. [CrossRef] [PubMed]
44. Tang, B.; Dong, S.; Song, T. Method for eliminating mode mixing of empirical mode decomposition based on the revised blind
source separation. Signal Process. 2012, 92, 248–258. [CrossRef]
45. Wu, J.; Chen, Y.; Zhou, T.; Li, T. An adaptive hybrid learning paradigm integrating CEEMD, ARIMA and SBL for crude oil price
forecasting. Energies 2019, 12, 1239. [CrossRef]
46. Li, T.; Zhou, M. ECG classification using wavelet packet entropy and random forests. Entropy 2016, 18, 285. [CrossRef]
47. Dau, H.A.; Bagnall, A.; Kamgar, K.; Yeh, C.C.M.; Zhu, Y.; Gharghabi, S.; Ratanamahatana, C.A.; Keogh, E. The UCR time series
archive. IEEE/CAA J. Autom. Sin. 2019, 6, 1293–1305. [CrossRef]
48. Chai, J.; Wang, Y.; Wang, S.; Wang, Y. A decomposition–integration model with dynamic fuzzy reconstruction for crude oil price
prediction and the implications for sustainable development. J. Clean. Prod. 2019, 229, 775–786. [CrossRef]
49. Demšar, J. Statistical comparisons of classifiers over multiple data sets. J. Mach. Learn. Res. 2006, 7, 1–30.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
65
electronics
Article
Financial Time Series Forecasting: A Data Stream
Mining-Based System
Zineb Bousbaa 1, *,†,‡ , Javier Sanchez-Medina 2,‡ and Omar Bencharef 1,‡
1 Computer and System Engineering Laboratory, Faculty of Science and Technology, Cadi Ayyad University,
Marrakech 40000, Morocco; [email protected]
2 Innovation Center for the Information Society (CICEI), Campus of Tafira, University of Las Palmas de Gran
Canaria, 35017 Las Palmas de Gran Canaria, Spain; [email protected]
* Correspondence: [email protected]
† Current address: Faculty of Sciences and Technology, Cadi Ayyad University, Marrakesh 40000, Morocco.
‡ These authors contributed equally to this work.
Abstract: Data stream mining (DSM) represents a promising process to forecast financial time series
exchange rate. Financial historical data generate several types of cyclical patterns that evolve, grow,
decrease, and end up dying. Within historical data, we can notice long-term, seasonal, and irregular
trends. All these changes make traditional static machine learning models not relevant to those
study cases. The statistically unstable evolution of financial market behavior yields a progressive
deterioration in any trained static model. Those models do not provide the required characteristics
to evolve continuously and sustain good forecasting performance as the data distribution changes.
Online learning without DSM mechanisms can also miss sudden or quick changes. In this paper,
we propose a possible DSM methodology, trying to cope with that instability by implementing an
incremental and adaptive strategy. The proposed algorithm includes the online Stochastic Gradient
Descent algorithm (SGD), whose weights are optimized using the Particle Swarm Optimization
Metaheuristic (PSO) to identify repetitive chart patterns in the FOREX historical data by forecasting
the EUR/USD pair’s future values. The data trend change is detected using a statistical technique
that studies if the received time series instances are stationary or not. Therefore, the sliding window
size is minimized as changes are detected and maximized as the distribution becomes more stable.
Results, though preliminary, show that the model prediction is better using flexible sliding windows
Citation: Bousbaa, Z.;
Sanchez-Medina, J.; Bencharef, O.
that adapt according to the detected distribution changes using stationarity compared to learning
Financial Time Series Forecasting: A using a fixed window size that does not incorporate any techniques for detecting and responding to
Data Stream Mining-Based System. pattern shifts.
Electronics 2023, 12, 2039. https://
doi.org/10.3390/electronics12092039 Keywords: data stream mining; forex; online learning; adaptive learning; incremental learning;
sliding window; concept drift; financial time series forecasting
Academic Editors: Taiyong Li, Wu
Deng and Jiang Wu
Received: 19 February 2023
Revised: 22 April 2023 1. Introduction
Accepted: 23 April 2023
Financial Time Series Exchange Rate Forecasting (FTSERF) is a growing field because
Published: 28 April 2023
many investors are interested in it. Artificial intelligence, as a computer science sub-field,
helped in this development by being part of trading decision systems. Machine learning
models became important parts of these systems because they were able to accurately
Copyright: © 2023 by the authors. predict the exchange rate and, as a result, increase the chances of making good profits.
Licensee MDPI, Basel, Switzerland. When we look at the work done on the algorithms used for FTSERF, we can see
This article is an open access article that researchers in both public and private institutions have tried out all the machine
distributed under the terms and learning tools that are available. Those tools may be supervised, such as classification [1],
conditions of the Creative Commons regression [2], recommender systems [3], and reinforement learning [4]. They also include
Attribution (CC BY) license (https:// unsupervised algorithms, such as clustering and association analysis, ranking, and anomaly
creativecommons.org/licenses/by/ detection techniques [5]. The research field of FTSERF using machine learning is wide.
4.0/).
Electronics 2023, 12, 2039. https://doi.org/10.3390/electronics12092039 https://www.mdpi.com/journal/electronics
67
Electronics 2023, 12, 2039
Some studies limit their focus to forecasting future trends, while others go beyond that to
implement trading strategies that work on maximizing profit.
Speaking about the FTSERF difficulties, dealing with the data’s volatile and chaotic
nature is the biggest one. To learn from historical financial time series datasets, you have
to be able to adapt to new patterns all the time. This adaptivity is called reacting to the
detected changes within the data stream mining (DSM) context. This task is challenging
as it requires both recognizing real changes and avoiding false alerts. There are many
change detection techniques. Ref. [6] cites some techniques, including the CUSUM test, the
geometric moving average test, statistical tests, and drift detection methods.
Our paper’s contribution is to show how integrating DSM techniques into the online
learning process can increase FTSERF performance. In our experimental study, we propose
the SGD algorithm optimized using the PSO. We managed the changes that occurred
in the financial time series trends by implementing a sliding window mechanism. The
sliding window size is flexible. It is minimized when a high fluctuation is detected and
maximized when the time series pattern is more or less stable. As a change detection
mechanism, we test for each sliding window the stationarity of the data stream within,
and based on the results, we decide to maintain or adapt the window size that will be
passed as input to our forecasting model. We have compared going through the learning
process using a traditional algorithm vs. integrating DSM techniques. The traditional
algorithm combines the SGD, whose parameters are optimized using the PSO metaheuristic
periodically. The DSM version involves the adaptive sliding window mechanism and the
statistical stationarity test.
The remainder of this paper is structured as follows. The following section carries
out a literature review that we have performed concerning data mining, in addition to
DSM’s application to FTSERF. For further illustration, Section 3 is devoted to describing our
dataset’s components, its preprocessing, analysis, and input selection processes. Section 4
represents the various proposed forecasting system components and illustrates its architec-
ture and algorithm. Section 4 also shows the various experimental studies, analysis of their
results, and further discussions. Finally, some concluding remarks are made in Section 5.
2. Literature Review
2.1. Machine Learning Application to Financial Forecasting
2.1.1. Overview
The financial forecasting research field is very dynamic. The value forecasting of
financial assets is a field that attracts the interest of multiple profiles, from accountants,
mathematicians, and statisticians to computer scientists. In addition, when it comes to
investing, we find that investors with no scientific background easily integrate themselves
into the field. Tools like technical analysis are highly used as they are easy to apply and
have shown effectiveness in trading. Despite the fact that financial asset markets first
appeared in the 16th century (see Figure 1), the first structured approaches to economic
forecasting of these assets date from the last century [7–10].
Research employs methods ranging from mathematical models to statistical models
like ARMA, suggested by Wold in 1938 by combining both AR and MA schemes [11],
as well as to macroeconomic models like Tinbergen’s (1939) [12]. By this time, various
accounting, mathematical, statistical, and machine learning models were constructed to
predict different kinds of financial assets, which led to their exponential increase. One of
the main apparent reasons for this increase is that this research field is one of the most
highly funded, since financial investment generates profit. Funding comes from many
sources; we can mainly mention big asset management companies and investment banks.
68
Electronics 2023, 12, 2039
Figure 1. The chronology of financial asset appearance and the existing forecasting approaches for
their valuation [7–10].
Back in the 1980s, exploring historical data was more difficult since the amount of data
had grown, but computational power was still weak [13]. By the 1990s, more economic and
statistical models had appeared, and they showed better performance than a random walk.
Still, these models do not perform the same way over all the financial assets [14].
However, by the beginning of the 21st century, machine learning models were all the
rage because computers had become faster and were capable of more work. During this
time, many hybrid algorithms, such as moving averages that take into account regressivity
(ARIMA) or algorithms that combine neural networks and traditional time series, have
been proposed. We also noticed the rapid, exponential growth in the number of papers
in this research field from 1998 to 2016. There has been a wide range of topics ranging
from credit rating to inflation forecasting and risk management, which has saturated this
research field and made finding innovative ideas more challenging [13].
On the other hand, scientists became more aware in the 1980s of how important it was
to process textual data. There were attempts to import other predictors developed from
linguistics by Frazier in 1984 [15]. More progress has been achieved, such as word spotting
using naïve statistical methods (Brachman and Khabaza 1996) [16]. Sentiment analysis
resources were proposed at the beginning of the 21st century (Hu and Liu 2004) [17].
Sentiment analysis is a critical component that employs both machine learning algorithms
and knowledge-based methodologies, particularly for analyzing the sentiments of social
media users [18]. From 2010 on, social media data increased exponentially, which attracted
69
Electronics 2023, 12, 2039
the interest of the news analytics community in processing real-time data (Cambria et al.
2014) [13,19].
While reviewing some surveys that shed light on research in financial forecasting,
we find some surveys that suggest categorizing the proposed models in different ways.
The study in [20] distinguished between singular and hybrid models, which include non-
linear models such as artificial neural networks (ANN), support vector machines (SVMs),
particle swarm optimization (PSO), as well as linear models like autoregressive integrated
moving average (ARIMA), etc. Meanwhile, the study in [21] revealed fundamental and
technical analysis as the two approaches that are commonly used to analyze and predict
financial market behaviors. It also distinguished between statistical and machine learning
approaches, assuming that machine learning approaches deal better with complex, dynamic,
and chaotic financial time series. In addition, Ref. [21] points out that the profit analysis of
the suggested forecasting techniques in real-world applications is generally neglected. As a
solution, they suggest a detailed process for creating a smart trading system. As a solution,
it is composed of data preparation, algorithm definition, training, forecasting evaluation,
trading strategies, and money evaluation [21]. Papers can also be summarized based on
their primary goal, which could be preprocessing, forecasting, or text mining. They can
likewise be classified based on the nature of the dataset, whether qualitatively derived
from technical analysis or quantitatively retrieved from financial news, business financial
reports, or other sources [21]. In addition, Ref. [22] distinguished between parametric
statistical methods like Discriminant Analysis and Logistic Regression, Non-Parametric
Statistical Methods like Decision Tree and Nearest Neighbor, or Soft Computing techniques
like Fuzzy Logic, Support Vector Machine, and Genetic Algorithm.
Essential conclusions are extracted from the survey [21], where it is considered that no
approach is better in every way than another, as there is no well-established methodology
to guide the construction of a successful, intelligent trading system. Another issue is
highlighted in [22] concerning the use of metrics like RMSE and MSE that depend on the
scale vs. those that do not, such as the MAPE metric. On the other hand, some papers
consider that once a forecasting system is trained, it is expected well in advance to forecast
future values. However, this is not possible in the financial time series study case, as they
change over time, making retraining with updated data necessary to collect the most recent
knowledge about the state of the market. This final issue has been our motivation to work
on the DSM application to FTSERF.
2.1.2. Optimization Techniques
In this paper, we combined two optimization techniques, SGD and PSO, as a form of
hybridization in order to improve exchange rate forecasting performance.
The gradient descent has been suggested for non-linear problems by Haskell Curry
back in 1944 [23]. In the gradient descent, we work on finding the optimal weights for the
regression function by minimizing the error loss function. In our study case, the regression
function weights depend on the number of explanatory variables used to forecast our target
variable. More details about our dataset structure will be shared in a later section. The
different types of gradient descent showed great results in dealing with fluctuating patterns,
and even with a limited training dataset [24], this makes it an adequate choice for dealing
with the chaotic and volatile nature of financial time series. Having an adaptive system is
also a must when dealing with change. Gradient descent is flexible enough to be combined
with adaptive mechanisms. For example, Ref. [25] propose an adaptive gradient descent
willing to deal with a time delay in receiving the input data. SGD can address various types
of problems. For example, in [26], a financial continuous-time problem is solved using SGD
in continuous time (SGDCT), which showed better results compared to the classic SGD
dealing with high-dimensional continuous-time problems. The possibility to combine the
SGD with other techniques in order to adapt to the target study’s challenges is a strong
point of this algorithm. Another example is the study [27] where a functional gradient
descent is proposed in order to forecast the historical interest rate progress possibilities.
70
Electronics 2023, 12, 2039
The PSO optimization technique is an iterative algorithm that works and converges
closer and faster to the solution search space. It is based on a population of solutions
collaborating together to reach the optimum results [28]. Despite its limitations, such as
the inability to guarantee a good convergence and its computational cost, researchers still
use it in financial optimization problems in particular and in other study fields as well,
as it helps exceed the convergence limits in many cases. PSO is proposed for the first
time by [29,30] as a solution to deal with problems presented in the form of nonlinear
continuous functions. In the literature, we find a lot of studies showing how the PSO
helped achieve a new score for forecasting time series or any other type of data. In [31],
authors have experimented with how PSO can help optimize the results given by neural
networks compared to the classic backpropagation algorithm for time series forecasting.
On the other hand, the article [32] shows how currency exchange rate forecasting capacity
can be polished by adjusting the model function parameters and using the PSO as a booster
to the generalized regression neural network algorithm’s performance. Another work
combining PSO and neural networks is [33], which worked on predicting the Singapore
stock market index. Results demonstrate the effectiveness of using the particle swarm
optimization technique to train neural network weights. The performance of the PSO
FFNN is assessed by optimizing the PSO settings. In addition, recurrent neural network
results predicting stock market behavior have been optimized using PSO in [34]. The
study’s findings demonstrate that the model used in this work has a noticeable impact on
performance compared to before the hybridization. Finally, we cite [35] where a competitive
swarm optimizer that is a PSO variant proved its efficiency dealing with datasets having a
large number of features. The experiment shows how the proposed technique can show a
fast convergence to greater accuracy.
2.2. Data Stream Mining Application to Financial Forecasting
2.2.1. Data Stream Mining
DSM is the sequence for learning the evolving data stream’s behavior. Data streams
could be formed in different data structures, such as trees, particularly ordered and un-
ordered ones. Data streams are present in several study cases, such as financial tickers,
network monitoring, traffic management performance metrics, log records, clickstreams
for web tracking, etc.
Data stream models need to assume that the sequence of the data that are coming and
that are already here is potentially infinite. Thus, it is impossible to keep the data stored.
In some circumstances, these models must also handle data in real time since the stream
of data might be significant. The distribution of data could change in the future. Thus,
historical information could be detrimental to the present situation. The algorithms of data
streams have been the subject of extensive research, leading to computer paradigms that
optimize memory and time-per-item consumption. The nature of the distribution change
has also been studied, where the sliding window approach is used to manage this issue.
The oldest element in a window is deleted to receive the newest one. Fixing the window
size cannot be prioritized. The change rate needs to be continuously studied since it may
itself vary over time [6].
2.2.2. Online Learning
Online learning is one of the main techniques for dealing with data streams. It is a
fundamental paradigm of computational learning theory. The algorithms that only employ
a small amount of prior data storage are covered under the field of online machine learning
in big data streams. After each prediction, an online learner receives the feedback. Online
learners are often compared to the top predictors in terms of their excess loss [36,37]. The
learning process is called online when it is incremental and adaptive.
For example, effective reinforcement learning is necessary for adaptive real-time
machine learning. Due to the nature of online learning, which involves continuous streams
of real-time data and adaptive learning from a limited sample size, the algorithm should
71
Electronics 2023, 12, 2039
constantly interact with its environment to optimize the reward [38]. Prequential learning
is also one of the efficient techniques used for online learning. It serves as an alternative
to the standard holdout evaluation that was carried over from batch-setting issues. The
prequential analysis is specifically created for stream environments. Each sample has two
distinct functions; it is analyzed sequentially in the order of receipt and then rendered
inaccessible. This approach makes predictions for each instance, tests the model, and then
trains it using the same sample (partial fit). The model is continually put to the test on
fresh samples. Validation techniques are also frequently used to help models be adaptive
and incremental. We can mention the following methods: data division into training,
test, and holdout groups. We can also cite cross-validation techniques including k-fold,
leave-one-out, leave-one-group, and nested. The problem with validation techniques is the
risk of overfitting. Techniques for adapting a model are many. We can mention, for example,
computing the area under the ROC Curve (AUC) using constant time and memory [39].
2.2.3. Incremental Learning
Incremental learning is a real-time learning approach that builds a similar model as a
batch learning algorithm. In theory, the stream of observations could go on indefinitely,
making it impossible to wait until all observations are received. Instead of accumulating
and storing all inputs and applying batch learning to the full series of received instances,
one should apply a batch learning algorithm to each new input [40]. A machine learning
paradigm known as incremental learning changes what has already been learned whenever
new instances appear. The biggest distinction between incremental learning and classical
machine learning is that the former does not presuppose the existence of an appropriate
training set before the learning process [41]. Many algorithms, such as neural networks,
use epochs to make the model incremental, which helps optimize computational power
consumption, especially when dealing with large datasets.
2.2.4. Adaptive Learning
On the other hand, adaptive learning techniques aid in employing a continuously
enhanced learning strategy that keeps the system current and maintains its excellent
performance. Input and output values, as well as the associated attributes, are continuously
monitored and learned through the adaptive learning process. Additionally, it continuously
improves its accuracy by learning from events that could change market behavior in real
time. Adaptive artificial intelligence takes into account the feedback from the operational
environment and responds to it to produce data-driven predictions [42].
Concept drift or changes in the way data are spread out are problems that make
it necessary to use adaptive learning techniques. It is a situation where the statistical
characteristics of the class variable, or the target we wish to forecast, change with time [43].
Concept drift in machine learning and data mining describes how relationships between
the input and output data in the underlying problem vary over time. The concept drift
issue is especially prevalent in some areas where forecasts are ordered by time, such as
time series forecasting and predictions on streaming data, and it needs to be specifically
checked for and addressed [44]. Concept drift can be sudden, gradual, or recurrent. To
effectively handle it, a system must be able to quickly adapt, be resilient to noise, be able to
separate the noise from it, notice and respond to severe drifts in the model’s performance,
and capture up-to-date data trends [45]. For the provided models, techniques, and libraries
for data stream classification, we can mention [5], which is a Java-based open-source DSM
framework. It also provides regression models. However, more resources are provided
when dealing with classification problems.
Machine learning models use different techniques to detect concept drift in classifi-
cation. We can mention AUC, which detects and adapts to concept drift for classification
models. AUC is computed with memory and constant time using a sliding window [46].
AUC evaluates the ranking abilities of a classification. The accuracy metric can be a good
choice in the high-class imbalance ratio case, but it may poorly display the concept drift
72
Electronics 2023, 12, 2039
and be biased in identifying the principal class. The foundation for drift identification in un-
balanced streams should be AUC. The study in [46] includes Page–Hinkey (PH) statistical
test with some updates, include the best outcomes, or very nearly so, except that ADWIN
might require more time and memory when change is constant or there is no change.
Regarding concept drift detection for regression problems, there is a technique that
consists of studying the eigenvalues and eigenvectors. It allows the characterization of
the distribution using an orthogonal basis. This approach is the object of the principal
component analysis. A second technique is to monitor covariance. In probability theory
and statistics, covariance measures the joint variability of two random variables, or how
far two random variables differ when combined. It is also used for two sets of numerical
data, calculating deviations from the mean. The covariance between two random variables,
X and Y, is 0 if they are independent. The opposite, however, is untrue [47]. For further
details, Ref. [48] shows the covariance matrix types. The cointegration study is another
technique that detects concept drift, identifying the sensitivity degree of two variables to
the same average price over a specified period. The use of it in econometrics is common. It
can be used to discover mean-reversion trading techniques in finance [49]. In our study, we
compared the use of a fixed versus a flexible window size. We are also involved in studying
the stationary process thing the AUC in the process. We conclude that class inequality has
an impact on both prequential accuracy and AUC. However, AUC is statistically more
discriminant. While accuracy can only reveal genuine drifts, it shows both real and virtual
drifts. The authors used post hoc analysis, and the results confirm that AUC performs
the best but has issues with highly imbalanced streams. Another family of methods is
adaptive decision trees. It can adaptively learn from the data stream, and it is not necessary
to understand how frequently or quickly the stream will change [6]. The ADWIN window
is also a great technique for adaptive learning. We can either fix its size or make it variable.
ADWIN is a parameter-free adaptive size sliding window. When two large sub-windows
are too different, the window’s older section is dropped. ADWIN reacts when sudden,
infrequent or slow, gradual changes occur. To evaluate ADWIN’s performance, we can
follow the accuracy evolution of the false alarm probability, the probability of accurate
detection, and the average delay time in detection. Some hybrid models, such as ADWIN
with the Kalman filter, have demonstrated that they producat is related to regression
problems; more details about it will be explained in the preliminaries section.
2.2.5. Implications of Econometric Methods
For a complete and successful real-world investment strategy in financial market assets,
financial economics theory employment is recommended. It is needed to study factors such
as time, risks, and investment costs and how they can play a major role in encouraging or
discouraging a certain decision. Having agents that are economy-oriented in an investment
strategy decision system can prevent the limitations that machine learning would present.
Data science and financial economics-oriented agents can work together for more profitable
approaches and better forecasting systems. In this context, we cite [50], where authors used
machine learning to predict intra-day realized volatility. The study considered stock market
crashes such as the European debt crisis, the China–United States trade war, and COVID-19.
They tested multiple machine learning algorithms: seasonal autoregressive integrated
moving averages (SARIMA), heterogeneous autoregressive with diurnal effects (HAR-D),
ordinary least squares (OLS), least absolute shrinkage and selection operator (LASSO),
XGBoost, multilayer perceptron (MLP), and long short-term memory (LSTM). They used
three training schemes, where in the singular scheme they built distinct models for each
stock. The universal scheme consists of constructing models with all stock data. The third
training scheme, which is called the augmented scheme, also works on constructing models
with all stock data except that predictors take into account market volatility. Training,
validation, and testing sets are used in the training process. General results showed the
advantage of incorporating volatility, which enhanced the forecasting ability. This study
73
Electronics 2023, 12, 2039
can show how the combination of machine learning and finance knowledge can lead to
better predictions and more efficient decision systems.
The paper in [51] has also conducted an interesting study where forecasting simula-
tions are made using econometric methods and other simulations are carried out using
machine learning methods. The experiment reveals the importance of considering financial
factors such as market maturity in addition to technical factors such as the used forecasting
methods and evaluation metrics for good forecasting performance. Results show how
Support Vector Machines (SVMs), which is a machine learning method, have given better
results than the autoregressive model (AR), which is an econometric method. Advanced
machine learning techniques show efficiency in detecting market anomalies in numerous
significant financial markets. Authors also criticize studies that judge machine learning
efficiency based on experiments applying traditional models instead of advanced ones like
sliding windows and optimization mechanisms. They also refer to the fact that forecasting
results do not necessarily lead to good returns. In addition to that, many researchers do not
consider the transaction cost in their trading simulations.
In the literature, we can find multiple research studies showing how financial and
machine learning methods can both contribute to efficient financial forecasting and invest-
ment systems. The study in [52] shows how combining statistical and machine learning
metrics enhances the forecasting system’s evaluation performance. They compare the
forecasting abilities of well-known machine learning techniques: multilayer perceptrons
(MLP) and support vector machine (SVM) models, the deep learning algorithm, and long
short-term memory (LSTM), in order to predict the opening and closing stock prices for
the Istanbul Stock Exchange National 100 Index (ISE-100). The evaluation metrics used
are MSE, RMSE, and R2 . In addition, statistical tests are made using IBM SPSS statistics
software in order to evaluate the different machine learning models’ results. The findings
of this study demonstrate how favorable MLP and LSTM machine learning models are
for estimating opening and closing stock prices. Authors of the study in [53] also recom-
mended combining fundamental economic knowledge with machine learning systems,
as experts’ judgment strengthens ultimate risk assessment. Their experiment compared
machine learning algorithms to a statistical model in risk modeling. The study shows
how extreme gradient boosting (XGBoost) succeeds in generating stress-testing scenarios
surpassing the classical method. However, the lack of balance complicates class detection
for machine learning models. Another challenge is that their dataset was limited to the
Portuguese environment and needs to be expanded to other markets in order to improve
the system’s validation.
We also find finance and economy-oriented papers that have explored machine learn-
ing algorithms and proved their efficiency to forecast financial market patterns and generate
good returns for investors. For example, authors in [7] demonstrated how asset pricing with
machine learning algorithms is promising in finance. They implemented linear, tree, and
neural network-based models. They used machine learning portfolios as metastrategies,
where the first metastrategy combines all the models they have built and the second one
selects the best-performing models. Results show how high-dimensional machine learning
approaches can approximate unknown and potentially complex data-generating processes
better than traditional economic models.
We also cite the study in [54], which shows how institutional investors use machine
learning to estimate stock returns and analyze systemic financial risks for better investment
decisions. The authors concluded that big data analysis can efficiently contribute to detect-
ing outliers or unusual patterns in the market. They also recommend data-driven or data
science-based research as a promising avenue for the finance industry.
Despite its efficiency in forecasting, machine learning applications in financial markets
have some limitations. For example, authors in [55] concluded that machine learning sys-
tems’ performance can vary depending on the studied market conditions. They evaluated
the following machine learning algorithms: elastic net (Enet), gradient-boosted regression
trees (GBRTs), random forest (RF), variable subsample aggregation (VASA), and neural net-
74
Electronics 2023, 12, 2039
works with one to five layers (NN1–NN5). In addition, they tested ordinary least squares
(OLS), regression LASSO, an efficient neural network, and gradient-boosted regression
trees equipped with a Huber loss function. They encountered difficulties when using data
from the US market but achieved good results as they worked on the Chinese stock market
time series. However, their experiment did not involve advanced optimization techniques
for hyperparameter selection and adaptation to each time series nature.
An interesting book that compares econometric models to machine learning models
is [56]. The study shows how econometrics leans more toward statistical significance, while
machine learning models focus more on the data’s behavior over time. Machine learning
advantages include the fact that they do not skip important information related to data
interaction, unlike econometric models. In addition, machine learning models have the
capacity to break down complex trends into simple patterns. They also better prevent
overfitting using validation datasets. On the other hand, econometric models’ advantage
is the fact that their results are explicable, unlike those of machine learning methods,
whose learning process includes black boxes. Overall, the references provide valuable
insights into the advantages and limitations of machine learning and econometric models
in financial forecasting and highlight the need for careful evaluation and interpretation of
their results. In our current work, we focused on showing how DSM techniques can boost
online algorithms to adapt to financial time series data with time-varying characteristics.
Statistical methods play a major role in our system, as we use the stationarity test to detect
if there is a change in the data stream distribution.
2.2.6. Data Stream Mining Application to Financial Forecasting
Data mining involves machine learning, statistics, information retrieval, and pattern
recognition. The DSM handles data mining tasks as well as the volume, speed, and
shifting patterns of data streams. The DSM technique improves and maintains the model’s
performance using pattern mining. As older data stream distribution can become irrelevant
or damaging to the forecasting accuracy, fitting to newer data using adaptive learning is a
must. The DSM is a recent machine learning domain that appeared as a result of multiple
domains that generate data streams.
Mining changing data streams employs multiple methods. They must save excellent
information, forget useless information, and enhance the model. We can mention as an
example the sliding window technique, which retains W data items in a window. New
elements replace the oldest ones, where a time t element expires at the time t + W for the
sake of memory optimization. The window size W may adjust with the data distribution
pace, either externally or during the learning process [6].
The scientists in the FTSERF field using machine learning models have benefited from
various incremental and adaptive approaches. They have also proposed novel approaches
and hybridized the existing ones. Most of these studies involve adaptive or incremental
techniques that are not among the DSM approaches. Few works concretely involved them
compared to the total. We can cite [57,58], where sliding windows are used. In those works,
adaptivity has been ensured using optimization techniques. For [57], the used technique is
called ELM-Jaya, where the final solution is based on the most effective and the weakest
solutions. The parameters are adapted in the study in [58] thanks to the PSO metaheuristic,
Genetic Algorithm (GA), and neural networks, which are adaptive algorithms by nature.
Incremental approaches include, for example, the uni-iterative approach, where the
model receives one instance at each iteration, as in [59,60]. Secondly, multi-iterative systems
have multiple instances instead of one. Refs. [61,62] are examples of this type. The third
technique is the sliding window. As examples of studies we can cite [63,64]. The sliding
window algorithm has a maintained window that keeps instances that have been read
most recently, and according to specified rules, older examples are removed [6]. The
fourth technique deals with real-time learning, which is efficient but could face difficulties
due to the time factor’s strictness. Online learning is the process of making predictions
about a series of instances, one after another, and being rewarded or penalized for each
75
Electronics 2023, 12, 2039
one. Before making a prediction, the learner often receives a description of the situation.
The learner’s objective is to maximize the cumulative benefit or, conversely, reduce the
cumulative loss [65]. Finally, we find no incremental studies in the literature that can be
used for batch learning, such as [66,67]. A set or a series of observations are accepted as a
single input by a batch learning algorithm. The algorithm creates its model, and it does not
continue to learn. In contrast to online learning, batch learning is standing [65].
Adaptive approaches include several categories; we can mention concept drift for
change detection to update decision systems, as in [68,69]. Secondly, forgetting factors are
highly used in the FTSERF field, and they are especially dedicated for models that rely on
weight updates for model tuning. Refs. [70,71] are two examples from this category. The
third technique we mention is the order selection technique. It analyzes statistics, makes
decisions based on sentimental analysis modules, and votes, such as in [72,73]. The fourth
technique is pattern selection, which entails identifying profitable patterns and testing
them, as in [74,75]. Last, the weight update is a very common technique. It consists of
using new data to adjust the system parameters, or weights. It is proposed in many studies,
such as in [76,77]. More information concerning the state of the art of DSM application for
FTSERF will be presented in another work, our global survey.
3. Preliminaries
3.1. Dataset Description
In our dataset, we have chosen to include three currency pairs. The EUR/USD pair
represents our target to forecast, while the GBP/USD and the JPY/USD pairs are included
because of their significant impact and correlation to our target pair. Each pair’s historical
data have open, high, low, and close prices. The dataset we used ranges from 30 May 2000
to 28 February 2017, later expanded to 30 November 2022. More information can be found
in the data availability statement.
Our dataset also integrated 12 technical indicators calculated for each one of the three
used pairs: the stochastic oscillator, the Relative Strength Index (RSI), the StochRSI oscillator,
the Moving Average Convergence and Divergence (MACD), the average directive index
(ADX), the Williams% R, the Commodity Channel Index (CCI), the true mean range (ATR),
the High-Low index, the ultimate oscillator, the Price Rate Of Change Indicator (ROC), the
Bull power, and the Bear power. In addition, we used historical gold price data in Euro, US
Dollar, British Pound, and Japanese Yen.
3.2. Dataset Preprocessing
Data preprocessing is a significant step between the data collection and the algorithm
learning phases. It can use techniques like data transformation, encoding, and feature
engineering to make the dataset easy for the algorithm to understand and work with. We
may exclude at this phase unnecessary or redundant features. The exclusion can also be
because of the weak correlation and impact on the target variable. Speaking about data
preprocessing for DSM, the study in [78] provides a detailed survey. The authors cited
how they converted unprocessed information into high-quality input. Techniques like
integration, normalization, purification, and transformation are involved. In addition, the
study integrated data reduction techniques, discretizing complex continuous feature spaces
by choosing and removing unnecessary and distracting features.
In our experimental study, we first started with the input data granularity unification
on a daily basis. Then we calculated for each one of the three pairs of time series from j-1
(1 day before the current value) to j-6 (6 days before the current value). The next step was
calculating the technical indicators using their mathematical formulas. The process has
been performed using a Python code we developed to make the process easy to repeat
every time a new input comes. Further details will be shared in the dataset analysis and
the experimental sections.
76
Electronics 2023, 12, 2039
3.3. The Dataset Analysis and the Input Selection
The next step that follows the data preprocessing is the data analysis. It allows an
understanding of the relevance of the data, and it also facilitates the choice of the algorithm
to be used in the learning process. The data analysis includes three main steps: the
univariate analysis, the bivariate analysis, and the multivariate analysis.
Whether we are looking at a qualitative or a quantitative feature changes how the
univariate analysis is performed. In this analysis, we can study the following characteristics:
the first quartile Q1, the minimum, the third quartile Q3, the median, the deciles, the 95th
percentile, the 5th percentile, the maximum, the variance, the standard deviation, the range,
the variable dispersion, and the symmetry index (skewness).
The bivariate analysis leads to linear links by restriction, transformation, or by study-
ing the linear correlation. We test the strength of the correlation using the Pearson correla-
tion coefficient, the H0 test, multiple linear regression, covariance, the assumptions of the
simple linear model, the variance analysis table (ANOVA), the estimators table, and model
validation methods like Anscombe.
The multivariate analysis techniques help choose the best combination of features and
carry out the data dimension reduction. One of the most commonly used techniques is
principal component analysis (PCA) [79].
Tests have been made in our previous work [2]. In Figure 2, we can see that dispersed
residuals along a horizontal line without clear patterns are equally distributed on the upper
and lower sides of the line. It is also noticeable that residuals have non-linear patterns. As
we do not have any non-linear correlations, linear regression is a reasonable option for our
study case.
Figure 3 shows that the residuals follow a straight line in the middle and do not
deviate in a severe way, indicating that our quantile sets do in fact originate from normal
distributions. However, residuals at the extremities curve off. This behavior typically
indicates that our historical data have more extreme instances than would be expected if
they really came from a normal distribution.
The spread-location plot is depicted in Figure 4. The residuals are distributed equally
over the predictor ranges, and the horizontal line with evenly dispersed points supports
the assumption of an equal variance.
Figure 5 displays the residual in relation to the leverage. Extreme values that might
have an impact on a regression line can be seen in the lower right corner, outside of a
dashed line, or at very few of Cook’s distance points. These examples have an impact on
the regression results, so excluding them will change the results.
The FactorMiner module in RStudio’s PCA method is used for feature selection. It
condensed the 147 columns to 30 variables with 99 percent of the information. The number
of columns is depicted in Figure 6 together with the percentage of data that each one can
carry. It aids in the optimization of memory usage during learning.
Figure 2. The residuals measure versus the fitted values.
77
Electronics 2023, 12, 2039
Figure 3. The normal Q-Q plot.
Figure 4. The location scale.
Figure 5. The leverage versus the residuals.
78
Electronics 2023, 12, 2039
Figure 6. The data distribution analysis.
3.4. Methodologies Adopted
3.4.1. The Stationary Process
The stationary process is the technique we used in our proposed architecture. A
stochastic process that is stationary in mathematics and statistics is one whose character-
istics or probability distribution do not change as time passes. As a result, variables like
the mean and the variance also remain constant over time [80]. Mathematically, a family of
random variables is the typical definition of a stochastic or random process. Time series
can be used to represent a variety of stochastic processes. A time series, on the other hand,
is a collection of observations with integer indexes, but a stochastic process is continuous.
The stochastic process is a process in which the characteristic variables undergo random
fluctuations [81].
3.4.2. Stochastic Gradient Descent
The gradient descent algorithm reduces a function to its smallest value iteratively. The
gradient descent algorithm is summarized in the formula below in a single line.
p
f ( x ) = θ0 + ∑ θi xi = y (1)
n =1
As we draw a random line through some of these data points in the space, this straight
line’s equation would be Y = mX + b, where m is the slope and b is the Y-axis intercept. A
machine-learning model tries to predict what will happen with a new set of inputs based
on what happened with a known set of inputs. The discrepancy between the expected and
actual values would be the error:
Error = Y (predicted) − Y (Actual)
The concept of a cost function or a loss function is relevant here. The loss function
calculates the error for a single training example in order to assess the performance of the
machine learning algorithm.
The cost function, on the other hand, is the average of all the loss functions from the
training samples. If the dataset has N total points and we want to minimize the error for
each of those N points, the total squared error would be the cost function. Any machine
learning algorithm’s goal is to lower the cost function. To do this, we identify the value
of X that results in the value of Y that is most similar to actual values. To locate the cost
function minima, we devise the gradient descent algorithm formula [82].
The gradient descent algorithm looks like this:
Repeat until convergence
m
1
θ j := θ j −
m ∑ (hθ (xi ) − yi )xij (2)
i =1
79
Electronics 2023, 12, 2039
The SGD is similar to the gradient descent algorithm structure, with the difference
that it processes one training sample at each iteration instead of using the whole dataset.
SGD is widely used for training large datasets because it is computationally faster and can
be processed in a distributed way. The fundamental idea is that we can arrive at a location
that is quite near the actual minimum by focusing our analysis on just one sample at a
time and following its slope. SGD has the drawback that, despite being substantially faster
than gradient descent, its convergence route is noisier. Since the gradient is only roughly
calculated at each step, there are frequent changes in the cost. Even so, it is the best option
for online learning and big datasets.
3.4.3. PSO Metaheuristic Optimization Technique
Metaheuristics apply to discrete problems, and they can also adapt to continuous
problems. These methods are stochastic, dealing with the combinatorial explosion of
possibilities. They are inspired by physics and biology (such as evolutionary algorithms or
ethology). They also share the same drawbacks: the difficulties of adjusting the method’s
parameters and the lengthy computation [83].
From the point of view of a particle, the PSO idea works by spreading a fleet of
randomly made particles around a search space. Each particle has its own random speed
and can evaluate its position to determine its best performance. This model is a good tool
for solving linear and mixed-number problems and for situations where the numbers are
mixed or continuous. More details about the PSO algorithm we used in our experimental
study can be found in [2,83].
4. Experimental Setup and Analysis
4.1. The Proposed Architecture
During our survey, we noticed several techniques ensuring that the proposed system is
adaptive, incremental, and consequently learning online. We can mention among adaptive
approaches penalization for wrong predictions, higher weighting to more recent data,
rewarding techniques, forgetting factors to ancient data, retraining, metaheuristics for
parameter adapting, learning rate optimization, sliding windows, and iterations until the
performance metric is optimized.
During our experimentation, we have chosen to study the paper in [57]. Their ar-
chitecture shows an online model that processes financial data streams. They employ a
sliding window of size 12, the model is incremental, and the system is adaptive by selecting
a solution based on their best and worst performances. The model is tested in various
cases: containing the dataset’s statistical metrics, containing technical indicators, and both.
In the experimental studies, their model predicts the next day, the following 3, 5, 7 and
15 days, and the following month. Additionally, they employ a variety of learning models,
including Teaching Learning-Based Optimization (TLBO), the Jaya optimization method,
Neural Networks (NNs), Functional Link Artificial Neural Networks (FLANNs) based on
the PSO, and the Differential Evolution (DE) algorithm for weights optimization. Among
the performance evaluation metrics they utilized were Theil’s U, Annual Rental Value
(ARV), Mean Absolute Error (MAE), and the Mean Absolute Percentage Error (MAPE).
Our idea consists of keeping the window size flexible depending on the concept drift
instead of using a fixed window size. We minimize the window size when the concept
drift occurs and negatively impacts our current model performance. We maximize the
window size if the data trend is stable and no concept drift is detected. Our architecture in
Figure 7 is composed of four parts. The first part consists of collecting and scraping the
data from the sources we use. The second part focuses on the data preprocessing. In this
stage, we first unify the granularity of our historical data on a daily basis, then compute
12 technical indicators for each of the three currency pairs. Online learning starts with
the concept of drift detection; this part is responsible for maintaining the stability of our
80
Electronics 2023, 12, 2039
model’s performance by continuously adapting it to new trends. We have tested several
techniques and mainly chose the study that tests if the data is stochastic. The presence or
absence of concept drift leads to the choice of the window size. The next step will be to fit
our model. Since the PSO usage requires more calculations than the SGD alone, we only
launch the PSO every 60 days. Using the PSO helps prevent falling into the local minima.
Last but not least, we visualize our prediction results and performance metrics progress in
several plots and tables.
Figure 7. Our proposed architecture.
4.2. The Experiment Environment
The model has been developed using the Anaconda distribution of the Python and R
programming languages for scientific computing. Specifically, we used Jupyter Notebook
6.4.12 for coding with Python version 3.9.13. Windows is the operating system where the
experiment was carried out.
4.3. The Parameters’ Description
This section explains the different parameters used in our algorithm. We initialized
the sliding window size with the value 15, which is likely to be minimized when a change
in the time series pattern is detected. We chose 15 because, from our preliminary tests, we
saw that, in general, patterns vary from 15 days to another. The variable numRows is our
index variable that we use to process the data stream. It is continuously updated by the
last instance index that we processed in our model training. The variables rangeMin and
rangeMax help us display the instances index from the dataset that our model is being
trained with. The PSOApplication parameter helps us count how many days have been
processed, so that as soon as we reach 60 days, we launch the PSO optimization technique
to help the SGD boost its results.
The PSO parameters are mainly c1 and cmax and are used while updating the weights.
xmin and xmax are the range where we try to find our solution. It can be challenging to fix
it every time we use a new dataset, and limiting it can take a lot of tests until it is properly
fixed. However, once fixed for a particular time series, we continue using it for training and
forecasting future values. The number of particles depends on our time and computational
power limitations. In this study, we fixed it at 20 particles after several tests on different
values. The parameters vmin and vmax determine the speed of movement in the search
space for each particle.
The gradient descent parameters are the tolerance that we use as a condition to stop
the optimization. It represents the margin of error that we tolerate once it is reached. xmin
and xmax are also given as parameters to the SGD.
81
Electronics 2023, 12, 2039
4.4. The Proposed Search Algorithm
The model-learning phase is composed of many parts. When new instances are
available, the stationarity test is performed to specify the next window size, and then
the SGD model receives the new input to update the model parameters. Every 60 days,
we update the model using the PSO optimization metaheuristic. Our proposed search
Algorithm 1 steps are:
Algorithm 1: The SGD algorithm optimized using the PSO metaheuristic with
an adaptive sliding window
Input: The window is initialized with the first 15 elements, and the SGD and the
PSO metaheuristic parameters are initialized by learning from the first
window instances.
1 Initialization;
2 windowsize = 15;
3 numrows = 15;
4 rangeMin = 0;
5 rangeMax = 15;
6 PSOApplication = 1;
7 while We have a new input with 15 instances or higher do
8 Save the previous window in a variable previousWindow;
9 Save the next 15 instances in a variable currentWindow;
10 Create the target variable combining our target variable from the
previousWindow and currentWindow datasets;
11 if The target variable is stationary then
12 windowsize = 15;
13 else
14 windowsize = 1;
/* Put in the variable currentwindow the instances ranging from
numrows+1-15 to numrows+1 */
15 numrows=numrows+windowsize;
16 Validate the current SGD model using the current window;
17 Give as input the current window instance to the SGD to obtain new weights
for our online model;
18 if numrows>= 60*PSOApplication then
19 Give as input the last 60 days to the PSO optimizer and receive as output
the new weight for our SGD model;
20 PSOApplication+=1;
The implementation of the SGD and PSO is inspired by our previous work, Ref. [2],
where we developed the classic gradient descent optimized using Particle Swarm Optimiza-
tion. We used almost the same gradient descent algorithm for the SGD, as the difference
between them is limited to the used training data. For the gradient descent, all the training
data are received as an input to the Algorithm 2, and then a backpropagation is applied to
adjust the model weights. The SGD algorithm receives a new part of the training data at
each iteration and adjusts its weights to that subset of data using a backpropagation.
Figure 8 shows our proposed method flowchart, which consists of adapting the sliding
window size based on the stationarity statistical test. After this, the forecasting model
receives the sliding window instances as input for validation and training.
82
Electronics 2023, 12, 2039
Algorithm 2: Gradient algorithm descent optimized with Particle Swarm
Optimization
Data: Algorithm input, c1, and cmax are used while updating the weights. xmin
and xmax determine the search space of weights, determined thanks to the
numerous tests carried out:
1 initialization;
2 Tolerance = 0.001;
3 c1 = 0.1;
4 cmax = (2 / 0.97725) * c1 ;
5 xmin = −0.3;
6 xmax = 0.3;
7 numberOfParticles = 20;
8 foreach particle pi ∈ P do
9 initialization;
10 Regression formula weights with random values:
11 wi = random(xmin ,xmax );
12 Particles’ movement speed for each particle by a real random value:
13 vmin = (xmin − xmax )/2;
14 vmax = (xmax − xmin )/2;
15 end
16 while MeanSquaredError > tolerance do
17 foreach particle pi ∈ P do
18 Calculate the predicted value by the model using the multiple linear
regression function:
d
19 y i = w0 + w1 x 1 + x 2 x 2 + · · · + w d x d = w0 + ∑ w i x i
i =1
20 Calculate the value of the function that we are optimizing and that is
presented by the derivative of the squared difference between the
predicted values and the actual values:
21
∂Jn (w) 2 n
∂w
=
n ∑ (yi − w0 − w1 x1 − w2 x2 − · · · − wd xd )xi,j
i =1
22 Speeds vd and weights wd update with d the number of weights:
23 vd ← c1 vd + random(0, cmax )( pdxd ) + random(0, cmmax )( pd − xd ) +
random(, cmax )( gd − xd )
24 xd ← xd + vd
25 with :
• gd : The list of weights having realized the best results in the whole
swarm.
• pd : The list of weights having realized the best results in the current
particle.
Calculate the value of the error function derivative and store it in a
variable called error;
if the error of the current particle is higher than the stored one in error variable
then
Assign the error of the current particle to error variable;
else
Go to the next particle without doing anything;
end
26 end
27 end
83
Electronics 2023, 12, 2039
Figure 8. The proposed method flowchart.
4.5. The Performance Evaluation Metrics
The model quality measurement metrics are many, depending on the algorithm type
and also on the study case. In our experiment, we evaluated our model using two tech-
niques. The first one is the Mean Square Error (MSE), which represents the loss function
we wish to optimize:
1 n
f ( x ) = ∑ (yi − f ( xi ))2 (3)
n i =1
The function f (x) is the gradient descent function for predicting our target variable,
which is the EUR/USD exchange rate:
d
f ( x ) = w0 + w1 x 1 + w2 x 2 + · · · + w d x d = w0 + ∑ w i x i (4)
i =1
Our goal is to find the optimal weights of the regression function in our iterative
process by optimizing our loss function. Weights are optimized in our SGD using the
following formula, where the tolerance is fixed to 0.001 in our experimental part and the
error is simply the difference between the real and predicted value of the target variable,
the EUR/USD exchange rate in our case:
wi = wi − (tolerance ∗ error ) (5)
84
Electronics 2023, 12, 2039
Our second metric is a classification metric, where we study the accuracy of predicting
if the exchange rate will rise or fall. It is presented in the form of a percent, and its formula
is the following:
TP + TN
Accuracy = (6)
TP + TN + FP + FN
The third metric we used is average rectified value ARV, which shows the average
variation for a group of data points. The forecasting model performs identically if we
calculate the mean over the series with ARV = 1. The model is considered worse than just
taking the mean if ARV > 1.
2
∑iN=1 (yi − f ( xi ))
ARV = (7)
∑iN=1 |(yi − f ( xi ))|
4.6. Analysis of Results
This section will discuss the various steps and the evolution of our experimental
study. In the first tests, we studied the variance and the MSE of the SGD algorithm during
its learning process. As shown in Figure 7, in the model learning phase, the concept
drift detector, the stationarity statistical test in this case, is applied, right after the sliding
window size is determined accordingly, and then we work on optimizing the exchange
rate forecasting margin error of the multilinear regression function that we optimize in our
SGD algorithm.
For optimizing the regression model weights, both SGD and PSO every 60 days are
involved in our experimental study. In SGD, weights are optimized using the gradient
descent weights update, Formula (5), in the part of Algorithm 1 where we give as input
the new window to the SGD. The second way weights are updated is based on the PSO
formula in Algorithm 2 where the particle speed is added to the weight value:
xd ← xd + vd (8)
As illustrated in Algorithm 2, the speed is then calculated based on the the search space
range, the best particle weight found, the best swarm weight found, and the current weight.
Figures 9 and 10 show that the SGD itself is making good progress. After receiving
1000 instances, the mean squared error (MSE) became more stable, and the variance reached
its best stability after receiving 3000 instances.
We updated the learning rate by adding or subtracting 20% of its value and multi-
plying it by 0.99 or 1.01. We remarked that the learning rate has no impact on the model
performance improvement in the case of our architecture. The results did not change and
stayed similar to those obtained with the default parameters. As we noted, even when
making the previously mentioned updates on the learning rate, the error still does not
stabilize until the algorithm reaches around 1000 processed instances.
Figure 11 shows the EUR/USD close price historical data from 1 January 2001 to
1 January 2004. We notice that the value range changed completely comparing 2001 and
2002 to 2003 and 2004, revealing the importance of online learning for financial time
series processing.
Figures 12 and 13 show the predicted values in orange versus the actual values in blue
using the SGD alone. On the other hand, Figure 14 shows the results as we integrate the
PSO metaheuristic every 60 days into the learning process. The accuracy for all the plots
is good and reaches 82%. This means that the models correctly predict the price direction
in 82% of the cases. The added value of the PSO metaheuristic is noticeable in terms of
the margin error, which decreases significantly as the price decreases. The PSO helped
minimize the margin error between the predicted and actual values as the price crashed
between instances 20 and 30.
85
Electronics 2023, 12, 2039
Figures 15 and 16 show, the EUR/USD daily close price time series and histogram,
respectively, from 30/05/2000 to 28/07/2000. The price values show the volatility of the
time series data stream that we need to deal with using concept drift detection techniques.
Tables 1–3 summarize statistical values such as the mean and the variance. They also
contain a p-value that indicates whether the data is stationary or not. If the p-value is higher
than 0.05, the null hypothesis (H0) cannot be rejected, and the data are non-stationary. The
results show that in the case of this two-month time series, we have a stationary trend every
15 days, but as we study a whole month or two months, the trend is non-stationary.
We made tests to compare the fixed and flexible window sizes. For the fixed-size case,
the chosen size is 15 instances at each iteration because, according to our statistical studies,
the data tend to have the same pattern every two weeks. For the flexible window size, we
study the next 15 days’ stationarity. If the data are stationary, the algorithm receives 15 new
instances. If the data are not stationary, the algorithm receives only one new instance.
Table 4 shows the prediction results for year 2000 EUR/USD historical data as it
represents the first data received by the system. In most intervals except [75:90], [90:105],
and [120:135], the mean squared error for the flexible-size window case exceeds the fixed-
size window case. Meanwhile, for all intervals, we notice that the accuracy using the
flexible-size window exceeds or equals the accuracy given using a fixed-size window. To
illustrate the predicted vs. the real values, Figures 17 and 18 show the interval [60:74]. We
can see that at each point, the real and predicted values are closer in the flexible approach
compared to the fixed window approach. The ARV results are all way smaller than 1, which
means that our model predicts way better than simply taking the mean. ARV also shows
the data points’ variation, and from the obtained values, we can see that the instances are
not too correlated to one another.
Table 1. The EUR/USD statistics from 30 May 2000 to 28 July 2000.
Mean 0.9819729708789546
Variance 0.008933902258522159
ADF Statistic −1.535025
p-value 0.516119
Critical Values 1%: −3.563; 5%: −2.919; 10%: −2.597
Table 2. The EUR/USD statistics from 30 May 2000 to 28 July 2000 split into two equal parts.
Data 1st 30 Days 2nd 30 Days
Mean 0.984582 0.979364
Variance 0.008592 0.008965
ADF Statistic −1.084344 −1.193593
p-value 0.721275 0.676346
1%: −3.770; 1%: −3.809;
Critical Values 5%: −3.005; 5%: −3.022;
10%: −2.643 10%: −2.651
86
Electronics 2023, 12, 2039
Table 3. The EUR/USD statistics from 30 May 2000 to 28 July 2000 split into four equal parts.
Data 1st 15days 2nd 15days 3rd 15days 4th 15days
Mean 0.983657 0.985506 0.986441 0.972288
Variance 0.008653 0.008529 0.008389 0.009440
ADF Statistic −4.419853 −3.628841 −17.540606 −16.313688
p-value 0.000274 0.005233 0.0 0.0
1%: −4.473 1%: −4.473 1%: −4.473 1%: −4.473
Critical Values 5%: −3.290 5%: −3.290 5%: −3.290 5%: −3.290
10%: −2.772 10%: −2.772 10%: −2.772 10%: −2.772
Table 4. The flexible vs. the fixed sliding window results from year 2000 EUR/USD historical data.
Flexible Window Size Fixed Window Size
Range MSE ARV Accuracy Range MSE ARV Accuracy
[0:15] 0.0027 0.0519 66.6 [0:15] 0.002902 0.0538 66.6
[1:16] 0.002534 0.0503 66.6 [15:30] 0.00528 0.0726 80.0
[2:17] 0.00237 0.0486 73.3
[3:18] 0.00217 0.0465 73.3
[4:19] 0.0028 0.0529 73.3
[5:20] 0.002 0.0447 73.3
[6:21] 0.00192 0.0438 80.0
[7:22] 0.00201 0.0448 86.6
[8:23] 0.0031 0.0556 86.6
[9:24] 0.00404 0.0635 80.0
[10:25] 0.00528 0.0726 80.0
[11:26] 0.00608 0.0779 80.0
[26:41] 0.00727 0.0852 66.6 [30:45] 0.01416 0,1189 66.6
[27:42] 0.00658 0.0811 66.6
[28:43] 0.00586 0.0765 66.6
[29:44] 0.00495 0.0703 66.6
[30:45] 0.00494 0.0702 66.6
[31:46] 0.00546 0.0738 66.6 [45:60] 0.00607 0.0779 93.3
[32:47] 0.00686 0.0828 66.6
[33:48] 0.00623 0.0789 66.6
[34:49] 0.00699 0.0836 66.6
[35:50] 0.00788 0.0887 73.3
[36:51] 0.00874 0.0934 73.3
[37:52] 0.00917 0.0957 73.3
[38:53] 0.00895 0.0946 73.3
[39:54] 0.01016 0,1007 80.0
[40:55] 0.00887 0.0941 86.6
[41:56] 0.00856 0.0925 93.3
[42:57] 0.00857 0.0925 93.3
[43:58] 0.00874 0.0934 93.3
[44:59] 0.00895 0.0946 93.3
[45:60] 0.00849 0.0921 93.3
[46:61] 0.00922 0.096 93.3 [60:75] 0.00936 0.0967 73.3
87
Electronics 2023, 12, 2039
Table 4. Cont.
Flexible Window Size Fixed Window Size
Range MSE ARV Accuracy Range MSE ARV Accuracy
[47:62] 0.00782 0.0884 93.3
[48:63] 0.0071 0.0842 86.6
[49:64] 0.00649 0.0805 86.6
[50:65] 0.00635 0.0796 86.6
[51:66] 0.00657 0.081 86.6
[52:67] 0.00709 0.0842 80.0
[53:68] 0.00843 0.0918 80.0
[54:69] 0.00836 0.0914 80.0
[55:70] 0.00908 0.0952 73.3
[56:71] 0.01043 0,1021 73.3
[57:72] 0.01237 0,1112 73.3
[58:73] 0.00573 0.0756 73.3
[59:74] 0.00464 0.0681 73.3
[74:89] 0.00688 0.0829 80.0 [75:90] 0.0047 0.0685 80.0
[75:90] 0.00781 0.0883 80.0
[76:91] 0.00917 0.0957 80.0 [90:105] 0.00672 0.0819 60.0
[77:92] 0.01095 0.1046 80.0
[78:93] 0.0127 0.1126 86.6
[79:94] 0.01469 0.1212 80.0
[80:95] 0.01651 0.1284 73.3
[81:96] 0.01672 0.1293 73.3
[82:97] 0.01695 0.1301 73.3
[83:98] 0.01727 0.1314 66.6
[84:99] 0.01819 0.1348 66.6
[85:100] 0.01864 0.4317 66.6
[86:101] 0.0186 0.1363 66.6
[87:102] 0.01881 0.1371 66.6
[88:103] 0.01814 0.1346 66.6
[89:104] 0.01837 0.1355 66.6
[90:105] 0.01754 0.1324 60.0
[91:106] 0.01636 0.1279 60.0 [105:120] 0.03948 0,1986 53.3
[92:107] 0.01427 0.1194 60.0
[93:108] 0.01176 0.1084 66.6
[94:109] 0.00956 0.0977 73.3
[95:110] 0.00766 0.0875 73.3
[96:111] 0.0074 0.086 73.3
[97:112] 0.00712 0.0843 73.3
[98:113] 0.00684 0.0827 66.6
[99:114] 0.00586 0.0765 60.0
[100:115] 0.00486 0.0697 60.0
[101:116] 0.00624 0.0789 66.6
[102:117] 0.00562 0.0749 60.0
[103:118] 0.00836 0.0914 53.3
[104:119] 0.01005 0.1002 60.0
[105:120] 0.01068 0.1033 53.3
[120:135] 0.01108 0.10526 60.0 [120:135] 0.00885 0.094 60.0
88
Electronics 2023, 12, 2039
Figure 9. The variance regression score progress.
Figure 10. The MSE regression score progress.
Figure 11. The EUR/USD close price historical data from 1 January 2001 to 1 January 2004.
Figure 12. The real vs. the predicted values using the SGD algorithm.
89
Electronics 2023, 12, 2039
Figure 13. The real vs. the predicted values using the SGD algorithm on a bigger test dataset.
Figure 14. The real vs. the predicted values using the SGD algorithm optimized using the PSO
metaheuristic every 60 days.
Figure 15. The EUR/USD daily close price time series from 30 May 2000 to 28 July 2000.
Figure 16. The EUR/USD daily close price histogram from 30 May 2000 to 28 July 2000.
90
Electronics 2023, 12, 2039
Figure 17. The flexible window: the predicted vs. the real value for the interval [60:74].
Figure 18. The fixed window: the predicted vs. the real value for the interval [60:74].
4.7. Discussions
Figure 9 shows the regression score variance. We see that the model should perform
the learning through multiple sliding windows and receive a certain number of instances to
reach the point where we can rely on the proposed algorithm results for decision making.
The same is true for Figure 10, where the mean squared error convergence reached its
limit starting from receiving approximately 1000 instances. One of the biggest challenges of
using gradient descent algorithms is building a model that converges as much as possible.
In addition, the best convergence is not guaranteed with the first algorithm execution. Since
the weights are often primarily initialized randomly, little by little we limit the search space
of the optimal weights to a smaller range.
The learning rate speeds up as the gradient moves while descending. If you set it too
high, your path will become unstable, and if you set it too low, the convergence will be slow.
If you set it to zero, your model is not picking up any new information from the gradients.
As we worked on updating the learning rate alpha by decreasing or increasing its value,
we did not notice a difference, and we still obtained the best convergence beyond receiving
1000 instances. The fact that reducing the error to some extent only requires receiving a
certain amount of data may help to explain those results.
On the other hand, Figure 11 reveals the importance of DSM to erase the old irrelevant
models and build a newer one that fits the new data trends. However, keeping the irrelevant
models aside for potential future use can be a good idea. As for some study cases, patterns
can reappear occasionally or periodically.
Figures 12–14 compared integrating the PSO metaheuristic to online learning vs.
not using it. The positive impact is noticed as the price crashes. The margin error was
significantly reduced when the PSO was used. Even though the computational and time
costs of using the PSO are higher, integrating it periodically to enhance the forecasting
quality is promising.
The volatility illustrated in Figures 15 and 16 is one of the biggest challenges en-
countered in the FTSERF. It has to be managed by minimizing the risks that it reveals. In
91
Electronics 2023, 12, 2039
cases of high volatility, using flexible sliding windows becomes a must. By doing this,
we can guarantee that the windows are the right size to see emerging trends and make
wise choices.
As noticed from Figures 17 and 18, flexible sliding windows ensured the suggested
algorithm had an optimal duration, accuracy, and error margin. The PSO periodic integra-
tion and the adaptive sliding windows achieved the fastest convergence. The training and
forecasting performances of the algorithm with a flexible window size are better when we
compare them to those of the learning algorithm with a fixed window size.
In traditional machine learning, the future fluctuations are adjusted based on previous
expectation errors. It consists of investing historical knowledge about past fluctuations, and
the model is making decisions or forecasts based on the training it went through. However,
as we integrate DSM techniques, adaptive expectations are also ensured by calculating
the statistical distribution for every new data stream. The model receives at each iteration
fifteen instances, which are minimized to one instance at each iteration as soon as a high
level of volatility is detected in the fifteen instances of the new sliding window, which
makes the model more adaptive compared to real-time approaches without data stream
mining techniques that work on detecting the change and reacting to it.
5. Conclusions and Perspectives
Our study aims to explore the DSM techniques’ efficiency in financial time series
forecasting. We mainly used the SGD, and for weight optimization, we integrated the PSO
metaheuristic periodically every 60 days. Our target variable was the Euro’s value relative
to the US dollar. The first technique involved in DSM is adaptive sliding windows. We
tested the cases of using a flexible window whose size changes depending on the data
volatility versus using a fixed sliding window. The second technique involved in DSM is
change detection. It is the stationarity statistical study where we test if the time series has
a constant variance. The flexible sliding window proved its ability to forecast the price
direction, as it achieved better accuracy compared to using a fixed sliding window. The
adaptivity with the changes in the dataset patterns also assured better price and value
forecasting with less margin error, especially as the PSO is involved. Future work will focus
on testing more online models and concept drift techniques for financial time series and
comparing the strengths and weaknesses of each one. Further experimental tests can also
be performed by including other periods of crisis and testing other financial time series.
Author Contributions: Conceptualization, Z.B.; methodology, Z.B.; software, Z.B.; validation, Z.B.;
formal analysis, Z.B.; investigation, Z.B.; resources, Z.B.; data curation, Z.B.; writing—original draft
preparation, Z.B.; writing—review and editing, Z.B.; visualization, Z.B.; supervision, O.B. and J.S.-M.;
project administration, O.B. and J.S.-M.; funding acquisition, O.B. and J.S.-M. All authors have read
and agreed to the published version of the manuscript.
Funding: This work was supported by a scholarship received from Erasmus+ exchange program and
funding from Centro de Innovación para la Sociedad de la Información, University of Las Palmas de
Gran Canaria (CICEI-ULPGC).
Data Availability Statement: We published the dataset we used in this research at the following link:
https://github.com/zinebbousbaa/eurusdtimeseries accessed on 27 March 2023.
Conflicts of Interest: All authors have no conflict of interest to disclose.
Abbreviations
The following abbreviations are used in this manuscript:
DSM Data Stream Mining
FTSERF Financial Time Series Exchange Rate Forecasting
PSO Particle Swarm Optimization Metaheuristic
SGD Stochastic Gradient Descent
92
Electronics 2023, 12, 2039
References
1. Gerlein, E.A.; McGinnity, M.; Belatreche, A.; Coleman, S. Evaluating machine learning classification for financial trading: An
empirical approach. Expert Syst. Appl. 2016, 54, 193–207. [CrossRef]
2. Bousbaa, Z.; Bencharef, O.; Nabaji, A. Stock Market Speculation System Development Based on Technico Temporal Indicators
and Data Mining Tools. In Heuristics for Optimization and Learning; Springer: Berlin/Heidelberg, Germany, 2021; pp. 239–251.
3. Stitini, O.; Kaloun, S.; Bencharef, O. An Improved Recommender System Solution to Mitigate the Over-Specialization Problem
Using Genetic Algorithms. Electronics 2022, 11, 242. [CrossRef]
4. Jamali, H.; Chihab, Y.; García-Magariño, I.; Bencharef, O. Hybrid Forex prediction model using multiple regression, simulated
annealing, reinforcement learning and technical analysis. Int. J. Artif. Intell. ISSN 2023, 2252, 8938. [CrossRef]
5. Bifet, A.; Holmes, G.; Pfahringer, B.; Kranen, P.; Kremer, H.; Jansen, T.; Seidl, T. Moa: Massive online analysis, a framework for
stream classification and clustering. In Proceedings of the First Workshop on Applications of Pattern Analysis, PMLR, Windsor,
UK, 1–3 September 2010; pp. 44–50.
6. Bifet, A. Adaptive Stream Mining: Pattern Learning and Mining from Evolving Data Streams; Ios Press: Amsterdam, The Netherlands,
2010; Volume 207.
7. Thornbury, W.; Walford, E. Old and New London: a Narrative of Its History, Its People and Its Places; Cassell Publisher: London, UK,
1878; Volume 6.
8. Cummans, J. A Brief History of Bond Investing. 2014. Available online: http://bondfunds.com/ (accessed on 24 February 2018).
9. BIS site development project. Triennial central bank survey: Foreign exchange turnover in April 2016. Bank Int. Settl. 2016.
Available online: https://www.bis.org/publ/rpfx16.htm (accessed on 24 February 2018).
10. Lange, G.M.; Wodon, Q.; Carey, K. The Changing Wealth of Nations 2018: Building a Sustainable Future; Copyright: International
Bank for Reconstruction and Development, The World Bank 2018, License type: CC BY, Access Rights Type: open, Post date: 19
March 2018; World Bank Publications: Washington, DC, USA, 2018; ISBN 978-1-4648-1047-3.
11. Makridakis, S.; Hibon, M. ARMA models and the Box–Jenkins methodology. J. Forecast. 1997, 16, 147–163. [CrossRef]
12. Tinbergen, J. Statistical testing of business cycle theories: Part i: A method and its application to investment activity. In Statistical
Testing of Business Cycle Theories; Agaton Press: New York, NY, USA, 1939; pp. 34–89.
13. Xing, F.Z.; Cambria, E.; Welsch, R.E. Natural language based financial forecasting: a survey. Artif. Intell. Rev. 2018, 50, 49–73.
[CrossRef]
14. Cheung, Y.W.; Chinn, M.D.; Pascual, A.G. Empirical exchange rate models of the nineties: Are any fit to survive? J. Int. Money
Financ. 2005, 24, 1150–1175. [CrossRef]
15. Clifton, C., Jr.; Frazier, L.; Connine, C. Lexical expectations in sentence comprehension. J. Verbal Learn. Verbal Behav. 1984,
23, 696–708. [CrossRef]
16. Brachman, R.J.; Khabaza, T.; Kloesgen, W.; Piatetsky-Shapiro, G.; Simoudis, E. Mining business databases. Commun. ACM 1996,
39, 42–48. [CrossRef]
17. Hu, M.; Liu, B. Mining and summarizing customer reviews. In Proceedings of the Tenth ACM SIGKDD International Conference
on Knowledge Discovery and Data Mining, Seattle, WA, USA, 22–25 August 2004; pp. 168–177.
18. Ali, T.; Omar, B.; Soulaimane, K. Analyzing tourism reviews using an LDA topic-based sentiment analysis approach. MethodsX
2022, 9, 101894. [CrossRef]
19. Cambria, E.; White, B. Jumping NLP curves: A review of natural language processing research. IEEE Comput. Intell. Mag. 2014,
9, 48–57. [CrossRef]
20. Rather, A.M.; Sastry, V.; Agarwal, A. Stock market prediction and Portfolio selection models: A survey. Opsearch 2017, 54, 558–579.
[CrossRef]
21. Cavalcante, R.C.; Brasileiro, R.C.; Souza, V.L.; Nobrega, J.P.; Oliveira, A.L. Computational intelligence and financial markets: A
survey and future directions. Expert Syst. Appl. 2016, 55, 194–211. [CrossRef]
22. Gadre-Patwardhan, S.; Katdare, V.V.; Joshi, M.R. A Review of Artificially Intelligent Applications in the Financial Domain. In
Artificial Intelligence in Financial Markets; Springer: Berlin/Heidelberg, Germany, 2016; pp. 3–44.
23. Curry, H.B. The method of steepest descent for non-linear minimization problems. Q. Appl. Math. 1944, 2, 258–261. [CrossRef]
24. Shao, H.; Li, W.; Cai, B.; Wan, J.; Xiao, Y.; Yan, S. Dual-Threshold Attention-Guided Gan and Limited Infrared Thermal Images for
Rotating Machinery Fault Diagnosis Under Speed Fluctuation. IEEE Trans. Ind. Inform. 2023, 1–10. [CrossRef]
25. Lv, L.; Zhang, J. Adaptive Gradient Descent Algorithm for Networked Control Systems Using Redundant Rule. IEEE Access 2021,
9, 41669–41675. [CrossRef]
26. Sirignano, J.; Spiliopoulos, K. Stochastic gradient descent in continuous time. Siam J. Financ. Math. 2017, 8, 933–961. [CrossRef]
27. Audrino, F.; Trojani, F. Accurate short-term yield curve forecasting using functional gradient descent. J. Financ. Econ. 2007,
5, 591–623.
28. Bonyadi, M.R.; Michalewicz, Z. Particle swarm optimization for single objective continuous space problems: A review. Evol.
Comput. 2017, 25, 1–54. [CrossRef]
29. Kennedy, J.; Eberhart, R. Particle swarm optimization. In Proceedings of the ICNN’95-International Conference on Neural
Networks, Perth, WA, Australia, 27 November–1 December 1995; IEEE: Piscataway, NJ, USA, 1995; Volume 4, pp. 1942–1948.
93
Electronics 2023, 12, 2039
30. Shi, Y.; Eberhart, R. A modified particle swarm optimizer. In Proceedings of the 1998 IEEE International Conference on
Evolutionary Computation Proceedings. IEEE World Congress on Computational Intelligence (Cat. No. 98TH8360), Anchorage,
AK, USA, 4–9 May 1998; IEEE: Piscataway, NJ, USA, 1998; pp. 69–73.
31. Jha, G.K.; Thulasiraman, P.; Thulasiram, R.K. PSO based neural network for time series forecasting. In Proceedings of the
2009 International Joint Conference on Neural Networks, Atlanta, GA, USA, 14–19 June 2009; IEEE: Piscataway, NJ, USA, 2009;
pp. 1422–1427.
32. Wang, K.; Chang, M.; Wang, W.; Wang, G.; Pan, W. Predictions models of Taiwan dollar to US dollar and RMB exchange rate
based on modified PSO and GRNN. Clust. Comput. 2019, 22, 10993–11004. [CrossRef]
33. Junyou, B. Stock Price forecasting using PSO-trained neural networks. In Proceedings of the 2007 IEEE Congress on Evolutionary
Computation, Singapore, 25–28 September 2007; IEEE: Piscataway, NJ, USA, 2007; pp. 2879–2885.
34. Yang, F.; Chen, J.; Liu, Y. Improved and optimized recurrent neural network based on PSO and its application in stock price
prediction. Soft Comput. 2021, 27, 3461–3476. [CrossRef]
35. Huang, C.; Zhou, X.; Ran, X.; Liu, Y.; Deng, W.; Deng, W. Co-evolutionary competitive swarm optimizer with three-phase for
large-scale complex optimization problem. Inf. Sci. 2023, 619, 2–18. [CrossRef]
36. Auer, P. Online Learning. In Encyclopedia of Machine Learning and Data Mining; Sammut, C., Webb, G.I., Eds.; Springer: Boston,
MA, USA, 2016; pp. 1–9.
37. Benczúr, A.A.; Kocsis, L.; Pálovics, R. Online machine learning algorithms over data streams. J. Encycl. Big Data Technol. 2018,
1207–1218.
38. Julie, A.; McCann, C.Z. Adaptive Machine Learning for Changing Environments. 2018. Available online: https://www.turing.ac.
uk/research/research-projects/adaptive-machine-learning-changing-environments (accessed on 1 September 2018).
39. Grootendorst, M. Validating your Machine Learning Model. 2019. Available online: https://towardsdatascience.com/validating-
your-machine-learning-model-25b4c8643fb7 (accessed on 26 September 2018).
40. Gepperth, A.; Hammer, B. Incremental learning algorithms and applications. In European Symposium on Artificial Neural Networks
(ESANN); HAL: Bruges, Belgium, 2016.
41. Li, S.Z. Encyclopedia of Biometrics: I-Z; Springer Science & Business Media: Berlin/Heidelberg, Germany, 2009; Volume 2.
42. Vishal Nigam, M.J. Advantages of Adaptive AI Over Traditional Machine Learning Models. 2019. Available online: https:
//insidebigdata.com/2019/12/15/advantages-of-adaptive-ai-over-traditional-machine-learning-models/ (accessed on 15 De-
cember 2018).
43. Santos, J.D.D. Understanding and Handling Data and Concept Drift. 2020. Available online: https://www.explorium.ai/blog/
understanding-and-handling-data-and-concept-drift/ (accessed on 24 February 2018).
44. Brownlee, J. A Gentle Introduction to Concept Drift in Machine Learning. 2020. Available online: https://machinelearningmastery.
com/gentle-introduction-concept-drift-machine-learning/ (accessed on 10 December 2018).
45. Das, S. Best Practices for Dealing With Concept Drift. 2021. Available online: https://neptune.ai/blog/concept-drift-best-
practices (accessed on 8 November 2018).
46. Brzezinski, D.; Stefanowski, J. Prequential AUC for classifier evaluation and drift detection in evolving data streams. In
Proceedings of the International Workshop on New Frontiers in Mining Complex Patterns; Springer: Berlin/Heidelberg, Germany, 2014;
pp. 87–101.
47. Dodge, Y. The Concise Encyclopedia of Statistics; Springer Science & Business Media: Berlin/Heidelberg, Germany, 2008.
48. Chan, J.; Choy, S. Analysis of covariance structures in time series. J. Data Sci. 2008, 6, 573–589. [CrossRef]
49. Ruppert, D.; Matteson, D.S. Statistics and Data Analysis for Financial Engineering; Springer: Berlin/Heidelberg, Germany, 2011;
Volume 13.
50. Zhang, C.; Zhang, Y.; Cucuringu, M.; Qian, Z. Volatility forecasting with machine learning and intraday commonality. arXiv 2022,
arXiv:2202.08962.
51. Hsu, M.W.; Lessmann, S.; Sung, M.C.; Ma, T.; Johnson, J.E. Bridging the divide in financial market forecasting: machine learners
vs. financial economists. Expert Syst. Appl. 2016, 61, 215–234. [CrossRef]
52. DEMİREL, U.; Handan, Ç.; Ramazan, Ü. Predicting stock prices using machine learning methods and deep learning algorithms:
The sample of the Istanbul Stock Exchange. Gazi Univ. J. Sci. 2021, 34, 63–82. [CrossRef]
53. Guerra, P.; Castelli, M.; Côrte-Real, N. Machine learning for liquidity risk modelling: A supervisory perspective. Econ. Anal.
Policy 2022, 74, 175–187. [CrossRef]
54. Kou, G.; Chao, X.; Peng, Y.; Alsaadi, F.E.; Herrera-Viedma, E. Machine learning methods for systemic risk analysis in financial
sectors. Technol. Econ. Dev. Econ. 2019, 25, 716–742. [CrossRef]
55. Leippold, M.; Wang, Q.; Zhou, W. Machine learning in the Chinese stock market. J. Financ. Econ. 2022, 145, 64–82. [CrossRef]
56. Shivarova, A.; Matthew, F. Dixon, Igor Halperin, and Paul Bilokon: Machine learning in Finance from Theory to Practice. 2021.
Available online: https://rdcu.be/daRTw (accessed on 8 November 2018).
57. Das, S.R.; Mishra, D.; Rout, M. A hybridized ELM-Jaya forecasting model for currency exchange prediction. J. King Saud-Univ.-
Comput. Inf. Sci. 2020, 32, 345–366. [CrossRef]
58. Nayak, S.C. Development and performance evaluation of adaptive hybrid higher order neural networks for exchange rate
prediction. Int. J. Intell. Syst. Appl. 2017, 9, 71. [CrossRef]
94
Electronics 2023, 12, 2039
59. Yu, L.; Wang, S.; Lai, K.K. An Online BP Learning Algorithm with Adaptive Forgetting Factors for Foreign Exchange Rates
Forecasting. In Foreign-Exchange-Rate Forecasting with Artificial Neural Networks; Springer: Boston, MA, USA, 2007; pp. 87–100.
[CrossRef]
60. Soares, S.G.; Araújo, R. An on-line weighted ensemble of regressor models to handle concept drifts. Eng. Appl. Artif. Intell. 2015,
37, 392–406. [CrossRef]
61. Carmona, J.; Gavalda, R. Online techniques for dealing with concept drift in process mining. In Proceedings of the International
Symposium on Intelligent Data Analysis; Springer: Berlin/Heidelberg, Germany, 2012; pp. 90–102.
62. Yan, H.; Ouyang, H. Financial time series prediction based on deep learning. Wirel. Pers. Commun. 2018, 102, 683–700. [CrossRef]
63. Barddal, J.P.; Gomes, H.M.; Enembreck, F. Advances on concept drift detection in regression tasks using social networks theory.
Int. J. Nat. Comput. Res. (IJNCR) 2015, 5, 26–41. [CrossRef]
64. Chen, J.F.; Chen, W.L.; Huang, C.P.; Huang, S.H.; Chen, A.P. Financial time-series data analysis using deep convolutional neural
networks. In Proceedings of the 2016 7th International Conference on Cloud Computing and Big Data (CCBD), Macau, China,
16–18 November 2016; IEEE: Piscataway, NJ, USA, 2016; pp. 87–92.
65. Sammut, C.; Webb, G.I. Encyclopedia of Machine Learning; Springer Science & Business Media: Berlin/Heidelberg, Germany, 2011.
66. Kumar Chandar, S. Fusion model of wavelet transform and adaptive neuro fuzzy inference system for stock market prediction.
J. Ambient. Intell. Humaniz. Comput. 2019, 1–9. [CrossRef]
67. Pradeepkumar, D.; Ravi, V. Forex rate prediction: A hybrid approach using chaos theory and multivariate adaptive regression
splines. In Proceedings of the 5th International Conference on Frontiers in Intelligent Computing: Theory and Applications; Springer:
Berlin/Heidelberg, Germany, 2017; pp. 219–227.
68. Wang, L.Y.; Park, C.; Yeon, K.; Choi, H. Tracking concept drift using a constrained penalized regression combiner. Comput. Stat.
Data Anal. 2017, 108, 52–69. [CrossRef]
69. Baier, L.; Hofmann, M.; Kühl, N.; Mohr, M.; Satzger, G. Handling Concept Drifts in Regression Problems–the Error Intersection
Approach. arXiv 2020, arXiv:2004.00438.
70. Maneesilp, K.; Kruatrachue, B.; Sooraksa, P. Adaptive parameter forecasting for forex automatic trading system using fuzzy time
series. In Proceedings of the 2011 International Conference on Machine Learning and Cybernetics, Guilin, China, 10–13 July 2011;
IEEE: Piscataway, NJ, USA, 2011; Volume 1, pp. 189–194.
71. Yu, L.; Wang, S.; Lai, K.K. An online learning algorithm with adaptive forgetting factors for feedforward neural networks in
financial time series forecasting. Nonlinear Dyn. Syst. Theory 2007, 7, 51–66.
72. Ilieva, G. Fuzzy Supervised Multi-Period Time Series Forecasting; Sciendo: Warszawa, Poland, 2019.
73. Bahrepour, M.; Akbarzadeh-T, M.R.; Yaghoobi, M.; Naghibi-S, M.B. An adaptive ordered fuzzy time series with application to
FOREX. Expert Syst. Appl. 2011, 38, 475–485. [CrossRef]
74. Martín, C.; Quintana, D.; Isasi, P. Grammatical Evolution-based ensembles for algorithmic trading. Appl. Soft Comput. 2019,
84, 105713. [CrossRef]
75. Hoan, M.V.; Mai, L.C.; Hui, D.T. Pattern discovery in the financial time series based on local trend. In Proceedings of the International
Conference on Advances in Information and Communication Technology; Springer: Berlin/Heidelberg, Germany, 2016; pp. 442–451.
76. Yu, L.; Wang, S.; Lai, K.K. Forecasting Foreign Exchange Rates Using an Adaptive Back-Propagation Algorithm with Optimal
Learning Rates and Momentum Factors. In Foreign-Exchange-Rate Forecasting with Artificial Neural Networks; Springer: Boston,
MA, USA, 2007; pp. 65–85.
77. Castillo, G.; Gama, J. An adaptive prequential learning framework for Bayesian network classifiers. In Proceedings of the European
Conference on Principles of Data Mining and Knowledge Discovery; Springer: Berlin/Heidelberg, Germany, 2006; pp. 67–78.
78. Ramírez-Gallego, S.; Krawczyk, B.; García, S.; Woźniak, M.; Herrera, F. A survey on data preprocessing for data stream mining:
Current status and future directions. Neurocomputing 2017, 239, 39–57. [CrossRef]
79. Husson, F.; Lê, S.; Pagès, J. Analyse de Données avec R; Presses universitaires de Rennes: Rennes, France, 2016.
80. Brockwell, P.J.; Davis, R.A. Introduction to Time Series and Forecasting; Springer: Berlin/Heidelberg, Germany, 2002.
81. Binder, M.D.; Hirokawa, N.; Windhorst, U. Encyclopedia of Neuroscience; Springer: Berlin/Heidelberg, Germany, 2009; Volume 3166.
82. Pandey, P. Understanding the Mathematics behind Gradient Descent. 2019. Available online: https://towardsdatascience.com/
understanding-the-mathematics-behind-gradient-descent-dde5dc9be06e (accessed on 18 March 2019).
83. Clerc, M.; Siarry, P. Une nouvelle métaheuristique pour l’optimisation difficile: La méthode des essaims particulaires. J3eA 2004,
3, 007. [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
95
electronics
Article
LST-GCN: Long Short-Term Memory Embedded Graph
Convolution Network for Traffic Flow Forecasting
Xu Han and Shicai Gong *
College of Science, Zhejiang University of Science and Technology, Hangzhou 310023, China;
[email protected]
* Correspondence: [email protected]; Tel.: +86-137-7758-5486
Abstract: Traffic flow prediction is an important part of the intelligent transportation system. Accurate
traffic flow prediction is of great significance for strengthening urban management and facilitating
people’s travel. In this paper, we propose a model named LST-GCN to improve the accuracy of current
traffic flow predictions. We simulate the spatiotemporal correlations present in traffic flow prediction
by optimizing GCN (graph convolutional network) parameters using an LSTM (long short-term
memory) network. Specifically, we capture spatial correlations by learning topology through GCN
networks and temporal correlations by embedding LSTM networks into the training process of GCN
networks. This method improves the traditional method of combining the recurrent neural network
and graph neural network in the original spatiotemporal traffic flow prediction, so it can better
capture the spatiotemporal features existing in the traffic flow. Extensive experiments conducted
on the PEMS dataset illustrate the effectiveness and outperformance of our method compared with
other state-of-the-art methods.
Keywords: traffic flow forecasting; long short-term memory network; graph convolutional network
Citation: Han, X.; Gong, S. LST-GCN:
Long Short-Term Memory Embedded 1. Introduction
Graph Convolution Network for
In recent years, with the increase in the utilization rate of automobiles, the traffic flow
Traffic Flow Forecasting. Electronics
2022, 11, 2230. https://doi.org/
on the road is increasing day by day. When the road is insufficient to accommodate vehicles,
10.3390/electronics11142230
problems such as traffic congestion and traffic accidents will emerge. In this situation, traffic
flow prediction is of great significance [1,2]. Traffic flow prediction refers to an analysis
Academic Editor: Wojciech using traffic flow, speed and other information obtained by sensors in a certain road section
Mazurczyk
for future prediction. It provides effective assistance in planning driving routes, thereby
Received: 16 June 2022 avoiding potential traffic jams.
Accepted: 16 July 2022 Traffic flow prediction is inseparable from the temporal and spatial information in the
Published: 17 July 2022 road network. Individually considering any aspect of the information in the prediction
will lead to a lack of information, and hence affect the accuracy of prediction. We need to
Publisher’s Note: MDPI stays neutral
predict outcomes from both a temporal and spatial perspective. Traffic data are recorded
with regard to jurisdictional claims in
at fixed time points and fixed locations in space. Observations at adjacent locations and
published maps and institutional affil-
iations.
adjacent timestamps are not independent of each other, but are dynamically related. The
key to such tasks is to explore dynamic correlations in data space and time to make
accurate predictions.
With the advancement of technology, it has become easier to obtain data about the
Copyright: © 2022 by the authors. transportation networks, which also makes it more convenient for us to predict the traffic
Licensee MDPI, Basel, Switzerland. flow. Using cameras, sensors and other equipment on the highway, people can collect
This article is an open access article a large amount of time-series data, including traffic flow, speed, occupancy, and other
distributed under the terms and information, which provides a solid data foundation for traffic forecasting, thus giving
conditions of the Creative Commons birth to a series of traffic forecast methods [3]. These include statistical methods and
Attribution (CC BY) license (https:// machine-learning methods. These methods either rely on feature engineering or cannot
creativecommons.org/licenses/by/ consider both the time and space information of the data and have certain limitations in the
4.0/).
Electronics 2022, 11, 2230. https://doi.org/10.3390/electronics11142230 https://www.mdpi.com/journal/electronics
97
Electronics 2022, 11, 2230
prediction of traffic flow. With the development of deep learning, some researchers tried to
use graph convolutional networks to predict traffic flow or combine graph convolutional
networks with recurrent neural networks to capture spatial and temporal features in traffic
flow. Although much progress has been made in the prediction of traffic flow, most studies
do not consider the periodicity of traffic flow, so the prediction of traffic flow still does not
achieve the desired accuracy. To improve the accuracy of model predictions, we take into
account the weekly and daily periodicity of traffic flow.
To make a more accurate traffic flow prediction, the LST-GCN model is proposed
in this paper, and the LSTM model [4] is embedded into the parameter training of the
GCN model [5], to capture the time and space information more synchronously. Further,
we explore the internal relation of time and space, and reduce the number of parameter
training, so as to make more accurate prediction.
The original combined model is relatively simple in processing data sets, such as the
combined model of LSTM model and GCN model. For traffic flow data, the GCN model is
used to update the node flow information at each moment separately to obtain data space
information, and then using the LSTM model further combines the node traffic information
at all times to obtain information about the time of the data. The disadvantage of this
method is that the number of model parameters and calculations are large. In response to
this problem, we propose a new LST-GCN embedded structure. Different from previous
models, we directly embed the LSTM model into the update process of GCN parameters,
which greatly reduces the number of parameters and the amount of computation. At
the same time, the model can make good use of the temporal and spatial information of
the data.
The remainder of this paper is organized as follows. The related works on traffic flow
forecasting are discussed in Section 2. In Section 3, we propose some definitions about traffic
flow and introduce the structure of the GCN model and LSTM models. Section 4 proposes
the LST-GCN model to capture spatial correlations by learning topology through GCN
networks and temporal correlations by embedding LSTM networks into the training process
of GCN networks. In Section 5, a comprehensive assessment of the model performance is
conducted using real road-traffic datasets. At the same time, the experimental results are
discussed. Section 6 concludes the paper and provides an outlook on future work.
2. Related Work
2.1. Traffic Forecasting
There are two main types of methods for traffic flow forecasting: one is the statistical
method and the other is the machine-learning method. The statistical methods mainly
include ARIMA (autoregressive integrated moving average model) [6–8], HA (history aver-
age model) [3], ES (exponential smoothing model) [9] and KF (Kalman filter model) [10–13].
ARIMA models analyze time-series data and use them to make predictions about future
traffic flows. The ARIMA model [6–8] assumes that the change in traffic flow is linear. The
HA model [2] uses the least-squares method to evaluate the parameters of the model to
further predict the traffic flow. The ES model [9] and the KF model [10–13] are suitable for
making predictions on traffic flow with a smaller amount of data. The assumptions of these
models are relatively strict. Once random interference occurs, the accuracy of the models
will decrease. They rely on the assumption of stability. At the same time, these models
cannot reflect the nonlinearity of traffic conditions. Therefore, the use of these models has
certain limitations.
There are many machine-learning methods for traffic flow prediction, which are mainly
divided into two categories: the traditional machine-learning method and the deep-learning
method. The SVR (support vector regression) model [14], KNN (K-nearest neighbor)
model [15], Bayesian model [16], fuzzy logic model [17], neural-network model [18], etc.,
as traditional machine-learning methods, are often used to predict traffic flow. The SVR
model [14] introduces a supervised machine-learning method called regressive online
support vector machines, which can make short-term traffic flow predictions for both
98
Electronics 2022, 11, 2230
typical and atypical conditions. The KNN model [15] takes the k value and dm value of the
nearest neighbors as the input parameters of the model, and combines the prediction range
of multiple intervals to optimize the parameter values of the model, and then predict the
value of traffic flow. The Bayesian model [16] first searches the manifold neighborhood,
and then obtains a higher accuracy of the manifold neighborhood, and then proposes a
traffic-state prediction method based on the expansion strategy of adaptive neighborhood
selection. Fuzzy logic models [17] use fuzzy methods to classify input data into clusters,
which in turn specify input–output relationships. The neural-network model [18] is the
first attempt to build an artificial neural network based on historical traffic data, aiming to
predict traffic volume based on historical data at major urban intersections. This type of
model has strong nonlinear mapping ability, and the data requirements are not as strict as
statistical methods, so it can better adapt to the uncertainty of traffic flow and effectively
improve the prediction effect. However, the spatial structure of observation points is
unstructured, and the above methods do not use the spatial structure information of the
data, and only analyzing from the time dimension has certain limitations in improving the
prediction accuracy.
The deep-learning models originally used for traffic flow prediction mainly include
the GRU (gated recurrent unit) model [19] and LSTM model. The GRU model and LSTM
model are important recursive neural-network models that are used to integrate and
analyze temporal information to make predictions. Compared with the prediction models
based on statistical learning and machine-learning methods, deep learning can model
multidimensional features and realize the approximation of complex functions by learning
the deep nonlinear network structures, which can better learn the abundant changes
inherent in traffic flow. It can simulate its complex nonlinear relationship and greatly
improve the accuracy of traffic flow prediction. However, these models also did not
consider the influence of the spatial structure of the data on the prediction results, and did
not fully mine the spatiotemporal characteristics of the traffic data. There are also certain
limitations in predicting traffic flow.
Recently, models that consider spatiotemporal information have sparked a lot of
research. Wu et al. [20] designed a feature fusion framework for short-term traffic flow
prediction by combining the CNN (convolutional neural network) model with the LSTM
model. This framework uses a one-dimensional CNN to describe the spatial features of
traffic flow data. For the time-varying periodicity and temporal variation of the traffic
flow, this framework utilizes two LSTM models. DCRNN, proposed by Li et al. [21], uses
a bidirectional random walk to capture spatial dependencies and an encoder-decoder
with predetermined sampling to capture temporal dependencies. Sun et al. [22] con-
structed a multibranch framework called TFPNet (traffic flow prediction network), a
deep-learning framework for short-term traffic flow prediction. TPFNet uses a multi-
layer fully convolutional network structure to extract the relationship from local to global
hierarchical space. Zhao et al. [23] proposed the T-GCN model, which combines gated
recurrent units with graph convolutional networks for short-term traffic flow prediction.
Geng et al. [24] designed a spatiotemporal multigraph convolutional network that first
encodes the non-Euclidean pairwise correlations between regions into multiple graphs, and
then uses multigraph convolution to explicitly map these correlations. Diao et al. [25] used
a dynamic Laplacian matrix estimator to discover changes in the Laplacian matrix, which
in turn made predictions about traffic flow. Huang et al. [26] proposed the cosAtt model,
a graph-attention network that integrates cosAtt and GCN into a spatial gating block.
Lv et al. [27] modeled various global features in road networks, including spatial, temporal,
and semantic correlations, and proposed a temporal multigraph convolutional network.
Guo et al. [28] used the attention mechanism for traffic flow prediction and proposed an
AST-GCN model. The attention mechanism has been applied in both time and space and
achieved better prediction results.
99
Electronics 2022, 11, 2230
2.2. Convolutions on Graphs
In order to solve the irregularity of the spatial neighborhood, Bruna et al. [29] made a
breakthrough from the spectral space and proposed a spectral network on the graph. Ac-
cording to the knowledge of graph theory, they decompose the Laplacian matrix spectrally
and use the obtained eigenvalues and eigenvectors to define the convolution operation in
the spectral space. To simplify the problem of complexity, Defferrard et al. [30] proposed
a Chebyshev network, which defined the convolution kernel as a polynomial form, and
used Chebyshev expansion to approximate the calculation of the convolution kernel, which
greatly improved the computational efficiency. After that, Kipf and Welling [5] simplified
the Chebyshev network, using only a first-order approximate convolution kernel, and
made a little sign change, resulting in the well-known graph-convolution network.
2.3. Long Short-Term Memory Network
Bengio et al. [31] proposed the RNN (recurrent neural network) model. Using the
RNN model can help people process sequence data more efficiently. In the RNN model,
people can reinput the output of a neuron at a certain time as the input to the neuron.
For the dependencies between time-series data, the network structure of the RNN model
can adequately maintain them. However, this model suffers from vanishing gradients
and exploding gradients. To solve the problems of gradient disappearance and gradient
explosion in the traditional RNN model, Hochreiter et al. [4] proposed the LSTM network.
The LSTM network is improved from the traditional RNN model. Compared with the RNN
model, the hidden unit of the LSTM model has more complexity. At the same time, the
LSTM model has a wider range of applications than RNN and is a more effective sequence
model. During the run of the model, the LSTM model can selectively add or subtract
information by adding linear interventions.
3. Preliminaries
3.1. Traffic Networks
Definition 1. Road network G. We use G = (V, E, A) to denote a spatial network, as shown
in Figure 1, where |V | = N is the set of vertices and N is the number of vertices. E is the
set of edges, which reflects the connections between road sections. A ∈ R N × N is the adjacency
matrix of the network G. The value of each element represents the connectivity between the
corresponding road segments. An element value of 1 indicates connectivity, and an element value of
0 indicates disconnection.
Figure 1. The spatial-temporal structure of traffic data, where the data at each time slice form a graph.
100
Electronics 2022, 11, 2230
(t)
Definition 2. The graph feature matrix XG ∈ R N ×C , where C is the number of attribute features
and t represents the time step. The graph signal matrix represents the observations of the spatial
network G at the time step t.
The problem of traffic flow data prediction can be described as learning a mapping
function, f, which maps the historical spatiotemporal network sequence
( t − T +1) ( t − T +2) (t)
XG , XG , . . . , XG into future observations of this spatiotemporal network
( t +1) ( t +2) (t+ T )
XG , XG , . . . , XG , where T represents the length of the historical spatiotem-
poral network sequence and T denotes the length of the target spatiotemporal network
sequence to be predicted.
3.2. GCN Model
Based on the Chebyshev network, Kipf and Welling proposed the GCN model. The
updated convolution formula of each layer of the GCN model node is as follows:
H ( l +1) = σ D D
− 12 A − 12 H (l ) W (l ) , (1)
= A + IN
A (2)
= D + IN
and D (3)
Among them, H ( l +1)
represents the node representation of the l + 1-th layer, H (l )
represents the node representation of the l + 1-th layer, and W (l ) represents the learnable
parameters of the l-th layer. A represents the adjacency matrix, IN represents the identity
matrix, and D represents the degree matrix.
By determining the topological relationship between the central node and the sur-
rounding nodes, the GCN model can simultaneously encode the topological structure of the
road network and the attributes of the nodes, so that spatial dependencies can be captured
on this basis.
3.3. LSTM Model
The LSTM model is a typical RNN (recurrent neural network) model, which is pro-
posed to solve the problems of gradient disappearance and gradient explosion existing in
the traditional RNN model. The structure diagram of LSTM is shown in Figure 2, and the
Equations are shown in (4)~(9).
Figure 2. LSTM model diagram.
101
Electronics 2022, 11, 2230
it = σ (Wi xt + Ui ht−1 + bi ), (4)
f t = σ W f x t + U f h t −1 + b f , (5)
ot = σ (Wo xt + Uo ht−1 + bo ), (6)
ct = tanh(Wc xt + Uc ht−1 + bc ), (7)
ct = it ∗ ct + f t ∗ ct−1 (8)
and ht = ot ∗ tanh(ct ). (9)
where it controls the input of the input gate to ct , f t controls the memory level of the
forget gate for ct−1 , and ot controls the output of tanh(ct ). Since the activation function is a
sigmoid function, the values of it , f t , and ot are in between 0 and 1.
The LSTM model uses the hidden state of the previous moment and the parameter
information of the current moment as input to determine the parameter state of the current
moment. Due to the gating mechanism, the LSTM model retains the changing trend of
historical parameter information when capturing the parameter information at the current
moment. Therefore, the model can capture the time-varying features of traffic dynamics
from parametric data. In this paper, we apply the LSTM model to learn the temporal-
varying trend of traffic states.
4. Method
Figure 3 shows the general framework of the LST-GCN model. The model consists of
three parts with the same structure, and the model is established by representing data from
three perspectives: adjacent time, daily cycle, and weekly cycle. As shown in Figure 3, this
paper takes χh , χd , and χw as input, respectively. We consider each sensor as a node, and the
sensor information about the three dimensions of traffic flow, vehicle speed, and occupancy
rate is regarded as the vector representation of the node. χh , χd , and χw represent the
node representation of all nodes at the adjacent time, the daily cycle, and the weekly
cycle, respectively.
Figure 3. LST-GCN model frame diagram.
102
Electronics 2022, 11, 2230
Xh ∈ R N × F×T , N represents the number of nodes; the value of F is 3, which represents
the three dimensions of traffic flow, vehicle speed, and occupancy; and T represents the
length of the adjacent time slice.
We update the node representation through the LSTM-GCN block, and then use a
fully connected layer to make predictions, and the results are denoted by Yh , Yd , and Yw ,
respectively. Afterwards, the prediction results of the three series of proximity correlation,
daily correlation, and weekly correlation are weighted and combined to obtain the final
result, which is represented by Y.
Figure 4 shows the general framework of the LSTM-GCN block. Taking χh as an
example, we take Xt0 −h+1 , Xt0 −h+2 , . . . , Xt0 as input. Xh ∈ R N × F×T , N represents the
number of nodes; the value of F is 3, which represents the three dimensions of traffic
flow, vehicle speed, and occupancy; and T represents the length of the adjacent time
slice. Xt0 −h+1 , Xt0 −h+2 , . . . , Xt0 represents the representation of each moment of χh .
Through the LSTM-GCN block, we can update the node representation to obtain Xt1 −h+1 ,
0
Xt1 −h+2 , . . . , Xt10 . Through the connection between the parameters, all GCN models are
0
combined together and the representation of each vector is updated in time and space.
Figure 4. LSTM-GCN block diagram.
To explore the distribution of data from the perspective of space and time simultane-
ously, we introduce the LSTM model into the parameter update process of the GCN model.
For the parameter W (l ) , we connect the W (l ) at each moment through the LSTM model, as
shown in Equation (10).
(l ) (l )
Wt = LSTM Wt−1 (10)
Meanwhile, at time t, the convolution operation from the lth layer to the l + 1-th layer
is the same as that of the GCN model, as shown in Equation (11).
( l +1) D
− 12 A − 12 , H (l ) , W (l )
Ht = GCONV D t t (11)
103
Electronics 2022, 11, 2230
Combining Equations (10) and (11), we can obtain the update rule of node representa-
tion at l + 1-th layer, as shown in Equation (12).
( l +1) (l ) D
− 12 A − 12 , H (l ) , W (l )
Ht , Wt = LST − GCN D t t −1 (12)
Figure 5 illustrates the update of the node. At time t, the representation of the node
at l + 1-th layer is determined by the node and the parameters at l-th layer through
convolution. Similarly, we can calculate the node representation of any layer. The node
at the zeroth layer at time t is represented Xt corresponding to time t, that is, the vector
representation of each sensor in the three dimensions of traffic flow, vehicle speed, and
occupancy at time t. For the parameter W of each layer, we can update it through the
LSTM model.
Figure 5. Node update.
5. Experiment
5.1. Data Set and Processing
To verify the effectiveness of our model, we used the California highway dataset.
PEMS uses sensors to acquire real-world traffic data from more than 8100 locations on Cali-
fornia highways and highway systems, which are integrated into multiple time intervals.
We selected the PEMS04 dataset and the PEMS08 dataset. The PEMS04 dataset contains
the traffic data of San Francisco Bay from 1 January 2018 to 28 February 2018 collected by
3848 sensors, including three aspects of traffic, speed, and occupancy, where we selected
data from 307 of these sensors for verification. The PEMS08 dataset contains the traffic data
of San Bernardino from 1 July 2016 to 31 August 2016 collected by 1979 sensors, including
three aspects of traffic, speed, and occupancy, where we selected data from 170 of these
sensors for verification.
We first removed redundant sensors with distances of less than 3.5 miles; some
data were missing from the original traffic speed dataset due to equipment failures, etc.
Considering the spatiotemporal characteristics of traffic data, we used linear interpolation
for missing values.
The traffic information in both datasets was updated every 5 min. In chronological
order, we selected the first 60% of the data as the training set, the middle 20% of the data as
the validation set, and the last 20% of the data as the test set.
Since the distance between each sensor was different, we chose the inverse of the
distance as the element value of the adjacency matrix, thereby constructing the adjacency
matrix. Because of the different dimensions, we normalized all the data, as shown in
Equation (13).
X − Xmin
Xnorm = . (13)
Xmax − Xmin
104
Electronics 2022, 11, 2230
5.2. Experimental Setup
Considering the influence of periodicity on the experimental results, we divided the
experimental data into adjacent time series, daily period series, and weekly period series.
They are represented by χh , χd , and χw , respectively. We fed χh , χd , and χw as inputs to
the three LSTM-GCN subnetworks for training, respectively, and combined the outputs
of the three subnetworks into the final output. We conducted experiments on a server
configured with a Xeon Platinum 8163 processor clocked at 2.7 GHz and an NVIDIA Tesla
P100 graphics card with 16 GB of VRAM. When training on the PMES04 dataset, the
number of iterations was 100, the batch size was 16, and the Adam optimizer was used to
update the parameters with a learning rate of 0.01. When training on the PMES08 dataset,
the number of iterations was 200, the batch size was 32, the Adam optimizer was used for
parameter update, and the learning rate was 0.01.
5.3. Evaluation Indicators
The experiment tests the model performance through RMSE (root-mean-square error),
MAE ((mean absolute error) and MAPE (mean absolute percentage error); the formulas are
defined as follows:
1 n
MAE = ∑i=1 |ŷi − yi |, (14)
n
1 n ŷ − yi
MAPE = 100% × ∑ i (15)
n y
i =1 i
1 n
and RMSE =
n ∑i=1 (ŷi − yi )2 (16)
where n is the number of predicted values, ŷi is the predicted value, and yi is the true value.
5.4. Results
As shown in Table 1, our model outperforms other models on both datasets. Since the
HA model and the ARIMA model are linear models and only consider the information
of the time dimension, the prediction effect of the models is relatively poor. The SVR
model and the GRU model use machine-learning methods to analyze data, and have better
nonlinear mapping capabilities than the HA model and the ARIMA model. However,
the SVR model and the GRU model also only analyze the data from the time dimension,
without considering the spatial dimension, so the prediction effect of the model is only
better than the HA model and the ARIMA model. The ASTGCN model uses an attention
mechanism from the temporal and spatial dimensions, respectively. Compared with the
ARIMA model, the LSTM model, and the GRU model, the model considers the information
of the spatial dimension, thereby significantly improving the prediction effect of the data.
The LST-GCN model uses the LSTM model to update the parameters of the GCN model,
which avoids the problem of too many parameters caused by separating the two models. It
also considers the information of the time dimension and the space dimension. At the same
time, the model also combines adjacent sequences and daily sequences. Three sequences of
weekly sequence are used to predict the traffic flow. Considering the influence of periodicity
on the prediction results, the data information is greatly utilized. Therefore, the model
in this paper has achieved better prediction results than other models. For example, for
the PEMS04 dataset, using RMSE, MAE, and MAPE as evaluation metrics, respectively,
LST-GCN has an average improvement of 0.9%, 2.2%, and 1.3% compared with ASTGCN.
For the PEMS08 dataset, using RMSE, MAE, and MAPE as evaluation metrics, respectively,
LST-GCN achieves an average improvement of 2.5%, 3.7%, and 1.8% compared to ASTGCN.
105
Electronics 2022, 11, 2230
Table 1. Average performance comparison of different approaches on PEMS04 and PEMS08.
PMES04 PMES08
Model
RMSE MAE MAPE(%) RMSE MAE MAPE(%)
HA 54.16 36.68 19.69 44.06 29.46 15.25
ARIMA 68.16 32.01 19.17 43.31 24.05 14.34
SVR 45.75 29.45 17.09 36.98 23.13 13.81
GRU 45.16 28.64 16.27 35.96 22.25 13.03
ASTGCN 35.23 22.93 16.58 28.16 18.61 13.05
LST-GCN 34.93 22.43 16.37 27.47 17.93 12.81
To confirm the spatiotemporal prediction ability of the LST-GCN model, we respec-
tively compared the LST-GCN model with the LSTM model and the GCN model. As shown
in Figure 6, our LST-GCN model has a strong spatiotemporal prediction ability. Since the
LSTM model only considers the impact of time factors on traffic flow, while the GCN model
only considers the impact of spatial factors on traffic flow, these two models cannot fully
consider the information of the data. Therefore, the prediction accuracy of the LSTM model
and GCN model is relatively poor. For example, using RMSE as the evaluation metric, on
the PEMS04 dataset, LST-GCN has an average improvement of 9.2% compared with GCN,
and an improvement of 3.4% compared to LSTM. On the PEMS08 dataset, LST-GCN has an
average improvement of 13.9% compared to GCN and 3.5% compared to LSTM.
Figure 6. Average performance comparison of LST-GCN and GCN and LSTM on PEMS04 and
PEMS08. (a) RMSE comparison of LST-GCN and GCN and LSTM on PEMS04 and PEMS08. (b) MAE
comparison of LST-GCN and GCN and LSTM on PEMS04 and PEMS08. (c) MAPE comparison of
LST-GCN and GCN and LSTM on PEMS04 and PEMS08.
Figure 7 shows how the prediction performance of the model varies with the range of
prediction. With the increase in the prediction interval, the prediction error of the model will
gradually increase, and the prediction effect will inevitably deteriorate. The RMSE, MAE,
and MAPE values of the four models, HA, ARIMA, SVR, and GRU, increase continuously
with the increase in prediction time, and the variation range is large. Compared with these
four models, the ASTGCN model and the LST-GCN model continue to increase with the
prediction time, but the variation range is relatively small. This is because the first four
models only consider the impact of variation of time on the prediction results. With the
increase in prediction interval, the time dimension information between roads on future
traffic will have less and less impact, resulting in a lower and lower prediction accuracy of
the model. In the long-term prediction, the spatiotemporal correlation is a more important
predictor, so ASTGCN model and LST-GCN model are far superior to the other four models
106
Electronics 2022, 11, 2230
in the longer-term prediction. It can also be seen from the figure that the overall prediction
effect of our LST-GCN model is better than that of ASTGCN model, which indicates that
our LST-GCN model can better mine the spatiotemporal correlation of traffic data, to make
more accurate predictions.
To better understand the LST-GCN model, we selected a road segment on the PEMS04
dataset and PEMS08 dataset, respectively, and visualized the prediction results on the
test set. Figure 8a,b show the visualization results on two datasets, PEMS04 and PEMS08,
respectively. It can be seen that the simulation effect of the model is better. It can be
seen from the results that the prediction results of the LST-GCN model are relatively
smooth. We speculate that it may be because the GCN model adds a smoothing filter to the
Fourier domain and moves the filter to capture spatial features. This results in smoother
experimental results.
Figure 7. Performance changes of different methods as the forecasting interval increases. (a) Changes
on PEMS04 dataset, based on RMSE. (b) Changes on PEMS08 dataset, based on RMSE. (c) Changes
on PEMS04 dataset, based on MAE. (d) Changes on PEMS08 dataset, based on MAE. (e) Changes on
PEMS04 dataset, based on MAPE. (f) Changes on PEMS08 dataset, based on MAPE.
107
Electronics 2022, 11, 2230
Figure 8. The visualization results for prediction. (a) Results on PEMS04 dataset. (b) Results on
PEMS08 dataset.
6. Discussion
Accurate and rapid traffic flow prediction is an important issue affecting the develop-
ment of intelligent transportation. The original traffic prediction model basically has the
problem of large-parameter data or an inability to make full use of the data information.
The reason why our model results are better than other models is mainly because of the
following advantages: (1) We propose a new LST-GCN structure, which directly embeds
the LSTM model into the updating process of GCN parameters, reducing the number
of parameters; (2) compared with the model with a single model structure, our model
considers both time and space factors, and makes full use of data information.
Our model improves the performance of short-term traffic flow, but there are still
some issues to consider. Considering the “memory” capability introduced by the LSTM
model may have a negative impact on the time complexity. [32–34] This effect exists in
many cyclic structures. This needs further research in future work.
7. Conclusions
According to the traffic flow prediction problem, this paper proposes a method to
update the model parameters of the graph convolutional network model using the long
short-term memory neural-network model. By embedding the long short-term memory
neural network into the graph convolutional network and modeling from the perspective
of time and space at the same time, we further explore the internal connection of time
and space. At the same time, three sequences of adjacent sequence, daily sequence, and
weekly sequence are combined to predict traffic flow, and the influence of periodicity on the
prediction result is considered. Finally, the method in this paper is compared with several
common methods for predicting traffic flow through three evaluation indicators—RMSE,
MAE, and MAPE—and it is concluded that the model proposed in this paper is better than
other models on the PEMS dataset.
In the future, the main directions that need to be studied are: (1) applying the LST-
GCN model to more road segments and increasing the prediction period of the model;
(2) considering more complex road conditions, and improving our model by taking into
account other factors such as weather and traffic accidents; (2) applying the LST-GCN
model to other scenarios such as air quality prediction, energy prediction, etc.
Author Contributions: Conceptualization, X.H. and S.G.; Methodology, X.H.; Formal Analysis, S.G.;
Writing—Original Draft Preparation, X.H.; Writing—Review & Editing, S.G. All authors have read
and agreed to the published version of the manuscript.
Funding: This research received no external funding.
108
Electronics 2022, 11, 2230
Conflicts of Interest: The authors declare no conflict of interest.
Abbreviations
GCN Graph convolutional network
LSTM Long short-term memory network
ARIMA Autoregressive integrated moving average model
HA History average model
ES Exponential smoothing model
KF Kalman filter model
SVR Support vector regression model
KNN K-nearest neighbor model
GRU Gated recurrent unit model
CNN Convolutional neural network
RNN Recurrent neural network
References
1. Hani, S.M. Traveler behavior and intelligent transportation systems. Transp. Res. Part C Emerg. Technol. 1999, 7, 73–74.
2. Li, Y.; Lin, Y.; Zhang, F. Research on geographic information system intelligent transportation systems. Chung-Kuo K. Lu Hsueh
Pao China J. Highw. Transp. 2000, 13, 97–100.
3. Liu, J.; Guan, W. A summary of traffic flow forecasting methods. J. Highw. Transp. Res. Dev. 2004, 3, 82–85.
4. Ma, X.; Tao, Z.; Wang, Y. Long short-term memory neural network for traffic speed prediction using remote microwave sensor
data. Transp. Res. C Emerg. Technol. 2015, 54, 187–197. [CrossRef]
5. Kipf, T.N.; Welling, M. Semi-Supervised Classification with Graph Convolutional Networks. arXiv 2016, arXiv:1609.02907.
6. Levin, M.; Tsao, Y.-D. On forecasting freeway occupancies and volumes. Transp. Res. Rec. 1980, 773, 47–49.
7. Guo, J.; Huang, W.; Williams, B.M. Adaptive Kalman filter approach for stochastic short-term traffic flow rate prediction and
uncertainty quantification. Transp. Res. C Emerg. Technol. 2014, 43, 50–64. [CrossRef]
8. Shi, G.; Guo, J.; Huang, W.; Williams, B.M. Modeling seasonal heteroscedasticity in vehicular traffic condition series using a
seasonal adjustment approach. J. Transp. Eng. 2014, 140, 5. [CrossRef]
9. Chan, K.Y.; Dillon, T.S.; Singh, J.; Chang, E. Neural-network-based models for short-term traffic flow forecasting using a hybrid
exponential smoothing and Levenberg–Marquardt algorithm. IEEE Trans. Intell. Transp. Syst. 2012, 13, 644–654. [CrossRef]
10. Kumar, S.V. Traffic flow prediction using Kalman filtering technique. Procedia Eng. 2017, 187, 582. [CrossRef]
11. Zhou, T.; Jiang, D.; Lin, Z.; Han, G.; Xu, X.; Qin, J. Hybrid dual Kalman filtering model for short-term traffic flow forecasting. IET
Intell. Transp. Syst. 2019, 13, 1023–1032. [CrossRef]
12. Cai, L.; Zhang, Z.; Yang, J.; Yu, Y.; Zhou, T.; Qin, J. A noise-immune Kalman filter for short-term traffic flow forecasting. Phys. A
Stat. Mech. Appl. 2019, 536, 122601. [CrossRef]
13. Zhang, S.; Song, Y.; Jiang, D.; Zhou, T.; Qin, J. Noise-identified Kalman filter for short-term traffic flow forecasting. In Proceedings
of the IEEE 15th International Conference on Mobile Ad-Hoc Sensor Networks, Shenzhen, China, 11–13 December 2019; pp. 1–5.
14. Castro-Netoa, M.; Jeong, Y.S.; Jeong, M.K.; Hana, L. Online-svr for short-term traffic flow prediction under typical and atypical
traffic conditions. Expert Syst. Appl. 2009, 36, 6164–6173. [CrossRef]
15. Chang, H.; Lee, Y.; Yoon, B.; Baek, S. Dynamic near-term traffic flow prediction: System-oriented approach based on past
experiences. IET Intell. Transp. Syst. 2012, 6, 292–305. [CrossRef]
16. Su, Z.; Liu, Q.; Lu, J.; Cai, Y.; Jiang, H.; Wahab, L. Short-time traffic state forecasting using adaptive neighborhood selection based
on expansion strategy. IEEE Access 2018, 6, 48210–48223. [CrossRef]
17. Yin, H.; Wong, S.C.; Xu, J.; Wong, C.K. Urban traffic flow prediction using a fuzzy-neural approach. Transp. Res. Part C 2002, 10,
85–98. [CrossRef]
18. Çetiner, B.G.; Sari, M.; Borat, O. A Neural Network Based Traffic-Flow Prediction Model. Math. Comput. Appl. 2010, 15, 269–278.
[CrossRef]
19. Fu, R.; Zhang, Z.; Li, L. Using LSTM and GRU neural network methods for traffic flow prediction. In Proceedings of the 2016 31st
Youth Academic Annual Conference of Chinese Association of Automation, Wuhan, China, 11–13 November 2016.
20. Wu, Y.; Tan, H. Short-term traffic flow forecasting with spatial-temporal correlation in a hybrid deep learning framework. arXiv
2016, arXiv:1612.01022.
21. Li, Y.; Yu, R.; Shahabi, C.; Liu, Y. Diffusion convolutional recurrent neural network: Data-driven traffic forecasting. In Proceedings
of the 6th International Conference on Learning Representations (ICLR), Vancouver, BC, Canada, 30 Apr–3 May 3 2018.
22. Sun, S.; Wu, H.; Xiang, L. City-Wide Traffic Flow Forecasting Using a Deep Convolutional Neural Network. Sensors 2020, 20, 421.
[CrossRef]
23. Zhao, L.; Song, Y.; Zhang, C. T-GCN: A temporal graph convolutional network for traffic prediction. IEEE Trans. Intell. Transp.
2020, 21, 3848–3858. [CrossRef]
109
Electronics 2022, 11, 2230
24. Geng, X.; Li, Y.; Wang, L. Spatiotemporal multi-graph convolution network for ride-hailing demand forecasting. AAAI Conf. Artif.
Intell. 2019, 33, 3656–3663. [CrossRef]
25. Diao, Z.; Wang, X.; Zhang, D. Dynamic spatial-temporal graph convolutional neural networks for traffic forecasting. AAAI Conf.
Artif. Intell. 2019, 33, 890–897. [CrossRef]
26. Huang, R.; Huang, C.; Liu, Y. Lsgcn: Long short-term traffic prediction with graph convolutional networks. Int. Joint Conf. Artif.
Intell. 2020, 2355–2361.
27. Lv, M.; Hong, Z.; Chen, L. Temporal multi-graph convolutional network for traffic flow prediction. IEEE Trans. Intell. Transp. Syst.
2020, 22, 3337–3348. [CrossRef]
28. Guo, S.; Lin, Y.; Feng, N.; Song, C.; Wan, H. Attention Based Spatial-Temporal Graph Convolutional Networks for Traffic Flow
Forecasting. AAAI Conf. Artif. Intell. 2019, 33, 922–929. [CrossRef]
29. Bruna, J.; Zaremba, W.; Szlam, A.; LeCun, Y. Spectral networks and locally connected networks on graphs. arXiv 2014,
arXiv:1312.6203.
30. Defferrard, M.; Bresson, X.; Vandergheynst, P. Convolutional neural networks on graphs with fast localized spectral filtering. In
Advances in Neural Information Processing Systems; Morgan Kaufmann Publishers Inc.: San Francisco, CA, USA, 2016.
31. Bengio, Y.; Simard, P.; Frasconi, P. Learning long-term dependencies with gradient descent is difficult. IEEE Trans. Neural Netw.
1994, 5, 157–166. [CrossRef]
32. Mauro, M.D.; Galatro, G.; Liotta, A. Experimental Review of Neural-Based Approaches for Network Intrusion Management.
IEEE Trans. Netw. Service Manag. 2020, 17, 2480–2495. [CrossRef]
33. Dong, S.; Xia, Y.; Peng, T. Network Abnormal Traffic Detection Model Based on Semi-Supervised Deep Reinforcement Learning.
IEEE Trans. Netw. Service Manag. 2021, 18, 4197–4212. [CrossRef]
34. Pelletier, C.; Webb, G.I.; Petitjean, F. Deep Learning for the Classification of Sentinel-2 Image Time Series. In Proceedings of the
IGARSS 2019, Yokohama, Japan, 31 July 2019.
110
electronics
Article
Multi-Population Enhanced Slime Mould Algorithm and with
Application to Postgraduate Employment Stability Prediction
Hongxing Gao 1,2 , Guoxi Liang 3, * and Huiling Chen 4, *
1 Graduate School, Wenzhou University, Wenzhou 325035, China; [email protected]
2 Wenzhounese Economy Research Institute, Wenzhou University, Wenzhou 325035, China
3 Department of Information Technology, Wenzhou Polytechnic, Wenzhou 325035, China
4 College of Computer Science and Artificial Intelligence, Wenzhou University, Wenzhou 325035, China
* Correspondence: [email protected] (G.L.); [email protected] (H.C.)
Abstract: In this study, the authors aimed to study an effective intelligent method for employment
stability prediction in order to provide a reasonable reference for postgraduate employment decision
and for policy formulation in related departments. First, this paper introduces an enhanced slime
mould algorithm (MSMA) with a multi-population strategy. Moreover, this paper proposes a predic-
tion model based on the modified algorithm and the support vector machine (SVM) algorithm called
MSMA-SVM. Among them, the multi-population strategy balances the exploitation and exploration
ability of the algorithm and improves the solution accuracy of the algorithm. Additionally, the pro-
posed model enhances the ability to optimize the support vector machine for parameter tuning and
for identifying compact feature subsets to obtain more appropriate parameters and feature subsets.
Then, the proposed modified slime mould algorithm is compared against various other famous
algorithms in experiments on the 30 IEEE CEC2017 benchmark functions. The experimental results
indicate that the established modified slime mould algorithm has an observably better performance
compared to the algorithms on most functions. Meanwhile, a comparison between the optimal
Citation: Gao, H.; Liang, G.; Chen, H. support vector machine model and other several machine learning methods on their ability to predict
Multi-Population Enhanced Slime employment stability was conducted, and the results showed that the suggested the optimal support
Mould Algorithm and with vector machine model has better classification ability and more stable performance. Therefore, it is
Application to Postgraduate
possible to infer that the optimal support vector machine model is likely to be an effective tool that
Employment Stability Prediction.
can be used to predict employment stability.
Electronics 2022, 11, 209.
https://doi.org/10.3390/
Keywords: global optimization; meta-heuristic; support vector machine swarm intelligence
electronics11020209
Academic Editor: Marco Mussetta
Received: 5 December 2021
Accepted: 7 January 2022
1. Introduction
Published: 10 January 2022 In China, postgraduates are valuable talent resources. The employment quality of
postgraduates is not only related to their own sense of social belonging and security, but
Publisher’s Note: MDPI stays neutral
it also affects social stability and sustainable development, where employment stability
with regard to jurisdictional claims in
published maps and institutional affil-
is an important measure of postgraduate employment quality. Employment stability not
iations.
only affects the career development of individual graduate students, but it is also a focal
issue of educational equity and social stability. Moreover, employment stability not only
reflects practitioners’ psychological satisfaction with the employment unit, employment
environment, remuneration, and career development, but it is also an important indicator of
Copyright: © 2022 by the authors. employment quality. When the skill level and the salary level of the job match, employment
Licensee MDPI, Basel, Switzerland. stability is high. On the contrary, the practitioner will actively seek to change jobs if
This article is an open access article there is a disparity between those factors, and especially in cases where the salary level
distributed under the terms and is extremely mismatched with the skill level, the practitioner will face the risk of being
conditions of the Creative Commons fired and will passively change jobs, and employment stability will be low. It can be seen
Attribution (CC BY) license (https:// that employment stability also determines the employment quality of graduate students
creativecommons.org/licenses/by/ to a large extent. In addition, for enterprises, if they can retain talent and maintain the
4.0/).
Electronics 2022, 11, 209. https://doi.org/10.3390/electronics11020209 https://www.mdpi.com/journal/electronics
111
Electronics 2022, 11, 209
job stability of new graduate students, they can not only reduce labor costs, but these
enterprises can also achieve sustainable development. Therefore, it is necessary to analyze
the employment stability of graduate students through the effective mining of big data
related to post-graduation graduate employment and to construct an intelligent prediction
model using a fusion of intelligent optimization algorithms and machine learning methods
to verify the hypothesis of relevant relationships. At the same time, in order to provide
a reference for postgraduate employment decision making and policy formulation by
relevant departments, it is also necessary to dig into the key factors affecting the stable
employment of postgraduates, conduct in-depth analyses of key influencing factors, and
explore the main factors affecting the stability of postgraduate employment.
At present, many studies have been conducted by many researchers on employment
and employment stability. Yogesh et al. [1] applied artificial intelligence algorithms to
enrich the student employability assessment process. Li et al. [2] made full use of the
C4.5 algorithm to generate a type of employment data mining model for graduates. Liu
et al. [3] proposed a weight-based decision tree to help students improve their employability.
Mahdi et al. [4] proposed a novel method based on support vector machines, which was
applied to predicting cryptocurrency returns. Tu et al. [5] developed an adaptive SVM
framework to predict whether students would choose to start a business or find a job
after graduation. Additionally, there also have been many studies on swarm intelligence
algorithms. Cuong-Le et al. [6] presented an improved version of the Cuckoo search
algorithm (NMS-CS) using the random walk strategy. Abualigah et al. [7] presented a novel
nature-inspired meta-heuristic optimizer called the reptile search algorithm (RSA). Nadimi-
Shahraki et al. [8] introduced an enhanced version of the whale optimization algorithm
(EWOA-OPF), which combines the Levy motion strategy and Brownian motion. Gandomi
et al. [9] proposed an evolutionary framework for the seismic response formulation of
self-centering concentrically braced frame systems.
Therefore, in order to better predict the employment stability of graduate students, this
paper first proposes a modified slime mould algorithm (MSMA), the core of which is the
use of a multi-population mechanism to further balance the exploration and development
of the slime mould algorithm, effectively improving the accuracy of the solution of the
original slime mould algorithm. Further, a MSMA-based SVM model (MSMA-SVM) is
proposed, in which MSMA effectively enhances the accuracy of the classification prediction
of the original SVM. To demonstrate the performance of MSMA, MSMA and the slime
mould algorithm were first subjected to analytical experiments to obtain careful balance
and diversity using the 30 benchmark functions in the IEEE CEC2017 as a basis. In addition,
this paper not only compares MSMA with other traditional basic algorithms, including
differential evolution (DE) [10], the slime mould algorithm (SMA) [11], the grey wolf opti-
mizer (GWO) [12,13], the bat-inspired algorithm (BA) [14], the firefly algorithm (FA) [15],
the whale optimizer (WOA) [16,17], moth–flame optimization (MFO) [18–20], and the
sine cosine algorithm (SCA) [21], but it also compares MSMA with some algorithm vari-
ants that have previously demonstrated very good performance, including boosted GWO
(OBLGWO) [22], the balanced whale optimization algorithm (BWOA) [17], the chaotic
mutative moth–flame-inspired optimizer (CLSGMFO) [20], PSO with an aging leader and
challengers (ALCPSO) [23], the differential evolution algorithm based on chaotic local
search (DECLS) [24], the double adaptive random spare reinforced whale optimization
algorithm (RDWOA) [25], the chaos-enhanced bat algorithm (CEBA) [26], and the chaos-
induced sine cosine algorithm (CESCA) [27]. Ultimately, the comparative experimental
results that were obtained for the benchmark functions effectively illustrate that MSMA
not only provides better performance than the initial SMA, but that it is also offers greater
superiority than many common similar algorithms. To make better predictions and judg-
ments about the employment stability of graduate students, the comparative MSMA-SVM
experiments and experiments for other machine learning approaches were conducted. The
results of the experiments indicate that, among all the comparison methods, MSMA-SVM
can obtain more accurate classification results and better stability using the four indicators.
112
Electronics 2022, 11, 209
The rest of this paper is structures as follows: Section 2 provides a brief introduction
to SVM and SMA. In Sections 3 and 4, the proposed MSMA and the MSMA-SVM model
are described in detail, respectively. Section 5 mainly introduces the data source and
simulation settings. The experimental outcomes of MSMA on the benchmark functions
and the MSMA-SVM on the real-life dataset are analyzed in Section 6. A discussion of
the improved algorithm is provided in Section 7. Additionally, the last section provides
summaries and advice as they pertain to the present research.
In conclusion, the present research contributes the following major innovations:
(a) This paper proposes a novel version of SMA that combines a multi-population strategy
called MSMA.
(b) Experiments comparing MSMA with other algorithms are conducted on a benchmark
function set. The experimental results demonstrate that the proposed algorithm can
better balance the exploitation and exploration capabilities and has better accuracy.
(c) The MSMA algorithm is combined with the support vector machine algorithm to
construct a prediction model for the first time, which is called MSMA-SVM. Addi-
tionally, the MSMA-SVM model is employed in entrepreneurial intention prediction
experiments.
(d) The proposed MSMA in the benchmark function experiment and the MSMA-SVM
in entrepreneurial intention prediction demonstrate better performance than their
counterparts.
2. Background
2.1. Support Vector Machine
The core principle of SVMs is the development of a plane that is best able to divide
two kinds of data in such a way where the distance between the two is maximized and
where the classification has the greatest generalization power. Support-vector data are
the closest data to the boundary. The SVM is often a supervised learning approach that is
used to process classification data for the purpose of finding the best hyperplane that can
properly separate positive and negative samples.
With the given data set G = ( xi , yi ), i = 1, . . . , N, x ∈ Rd , y ∈ {±1}, the hyperplane
can be expressed as:
g( x ) = ω x + b (1)
In terms of the geometric understanding of the hyperplane, the maximization of the
geometric spacing is equal to the minimization of ||ω ||. The concept of a “soft interval” is
introduced, and the slack variable ξ i > 0 is applied in cases where there are few outliers.
One of the key parameters that can influence the ability of SVM classification is the disci-
plinary factor c, which represents the ability to accommodate outliers. A standard SVM
model is shown below:
⎧
⎨ N
min(ω ) = 12 ||ω ||2 + c ∑ ξ i 2
= (2)
⎩ i 1
s.t yi ω T xi + b ≥ 1 − ξ i , i = 1, 2, . . . , N
where ω is an inertia weight, and b is a constant.
In this way, the initial low dimensional sample set is mapped to the high dimensional
space H, allowing the best classification surface to be established in a linear method. Mean-
while, the SVM non-linearly transforms the linearly inseparable sample set Φ : Rd → H .
For the purposes of keeping the computed results of the sample set in the low dimen-
sional space corresponding to the results of the inner product that is mapped to the high
dimensional part, a suitable k xi , x j is constructed using generalized function theory to
113
Electronics 2022, 11, 209
denote the kernel function, with αi denoting the Lagrange multiplier, and Equation (3)
being converted to as it is seen below:
⎧ N N
⎪
⎪ Q(α) =
⎨
1
2 ∑ αi α j yi y j k xi , x j − ∑ αi
i =1 i =1 (3)
⎪
⎪
N
⎩ s.t ∑ ai yi = 0, 0 ≤ ai ≤ C, i = 1, 2, . . . , N
i =1
This paper adopts the generalized radial basis kernel function as the function model
of the support vector machine, and its expression is as follows:
k( x, y) = e−γ|| xi − x j || (4)
where γ is a kernel parameter, another element that is quite important to the classification
performance of an SVM, and it represents the interaction’s kernel function width.
2.2. Slime Mould Algorithm
Similar to many other recently proposed optimization algorithms, including Harris
hawks optimization (HHO) [28], the Runge Kutta optimizer (RUN) [29], the colony pre-
dation algorithm (CPA) [30], and hunger games search (HGS) [31], SMA is a novel and
high-performing swarm intelligence optimization algorithm that was developed by Li
et al. [11], who were motivated by the slime mould’s foraging behavior. Since its intro-
duction, SMA has been applied to many problems such as image segmentation [32,33],
engineering design [34], parameter identification in photovoltaic models [35], medical
decision-making [36], and multi-objective problems [37]. In this section, some mathemati-
cal models related to the mechanisms and characteristics of SMA are presented.
During its approach to food, the slime mould can be approached by odors in the
environment. To show its actions mathematically in terms of convergence, the expressions
below can be used to simulate its shrinkage pattern:
⎧ ! "
→ → → →
⎪
⎨ Xb (t) + v→b · W · X A (t) − XB (t) r < p
→
X( t +1) = , (5)
⎪
⎩ v→ · X→
c (t) , r≥p
→ →
where vb is a parameter in [− a, a], vC that takes values in the range [−1, 1], t acts as the the
→
quantity of current iterations, Xb represents the location of the individual found to have
→ → →
the best fitness value, X represents the location of the slime mould, X A and XB represent
→
two individuals chosen from the slime mould in a random way, W represents the weight of
→ →
the slime mould, and r is a stochastic number in the range [0, 1]. In addition, p, vb , vc , and
→
W are computed as follows:
p = tanh (|S(i ) − BF |) (6)
→
vb = [− a, a] (7)
→
= rand(−b, b)
vc (8)
! ! " "
FEs
a = arctanh − +1 (9)
Max_FEs
! "
FEs
b = 1− (10)
Max_FEs
⎧
→ ⎨ 1 + r · log BF−S(i) + 1 , condition
BF −WF
W ((SI ( FEs))) = (11)
⎩ 1 − r · log BF−S(i) + 1 , others
BF −WF
114
Electronics 2022, 11, 209
smell Index = sort(S) (12)
→
where i ∈ 1, 2, 3, · · · , n, S(i ) represents the fitness of X , BF and WF are the currently gained
best fitness and worst fitness, Fes is the current quantity of the evaluations, Max_FEs is the
maximum quantity of the evaluations, condition refers to the top half of the S(i ) ranking in
the population, and SI represents the sequence of the fitness values arranged in ascend-
ing order.
When food is being wrapped and as the concentration of food exposed to the vein
increases, the more powerful the propagation wave produced by the bio-oscillator and
the quicker the cytoplasmic flow are, resulting in thicker veins. Equation (11) models the
positive and negative feedback relationship between vein width and food concentration
in slime moulds. If the food concentration is higher, the weight of the nearby area will
increase, and at lower food concentrations, the weight of the area will decline, causing the
slime mould to move on to explore other areas. Therefore, the motility behavior of slime
moulds can be simulated using Equation (13).
⎧
⎪
⎪ ⎧ rand · ! (UB − LB) + LB " (1) rand < z
→
⎪
⎨ ⎪ → → → →
⎨ Xb ( t ) + v b · W · X A ( t ) − X B ( t ) r<p (2),
X∗ = (13)
⎪
⎪ , rand ≥ z
⎪ ⎪
⎩ ⎩ → →
v c · X( t ) , r≥p (3)
where the upper and lower bounds are expressed by UB and LB in the search range, and
rand and r are random values in [0, 1]. According to the original version, parameter z is set
to 0.03.
While grasping food, the way in which the slime moulds change the cytoplasmic flux
is mainly through the propagation wave of the biological oscillator, putting it in a more
favorable position for food concentration. W, vb, and vc were used to imitate the changes
→
observed in the venous width of slime moulds. The value of vb oscillates randomly between
→
[− a, a] and approaches 0 with increasing iterations of the primary key. The value of vc
varies between [−1, 1] and eventually converges to 0. The drifts of the two are monitored
in Figure 1, and these drifts are also specific to the task considered in this work.
→ →
Figure 1. Variations in vb and vc trends.
The pseudo-code of the SMA is displayed in Algorithm 1.
115
Electronics 2022, 11, 209
Algorithm 1 Pseudo-code of SMA
Initialize the parameters popsize, Max_FEs;
Initialize the population of slime mould Xi (i = 1, 2, 3, . . . n);
Initialize control parameters z, a;
While (t ≤ Max_FEs)
Calculate the fitness of slime mould;
Sorted in ascending order by fitness;
Update bestFitness, Xb ;
Calculate the W by Equation (12);
For i = 1 to popsize
Update p by Equation(6);
Update vb by Equations (7) and (9);
Update vb by Equations (8) and (10);
If rand < z
update positions by Equation (13)(1);
Else
update p, vb, vc;
If r < p
update positions by Equation (13)(2);
Else
update positions by Equation (13)(3);
End If
End If
End For
t = t + 1;
End While
Return bestFitness, Xb
3. Suggested MSMA
3.1. Multi-Population Structure
As an important factor that affects the information exchange between populations,
the topological structure of the population also has a great impact on the balancing of the
exploration and development processes. In the multi-population topological structure, the
structure is mainly composed of three parts, which are the dynamic sub-population number
strategy (DNS), the purposeful detecting strategy (PDS), the sub-populations regrouping
strategy (SRS).
DNS means that the whole population is separated into many sub-populations after
the first iteration. Usually, a sub-population is composed of two search individuals, and as
the quantity of iterations increases, the quantity of the sub-populations gradually decreases,
and the scale of the sub-populations increases. Additionally, only one sub-population is
left in the search space, which represents the aggregation of all of the sub-populations at
the ending of the iteration process. Smaller sub-populations can better help the swarm
maintain its diversity. With the iteration process, the population change characteristics
mainly show that the number of sub-populations gradually decreases and that the size of
sub-populations expands. The strategy enables individuals in the population to exchange
information more quickly and widely. In addition, the DNS implementation is decided by
the feedback of the changing principle of the subgroup quantity and the cycle. To resolve
the first problem, a set of integers N = {n1 , n2 , · · · , nk−1 , nk }, n1 > n2 > · · · > nk−1 > nk
are used, where the integer indicates the subgroup quantity. To ensure the implementation
of the DNS strategy, the size of each sub-population remains unchanged in one iteration,
that is, the whole number of individuals can be evenly divided by the quantity of the
sub-populations. For that changing period, a fixed stage is used to adapt the structure of
the whole population. The stage length is calculated by Cgen = MaxFEs/ N , where N
is the quantity of the integers in N, and MaxFEs delegates the preset number of evaluation
times to ensure that the efficient variation of sub-population quantity is efficient.
116
Electronics 2022, 11, 209
In SRS, the proposed method uses the same sub-population reorganization strategy
as the published enhanced particle swarm optimization [38], where Stagbest represents the
quantity of the best individual stagnations. The sub-population reorganization strategy
will be executed when the whole population stagnates in the suggested approach, and
the execution timing of the sub-population reorganization scheme is determined in this
way. Additionally, the scale of the sub-population impacts the frequency with which this
strategy is executed. As the scale of the sub-population increases, individuals need more
iterations to obtain useful guidelines. Because of the above points, the Stagbest calculation
method is shown below: Stagbest = Ssub /2.
PDS enhances the capability of the presented method to get rid of the local optima,
particularly in multi-modal problems. The collected population information is used to
guide the swarm to energetically search rooms with a higher search value, and many
researches have proven the superiority of the scheme [39,40]. To provide convenience
for PDS execution, it is stipulated that each dimension of the search room be equal in
size. The function of the segmentation mechanism is to help the search individuals collect
information. For PDS, the segments are classified. When the best search agent and when
the current individual are in the best exploration interval of the dimension, the best search
individual will select a search segment in the worst exploration interval of the same
dimension. If the fitness of that newly searched-for new candidate solution is superior
to the current optimal record, the optimal single position will be substituted by the new
solution. The underexplored intervals will be more fully explored because of the benefits
imparted by PDS. Meanwhile, a taboo scheme was attached to the PDS to avoid repeatedly
exploring the same area. When a segment sij is searched, the variable tabij that delegates the
segment is set to 1. Additionally, segment sij can only be found again when tabij is reset to
0. All flag variables will be recorded as 0 when each segment of each dimension has been
fully explored.
3.2. Proposed MSMA
The MSMA improvement principle is the addition of the dynamic multi-population
structure to the original SMA. The whole population is divided into many subgroups with
the same swarm scale at the start of the multi-population strategy. The equal scale of
the subgroups not only simplifies the general population structure, but it also simplifies
the process complication of adjusting and fusing the population structure. The multi-
population structure is employed to lead the whole population’s exploration tendency in
the direction of the improved search methodology by updating the SMA function. With the
continuation of the iterative process, the DNS strategy is to increase the scale of the sub-
populations while reducing their number in order to guide this method to the exploitation
stage. In addition, during the searching process, the PDS scheme is implemented to
realize information sharing among sub-populations and enhances algorithm exploration
capabilities as well. The SRS strategy will be executed to make the population jump out of
the local optima when the population is located in the local optima. The pseudocode of
Algorithm 2 below expresses those details of the MSMA framework.
117
Electronics 2022, 11, 209
Algorithm 2 Pseudo-code of MSMA
Initialize the parameters popsize, Max_FEs;
Initialize the population of slime mould Xi (i = 1, 2, 3, . . . n);
Initialize control parameters z, a;
While (t ≤ Max_FEs)
Calculate the fitness of slime mould;
Sorted in ascending order by fitness;
Update bestFitness, Xb ;
Calculate the W by Equation (12);
For i = 1 to popsize
Update p by Equation (6);
Update vb by Equations (7) and (9);
Update vb by Equations (8) and (10);
If rand < z
update positions by Equation (13)(1);
Else
update p, vb, vc;
If r < p
update positions by Equation (13)(2);
Else
update positions by Equation (13)(3);
End If
End If
End For
Perform DNS, SRS, and PDS from multi-population topological structure;
t = t + 1;
End While
Return bestFitness, Xb
The complexity of MSMA is mainly related to slime mould initialization, fitness calcula-
tion, weight calculation, position updating, and the complexity of DNS, SRS, and PDS. n rep-
resents the quantity of the slime mould, T represents the number of iterations, and dim rep-
resents the dimension of the objective function. Thus, the complexity of slime mould initial-
ization is O(n), the fitness calculation and ordering complexity is O( T × 3 × (n + nlog n)),
the weight calculation complexity is O( T × n × dim), and the position updating com-
plexity is O( T × n × dim). The DNS complexity is O ( T × (n + T × n)). The SRS com-
plexity is O ( T × n). The PDS complexity is O ( T × dim × Rn), where Rn represents
the quantity of segments in the dimension. Thus, the overall MSMA complexity is
O(n × (1 + T × n × ((5 + T ) + 3 × log n + 3 × dim))).
3.3. Proposed MSMA-SVM Method
Penalty factor C, the kernel parameter γ, and the optimal feature set are two important
factors that determine the classification results and algorithm complexity of the SVM
classification model. Usually, these two parameters are selected based on experience,
resulting in poor efficiency and accuracy. The feature subset also uses the whole set or
randomly selected variables, which also leads to poor efficiency and accuracy. Therefore, a
new solution model MSMA-SVM was proposed, in which MSMA is used to optimize two
vital parameters in SVM and in the feature subset. Then, the model will be applied to two
special situations in the actual world: medical diagnosis situations and financial forecasting
situations. The framework of the MSMA-SVM is displayed in Figure 2. The model mainly
contains two important components. The left two columns use MSMA to optimize the two
parameters and feature subset in the SVM model. In the right half, this optimized SVM
obtained the classification accuracy (ACC) through 10-fold cross-validation (CV), nine of
which were utilized for the training, and the rest was employed for test applications.
118
Electronics 2022, 11, 209
Figure 2. Flowchart of the suggested MSMA-SVM model.
4. Experiments
4.1. Collection of Data
The population studied in this article comprised (a total of 331) full-time postgraduate
students from the class of 2016 at Wenzhou University. According to the comparison of
the employment status of the 2016 postgraduate graduates after three years with the initial
postgraduate graduate employment program in September 2019, it was found that 153
postgraduates (46.22%) had not changed workplaces in three years, and 178 postgraduates
(53.78%) demonstrated separation behavior.
Through data mining and analyses gender, political outlook, professional attributes,
academic system, situations where the student experienced difficulty, student origin, aca-
demic performance (average course grades, teaching practice grades, social practice grades,
academic report grades, thesis grades), graduation destination, nature of initial employ-
ment unit, location of initial employment unit, initial employment position, degree of initial
employment and its relevance to the student’s major, monthly salary level during initial
employment, employment variation, current employment status, nature of current employ-
ment unit, location of current employment unit, variation in employment location, current
employment position, degree of current employment and its relevance to the student’s
major, current monthly salary level, and monthly salary difference (see Table 1), the authors
explored the importance and intrinsic connection of each index and built an intelligent
prediction model based on this information.
Table 1. Description of the total 26 attributes.
ID Attribute Description
Male and female students are marked as 1 and 2,
F1 gender
respectively.
There are four categories: Communist Party members,
reserve party members, Communist Youth League
F2 political status (PS)
members, and the masses, denoted by 1, 2, 3, and 13,
respectively.
division of liberal arts and
F3 Liberal arts and sciences are indicated by 1 and 2.
science (DLS)
The 3-year and 4-year academic terms are indicated by 3
F4 years of schooling (YS)
and 4.
There are four categories: non-difficult students,
students with difficulties employment difficulties, family financial difficulties,
F5
(SWD) and dual employment and family financial difficulties,
which are indicated by 0, 1, 2, and 3, respectively.
119
Electronics 2022, 11, 209
Table 1. Cont.
ID Attribute Description
There are three categories: urban, township, and rural,
F6 student origin (OS)
denoted by 1, 2, and 3, respectively.
There are three categories of direct employment,
career development after
F7 pending employment, and further education, which are
graduation (CDG)
indicated by 1, 2, and 3, respectively.
Employment pending is indicated by 0. State
organizations are indicated by 10, scientific research
institutions are indicated by 20, higher education
institutions are indicated by 21, middle and junior high
education institutions are indicated by 22, health and
unit of first employment
F8 medical institutions are indicated by 23, other
(UFE)
institutions are indicated by 29, state-owned enterprises
are indicated by 31, foreign-funded enterprises are
indicated by 32, private enterprises are indicated by 39,
troops are indicated by 40, rural organizations are
indicated by 55, and self-employment is indicated by 99.
Employment pending is indicated by 0, sub-provincial
location of first employment
F9 and above large cities by 1, prefecture-level cities by 2,
(LFE)
and counties and villages by 3.
Employment pending is represented by 0, civil servants
by 10, doctoral students and researchers by 11, engineers
position of first employment
F10 and technicians by 13, teaching staff by 24, professional
(PFE)
and technical staff by 29, commercial service staff and
clerks by 30, and military personnel by 80.
degree of specialty relevance The correlation between major and job is measured, and
F11
of first employment (DSRFE) the higher the percentage, the higher the correlation.
monthly salary of first Used to measure the average monthly salary earned,
F12
employment (MSFE) with higher values indicating higher salary levels.
Three years after graduation, the employment status is
status of current employment represented by 1, 2, and 3 for the categories of
F13
(SCE) employment, pending employment, and further
education, respectively.
When comparing the employment units three years after
F14 employment change (EC) graduation with initial employment units, no change is
indicated by 0 and any change is indicated by 1.
The nature of the employment unit three years after
unit of current employment
F15 graduation is expressed in the same way as the nature of
(UCE)
initial employment unit in F8.
The type employment location three years after
location of current
F16 graduation is expressed in the same way as the initial
employment (LCE)
employment location in F9.
Used to measure the changes in employment location
from the initial employment location three years after
graduation and is expressed as the difference between
change in place of
F17 F16 current employment location type and F9 initial
employment (CPE)
employment location type, and the larger the absolute
value of the difference, the larger the change in
employment location.
position of current The job type three years after graduation is expressed in
F18
employment (PCE) the same way as the initial employment job type in F10.
The professional relevance of employment three years
specialty relevance of current
F19 after graduation is expressed in the same way as the
employment (SRCE)
initial employment job type in F11.
The monthly salary level three years after graduation is
monthly salary of current
F20 expressed in the same way as the monthly salary level
employment (MSCE)
during initial employment in F12.
120
Electronics 2022, 11, 209
Table 1. Cont.
ID Attribute Description
Used to measure the changes in the graduates’ monthly
salary in their current employment and initial
employment, i.e., the difference between F20 monthly
F21 salary difference (SD)
salary level in current employment and F12 monthly
salary level in initial employment, with a larger value
indicating a larger increase in monthly salary.
Used to assess the how much the postgraduate students
learned while they were in school and is the average of
F22 grade point average (GPA)
the final grades of courses taken by graduate students,
with higher averages indicating higher quality learning.
A method used to assess the quality of learning in
scores of teaching practice postgraduate teaching practice sessions, with excellent,
F23
(STP) good, moderate, pass, and fail expressed as 1, 2, 3, 4, and
5, respectively.
A method used to assess how much the postgraduate
students learned in social practice sessions, with
F24 scores of social practices (SSP)
excellent, good, moderate, pass, and fail expressed as 1,
2, 3, 4, and 5, respectively.
A method used to assess how the must the postgraduate
scores of academic reports students learned during academic reporting sessions,
F25
(SAR) with excellent, good, moderate, pass, and fail expressed
as 1, 2, 3, 4, and 5, respectively.
A method used to assess the how much the
scores of graduation thesis postgraduate students learned during the thesis
F26
(SGT) sessions, with excellent, good, moderate, pass, and fail
expressed as 1, 2, 3, 4, and 5, respectively.
4.2. Experimental Setup
MATLAB R2018 software was utilized to conduct the experiment. The data were
scaled to [−1, 1] before classification. The k-fold cross-validation (CV) was used to split
the data, where k was set to 10.
In addition, to ensure the same environment for all experiments, the experiments were
conducted on a Windows 10 with Intel(R) Core (TM) i5−4200 H CPU @ 2.80 GHz and 8 GB
of RAM. Coding was completed by using Matlab R2018.
5. Experimental Result
5.1. The Qualitative Analysis of MSMA
Swarm intelligence algorithms are good at solving many optimization problems,
such as traveling salesman problems [41], feature selection [42–46], object tracking [47,48],
wind speed prediction [49], PID optimization control [50–52], image segmentation [53,54],
the hard maximum satisfiability problem [55,56], parameter optimization [22,57–59], gate
resource allocation [60,61], fault diagnosis of rolling bearings [62,63], the detection of foreign
fibers in cotton [64,65], large-scale supply chain network design [66], cloud workflow
scheduling [67,68], neural network training [69], airline crew rostering problems [70], and
energy vehicle dispatch [71]. This section conducts a qualitative analysis of MSMA.
Original SMA was selected for comparison with MSMA. Figure 3 displays the feasi-
bility outcomes of the study comparing MSMA and SMA. There are five columns in the
figure. The first column (a) is the position distribution for the MSMA search history on
the three-dimensional plane. The second column (b) is the position distribution for the
MSMA search history on the two-dimensional plane. In Figure 3b, the red dot represents
the location of the optimal solution, and the black dot represents the MSMA search location.
In the figure, the black dots are scattered everywhere on the entire search flat, which shows
that MSMA performs a global search on the solution space. The black dots are significantly
denser in the area around the red dots, which shows that MSMA has exploited the area to a
121
Electronics 2022, 11, 209
greater extent in the areas where the best solution is situated. The third column (c) is the
trajectory of the first dimension of the MSMA during the iteration. In Figure 3c, it is easy to
see that the one-MSMA dimensional trajectory has large fluctuations. The amplitude of the
trajectory fluctuation reflects the search range of the algorithm to a certain extent. The large
fluctuation range of the trajectory indicates that the algorithm has performed a large-scale
search. The fourth column (d) displays changes in the average MSMA fitness during
the iteration. In Figure 3d, the average fitness of the algorithm shows huge fluctuations,
but the overall fitness is decreasing. The fifth column (e) describes the MSMA and SMA
convergence curves. In Figure 3e, the authors can clearly see that the MSMA convergence
is lower than that of SMA, which shows that MSMA has better convergence performance.
Figure 3. (a) Three-dimensional location distribution of MSMA; (b) two-dimensional location distri-
bution of MSMA; (c) MSMA trajectory in the first dimension; (d) mean fitness of MSMA; (e) c MSMA
and SMA convergence graphs.
Balance analysis and diversity analysis were carried out on the same functions.
Figure 4 shows the outcomes of the balance study on MSMA and SMA. The three curves in
each picture represent three different behaviors. As indicated in the legend, the red curve
and blue curve represent exploration and exploitation, respectively. The large value of
the curve indicates that this corresponding behavior is prominent in this algorithm. The
green curve is an incremental–decremental curve. This curve can more intuitively reflect
the changing trends in the two behaviors of the algorithm. When the curve increases, it
means that exploration activities are currently dominant. The exploitation behavior is
dominant in the opposite circumstances. Additionally, if these two are at the same stage,
the increment–decrement curve has the best performance.
122
Electronics 2022, 11, 209
Figure 4. Balance analysis of MSMA and SMA.
The swarm intelligence algorithm will first perform a global search when solving
optimization problems. After determining the position of the optimal solution, the area will
be locally developed. Therefore, the authors see that exploration activities are dominant
in MSMA and SMA at the beginning. MSMA spends more time on exploration than the
original SMA, which can be clearly seen in F2, F23, F27, and F30. However, the proportion
of MSMA exploration behavior on F4, F9, F22, and F26 is also higher than that of SMA.
The authors can see that the exploration curves and exploitation curves of MSMA on F4,
F9, F22, and F26 are not monotonous, but instead fluctuate. This fluctuation can be clearly
observed when the MSMA exploration curve drops rapidly in the early phase. Because
the fluctuation guarantees the proportion of exploration behavior, MSMA will not end the
global exploration phase too quickly. This is a big difference in the balance between MSMA
and SMA.
Figure 5 is the result of diversity analysis of MSMA and SMA. In Figure 5, the abscissa
stands for the iteration quantity, and the ordinate represents the population diversity. At
the beginning, the swarm is randomly generated, so the population diversity is very high.
As the iteration progresses, the algorithm continues to narrow the search range, and the
population diversity will decrease. The SMA diversity curve is a monotonically decreasing
curve, which can be seen in Figure 5. However, MSMA is different. The fluctuations in the
balance analysis are also reflected in the diversity curve. The authors can see that the F1,
F3, F12, and F15 curves all have a reverse increase period in terms of diversity, while other
functions are not obvious. This fluctuation period becomes more obvious when the MSMA
diversity decreases rapidly in the early stage. Obviously, this ensures that MSMA can
maintain high population diversity and wide search capabilities in the early and mid-term.
In the later period, the MSMA diversity dropped to a low level and demonstrated good
convergence ability.
123
Electronics 2022, 11, 209
Figure 5. Diversity analysis of MSMA and SMA.
5.2. Comparison with Original Methods
In this section, the MSMA is compared with eight original swarm intelligence algo-
rithms: SMA [11], DE [10], GWO [12,13], BA [14], FA [15], WOA [16,17], MFO [18–20], and
SCA [21], to prove the performance of the MSMA. These comparison algorithms are classic
and representative original algorithms that have been cited by many researchers for the
sake of estimating the superiority of their own developed algorithms. In this experiment,
the authors selected the CEC2017 [72] test function to judge the excellence of the involved
algorithms and set the number of search agents to 30, the search agent dimension to 30,
and the maximum evaluation times to 150,000. Every algorithm was run individually 30
times to obtain the mean value. In Table 2, the average and standard deviation that these
algorithms searched for on different test functions is displayed, respectively. Obviously,
the mean and standard deviations of the presented algorithm are lower than those of other
compared ones for most functions. The Friedman [73] test is a non-parametric test method
that can test whether multiple population distributions are significantly different. The
Friedman test calculates the average performance differences for the chosen approaches
and then compares them statistically to determine the ARV values (average ranking values)
for the different methods. In Table 2, the MSMA algorithm ranks first in 22 benchmark
functions, such as F1 and F3, proving that this paper’s enhanced algorithm has numerous
advantages over other algorithms that were compared using the CEC2017 benchmark
functions. The Wilcoxon [74] symbolic rank test was used to test whether the algorithm
that was improved in the article was significantly better than the others. In the Wilcoxon
symbolic rank test, when the p value is lower than 0.05, the MSMA algorithm is obviously
better than others in the present test functions. In Table 2, most of the p-values that were
124
Electronics 2022, 11, 209
calculated by the MSMA and the comparison algorithm on the test function are less than
0.05. Therefore, the MSMA algorithm is more capable of searching for the optimal solution
using the CEC2017 test function than other competitors.
Table 2. Comparison results of different original algorithms best scores obtained so far.
MSMA SMA DE GWO BA FA WOA MFO SCA
Avg 1.31 × 102 8.03 × 103 1.79 × 103 2.24 × 109 5.72 × 105 1.55 × 10+10 2.36 × 107 9.38 × 109 1.41 × 10+10
Std 1.68 × 102 7.18 × 103 2.96 × 103 1.68 × 109 3.78 × 105 1.58 × 109 1.86 × 107 7.26 × 109 1.89 × 109
F1
Rank 1 3 2 6 4 9 5 7 8
p-value 1.73 × 10−6 3.88 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 8.31 × 104 6.49 × 102 1.26 × 10+24 2.36 × 10+32 1.75 × 103 6.49 × 10+34 2.84 × 10+26 1.31 × 10+38 7.01 × 10+36
Std 2.55 × 105 9.69 × 102 3.56 × 10+24 9.82 × 10+32 8.51 × 103 1.54 × 10+35 1.11 × 10+27 6.86 × 10+38 3.82 × 10+37
F2
Rank 3 1 4 6 2 7 5 9 8
p-value 7.51 × 10−5 1.73 × 10−6 1.73 × 10−6 2.37 × 10−5 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 3.00 × 102 3.00 × 102 6.26 × 104 3.85 × 104 3.00 × 102 6.85 × 104 2.18 × 105 1.09 × 105 4.37 × 104
Std 3.11 × 10−5 2.80 × 10−1 1.13 × 104 1.15 × 104 1.39 × 10−1 7.95 × 103 6.96 × 104 5.83 × 104 7.84 × 103
F3
Rank 1 3 6 4 2 7 9 8 5
p-value 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 4.01 × 102 4.92 × 102 4.91 × 102 5.90 × 102 4.81 × 102 1.49 × 103 5.69 × 102 1.60 × 103 1.53 × 103
Std 1.62 × 100 2.69 × 101 7.26 × 100 8.24 × 101 3.02 × 101 1.92 × 102 3.31 × 101 8.13 × 102 2.85 × 102
F4
Rank 1 4 3 6 2 7 5 9 8
p-value 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 5.90 × 102 5.94 × 102 6.26 × 102 6.09 × 102 7.94 × 102 7.66 × 102 7.81 × 102 7.13 × 102 7.96 × 102
Std 2.31 × 101 2.55 × 101 8.69 × 100 2.52 × 101 5.42 × 101 1.12 × 101 6.49 × 101 5.43 × 101 1.89 × 101
F5
Rank 1 2 4 3 8 6 7 5 9
p-value 5.86 × 10−1 6.98 × 10−6 6.04 × 10−3 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 6.03 × 102 6.02 × 102 6.00 × 102 6.08 × 102 6.73 × 102 6.46 × 102 6.71 × 102 6.38 × 102 6.52 × 102
Std 1.28 × 100 1.30 × 100 5.59 × 10−14 3.70 × 100 1.16 × 101 2.57 × 100 1.02 × 101 1.20 × 101 4.36 × 100
F6
Rank 3 2 1 4 9 6 8 5 7
p-value 2.85 × 10−2 1.73 × 10−6 2.35 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 8.25 × 102 8.35 × 102 8.61 × 102 8.74 × 102 1.73 × 103 1.42 × 103 1.25 × 103 1.14 × 103 1.15 × 103
Std 1.92 × 101 2.31 × 101 1.18 × 101 4.93 × 101 2.24 × 102 3.68 × 101 8.20 × 101 1.51 × 102 3.99 × 101
F7
Rank 1 2 3 4 9 8 7 5 6
p-value 6.87 × 10−2 4.29 × 10−6 1.36 × 10−5 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 8.82 × 102 9.04 × 102 9.24 × 102 8.96 × 102 1.02 × 103 1.06 × 103 1.01 × 103 1.02 × 103 1.06 × 103
Std 2.07 × 101 3.00 × 101 9.78 × 100 2.54 × 101 4.55 × 101 1.20 × 101 5.04 × 101 5.39 × 101 2.19 × 101
F8
Rank 1 3 4 2 6 9 5 7 8
p-value 5.67 × 10−3 2.35 × 10−6 1.85 × 10−2 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 1.08 × 103 2.84 × 103 9.00 × 102 2.17 × 103 1.42 × 104 5.49 × 103 8.24 × 103 7.75 × 103 5.95 × 103
Std 1.44 × 102 1.55 × 103 2.11 × 10−14 1.05 × 103 5.31 × 103 6.66 × 102 2.81 × 103 1.97 × 103 1.11 × 103
F9
Rank 2 4 1 3 9 5 8 7 6
p-value 8.47 × 10−6 1.73 × 10−6 2.35 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 3.86 × 103 4.23 × 103 6.29 × 103 3.92 × 103 5.54 × 103 8.21 × 103 6.32 × 103 5.24 × 103 8.32 × 103
Std 6.45 × 102 6.50 × 102 2.26 × 102 6.84 × 102 6.85 × 102 3.30 × 102 9.04 × 102 6.51 × 102 3.21 × 102
F10
Rank 1 3 6 2 5 8 7 4 9
p-value 3.85 × 10−3 1.73 × 10−6 9.59 × 10−1 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 1.19 × 103 1.27 × 103 1.18 × 103 2.17 × 103 1.29 × 103 3.95 × 103 2.11 × 103 4.85 × 103 2.49 × 103
Std 3.49 × 101 5.92 × 101 2.27 × 101 1.00 × 103 6.85 × 101 6.09 × 102 7.63 × 102 4.69 × 103 5.58 × 102
F11
Rank 2 3 1 6 4 8 5 9 7
p-value 1.24 × 10−5 7.81 × 10−1 1.73 × 10−6 2.60 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 2.99 × 103 1.39 × 106 3.25 × 106 1.15 × 108 2.80 × 106 1.71 × 109 8.42 × 107 3.92 × 108 1.37 × 109
Std 5.18 × 102 1.27 × 106 1.84 × 106 3.27 × 108 1.65 × 106 4.40 × 108 7.66 × 107 6.94 × 108 4.14 × 108
F12
Rank 1 2 4 6 3 9 5 7 8
p-value 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 4.43 × 103 2.80 × 104 8.88 × 104 3.05 × 107 3.75 × 105 7.12 × 108 2.29 × 105 4.63 × 107 5.09 × 108
Std 1.76 × 103 2.43 × 104 5.01 × 104 8.51 × 107 1.76 × 105 1.95 × 108 3.25 × 105 1.93 × 108 1.46 × 108
F13
Rank 1 2 3 6 5 9 4 7 8
p-value 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 1.69 × 103 6.08 × 104 8.10 × 104 2.12 × 105 8.68 × 103 2.78 × 105 1.05 × 106 1.07 × 105 2.32 × 105
Std 1.85 × 102 2.74 × 104 4.73 × 104 3.41 × 105 5.59 × 103 1.38 × 105 1.15 × 106 1.62 × 105 1.36 × 105
F14
Rank 1 3 4 6 2 8 9 5 7
p-value 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 2.04 × 103 2.97 × 104 1.54 × 104 2.44 × 105 1.36 × 105 7.90 × 107 7.87 × 104 6.23 × 104 2.07 × 107
Std 2.08 × 102 1.46 × 104 1.08 × 104 6.85 × 105 6.24 × 104 3.57 × 107 4.96 × 104 5.54 × 104 1.60 × 107
F15
Rank 1 3 2 7 6 9 5 4 8
p-value 2.35 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
125
Electronics 2022, 11, 209
Table 2. Cont.
MSMA SMA DE GWO BA FA WOA MFO SCA
Avg 2.22 × 103 2.52 × 103 2.17 × 103 2.47 × 103 3.61 × 103 3.56 × 103 3.67 × 103 3.14 × 103 3.74 × 103
Std 2.05 × 102 3.15 × 102 1.40 × 102 2.68 × 102 4.46 × 102 1.68 × 102 6.32 × 102 3.36 × 102 1.80 × 102
F16
Rank 2 4 1 3 7 6 8 5 9
p-value 5.29 × 10−4 2.80 × 10−1 1.29 × 10−3 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 1.93 × 103 2.28 × 103 1.89 × 103 2.03 × 103 2.79 × 103 2.62 × 103 2.53 × 103 2.47 × 103 2.47 × 103
Std 1.41 × 102 2.33 × 102 7.80 × 101 1.66 × 102 3.14 × 102 1.13 × 102 2.60 × 102 2.56 × 102 1.80 × 102
F17 Rank 2 4 1 3 9 8 7 5 6
p-value 1.13 × 10−5 4.53 × 10−1 2.18 × 10−2 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 2.35 × 10−6 1.73 × 10−6
Avg 2.19 × 103 3.49 × 105 4.56 × 105 7.66 × 105 2.28 × 105 5.26 × 106 3.15 × 106 6.37 × 106 4.05 × 106
Std 1.67 × 102 3.22 × 105 2.64 × 105 9.10 × 105 2.49 × 105 2.44 × 106 3.44 × 106 9.45 × 106 2.28 × 106
F18 Rank 1 3 4 5 2 8 6 9 7
p-value 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 2.61 × 103 2.68 × 104 1.54 × 104 5.05 × 106 9.81 × 105 1.21 × 108 4.14 × 106 5.36 × 106 3.37 × 107
Std 4.59 × 102 2.26 × 104 1.12 × 104 2.49 × 107 4.02 × 105 5.76 × 107 3.06 × 106 1.87 × 107 1.94 × 107
F19 Rank 1 3 2 6 4 9 5 7 8
p-value 5.22 × 10−6 1.92 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 2.13 × 10−6 1.73 × 10−6
Avg 2.28 × 103 2.40 × 103 2.20 × 103 2.38 × 103 3.03 × 103 2.65 × 103 2.73 × 103 2.71 × 103 2.70 × 103
Std 1.07 × 102 1.89 × 102 8.56 × 101 1.26 × 102 2.14 × 102 8.76 × 101 1.96 × 102 2.28 × 102 1.17 × 102
F20
Rank 2 4 1 3 9 5 8 7 6
p-value 4.99 × 10−3 1.83 × 10−3 4.99 × 10−3 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 2.35 × 10−6 1.73 × 10−6
Avg 2.37 × 103 2.40 × 103 2.42 × 103 2.40 × 103 2.64 × 103 2.55 × 103 2.57 × 103 2.50 × 103 2.56 × 103
Std 3.69 × 101 2.52 × 101 1.09 × 101 3.07 × 101 8.23 × 101 1.38 × 101 7.61 × 101 4.54 × 101 2.18 × 101
F21
Rank 1 3 4 2 9 6 8 5 7
p-value 1.60 × 10−4 1.73 × 10−6 3.38 × 10−3 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 2.30 × 103 5.31 × 103 4.57 × 103 5.36 × 103 7.27 × 103 3.95 × 103 6.36 × 103 6.40 × 103 8.74 × 103
Std 8.02 × 10−1 1.17 × 103 2.14 × 103 1.69 × 103 1.27 × 103 1.59 × 102 2.11 × 103 1.56 × 103 2.09 × 103
F22
Rank 1 4 3 5 8 2 6 7 9
p-value 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 2.74 × 103 2.75 × 103 2.78 × 103 2.77 × 103 3.31 × 103 2.92 × 103 3.08 × 103 2.85 × 103 3.01 × 103
Std 2.31 × 101 2.77 × 101 1.29 × 101 3.96 × 101 1.70 × 102 1.25 × 101 1.06 × 102 4.02 × 101 3.07 × 101
F23
Rank 1 2 4 3 9 6 8 5 7
p-value 8.59 × 10−2 1.73 × 10−6 3.61 × 10−3 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 2.90 × 103 2.93 × 103 2.98 × 103 2.94 × 103 3.37 × 103 3.07 × 103 3.17 × 103 2.99 × 103 3.18 × 103
Std 2.31 × 101 2.80 × 101 1.13 × 101 6.09 × 101 1.25 × 102 1.13 × 101 7.61 × 101 4.48 × 101 3.44 × 101
F24
Rank 1 2 4 3 9 6 7 5 8
p-value 1.60 × 10−4 1.73 × 10−6 8.73 × 10−3 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6
Avg 2.88 × 103 2.89 × 103 2.89 × 103 3.00 × 103 2.92 × 103 3.64 × 103 2.98 × 103 3.23 × 103 3.24 × 103
Std 2.14 × 100 1.42 × 100 2.86 × 10−1 6.92 × 101 2.39 × 101 1.10 × 102 3.13 × 101 3.69 × 102 9.54 × 101
F25
Rank 1 2 3 6 4 9 5 7 8
p-value 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 4.41 × 103 4.63 × 103 4.86 × 103 4.81 × 103 9.93 × 103 6.65 × 103 7.13 × 103 5.97 × 103 7.07 × 103
Std 2.73 × 102 2.29 × 102 9.40 × 101 4.56 × 102 1.04 × 103 1.49 × 102 1.34 × 103 5.01 × 102 2.27 × 102
F26
Rank 1 2 4 3 9 6 8 5 7
p-value 2.77 × 10−3 2.35 × 10−6 5.71 × 10−4 1.73 × 10−6 1.73 × 10−6 2.35 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 3.18 × 103 3.22 × 103 3.21 × 103 3.26 × 103 3.44 × 103 3.34 × 103 3.37 × 103 3.25 × 103 3.44 × 103
Std 2.30 × 101 1.23 × 101 4.56 × 100 3.15 × 101 1.26 × 102 1.68 × 101 8.05 × 101 3.12 × 101 6.15 × 101
F27
Rank 1 3 2 5 8 6 7 4 9
p-value 1.92 × 10−6 2.60 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 3.15 × 103 3.24 × 103 3.22 × 103 3.47 × 103 3.14 × 103 3.98 × 103 3.36 × 103 4.40 × 103 3.88 × 103
Std 5.70 × 101 3.12 × 101 1.96 × 101 1.37 × 102 6.20 × 101 9.78 × 101 4.44 × 101 1.02 × 103 1.46 × 102
F28
Rank 2 4 3 6 1 8 5 9 7
p-value 7.69 × 10−6 3.11 × 10−5 1.73 × 10−6 4.17 × 10−1 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 3.58 × 103 3.79 × 103 3.63 × 103 3.73 × 103 5.11 × 103 4.80 × 103 4.88 × 103 4.19 × 103 4.81 × 103
Std 1.27 × 102 2.25 × 102 7.18 × 101 1.83 × 102 4.23 × 102 1.48 × 102 4.28 × 102 2.98 × 102 2.71 × 102
F29
Rank 1 4 2 3 9 6 8 5 7
p-value 5.29 × 10−4 7.86 × 10−2 2.77 × 10−3 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 8.37 × 103 1.75 × 104 1.67 × 104 7.79 × 106 1.67 × 106 1.03 × 108 1.81 × 107 3.54 × 106 7.72 × 107
Std 2.08 × 103 4.73 × 103 5.47 × 103 9.38 × 106 9.70 × 105 4.04 × 107 1.32 × 107 7.66 × 106 3.40 × 107
F30 Rank 1 3 2 6 4 9 7 5 8
p-value 1.92 × 10−6 3.18 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6
The authors can more clearly understand the convergence speed and precision of
the algorithm through the algorithm convergence graph. The authors have selected six
representative algorithm convergence graphs from the CEC2017 test function. As shown
in Figure 6, six convergence trend graphs are listed, namely F1, F12, F15, F18, F22, and
F30. In the trends observed in the six convergence graphs, the MSMA algorithm converges
126
Electronics 2022, 11, 209
quickly before approaching 5000 evaluations, but the convergence speed becomes slower at
around 5000 to 20,000 evaluations, and then the convergence speed increases. Consequently,
the MASA algorithm demonstrates a strong ability to remove the local optimal solution
well. Furthermore, the optimal solutions that are searched for by the MSMA algorithm on
these six test functions are better than those determined by the other algorithms that were
compared.
Figure 6. Convergence tendency of MSMA and original algorithms.
5.3. Comparison against Well-Established Algorithms
To prove the superiority of the MSMA algorithm, this section compares the MSMA
algorithm with eight improved swarm intelligence algorithms, including OBLGWO [22],
CLSGMFO [20], BWOA [17], RDWOA [25], CEBA [26], DECLS [24], ALCPSO [23], and
CESCA [27]. Those comparison algorithms are improved by some classic original algo-
rithms and have a strong ability to find optimal solutions. This section uses these algorithms
127
Electronics 2022, 11, 209
to evaluate the superiority of the MSMA algorithm more precisely. The authors chose
the CEC2017 test function as the test function and set the number of search agents to
30, the dimension of search agents to 30, and the maximum quantity of evaluations to
150,000. Every algorithm was run individually 30 times to obtain the average value. Table 3
shows the average fitness value and standard deviation for every algorithm on various
test functions. The smaller the average fitness value and standard deviation, the better
the algorithm performed on the current test function. As seen from the table, the average
value and standard deviation of the MSMA on a few test functions are larger than some
comparison algorithms, which m proves that the MSMA has great advantages over the
other algorithms. This research uses Friedman’s test to rank the algorithm’s efficiency
and to obtain the ARV value (average ranking value) of different algorithms. Observing
Table 3, the authors can see that the MSMA algorithm ranks first in most test functions.
This proves that the MSMA also has a relatively strong advantage compared to the other
peers on the CEC2017 test functions. Additionally, the Wilcoxon signed-rank test was used
to assess whether the MSMA algorithm performs significantly better than other advanced
and improved algorithms in this experiment. Table 3 presents that the p values calculated
on most test functions, and all of them are lower than 0.05. This proves that the MSMA
algorithm has a big advantage over the remaining algorithms on most test functions.
The convergence diagram was employed to clearly understand the convergence trends
of the algorithms on the test functions. The authors selected six representative con-vergence
graphs from the CEC2017 test functions. As shown in Figure 7, when the con-vergence
trend of the MSMA algorithm slows down, the algorithm convergence speed be-comes
faster after a certain number of evaluations, which proves that it able to skip be-tween local
optimal solution well. The MSMA algorithm searches for the optimal solution on these six
test functions better than the other advanced and improved algorithms.
Table 3. Comparison results of different well-established algorithms.
MSMA OBLGWO CLSGMFO BWOA RDWOA CEBA DECLS ALCPSO CESCA
Avg 1.22 × 102 3.26 × 107 5.45 × 103 1.10 × 109 4.48 × 107 3.89 × 103 2.80 × 103 5.48 × 103 5.71 × 10+10
Std 8.09 × 101 1.94 × 107 6.08 × 103 1.04 × 109 4.02 × 107 3.77 × 103 3.85 × 103 6.14 × 103 4.49 × 109
F1
Rank 1 6 4 8 7 3 2 5 9
p-value 1.73 × 10−6 3.52 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6 1.73 × 10−6
1.88 × 1.53 × 1.07 ×
Avg 1.05 × 105 1.16 × 10+18 5.25 × 10+13 8.48 × 102 1.18 × 10+17 5.51 × 10+45
10+30 10+17 10+26
F2 8.16 × 2.34 × 2.66 ×
Std 4.32 × 105 1.45 × 10+18 1.49 × 10+14 3.30 × 103 4.62 × 10+17 1.54 × 10+46
10+30 10+17 10+26
Rank 2 6 3 8 5 1 7 4 9
p-value 1.73 × 10−6 2.13 × 10−6 1.73 × 10−6 1.73 × 10−6 4.90 × 10−4 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6
Avg 3.00 × 102 2.96 × 104 1.70 × 104 6.53 × 104 3.17 × 104 3.00 × 102 8.43 × 104 3.97 × 104 1.09 × 105
Std 9.43 × 10−6 6.71 × 103 4.55 × 103 1.11 × 104 8.77 × 103 2.07 × 10−2 1.42 × 104 6.83 × 103 1.55 × 104
F3
Rank 1 4 3 7 5 2 8 6 9
p-value 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 4.01 × 102 5.35 × 102 4.96 × 102 7.18 × 102 5.27 × 102 4.50 × 102 4.95 × 102 5.06 × 102 1.57 × 104
Std 1.95 × 100 3.64 × 101 2.43 × 101 9.64 × 101 3.15 × 101 3.74 × 101 1.04 × 101 4.45 × 101 2.38 × 103
F4
Rank 1 7 4 8 6 2 3 5 9
p-value 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 3.52 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 5.93 × 102 6.68 × 102 6.59 × 102 7.85 × 102 7.10 × 102 7.61 × 102 6.41 × 102 6.14 × 102 9.64 × 102
Std 2.58 × 101 5.27 × 101 3.67 × 101 3.55 × 101 5.15 × 101 3.20 × 101 1.23 × 101 3.21 × 101 1.71 × 101
F5
Rank 1 5 4 8 6 7 3 2 9
p-value 5.75 × 10−6 4.73 × 10−6 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6 4.29 × 10−6 8.73 × 10−3 1.73 × 10−6
Avg 6.03 × 102 6.20 × 102 6.25 × 102 6.68 × 102 6.19 × 102 6.61 × 102 6.00 × 102 6.08 × 102 7.03 × 102
1.12 ×
F6 Std 1.84 × 100 1.36 × 101 1.14 × 101 5.47 × 100 6.09 × 100 4.07 × 100 5.98 × 100 4.67 × 100
10−13
Rank 2 5 6 8 4 7 1 3 9
p-value 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 7.51 × 10−5 1.73 × 10−6
Avg 8.27 × 102 9.54 × 102 9.09 × 102 1.28 × 103 9.72 × 102 1.27 × 103 8.75 × 102 8.55 × 102 1.54 × 103
Std 2.12 × 101 6.76 × 101 5.79 × 101 6.67 × 101 6.66 × 101 4.55 × 101 1.07 × 101 3.20 × 101 4.64 × 101
F7
Rank 1 5 4 8 6 7 3 2 9
p-value 1.73 × 10−6 3.52 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.92 × 10−6 8.31 × 10−4 1.73 × 10−6
128
Electronics 2022, 11, 209
Table 3. Cont.
MSMA OBLGWO CLSGMFO BWOA RDWOA CEBA DECLS ALCPSO CESCA
Avg 8.83 × 102 9.61 × 102 9.28 × 102 9.89 × 102 9.93 × 102 9.90 × 102 9.41 × 102 9.10 × 102 1.18 × 103
Std 1.74 × 101 3.84 × 101 2.49 × 101 2.73 × 101 4.43 × 101 1.94 × 101 8.93 × 100 2.41 × 101 1.95 × 101
F8
Rank 1 5 3 6 8 7 4 2 9
p-value 2.35 × 10−6 2.88 × 10−6 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6 1.73 × 10−6 3.06 × 10−4 1.73 × 10−6
Avg 1.03 × 103 4.25 × 103 3.26 × 103 6.66 × 103 5.35 × 103 5.29 × 103 9.00 × 102 1.94 × 103 1.45 × 104
Std 1.32 × 102 2.71 × 103 9.16 × 102 9.50 × 102 1.90 × 103 2.58 × 102 8.94 × 10−2 1.08 × 103 1.47 × 103
F9
Rank 2 5 4 8 7 6 1 3 9
p-value 2.88 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 5.75 × 10−6 1.73 × 10−6
Avg 3.93 × 103 5.48 × 103 5.05 × 103 6.68 × 103 4.99 × 103 5.31 × 103 6.71 × 103 4.38 × 103 8.65 × 103
Std 5.84 × 102 1.11 × 103 6.26 × 102 8.24 × 102 6.41 × 102 5.86 × 102 2.77 × 102 8.41 × 102 2.46 × 102
F10 Rank 1 6 4 7 3 5 8 2 9
p-value 1.64 × 10−5 2.35 × 10−6 1.73 × 10−6 1.24 × 10−5 3.18 × 10−6 1.73 × 10−6 3.16 × 10−2 1.73 × 10−6
Avg 1.18 × 103 1.29 × 103 1.26 × 103 2.51 × 103 1.29 × 103 1.25 × 103 1.22 × 103 1.28 × 103 1.06 × 104
Std 2.81 × 101 5.14 × 101 5.10 × 101 5.13 × 102 4.38 × 101 6.13 × 101 1.25 × 101 7.34 × 101 1.61 × 103
F11
Rank 1 7 4 8 6 3 2 5 9
p-value 2.35 × 10−6 5.75 × 10−6 1.73 × 10−6 2.35 × 10−6 4.45 × 10−5 6.34 × 10−6 1.02 × 10−5 1.73 × 10−6
Avg 2.82 × 103 2.09 × 107 1.68 × 106 1.49 × 108 4.00 × 106 1.46 × 105 5.04 × 106 3.46 × 105 1.54 × 10+10
Std 4.40 × 102 2.14 × 107 1.81 × 106 1.00 × 108 2.27 × 106 2.53 × 105 2.16 × 106 5.30 × 105 1.82 × 109
F12
Rank 1 7 4 8 5 2 6 3 9
p-value 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 4.69 × 103 3.08 × 105 1.95 × 105 9.78 × 105 1.24 × 104 1.70 × 104 2.23 × 105 1.97 × 104 1.39 × 10+10
Std 1.83 × 103 5.16 × 105 8.05 × 105 9.89 × 105 1.26 × 104 1.73 × 104 1.79 × 105 1.94 × 104 4.05 × 109
F13
Rank 1 7 5 8 2 3 6 4 9
p-value 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6 9.63 × 10−4 4.20 × 10−4 1.73 × 10−6 4.53 × 10−4 1.73 × 10−6
Avg 1.95 × 103 8.01 × 104 6.88 × 104 1.44 × 106 2.35 × 105 3.62 × 103 1.13 × 105 3.53 × 104 5.46 × 106
Std 1.16 × 103 6.51 × 104 6.79 × 104 1.58 × 106 1.94 × 105 2.18 × 103 7.96 × 104 8.56 × 104 2.62 × 106
F14
Rank 1 5 4 8 7 2 6 3 9
p-value 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6 1.73 × 10−6 1.80 × 10−5 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 2.01 × 103 1.17 × 105 9.54 × 103 7.57 × 105 1.22 × 104 3.96 × 103 5.15 × 104 1.47 × 104 5.02 × 108
Std 2.01 × 102 1.14 × 105 7.76 × 103 1.16 × 106 1.07 × 104 3.52 × 103 3.34 × 104 1.36 × 104 1.44 × 108
F15 Rank 1 7 3 8 4 2 6 5 9
p-value 1.73 × 10−6 2.88 × 10−6 1.73 × 10−6 2.60 × 10−6 8.31 × 10−4 1.73 × 10−6 4.73 × 10−6 1.73 × 10−6
Avg 2.21 × 103 2.94 × 103 2.87 × 103 3.87 × 103 2.82 × 103 3.14 × 103 2.34 × 103 2.62 × 103 6.02 × 103
Std 2.73 × 102 3.06 × 102 3.66 × 102 5.28 × 102 3.71 × 102 3.48 × 102 1.55 × 102 3.36 × 102 5.57 × 102
F16 Rank 1 6 5 8 4 7 2 3 9
p-value 1.73 × 10−6 1.49 × 10−5 1.73 × 10−6 4.29 × 10−6 1.73 × 10−6 2.70 × 10−2 1.60 × 10−4 1.73 × 10−6
Avg 1.97 × 103 2.28 × 103 2.36 × 103 2.65 × 103 2.36 × 103 2.65 × 103 1.95 × 103 2.15 × 103 4.75 × 103
Std 1.23 × 102 1.96 × 102 3.11 × 102 2.93 × 102 2.46 × 102 3.11 × 102 6.19 × 101 1.83 × 102 8.76 × 102
F17
Rank 2 4 6 7 5 8 1 3 9
p-value 8.47 × 10−6 1.97 × 10−5 1.73 × 10−6 7.69 × 10−6 1.92 × 10−6 5.04 × 10−1 1.36 × 10−4 1.73 × 10−6
Avg 2.20 × 103 1.75 × 106 3.78 × 105 5.38 × 106 7.65 × 105 9.68 × 104 7.13 × 105 5.27 × 105 5.57 × 107
Std 1.57 × 102 1.81 × 106 3.12 × 105 4.77 × 106 8.51 × 105 7.27 × 104 3.24 × 105 1.09 × 106 2.69 × 107
F18
Rank 1 7 3 8 6 2 5 4 9
p-value 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 2.63 × 103 8.18 × 105 5.75 × 103 7.67 × 106 1.56 × 104 5.61 × 103 4.83 × 104 1.47 × 104 1.26 × 109
Std 4.31 × 102 7.17 × 105 4.29 × 103 7.54 × 106 1.38 × 104 3.26 × 103 3.47 × 104 1.46 × 104 2.75 × 108
F19
Rank 1 7 3 8 5 2 6 4 9
p-value 1.73 × 10−6 4.86 × 10−5 1.73 × 10−6 2.35 × 10−6 6.32 × 10−5 1.73 × 10−6 2.16 × 10−5 1.73 × 10−6
Avg 2.32 × 103 2.49 × 103 2.49 × 103 2.75 × 103 2.54 × 103 2.90 × 103 2.22 × 103 2.44 × 103 3.23 × 103
Std 1.40 × 102 1.15 × 102 2.23 × 102 1.96 × 102 2.00 × 102 1.81 × 102 8.02 × 101 1.86 × 102 1.12 × 102
F20
Rank 2 5 4 7 6 8 1 3 9
p-value 4.20 × 10−4 1.04 × 10−2 3.18 × 10−6 4.45 × 10−5 1.73 × 10−6 6.64 × 10−4 6.84 × 10−3 1.73 × 10−6
Avg 2.38 × 103 2.45 × 103 2.43 × 103 2.59 × 103 2.50 × 103 2.60 × 103 2.44 × 103 2.42 × 103 2.76 × 103
Std 1.82 × 101 3.94 × 101 3.33 × 101 4.95 × 101 3.49 × 101 5.17 × 101 1.26 × 101 3.37 × 101 3.19 × 101
F21
Rank 1 5 3 7 6 8 4 2 9
p-value 2.13 × 10−6 1.02 × 10−5 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 2.16 × 10−5 1.73 × 10−6
Avg 2.30 × 103 2.90 × 103 2.30 × 103 7.18 × 103 6.06 × 103 7.16 × 103 4.39 × 103 4.73 × 103 9.35 × 103
Std 7.47 × 10−1 1.51 × 103 1.43 × 100 1.96 × 103 1.81 × 103 1.41 × 103 1.99 × 103 1.94 × 103 6.80 × 102
F22
Rank 1 3 2 8 6 7 4 5 9
p-value 1.73 × 10−6 1.04 × 10−3 1.73 × 10−6 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6 5.31 × 10−5 1.73 × 10−6
Avg 2.73 × 103 2.82 × 103 2.79 × 103 3.10 × 103 2.89 × 103 3.39 × 103 2.79 × 103 2.80 × 103 3.46 × 103
Std 2.69 × 101 4.28 × 101 3.48 × 101 1.20 × 102 7.39 × 101 2.00 × 102 1.23 × 101 6.07 × 101 5.09 × 101
F23 Rank 1 5 3 7 6 8 2 4 9
p-value 1.92 × 10−6 5.22 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 3.11 × 10−5 1.73 × 10−6
Avg 2.91 × 103 2.98 × 103 2.96 × 103 3.23 × 103 3.09 × 103 3.48 × 103 3.00 × 103 2.99 × 103 3.49 × 103
Std 2.15 × 101 4.97 × 101 4.75 × 101 9.77 × 101 8.74 × 101 1.48 × 102 1.14 × 101 7.20 × 101 3.88 × 101
F24
Rank 1 3 2 7 6 8 5 4 9
p-value 2.37 × 10−5 8.47 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.64 × 10−5 1.73 × 10−6
129
Electronics 2022, 11, 209
Table 3. Cont.
MSMA OBLGWO CLSGMFO BWOA RDWOA CEBA DECLS ALCPSO CESCA
Avg 2.88 × 103 2.93 × 103 2.90 × 103 3.08 × 103 2.92 × 103 2.90 × 103 2.89 × 103 2.90 × 103 5.53 × 103
Std 1.78 × 100 2.33 × 101 1.89 × 101 5.01 × 101 2.15 × 101 1.74 × 101 3.67 × 10−1 1.91 × 101 4.63 × 102
F25
Rank 1 7 3 8 6 4 2 5 9
p-value 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 4.50 × 103 5.55 × 103 3.84 × 103 7.90 × 103 5.61 × 103 6.08 × 103 5.00 × 103 4.99 × 103 1.11 × 104
Std 2.57 × 102 4.03 × 102 1.32 × 103 1.04 × 103 1.27 × 103 2.40 × 103 9.28 × 101 5.57 × 102 5.86 × 102
F26
Rank 2 5 1 8 6 7 4 3 9
p-value 1.73 × 10−6 2.07 × 10−2 1.92 × 10−6 3.59 × 10−4 3.32 × 10−4 2.60 × 10−6 1.25 × 10−4 1.73 × 10−6
Avg 3.19 × 103 3.25 × 103 3.31 × 103 3.41 × 103 3.25 × 103 3.69 × 103 3.21 × 103 3.25 × 103 3.72 × 103
Std 2.16 × 101 2.11 × 101 7.31 × 101 1.09 × 102 2.48 × 101 3.83 × 102 3.69 × 100 2.38 × 101 6.97 × 101
F27
Rank 1 3 6 7 5 8 2 4 9
p-value 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 4.29 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 3.13 × 103 3.30 × 103 3.23 × 103 3.49 × 103 3.28 × 103 3.14 × 103 3.23 × 103 3.23 × 103 7.09 × 103
Std 5.03 × 101 3.61 × 101 1.88 × 101 1.01 × 102 2.96 × 101 5.78 × 101 2.15 × 101 3.55 × 101 4.95 × 102
F28
Rank 1 7 4 8 6 2 5 3 9
p-value 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6 1.73 × 10−6 5.44 × 10−1 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 3.57 × 103 4.11 × 103 4.02 × 103 5.13 × 103 4.02 × 103 4.48 × 103 3.73 × 103 3.84 × 103 6.05 × 103
Std 1.20 × 102 3.17 × 102 2.20 × 102 5.98 × 102 2.53 × 102 3.27 × 102 1.04 × 102 1.92 × 102 1.49 × 102
F29
Rank 1 6 5 8 4 7 2 3 9
p-value 1.73 × 10−6 2.88 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 9.32 × 10−6 1.36 × 10−5 1.73 × 10−6
Avg 9.82 × 103 4.24 × 106 1.19 × 105 3.50 × 107 2.74 × 104 9.74 × 103 3.89 × 104 1.84 × 104 2.74 × 109
Std 3.02 × 103 2.92 × 106 1.69 × 105 2.91 × 107 1.92 × 104 4.48 × 103 2.49 × 104 1.44 × 104 7.83 × 108
F30
Rank 2 7 6 8 4 1 5 3 9
p-value 1.73 × 10−6 1.97 × 10−5 1.73 × 10−6 3.18 × 10−6 5.44 × 10−1 1.92 × 10−6 2.11 × 10−3 1.73 × 10−6
Figure 7. Convergence trends of MSMA and well-established algorithms.
130
Electronics 2022, 11, 209
5.4. Predicting Results of Employment Stability
During this experiment, the authors evaluated the validity of the MSMA-SVM with a
feature selection (MSMA-SVM-FS) model relative to its peers, the detailed results of which
are presented in Table 4. From the results that were obtained, the authors can conclude that
the ACC obtained from MSMA-SVM-FS was 86.4%, the MCC was 72.9%, the sensitiv-ity
was 82.3%, the specificity was 89.9%, and the standard deviations (STD) were 0.040, 0.081,
0.064, and 0.057, respectively. In addition, the optimal parameters and feature sub-sets
were acquired directly by the MSMA method in our experiments, which means that the
introduction of the multi-population structure mechanism results in the SMA having a
stronger search capability and better accuracy.
Table 4. Classification results of MSMA-SVM-FS in the light of four metrics.
Fold ACC MCC Sensitivity Specificity
Num.1 0.848 0.702 0.733 0.944
Num.2 0.824 0.646 0.813 0.833
Num.3 0.909 0.819 0.875 0.941
Num.4 0.909 0.820 0.938 0.882
Num.5 0.909 0.817 0.867 0.944
Num.6 0.848 0.702 0.733 0.944
Num.7 0.879 0.756 0.867 0.889
Num.8 0.879 0.759 0.800 0.944
Num.9 0.788 0.576 0.800 0.778
Num.10 0.848 0.694 0.800 0.889
AVG 0.864 0.729 0.823 0.899
STD 0.040 0.081 0.064 0.057
With the aim of determining the efficiency of the approach, the authors compared it
with five other successful machine learning models containing MSMA-SVM, SMA-SVM,
ANN, RF, and KELM, is the results of which are displayed in Figure 8. The results show
that MSMA-SVM-FS outperforms SMA-SVM, ANN, RF, and KELM in four evaluation
metrics and that MSMA-SVM only outperforms MSMA-SVM-FS in sensitivity, but not in
the other three metrics. Further, the STD is smaller than that of MSMA-SVM, SMA-SVM,
ANN, RF, and KELM, indicating that the introduction of the multi-population structure
strategy makes MSMA-SVM-FS perform better and results in it being more stable. On
the ACC evaluation metric, the best performance was achieved by MSMA-SVM-FS with
MSMA-SVM, which was 2.4% higher than the second ranked MSMA-SVM. This was closely
followed by SMA-SVM and RF, with ANN achieving the worst result, which was 6.6%
lower than that of MSMA-SVM-FS. The STD of MSMA-SVM-FS is smaller than that of
MSMA-SVM and SMA-SVM, indicating that the MSMA-SVM and SMA-SVM models are
less stable than MSMA-SVM-FS in coping with the situation but that the enhanced MSMA-
SVM-FS model has much better results. On the MCC evaluation metric, the best results
were still achieved with MSMA-SVM-FS followed by MSMA-SVM. MSMA-SVM was 4.6%
lower than MSMA-SVM-FS accompanied by SMA-SVM and RF, and ANN had the worst
effects, with values that were 12.5% lower than MSMA-SVM-FS, where MSMA-SVM-FS
had the smallest STD of 0.081. In terms of sensitivity evaluation metrics, MSMA-SVM
had the best effects along with MSMA-SVM-FS, only demonstrating a difference of 0.7%,
accompanied by RF and SMA-SVM. The ANN model owns the worst effects, but concerning
STD, MSMA-SVM-FS is the smallest at 0.064, and MSMA-SVM is the largest at 0.113. In
terms of specificity metrics, MSMA-SVM-FS ranked first, accompanied by ANN, RF, KELM,
MSMA-SVM, and SMA-SVM. MSMA-SVM-FS only differed from ANN by 2.4% and from
MSMA-SVM by 5%; the worst was SMA-SVM at 84.9%. However, regarding STD, MSMA-
SVM-FS was still the smallest at 0.057.
131
Electronics 2022, 11, 209
Figure 8. Classification results of five models in terms of four metrics.
During the process, the suggested MSMA not only achieved the optimal SVM super
parameters settings, but it also achieved the best feature set. The authors took advantage
of a 10-fold CV technique. Figure 9 illustrates the frequency of the major characteristics
identified by the MSMA-SVM through the 10-fold CV procedure.
Figure 9. Frequency of the features chosen from MSMA-SVM through the 10-fold CV procedure.
As displayed in the chart, the monthly salary of current employment (F20), monthly
salary of first employment (F12), change in place of employment (F17), degree of specialty
relevance of first employment (F11), and salary difference (F21) were the five most frequent
characteristics, which appeared 10, 9, 9, 7, and 7 times, respectively. Consequently, it
was concluded that those characteristics may play a central part in forecasting graduate
employment.
6. Discussion
The simulation results reveal the postgraduate student employment stability is in-
fluenced by the constraints of many factors, showing corresponding patterns in specific
aspects and showing some inevitable links with most of the factors involved. Among
132
Electronics 2022, 11, 209
them, the monthly salary of current employment (F20), the monthly salary of first employ-
ment (F12), change in place of employment (F17), degree of specialty relevance of first
employment (F11), and salary difference (F21) have a great deal of influence on student
employment stability. This section analyzes and predicts graduate student employment
stability based on these five characteristic factors while further demonstrating the practical
significance and validity of the MSMA-SVM model.
Among them, the monthly salary of current employment, the monthly salary of first
employment, and salary difference can be unified into a wage category for analysis. First, in
terms of employment area, graduate student employment is mainly concentrated in large
and medium-sized cities with higher costs of living, and the monthly employment salary
(F12, F20) is closely related to the costs associated with daily life in those environments;
in addition, compared to undergraduates, graduate students have higher employment
expectations, and they have higher salary requirements in terms of them being able to
support themselves well. Secondly, the salary difference (F21) indicates the difference
between the current monthly salary and the first monthly salary, and the salary difference
can, to a certain extent, infer future salary packages. Graduate students do not choose
employment immediately after their bachelor’s degree, often because they believe that a
higher level of education offers broader employment prospects. If the gap between the
higher expectations that graduate students have and the real salary level is large, then
graduate students will feel that the salary cannot does not reflect their human resource
value and labor contribution, which will reduce their confidence in their current jobs and
affect their job satisfaction, which will lead to separation behavior, and the probability
of separation is higher for graduates at lower salary and benefit levels. Finally, from a
comprehensive point of view, postgraduate employment looks at the current employment
monthly salary, the first employment monthly salary, and salary difference in order to seek
better career development and a more favorable working environment, improve quality of
life, and achieve more sustainable and stable employment.
The degree of specialty relevance of first employment (F11) represents the relevance
between the field of study and the work performed. According to the theory of person–
job matching, it is only possible to obtain stable and harmonious career development
when personal traits and career traits are consistent. On the one hand, graduate students
choose their graduate majors independently based on their undergraduate professional
knowledge and ability, which is reflective in their subjective future career aspirations. On
the other hand, the disciplinary strength of graduate students, the influence of supervisors,
academic ability and professionalism, and the demand of the job market all directly or
indirectly affect the choice of graduate employment positions. If there is inconsistency
between the professional structure and economic development structure in postgraduate
training, or if there is a distance between academic goal of cultivation and real social
and economic development, the deviation phenomenon between study major and the
employment industry will appear, which will be specifically manifested as a low-relevance
employment position and a job that is less relevant to the student’s field of study. Therefore,
graduate students are prone to making the decision to find another job that reflects their
own values. Therefore, it can be seen that the degree of relevance that a student’s major
has on their first employment position can greatly affect the employment stability of
graduate students.
Among them, changes in the place of employment (F17) represent the difference
in location type between initial employment location and current employment location.
First, in recent years, major cities have realized that talent is an important resource for
urban development and frequently introduce unprecedented policies to attract talent. By
virtue of developed economic conditions, perfect infrastructure, quality public services,
and wide development space, large cities attract a continuous inflow of talent. Therefore,
in order to squeeze into big cities, some postgraduates give up their majors and engage
in jobs with a relatively low professional match; other postgraduates accumulate certain
working experience in small and medium cities before rushing to the job market of big
133
Electronics 2022, 11, 209
cities. Secondly, changes in employment location often follow changes in occupation. In
our re-study sample, the authors found that among the 128 graduate students employed in
non-staff positions, such as at private enterprises, 82 of them found their jobs with those
establishments within three years of graduation, accounting for 64.06% of the students
involved in the study, which is 10.28 percentage points higher than the average separation
rate of the sample. On the one hand, the reason for this is that postgraduates working
in established jobs have higher security in terms of social security, social reputation and
occupational safety, and higher job stability. On the other hand and in contrast, non-
established positions are a two-way selection market that is characterized by competition,
and although employees can enjoy good income and security, the competition is fierce and
stressful, so the probability of leaving is higher.
This subsection provides a detailed analysis of graduate student employment stability
through MSMA-SVM model simulation experiments and actual survey sampling. From
the monthly salary of current employment, monthly salary of first employment, and
salary difference, it can be seen that graduate students first care about their salary because it
represents the guarantee of current and future quality of life; The degree at which a student’s
specialization relevant to their first job indicates that when employment is consistent with
the field of study, it is easier students to realize their own value and thus find a long-
term and stable job. Changes in employment location indicate that graduate students are
more likely to be employed in big cities with rich resources or in stable and established
positions where they are able to realize their value. In summary, the MSMA-SVM model
can reasonably analyze and predict the current employment situation of postgraduates,
which will hopefully act as an effective reference for related postgraduate employment.
Due to its strong optimization capability, the developed MSMA can also be applied to
other optimization problems, such as multi-objective or many optimization problems [75–77],
big data optimization problems [78], and combination optimization problems [79]. More-
over, it can be applied to tackle the practical problems such as medical diagnosis [80–83],
location-based service [84,85], service ecosystem [86], communication system conver-
sion [87–89], kayak cycle phase segmentation [90], image dehazing and retrieval [91,92],
information retrieval service [93–95], multi-view learning [96], human motion capture [97],
green supplier selection [98], scheduling [99–101], and microgrid planning [102] problems.
7. Conclusions, Limitations, and Future Research
In this study, the authors developed an effective hybrid MSMA-SVM model that could
be used to predict the employment stability of graduate students. This method’s main
innovation is the introduction a multi-population mechanism into the SMA, which further
balances its exploration and exploitation abilities. The proposed MSMA can provide better
solutions with better stability for the 30 CEC2017 benchmark functions when compared
to several comparison algorithms. Meanwhile, it is possible to acquire better parameter
combinations and feature subsets than other methods when using MSMA to optimize SVM.
According to the employment stability prediction model for graduate students, it was
found that the career stability of graduate students within three years of graduation is low,
and the monthly salary level of initial employment, the relevance of initial employment,
the location of the initial employment unit, and the nature of the initial employment unit
are significant in predicting the exit behavior of graduates. The proposed method has more
accurate and stable prediction and realization abilities when dealing with the problem of
graduate employment stability prediction compared to other machine learning methods.
This article has some limitations. First of all, there were not enough research samples,
and if more data samples are collected, better prediction performance with prediction
accuracy can be obtained. Second, the incomplete sample attributes of the study create
factors that affect the employment stability of graduate students, and these factors need
to be discussed further. In addition, due to the fact that the study sample is only from
one university, both the applicability of the model and the reliability of its prediction of
postgraduate employment stability need to be proven further.
134
Electronics 2022, 11, 209
In future research, the authors will address the limitations for future work expansion,
such as expanding the number of samples to enhance the prediction performance and
accuracy of the model, expanding the number of employment attribute samples to enhance
the precision of the model, and collecting samples from different regions to enhance the
adaptability of the model. On the other hand, MSMA-SVM models will be applied to predict
other problems such as disease diagnosis and financial risk prediction. In addition, it is
expected that the MSMA algorithm can be extended to address different application areas
such as photovoltaic cell optimization [103], resource requirement prediction [104,105], and
the optimization of deep learning network nodes [106,107].
Author Contributions: Conceptualization, H.G. and H.C.; Methodology, H.C. and G.L.; software,
G.L.; validation, H.C., H.G. and G.L.; formal analysis, H.G.; investigation, G.L. and G.L.; resources,
H.C.; data curation, G.L.; writing—original draft preparation, G.L.; writing—review and editing,
H.C., G.L. and H.G.; visualization, G.L. and H.G.; supervision, H.G.; project administration, G.L.;
funding acquisition, H.C., H.G. and G.L. All authors have read and agreed to the published version
of the manuscript.
Funding: This work was supported in part by The WenZhou Philosophy and Social Science Planning
(21wsk205).
Data Availability Statement: The data involved in this study are all public data, which can be
downloaded through public channels.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Bharambe, Y.; Mored, N.; Mulchandani, M.; Shankarmani, R.; Shinde, S.G. Assessing employability of students using data mining
techniques. In Proceedings of the 2017 International Conference on Advances in Computing, Communications and Informatics
(ICACCI), Manipal, Karnataka, India, 13–16 September 2017; pp. 2110–2114.
2. Li, L.; Zheng, Y.; Sun, X.H.; Wang, F.S. The Application of Decision Tree Algorithm in the Employment Management System.
Appl. Mech. Mater. 2014, 543-547, 1639–1642. [CrossRef]
3. Liu, Y.; Hu, L.; Yan, F.; Zhang, B. Information Gain with Weight Based Decision Tree for the Employment Forecasting of
Undergraduates. In Proceedings of the 2013 IEEE International Conference on Green Computing and Communications and IEEE
Internet of Things and IEEE Cyber, Physical and Social Computing, Washington, DC, USA, 20–23 August 2013; pp. 2210–2213.
4. Mahdi, E.; Leiva, V.; Mara’Beh, S.; Martin-Barreiro, C. A New Approach to Predicting Cryptocurrency Returns Based on the
Gold Prices with Support Vector Machines during the COVID-19 Pandemic Using Sensor-Related Data. Sensors 2021, 21, 6319.
[CrossRef] [PubMed]
5. Tu, J.; Lin, A.; Chen, H.; Li, Y.; Li, C. Predict the Entrepreneurial Intention of Fresh Graduate Students Based on an Adaptive
Support Vector Machine Framework. Math. Probl. Eng. 2019, 2019, 1–16. [CrossRef]
6. Cuong-Le, T.; Minh, H.-L.; Khatir, S.; Wahab, M.A.; Tran, M.T.; Mirjalili, S. A novel version of Cuckoo search algorithm for solving
optimization problems. Expert Syst. Appl. 2021, 186, 115669. [CrossRef]
7. Abualigah, L.; Elaziz, M.A.; Sumari, P.; Geem, Z.W.; Gandomi, A.H. Reptile Search Algorithm (RSA): A nature-inspired
meta-heuristic optimizer. Expert Syst. Appl. 2021, 191, 116158. [CrossRef]
8. Nadimi-Shahraki, M.H.; Taghian, S.; Mirjalili, S.; Abualigah, L.; Elaziz, M.A.; Oliva, D. EWOA-OPF: Effective Whale Optimization
Algorithm to Solve Optimal Power Flow Problem. Electronics 2021, 10, 2975. [CrossRef]
9. Gandomi, A.H.; Roke, D. A Multi-Objective Evolutionary Framework for Formulation of Nonlinear Structural Systems. IEEE
Trans. Ind. Inform. 2021, 1. [CrossRef]
10. Storn, R.; Price, K. Differential evolution—A simple and efficient heuristic for global optimization over continuous spaces. J. Glob.
Optim. 1997, 11, 341–359. [CrossRef]
11. Li, S.; Chen, H.; Wang, M.; Heidari, A.A.; Mirjalili, S. Slime mould algorithm: A new method for stochastic optimization. Future
Gener. Comput. Syst. 2020, 111, 300–323. [CrossRef]
12. Mirjalili, S.; Mirjalili, S.M.; Lewis, A. Grey Wolf Optimizer. Adv. Eng. Softw. 2014, 69, 46–61. [CrossRef]
13. Zhao, X.; Zhang, X.; Cai, Z.; Tian, X.; Wang, X.; Huang, Y.; Chen, H.; Hu, L. Chaos enhanced grey wolf optimization wrapped
ELM for diagnosis of paraquat-poisoned patients. Comput. Biol. Chem. 2019, 78, 481–490. [CrossRef]
14. Yang, X.-S. A New Metaheuristic Bat-Inspired Algorithm. In Nature Inspired Cooperative Strategies for Optimization (NICSO
2010). Studies in Computational Intelligence; González, J.R., Pelta, D.A., Cruz, C., Terrazas, G., Krasnogor, N., Eds.; Springer:
Berlin/Heidelberg, Germany, 2010; pp. 65–74.
15. Yang, X.-S. Firefly Algorithms for Multimodal Optimization. In International Symposium on Stochastic Algorithms; Springer:
Berlin/Heidelberg, Germany, 2009; pp. 169–178.
16. Mirjalili, S.; Lewis, A. The Whale Optimization Algorithm. Adv. Eng. Softw. 2016, 95, 51–67. [CrossRef]
135
Electronics 2022, 11, 209
17. Chen, H.; Xu, Y.; Wang, M.; Zhao, X. A balanced whale optimization algorithm for constrained engineering design problems.
Appl. Math. Model. 2019, 71, 45–59. [CrossRef]
18. Mirjalili, S. Moth-flame optimization algorithm: A novel nature-inspired heuristic paradigm. Knowl. Based Syst. 2015, 89, 228–249.
[CrossRef]
19. Xu, Y.; Chen, H.; Luo, J.; Zhang, Q.; Jiao, S.; Zhang, X. Enhanced Moth-flame optimizer with mutation strategy for global
optimization. Inf. Sci. 2019, 492, 181–203. [CrossRef]
20. Xu, Y.; Chen, H.; Heidari, A.A.; Luo, J.; Zhang, Q.; Zhao, X.; Li, C. An efficient chaotic mutative moth-flame-inspired optimizer
for global optimization tasks. Expert Syst. Appl. 2019, 129, 135–155. [CrossRef]
21. Mirjalili, S. SCA: A Sine Cosine Algorithm for solving optimization problems. Knowl. Based Syst. 2016, 96, 120–133. [CrossRef]
22. Heidari, A.A.; Abbaspour, R.A.; Chen, H. Efficient boosted grey wolf optimizers for global search and kernel extreme learning
machine training. Appl. Soft Comput. 2019, 81, 105521. [CrossRef]
23. Chen, W.-N.; Zhang, J.; Lin, Y.; Chen, N.; Zhan, Z.-H.; Chung, H.; Li, Y.; Shi, Y.-H. Particle Swarm Optimization with an Aging
Leader and Challengers. IEEE Trans. Evol. Comput. 2012, 17, 241–258. [CrossRef]
24. Jia, D.; Zheng, G.; Khan, M.K. An effective memetic differential evolution algorithm based on chaotic local search. Inf. Sci. 2011,
181, 3175–3187. [CrossRef]
25. Chen, H.; Yang, C.; Heidari, A.A.; Zhao, X. An efficient double adaptive random spare reinforced whale optimization algorithm.
Expert Syst. Appl. 2020, 154, 113018. [CrossRef]
26. Yu, H.; Zhao, N.; Wang, P.; Chen, H.; Li, C. Chaos-enhanced synchronized bat optimizer. Appl. Math. Model. 2020, 77, 1201–1215.
[CrossRef]
27. Lin, A.; Wu, Q.; Heidari, A.A.; Xu, Y.; Chen, H.; Geng, W.; Li, Y.; Li, C. Predicting Intentions of Students for Master Programs
Using a Chaos-Induced Sine Cosine-Based Fuzzy K-Nearest Neighbor Classifier. IEEE Access 2019, 7, 67235–67248. [CrossRef]
28. Heidari, A.A.; Mirjalili, S.; Faris, H.; Aljarah, I.; Mafarja, M.; Chen, H. Harris hawks optimization: Algorithm and applications.
Futur. Gener. Comput. Syst. 2019, 97, 849–872. [CrossRef]
29. Ahmadianfar, I.; Heidari, A.A.; Gandomi, A.H.; Chu, X.; Chen, H. RUN beyond the metaphor: An efficient optimization algorithm
based on Runge Kutta method. Expert Syst. Appl. 2021, 181, 115079. [CrossRef]
30. Tu, J.; Chen, H.; Wang, M.; Gandomi, A.H. The Colony Predation Algorithm. J. Bionic Eng. 2021, 18, 674–710. [CrossRef]
31. Yang, Y.; Chen, H.; Heidari, A.A.; Gandomi, A.H. Hunger games search: Visions, conception, implementation, deep analysis,
perspectives, and towards performance shifts. Expert Syst. Appl. 2021, 177, 114864. [CrossRef]
32. Zhao, S.; Wang, P.; Heidari, A.A.; Chen, H.; Turabieh, H.; Mafarja, M.; Li, C. Multilevel threshold image segmentation with
diffusion association slime mould algorithm and Renyi’s entropy for chronic obstructive pulmonary disease. Comput. Biol. Med.
2021, 134, 104427. [CrossRef] [PubMed]
33. Liu, L.; Zhao, D.; Yu, F.; Heidari, A.A.; Ru, J.; Chen, H.; Mafarja, M.; Turabieh, H.; Pan, Z. Performance optimization of differential
evolution with slime mould algorithm for multilevel breast cancer image segmentation. Comput. Biol. Med. 2021, 138, 104910.
[CrossRef]
34. Yu, C.; Heidari, A.A.; Xue, X.; Zhang, L.; Chen, H.; Chen, W. Boosting quantum rotation gate embedded slime mould algorithm.
Expert Syst. Appl. 2021, 181, 115082. [CrossRef]
35. Liu, Y.; Heidari, A.A.; Ye, X.; Liang, G.; Chen, H.; He, C. Boosting slime mould algorithm for parameter identification of
photovoltaic models. Energy 2021, 234, 121164. [CrossRef]
36. Shi, B.; Ye, H.; Zheng, J.; Zhu, Y.; Heidari, A.A.; Zheng, L.; Chen, H.; Wang, L.; Wu, P. Early Recognition and Discrimination of
COVID-19 Severity Using Slime Mould Support Vector Machine for Medical Decision-Making. IEEE Access 2021, 9, 121996–122015.
[CrossRef]
37. Premkumar, M.; Jangir, P.; Sowmya, R.; Alhelou, H.H.; Heidari, A.A.; Chen, H. MOSMA: Multi-Objective Slime Mould Algorithm
Based on Elitist Non-Dominated Sorting. IEEE Access 2020, 9, 3229–3248. [CrossRef]
38. Xia, X.; Gui, L.; Zhan, Z.-H. A multi-swarm particle swarm optimization algorithm based on dynamical topology and purposeful
detecting. Appl. Soft Comput. 2018, 67, 126–140. [CrossRef]
39. Zhang, L.; Zhang, C. Hopf bifurcation analysis of some hyperchaotic systems with time-delay controllers. Kybernetika 2008, 44,
35–42.
40. Geyer, C.J. Markov Chain Monte Carlo Maximum Likelihood; Interface Foundation of North America: Fairfax Sta, VA, USA, 1991.
41. Lai, X.; Zhou, Y. Analysis of multiobjective evolutionary algorithms on the biobjective traveling salesman problem (1,2). Multimedia
Tools Appl. 2020, 79, 30839–30860. [CrossRef]
42. Zhang, Y.; Liu, R.; Wang, X.; Chen, H.; Li, C. Boosted binary Harris hawks optimizer and feature selection. Eng. Comput. 2021, 37,
3741–3770. [CrossRef]
43. Hu, J.; Chen, H.; Heidari, A.A.; Wang, M.; Zhang, X.; Chen, Y.; Pan, Z. Orthogonal learning covariance matrix for defects of grey
wolf optimizer: Insights, balance, diversity, and feature selection. Knowl. Based Syst. 2020, 213, 106684. [CrossRef]
44. Zhang, X.; Xu, Y.; Yu, C.; Heidari, A.A.; Li, S.; Chen, H.; Li, C. Gaussian mutational chaotic fruit fly-built optimization and feature
selection. Expert Syst. Appl. 2020, 141, 112976. [CrossRef]
45. Li, Q.; Chen, H.; Huang, H.; Zhao, X.; Cai, Z.-N.; Tong, C.; Liu, W.; Tian, X. An Enhanced Grey Wolf Optimization Based Feature
Selection Wrapped Kernel Extreme Learning Machine for Medical Diagnosis. Comput. Math. Methods Med. 2017, 2017, 1–15.
[CrossRef]
136
Electronics 2022, 11, 209
46. Liu, T.; Hu, L.; Ma, C.; Wang, Z.-Y.; Chen, H.-L. A fast approach for detection of erythemato-squamous diseases based on extreme
learning machine with maximum relevance minimum redundancy feature selection. Int. J. Syst. Sci. 2013, 46, 919–931. [CrossRef]
47. Hu, K.; Ye, J.; Fan, E.; Shen, S.; Huang, L.; Pi, J. A novel object tracking algorithm by fusing color and depth information based on
single valued neutrosophic cross-entropy. J. Intell. Fuzzy Syst. 2017, 32, 1775–1786. [CrossRef]
48. Hu, K.; He, W.; Ye, J.; Zhao, L.; Peng, H.; Pi, J. Online Visual Tracking of Weighted Multiple Instance Learning via Neutrosophic
Similarity-Based Objectness Estimation. Symmetry 2019, 11, 832. [CrossRef]
49. Chen, M.-R.; Zeng, G.-Q.; Lu, K.-D.; Weng, J. A Two-Layer Nonlinear Combination Method for Short-Term Wind Speed Prediction
Based on ELM, ENN, and LSTM. IEEE Internet Things J. 2019, 6, 6997–7010. [CrossRef]
50. Zeng, G.-Q.; Lu, K.; Dai, Y.-X.; Zhang, Z.; Chen, M.-R.; Zheng, C.-W.; Wu, D.; Peng, W.-W. Binary-coded extremal optimization for
the design of PID controllers. Neurocomputing 2014, 138, 180–188. [CrossRef]
51. Zeng, G.-Q.; Chen, J.; Dai, Y.-X.; Li, L.-M.; Zheng, C.-W.; Chen, M.-R. Design of fractional order PID controller for automatic
regulator voltage system based on multi-objective extremal optimization. Neurocomputing 2015, 160, 173–184. [CrossRef]
52. Zeng, G.-Q.; Xie, X.-Q.; Chen, M.-R.; Weng, J. Adaptive population extremal optimization-based PID neural network for
multivariable nonlinear control systems. Swarm Evol. Comput. 2019, 44, 320–334. [CrossRef]
53. Zhao, D.; Liu, L.; Yu, F.; Heidari, A.A.; Wang, M.; Liang, G.; Muhammad, K.; Chen, H. Chaotic random spare ant colony
optimization for multi-threshold image segmentation of 2D Kapur entropy. Knowl. Based Syst. 2021, 216, 106510. [CrossRef]
54. Zhao, D.; Liu, L.; Yu, F.; Heidari, A.A.; Wang, M.; Oliva, D.; Muhammad, K.; Chen, H. Ant colony optimization with horizontal
and vertical crossover search: Fundamental visions for multi-threshold image segmentation. Expert Syst. Appl. 2020, 167, 114122.
[CrossRef]
55. Zeng, G.-Q.; Lu, Y.-Z.; Mao, W.-J. Modified extremal optimization for the hard maximum satisfiability problem. J. Zhejiang Univ.
Sci. C 2011, 12, 589–596. [CrossRef]
56. Zeng, G.; Zheng, C.; Zhang, Z.; Lu, Y. An Backbone Guided Extremal Optimization Method for Solving the Hard Maximum
Satisfiability Problem. Int. J. Innov. Comput. Inf. Control. 2012, 8, 8355–8366. [CrossRef]
57. Shen, L.; Chen, H.; Yu, Z.; Kang, W.; Zhang, B.; Li, H.; Yang, B.; Liu, D. Evolving support vector machines using fruit fly
optimization for medical data classification. Knowl. Based Syst. 2016, 96, 61–75. [CrossRef]
58. Wang, M.; Chen, H.; Yang, B.; Zhao, X.; Hu, L.; Cai, Z.; Huang, H.; Tong, C. Toward an optimal kernel extreme learning machine
using a chaotic moth-flame optimization strategy with applications in medical diagnoses. Neurocomputing 2017, 267, 69–84.
[CrossRef]
59. Wang, M.; Chen, H. Chaotic multi-swarm whale optimizer boosted support vector machine for medical diagnosis. Appl. Soft
Comput. 2020, 88, 105946. [CrossRef]
60. Deng, W.; Xu, J.; Zhao, H.; Song, Y. A Novel Gate Resource Allocation Method Using Improved PSO-Based QEA. IEEE Trans.
Intell. Transp. Syst. 2020, PP, 1–9. [CrossRef]
61. Deng, W.; Xu, J.; Song, Y.; Zhao, H. An Effective Improved Co-evolution Ant Colony Optimization Algorithm with Multi-Strategies
and Its Application. Int. J. Bio-Inspired Comput. 2020, 16, 158–170. [CrossRef]
62. Deng, W.; Liu, H.; Xu, J.; Zhao, H.; Song, Y. An Improved Quantum-Inspired Differential Evolution Algorithm for Deep Belief
Network. IEEE Trans. Instrum. Meas. 2020, 69, 7319–7327. [CrossRef]
63. Zhao, H.; Liu, H.; Xu, J.; Deng, W. Performance Prediction Using High-Order Differential Mathematical Morphology Gradient
Spectrum Entropy and Extreme Learning Machine. IEEE Trans. Instrum. Meas. 2020, 69, 4165–4172. [CrossRef]
64. Zhao, X.; Li, D.; Yang, B.; Ma, C.; Zhu, Y.; Chen, H. Feature selection based on improved ant colony optimization for online
detection of foreign fiber in cotton. Appl. Soft Comput. 2014, 24, 585–596. [CrossRef]
65. Zhao, X.; Li, D.; Yang, B.; Chen, H.; Yang, X.; Yu, C.; Liu, S. A two-stage feature selection method with its application. Comput.
Electr. Eng. 2015, 47, 114–125. [CrossRef]
66. Zhang, X.; Du, K.-J.; Zhan, Z.-H.; Kwong, S.; Gu, T.-L.; Zhang, J. Cooperative Coevolutionary Bare-Bones Particle Swarm
Optimization With Function Independent Decomposition for Large-Scale Supply Chain Network Design With Uncertainties.
IEEE Trans. Cybern. 2019, 50, 4454–4468. [CrossRef]
67. Chen, Z.-G.; Zhan, Z.-H.; Lin, Y.; Gong, Y.-J.; Gu, T.-L.; Zhao, F.; Yuan, H.-Q.; Chen, X.; Li, Q.; Zhang, J. Multiobjective Cloud
Workflow Scheduling: A Multiple Populations Ant Colony System Approach. IEEE Trans. Cybern. 2019, 49, 2912–2926. [CrossRef]
68. Wang, Z.-J.; Zhan, Z.-H.; Yu, W.-J.; Lin, Y.; Zhang, J.; Gu, T.-L.; Zhang, J. Dynamic Group Learning Distributed Particle Swarm
Optimization for Large-Scale Optimization and Its Application in Cloud Workflow Scheduling. IEEE Trans. Cybern. 2020, 50,
2715–2729. [CrossRef]
69. Yang, Z.; Li, K.; Guo, Y.; Ma, H.; Zheng, M. Compact real-valued teaching-learning based optimization with the applications to
neural network training. Knowl. Based Syst. 2018, 159, 51–62. [CrossRef]
70. Zhou, S.-Z.; Zhan, Z.-H.; Chen, Z.-G.; Kwong, S.; Zhang, J. A Multi-Objective Ant Colony System Algorithm for Airline Crew
Rostering Problem with Fairness and Satisfaction. IEEE Trans. Intell. Transp. Syst. 2020, 22, 6784–6798. [CrossRef]
71. Liang, D.; Zhan, Z.-H.; Zhang, Y.; Zhang, J. An Efficient Ant Colony System Approach for New Energy Vehicle Dispatch Problem.
IEEE Trans. Intell. Transp. Syst. 2019, 21, 4784–4797. [CrossRef]
72. Liang, J.J.; Qu, B.Y.; Suganthan, P.N. Problem definitions and evaluation criteria for the CEC 2017 special session and competition
on single objective real-parameter numerical optimization. Tech. Rep. 2016, 635, 490.
137
Electronics 2022, 11, 209
73. Derrac, J.; García, S.; Molina, D.; Herrera, F. A practical tutorial on the use of nonparametric statistical tests as a methodology for
comparing evolutionary and swarm intelligence algorithms. Swarm Evol. Comput. 2011, 1, 3–18. [CrossRef]
74. García, S.; Fernández, A.; Luengo, J.; Herrera, F. Advanced nonparametric tests for multiple comparisons in the design of
experiments in computational intelligence and data mining: Experimental analysis of power. Inf. Sci. 2010, 180, 2044–2064.
[CrossRef]
75. Hua, Y.; Liu, Q.; Hao, K.; Jin, Y. A Survey of Evolutionary Algorithms for Multi-Objective Optimization Problems with Irregular
Pareto Fronts. IEEE/CAA J. Autom. Sin. 2021, 8, 303–318. [CrossRef]
76. Zhang, W.; Hou, W.; Li, C.; Yang, W.; Gen, M. Multidirection Update-Based Multiobjective Particle Swarm Optimization for
Mixed No-Idle Flow-Shop Scheduling Problem. Complex Syst. Model. Simul. 2021, 1, 176–197. [CrossRef]
77. Gu, Z.-M.; Wang, G.-G. Improving NSGA-III algorithms with information feedback models for large-scale many-objective
optimization. Futur. Gener. Comput. Syst. 2020, 107, 49–69. [CrossRef]
78. Yi, J.-H.; Deb, S.; Dong, J.; Alavi, A.H.; Wang, G.-G. An improved NSGA-III algorithm with adaptive mutation operator for Big
Data optimization problems. Futur. Gener. Comput. Syst. 2018, 88, 571–585. [CrossRef]
79. Zhao, F.; Di, S.; Cao, J.; Tang, J. Jonrinaldi A Novel Cooperative Multi-Stage Hyper-Heuristic for Combination Optimization
Problems. Complex Syst. Model. Simul. 2021, 1, 91–108. [CrossRef]
80. Hu, Z.; Wang, J.; Zhang, C.; Luo, Z.; Luo, X.; Xiao, L.; Shi, J. Uncertainty Modeling for Multi center Autism Spectrum Disorder
Classification Using Takagi-Sugeno-Kang Fuzzy Systems. IEEE Trans. Cogn. Dev. Syst. 2021, 1. [CrossRef]
81. Chen, C.Z.; Wu, Q.; Li, Z.Y.; Xiao, L.; Hu, Z.Y. Diagnosis of Alzheimer’s disease based on Deeply-Fused Nets. Comb. Chem. High
Throughput Screen. 2020, 24, 781–789. [CrossRef]
82. Fei, X.; Wang, J.; Ying, S.; Hu, Z.; Shi, J. Projective parameter transfer based sparse multiple empirical kernel learning Machine for
diagnosis of brain disease. Neurocomputing 2020, 413, 271–283. [CrossRef]
83. Saber, A.; Sakr, M.; Abo-Seida, O.M.; Keshk, A.; Chen, H. A Novel Deep-Learning Model for Automatic Detection and
Classification of Breast Cancer Using the Transfer-Learning Technique. IEEE Access 2021, 9, 71194–71209. [CrossRef]
84. Wu, Z.; Li, G.; Shen, S.; Lian, X.; Chen, E.; Xu, G. Constructing dummy query sequences to protect location privacy and query
privacy in location-based services. World Wide Web 2021, 24, 25–49. [CrossRef]
85. Wu, Z.; Wang, R.; Li, Q.; Lian, X.; Xu, G.; Chen, E.; Liu, X. A Location Privacy-Preserving System Based on Query Range Cover-Up
or Location-Based Services. IEEE Trans. Veh. Technol. 2020, 69, 5244–5254. [CrossRef]
86. Xue, X.; Zhou, D.; Chen, F.; Yu, X.; Feng, Z.; Duan, Y.; Meng, L.; Zhang, M. From SOA to VOA: A Shift in Understanding the
Operation and Evolution of Service Ecosystem. IEEE Trans. Serv. Comput. 2021, 1. [CrossRef]
87. Zhang, L.; Zou, Y.; Wang, W.; Jin, Z.; Su, Y.; Chen, H. Resource allocation and trust computing for blockchain-enabled edge
computing system. Comput. Secur. 2021, 105, 102249. [CrossRef]
88. Zhang, L.; Zhang, Z.; Wang, W.; Waqas, R.; Zhao, C.; Kim, S.; Chen, H. A Covert Communication Method Using Special Bitcoin
Addresses Generated by Vanitygen. Comput. Mater. Contin. 2020, 65, 597–616.
89. Zhang, L.; Zhang, Z.; Wang, W.; Jin, Z.; Su, Y.; Chen, H. Research on a Covert Communication Model Realized by Using Smart
Contracts in Blockchain Environment. IEEE Syst. J. 2021, 1–12. [CrossRef]
90. Qiu, S.; Hao, Z.; Wang, Z.; Liu, L.; Liu, J.; Zhao, H.; Fortino, G. Sensor Combination Selection Strategy for Kayak Cycle Phase
Segmentation Based on Body Sensor Networks. IEEE Internet Things J. 2021, 1. [CrossRef]
91. Zhang, X.; Wang, T.; Wang, J.; Tang, G.; Zhao, L. Pyramid Channel-based Feature Attention Network for image dehazing. Comput.
Vis. Image Underst. 2020, 197–198, 103003. [CrossRef]
92. Liu, H.; Li, X.; Zhang, S.; Tian, Q. Adaptive Hashing With Sparse Matrix Factorization. IEEE Trans. Neural Networks Learn. Syst.
2019, 31, 4318–4329. [CrossRef]
93. Wu, Z.; Li, R.; Zhou, Z.; Guo, J.; Jiang, J.; Su, X. A user sensitive subject protection approach for book search service. J. Assoc. Inf.
Sci. Technol. 2020, 71, 183–195. [CrossRef]
94. Wu, Z.; Shen, S.; Lian, X.; Su, X.; Chen, E. A dummy-based user privacy protection approach for text information retrieval. Knowl.
Based Syst. 2020, 195, 105679. [CrossRef]
95. Wu, Z.; Shen, S.; Zhou, H.; Li, H.; Lu, C.; Zou, D. An effective approach for the protection of user commodity viewing privacy in
e-commerce website. Knowl. Based Syst. 2021, 220, 106952. [CrossRef]
96. Liu, H.; Liu, L.; Le, T.D.; Lee, I.; Sun, S.; Li, J. Nonparametric Sparse Matrix Decomposition for Cross-View Dimensionality
Reduction. IEEE Trans. Multimedia 2017, 19, 1848–1859. [CrossRef]
97. Qiu, S.; Zhao, H.; Jiang, N.; Wu, D.; Song, G.; Zhao, H.; Wang, Z. Sensor network oriented human motion capture via wearable
intelligent system. Int. J. Intell. Syst. 2021, 37, 1646–1673. [CrossRef]
98. Liu, P.; Gao, H. A novel green supplier selection method based on the interval type-2 fuzzy prioritized choquet bonferroni means.
IEEE/CAA J. Autom. Sin. 2020, 1–17. [CrossRef]
99. Han, X.; Han, Y.; Chen, Q.; Li, J.; Sang, H.; Liu, Y.; Pan, Q.; Nojima, Y. Distributed Flow Shop Scheduling with Sequence-Dependent
Setup Times Using an Improved Iterated Greedy Algorithm. Complex Syst. Model. Simul. 2021, 1, 198–217. [CrossRef]
100. Gao, D.; Wang, G.-G.; Pedrycz, W. Solving Fuzzy Job-Shop Scheduling Problem Using DE Algorithm Improved by a Selection
Mechanism. IEEE Trans. Fuzzy Syst. 2020, 28, 3265–3275. [CrossRef]
101. Cao, X.; Cao, T.; Gao, F.; Guan, X. Risk-Averse Storage Planning for Improving RES Hosting Capacity Under Uncertain Siting
Choices. IEEE Trans. Sustain. Energy 2021, 12, 1984–1995. [CrossRef]
138
Electronics 2022, 11, 209
102. Cao, X.; Wang, J.; Wang, J.; Zeng, B. A Risk-Averse Conic Model for Networked Microgrids Planning with Reconfiguration and
Reorganizations. IEEE Trans. Smart Grid 2020, 11, 696–709. [CrossRef]
103. Ramadan, A.; Kamel, S.; Taha, I.B.M.; Tostado-Véliz, M. Parameter Estimation of Modified Double-Diode and Triple-Diode
Photovoltaic Models Based on Wild Horse Optimizer. Electronics 2021, 10, 2308. [CrossRef]
104. Liu, Y.; Ran, J.; Hu, H.; Tang, B. Energy-Efficient Virtual Network Function Reconfiguration Strategy Based on Short-Term
Resources Requirement Prediction. Electronics 2021, 10, 2287. [CrossRef]
105. Shafqat, W.; Malik, S.; Lee, K.-T.; Kim, D.-H. PSO Based Optimized Ensemble Learning and Feature Selection Approach for
Efficient Energy Forecast. Electronics 2021, 10, 2188. [CrossRef]
106. Choi, H.-T.; Hong, B.-W. Unsupervised Object Segmentation Based on Bi-Partitioning Image Model Integrated with Classification.
Electronics 2021, 10, 2296. [CrossRef]
107. Saeed, U.; Shah, S.Y.; Shah, S.A.; Ahmad, J.; Alotaibi, A.A.; Althobaiti, T.; Ramzan, N.; Alomainy, A.; Abbasi, Q.H. Discrete Human
Activity Recognition and Fall Detection by Combining FMCW RADAR Data of Heterogeneous Environments for Independent
Assistive Living. Electronincs 2021, 10, 2237. [CrossRef]
139
electronics
Article
Random Replacement Crisscross Butterfly Optimization
Algorithm for Standard Evaluation of Overseas
Chinese Associations
Hanli Bao 1 , Guoxi Liang 2, *, Zhennao Cai 3 and Huiling Chen 3, *
1 College of Overseas Chinese, Wenzhou University, Wenzhou 325035, China; [email protected]
2 Department of Information Technology, Wenzhou Polytechnic, Wenzhou 325035, China
3 College of Computer Science and Artificial Intelligence, Wenzhou University, Wenzhou 325035, China;
[email protected]
* Correspondence: [email protected] (G.L.); [email protected] (H.C.)
Abstract: The butterfly optimization algorithm (BOA) is a swarm intelligence optimization algorithm
proposed in 2019 that simulates the foraging behavior of butterflies. Similarly, the BOA itself
has certain shortcomings, such as a slow convergence speed and low solution accuracy. To cope
with these problems, two strategies are introduced to improve the performance of BOA. One is
the random replacement strategy, which involves replacing the position of the current solution
with that of the optimal solution and is used to increase the convergence speed. The other is the
crisscross search strategy, which is utilized to trade off the capability of exploration and exploitation
in BOA to remove local dilemmas whenever possible. In this case, we propose a novel optimizer
named the random replacement crisscross butterfly optimization algorithm (RCCBOA). In order to
evaluate the performance of RCCBOA, comparative experiments are conducted with another nine
advanced algorithms on the IEEE CEC2014 function test set. Furthermore, RCCBOA is combined with
support vector machine (SVM) and feature selection (FS)—namely, RCCBOA-SVM-FS—to attain a
Citation: Bao, H.; Liang, G.; Cai, Z.;
standardized construction model of overseas Chinese associations. It is found that the reasonableness
Chen, H. Random Replacement
of bylaws; the regularity of general meetings; and the right to elect, be elected, and vote are of
Crisscross Butterfly Optimization
importance to the planning and standardization of Chinese associations. Compared with other
Algorithm for Standard Evaluation of
Overseas Chinese Associations.
machine learning methods, the RCCBOA-SVM-FS model has an up to 95% accuracy when dealing
Electronics 2022, 11, 1080. https:// with the normative prediction problem of overseas Chinese associations. Therefore, the constructed
doi.org/10.3390/electronics11071080 model is helpful for guiding the orderly and healthy development of overseas Chinese associations.
Academic Editor: Maciej
Keywords: butterfly optimization algorithm; random replacement; crisscross search; overseas
Ławryńczuk
Chinese associations; support vector machine
Received: 9 February 2022
Accepted: 23 March 2022
Published: 29 March 2022
Publisher’s Note: MDPI stays neutral
1. Introduction
with regard to jurisdictional claims in As an important organizational form of overseas Chinese society and a direct partici-
published maps and institutional affil- pant and promoter of the great rejuvenation of China, the Overseas Chinese Association has
iations. shown a good development momentum in the new era. In recent years, Zhejiang overseas
Chinese groups have gradually increased in number and expanded in scale. However, most
overseas Chinese associations are still irregular in terms of their establishment, operation,
and management, meaning that they cannot become exemplary and representative featured
Copyright: © 2022 by the authors.
overseas Chinese associations. The problems of irregularities in overseas Chinese associ-
Licensee MDPI, Basel, Switzerland.
ations are mainly manifested in ten aspects: legality, incomplete constitutions, irregular
This article is an open access article
elections, the phenomenon of the “one-man meeting”, prominent concurrent roles, unsound
distributed under the terms and
teams, significantly bad records held by the head of the association, lack of innovation
conditions of the Creative Commons
awareness caused by aging, the existence of zombie groups, and a lack of professionalism.
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
Both internal contradictions and external pressures lead to the emergence of these problems,
4.0/).
which hinder the development of the overseas Chinese associations and undermine their
Electronics 2022, 11, 1080. https://doi.org/10.3390/electronics11071080 https://www.mdpi.com/journal/electronics
141
Electronics 2022, 11, 1080
harmonious atmosphere. Carrying out the standardization of overseas Chinese associations
is a necessary and urgent task in order to safeguard the rights and interests of overseas
Chinese citizens. Therefore, it is necessary to conduct an in-depth analysis of the factors
affecting the standardized construction of overseas Chinese associations and establish an
evaluation model to help guide their orderly and healthy development.
The study of overseas Chinese associations has been a hot topic in academic circles.
Many scholars have studied the development of overseas Chinese associations around
the world from multiple perspectives. Li et al. [1] studied the reasons, characteristics, and
influence of explosive growth of overseas Chinese associations in Europe from the 1980s to
the 1990s. Fei et al. [2] studied how “new” overseas Chinese immigrant associations drive
the development of “old” overseas Chinese immigrant associations in the Pacific region
from a historical perspective. Maurice et al. [3] focused on how the Chinese immigrants and
overseas Chinese associations in Singapore adapted to colonial society in the 19th century.
Ma et al. [4] elaborated on the formation of overseas Chinese associations in the United
States and their influence on local politics and economy. The above scholars have studied
overseas Chinese associations from the perspectives of history, politics, and international
relations, but no scholars have automated their analysis by means of computer algorithms
yet [5]. Previously, research has only been conducted to classify non-profit organizations by
their fields of activity through computer algorithms. In this paper, we will use intelligent
algorithms to calculate 1050 valid questionnaires made by overseas Chinese of Zhejiang
nationality from all over the world and establish a program that can quickly identify the
regularity of overseas Chinese associations so as to provide a reference allowing Chinese
embassies and consulates abroad to accurately grasp the latest trends of overseas Chinese
associations and examine whether or not they are legitimate. This procedure can provide a
standard for the standardization of overseas Chinese associations, so that the rights and
interests of every overseas Chinese can be protected and avoid irregular overseas Chinese
associations from harming the rights and interests of them.
Based on existing data, this paper first proposes RCCBOA with SVM, the core of which
is mainly combined with random replacement and a crisscross search strategy to better
predict the standardized construction of overseas Chinese associations, effectively boosting
the accuracy of the solution of BOA. BOA is one of many intelligent optimization algo-
rithms. It is a global optimization algorithm inspired by butterfly foraging behavior that
was proposed by Sankalap Arora and Satvir Singh in 2019 [6]. BOA has a simple structure,
few parameters, and is based on a novel idea; it is suitable for solving high-dimensional
optimization problems. Compared with other optimization algorithms proposed recently,
the optimization performance is stronger and the influence of dimensional changes is
smaller, so it has relevant research potential. However, BOA has the problems of a slow
convergence speed and low solution accuracy on some benchmark functions. According
to “no free lunch” (NFL) theorems [7], no one algorithm can be applied to all problems.
Similarly, the main reason why we conducted this research was to find a type of benchmark
problem or practical problem that would be suitable for the algorithm. The relevant work
on BOA has attracted a wide range of scholars both at home and abroad. Long et al. [8]
designed an enhanced adaptable BOA (EABOA) to improve the parameter estimation of PV
models; this was also tested on 12 classical benchmark function sets to verify its superior
performance. Sharma et al. [9] proposed a boosted BOA with bidirectional search (BBOA)
and tested it on seven unimodal benchmark functions and three practical engineering
optimization problems. Mortazavi et al. [10] used a fuzzy BOA (FBOA) and tested it on
resolving certain constrained and non-constrained optimization problems. Sundaravadi-
vel et al. [11] proposed a weighted BOA (WBOA) with an intuitionistic fuzzy gaussian
function to predict the outcome of infection with COVID-19. Zhou et al. [12] proposed
an improved BOA to apply numerical examples of a simply-supported beam and truss
structure. Thawkar et al. [13] introduced an ant lion optimizer into BOA (BOAALO), which
was used to predict the benign or malignant status of breast tissue. Long et al. [14] designed
a hybrid BOA with an adaptive gbest-guided search strategy and pinhole-imaging-based
142
Electronics 2022, 11, 1080
learning (PIL-BOA) to deal with feature selection problems. Sowjanya et al. [15] utilized
BOA and gas Brownian motion optimization to obtain the optimal threshold levels for
image segmentation. Some other improved algorithms have also been widely used to solve
complex problems in various fields. Descriptions of the novel improved algorithms are
provided in Table 1.
Table 1. Description of other novel improved algorithms.
Author Year Proposed Algorithm Description
An improved Harris hawk optimization It was applied to feature selection and gained
Hu et al. [16] 2021
(HHOSRL) a high accuracy.
It was used to estimate the parameters of
Fan et al. [17] 2021 A new particle swarm optimization (PSOCS)
PV models.
An enhanced colony predation algorithm It used a kernel extreme learning machine to
Shi et al. [18] 2021
(ECPA) classify the severity of COVID-19.
A novel enhanced spherical evolution It was applied to evaluate unknown
Zhou et al. [19] 2021
algorithm (DSCSE) parameters of PV models.
An improved slime mould algorithm It provided effective assistance in solving
Yu et al. [20] 2021
(WQSMA) optimization problems.
A new gradient-based optimizer with It was employed to gain the PV model
Zhou et al. [21] 2021
random learning mechanism (RLGBO) parameters of different conditions.
It was utilized to select optimal feature
An innovative binary version of moth-flame
Xu et al. [22] 2021 subsets with the K-Nearest Neighbor
optimizer (ESAMFO)
Classifier.
It was verified by comparison with certain
Liu et al. [23] 2021 A novel ant colony optimizer (CLACO)
excellent peers.
It was tested on CEC2014 functions and
Zhao et al. [24] 2021 An improved salp swarm algorithm (EHSSA)
image segmentation problems.
A dynamic bare-bones fruit fly optimization It was tested on with CEC2017 and seven
Yu et al. [25] 2020
algorithm (BareFOA) engineering optimization problems.
An enhanced DE-driven multi-population It was compared with plenty of other
Chen et al. [26] 2020
Harris hawks optimization (CMDHHO) algorithms based on CEC2017 and CEC2011.
It was applied in CEC2014 and used to solve
Chen et al. [27] 2020 A boosted sine cosine algorithm (OMGSCA)
some real-world optimization problems.
An adaptive support vector machine It was regarded as being successful for
Tu et al. [28] 2019
framework (RF-CSCA-SVM) predicting student graduation.
A hybrid whale optimization algorithm It was treated as an effective means to solve
Chen et al. [29] 2019
(BWOA) complex problems.
Aiming at addressing the deficiencies of BOA, we propose an improved butterfly
algorithm combining random replacement and a crisscross search strategy. The combination
of these two strategies effectively boosts the performance of the original one, enabling it to
have a better performance on complex problems. In order to evaluate the performance of
the proposed algorithm, it is compared with nine recently proposed advanced algorithms
on the CEC 2014 benchmark test set, including CDLOBA [30], CBA [31], RCBA J [32],
MWOA [33], LWOA [34], IWOA [35], CEFOA [36], CIFOA [37], and AMFOA [38]. In
addition, RCCBOA was also combined with SVM to solve the problem of predicting the
standardized construction of overseas Chinese associations. Experimental results show that
the convergence speed and convergence accuracy of this algorithm are better than those
of other advanced algorithms, and the best SVM optimized by RCCBOA had an accuracy
rate of 95% on the relevant data set. Therefore, the proposed RCCBOA has very broad
application prospects. The main contributions of this paper are as follows:
1. A new type of enhanced BOA which combines a random replacement strategy and
cross search strategy is proposed.
2. RCCBOA is compared with nine other advanced algorithms on the CEC 2014 bench-
mark function test.
143
Electronics 2022, 11, 1080
3. RCCBOA is combined with SVM to solve the problem of predicting overseas Chinese
associations.
The organizational structure of the thesis is as follows. Section 2 describes the SVM
and BOA. Sections 3 and 4 introduce the proposed RCCBOA and RCCBOA-SVM. Section 5
describes the data sources and experimental settings used. Section 6 shows the experimental
results. Section 7 discusses the experimental results, and the last section summarizes the
full paper and related future prospects.
2. Backgrounds
2.1. Overseas Chinese Associations
The full name of “Qiao Tuan” is “Overseas Chinese Association”. It is a formal group
made up of overseas Chinese nationals due to their certain related attributes and is an
important organizational form of overseas Chinese society, whose related attributes include
factors such as living area, work industry, academic field, language exchange, ethnic blood
relationship, etc. At present, the number of overseas Chinese associations exceeds 25,700.
Overseas Chinese associations have the functions of economic construction, safeguarding
rights and interests, overseas friendship, political participation, cultural dissemination,
and public welfare dedication. Overseas Chinese groups have participated in China’s
economic construction for a long time to achieve mutual benefits, contributing to the
masses and earnestly safeguard the basic rights and interests of overseas Chinese. Moreover,
overseas Chinese associations organize networking activities for overseas Chinese nationals
to promote communication and interaction among overseas Chinese people; they pay
attention to political changes, keep abreast of current trends, strive for resources, and serve
overseas Chinese nationals. Overseas Chinese associations are an important part of the
overseas dissemination of Chinese culture, inheriting culture vertically and spreading
culture horizontally. Moreover, overseas Chinese associations are parts of the country
where they are located, and it is the basic responsibility of the overseas Chinese associations
to serve local society and participate in public welfare matters.
Overseas Chinese associations are known as one of the three pillars of overseas
Chinese society and an important organizational form for maintaining its orderly operation.
Overseas Chinese associations have functions such as safeguarding the rights and interests
of overseas Chinese, building overseas friendships, promoting cultural dissemination,
and contributing to public welfare. Currently, the number of overseas Chinese nationals
exceeds 60 million, and the number of overseas Chinese associations around the world has
reached 25,700. The total number of overseas Chinese nationals from Zhejiang Province
is 3.792 million, ranking fifth in the country. There are also a large number of overseas
Chinese associations composed mostly of Zhejiang nationals. According to incomplete
statistics, there are 865 overseas Chinese associations, which are mainly distributed in
66 countries including Italy, Spain, the United States, and Australia.
2.2. Butterfly Optimization Algorithm (BOA)
In recent years, many optimization algorithms have been proposed for solving ap-
proximate optimal problems, such as hunger games search (HGS) [39], Harris hawks
optimization (HHO) [40], the slime mould algorithm (SMA) [41], the Runge–Kutta opti-
mizer (RUN) [42], the colony predation algorithm (CPA) [43], and the weighted mean of
vectors (INFO) [44].
These algorithms have a strong search ability and can solve many practical problems,
with applications such as medical diagnosis [45,46], economic emission dispatch problems [47],
engineering design [48–50], parameter tunning for machine learning models [18,51,52], image
segmentation [53–55], plant disease recognition [56], feature selection [57,58], bankruptcy
prediction [59,60], prediction problems in the educational field [61,62], PID optimization
control [63,64], the detection of foreign fibers in cotton [65,66], expensive optimization
problems [67,68], multi-objective or many optimization problems [69–71], the fault diagno-
sis of rolling bearings [72,73], gate resource allocation [74,75], combination optimization
144
Electronics 2022, 11, 1080
problems [76], big data optimization problems [77], green supplier selection [78], and
scheduling problems [79,80].
BOA [6] is a newly proposed optimization algorithm which is based on imitating the
foraging behavior of butterflies in nature [6]. Since its introduction, it has been applied
to many problems, such as fault diagnosis [81] and disease diagnosis [82]. Each butterfly
acts as a search operator and performs an optimization process in the search space. The
butterfly can perceive and distinguish different fragrance intensities, and the fragrance
emitted by each butterfly has a certain level of intensity. One must assume that the intensity
of the fragrance produced by the butterfly is related to its fitness; when the butterfly moves
from one place to another, its fitness will also change accordingly. The scent emitted by the
butterfly will spread in the air and be felt by other butterflies. This is the process by which
individual butterflies share personal information with other individual butterflies, thus
forming a collective social knowledge network. When a butterfly detects the scent of other
butterflies, it will move to the butterfly with the most scent, which is called a global search.
Conversely, when a butterfly cannot perceive the fragrance of other butterflies, it will move
randomly, which is called a local search.
If Xi = ( xi1 , xi2 , . . . , xiD ) is the i-th (i = 1, 2, . . . , N) butterfly individual, D is the search
space dimension, N is the butterfly population size, and the position update of the butterfly
individual is as shown in Equation (1).
xit + r2 × g∗ − xit f i
xit+1 = (1)
xit + r2 × x tj − xkt f i
where xit+1 is the solution vector of the i-th butterfly in t + 1 iterations; r is a random number
between 0 and 1; g∗ represents the global optimal individual in the current iteration; and xit
and xit are randomly generated butterfly individuals, representing the solution vector of
the j-th butterfly and the k-th butterfly in the solution space. The fragrance emitted by the
i-th butterfly is denoted by f i , and the specific expression of f i is shown in Equation (2).
f = cI a (2)
where f is the level of fragrance perception, c is the form of perception, and a is the power
exponent, which depends on the form of perception, reflecting the different degrees of
scent absorption.
The BOA is divided into three stages; the pseudo-code is shown in Algorithm 1.
(1) Initial stage. The parameter values used in BOA are assigned, and when these values
are set the algorithm proceeds to create an initial butterfly population for optimization.
The positions of the butterflies are randomly generated in the search space and their
scent and fitness values are calculated and stored.
(2) Iterative stage. In each iteration, all butterflies in the solution space are moved to new
positions and their fitness values are re-evaluated. The algorithm m first calculates
the fitness values of all butterflies at different positions of the solution space. Then,
these butterflies will use Equation (1) to generate fragrance in their place.
(3) End stage. Iteration continues until the maximum number of iterations is reached.
When the iteration phase ends, the algorithm outputs the optimal solution with the
best fitness.
145
Electronics 2022, 11, 1080
Algorithm 1: Pseudo-code of BOA.
Initialize population number n, dimensions d, max evaluations Max FEs , objective function f ( x );
Initialize sensor modality c, power exponent a, switch probability p, and evaluations t;
Initialize the population of butterflies xi (i = 1, 2, . . . , n);
Gain intensity Ii by f ( xi );
While (t ≤ Max FEs ):
Calculate the fragrance b f of each butterfly using Equation (2);
Gain the best b f ;
For i = 1 to n
Update r in [0, 1];
If r < p
Move to the best solution with Equation (1);
Else
Move randomly using Equation (1);
End if
End for
t = t + 1;
Update parameter a;
End while
Output best solution.
2.3. Support Vector Machine
The purpose of the support vector machine (SVM) is to find the hyperplane that is
the furthest away from various sample points. SVM is a supervised learning method used
for classification problems, with the goal of finding the hyperplane that can most accu-
rately separate positive and negative samples. Assuming given sample data G = ( xi , yi ),
i = 1, . . . , N, x ∈ Rd , y ∈ {±1}, the hyperplane is expressed as follows:
g( x ) = ω T x + b (3)
The SVM model according to the existing standard is as follows:
⎧
⎨ N
min(ω ) = 12 ω 2 + c ∑ ξ i 2
i =1 (4)
⎩
s.t yi ω T xi + b ≥ 1 − ξ i , i = 1, 2, . . . , N
where ω is the inertia weight, b is a constant, ξ i is a slack variable, and c is a disciplinary
factor.
The initial low-dimensional sample set is mapped to a high-dimensional space H by
introducing a kernel function; then, the optimal classification surface is established using a
linear method. The conversion formula is shown below.
⎧ N N
⎪
⎪ Q(α) = 12 ∑ αi α j yi y j k xi , x j − ∑ αi
⎨
i =1 i =1 (5)
⎪
⎪
N
⎩ s.t ∑ ai yi = 0, 0 ≤ ai ≤ C, i = 1, 2, . . . , N
i =1
where αi is the Lagrange multiplier and k xi , x j is the kernel function, which can be
expressed in Equation (6).
k ( x, y) = e−γ xi − x j (6)
where γ is a kernel parameter, which represents the interaction width of the kernel function.
3. Suggested RCCBOA
3.1. Random Replacement Strategy
Most optimization algorithms will show global exploration behavior in the early
stage [83]. When the algorithm exploration is weak, the convergence speed will be slow
146
Electronics 2022, 11, 1080
and it will be easy to fall into the local optimum [84]. Thus, we introduce a random
replacement strategy to BOA, which effectively helps the individuals of the population
to move closer to the food source, thereby improving the algorithm’s convergence speed.
The individuals of the population are compatible with the optimal individual in some
dimensions, and it is possible that some of the dimensions of the individual will deviate
from those of the optimal individual. In this case, the current position is replaced with the
position of the optimal solution with some probability. The probability value is mainly
determined by comparing the ratio of the remaining time of the algorithm to the total
running time and the Cauchy random number. The random replacement strategy can
easily be replaced in the early stage of the algorithm, and it is less likely to be replaced
in the later stage. In short, the random replacement strategy can effectively improve the
convergence speed of the algorithm and prevent the algorithm from falling into the local
optimum prematurely.
3.2. Crisscross Search
The crisscross search strategy is derived from the crisscross optimization algorithm
(CSO) proposed by Meng et al. in 2014 [85], which includes vertical crossover and horizontal
crossover. Its effectiveness has been demonstrated in many optimization algorithms [86];
for example, Zhao et al. [87] used it in ant colony optimization to solve the problem of multi-
threshold image segmentation. Liu et al. [88] designed an improved Harris hawks optimizer
(HHO) with the crisscross search strategy to estimate the parameters of PV models.
3.2.1. Vertical Crossover Search
The function of vertical crossover is mainly to increase the diversity of the population
to avoid it falling into a stagnant state; it mainly uses two dimensions to achieve crossover.
Assuming that the j1th and j2th dimensions of the i-th individual are selected and that a
vertical crossover operation is then performed, the new offspring Mvci can be obtained by
Equations (7) and (8).
Mvci,j1 = r × Mi,j1 + (1 − r ) × Mi,j2 (7)
r = uni f rnd(0, 1) (8)
where i = 1, 2, . . . , N; j1, j2 = 1, 2, . . . , D; Mi,j1 represent the j1 and j2 dimensions of the
i agent Mi . Additionally, r is a random number uniformly distributed from 0 to 1. Spe-
cial attention must be paid to the normalization of the lower and upper bounds of each
dimension to ensure that the individual remains within the bounds after the operation
before implementing the vertical crossover operation. After performing vertical crossing, a
reverse normalization operation needs to be performed to ensure that the offspring is still
within the given boundary.
3.2.2. Horizontal Crossover Search
Horizontal crossover can further improve the search and development of algorithms.
It mainly involves crossover operations being performed on all dimensions of two different
agents. Assuming that the agents Mi1 and Mi2 are selected to perform level crossing, the
new agents Mhci1 and Mhci2 can be obtained using Equations (9) and (10).
Mhci1,j = r1 × Mi1,j + (1 − r1) × Mi2,j + c1 × Mi1,j − Mi2,j (9)
Mhci2,j = r2 × Mi2,j + (1 − r1) × Mi1,j + c2 × Mi2,j − Mi1,j (10)
where Mhci1,j and Mhci2,j are j-th dimension of Mhci1 and Mhci2 ; Mi1,j and Mi2,j is the j-th
dimension of Mi1 and Mi2 ; and r1 and r2 are uniformly distributed random numbers from
0 to 1. c1 and c2 are uniformly distributed random numbers in [−1, 1].
147
Electronics 2022, 11, 1080
3.3. Proposed RCCBOA
The idea of the RCCBOA is to introduce random replacement and crossover strategies
on the basis of the BOA. Regarding the early exploration and later development of the
algorithm, it can be determined by including the ratio of the current number of iterations
to the total number of iterations. In the exploration phase, the random replacement
strategy uses the location of the optimal solution to replace the current solution, which
can improve the convergence speed of the BOA. In the exploitation stage, a cross-search
strategy is introduced to improve the exploration and exploitation capabilities of the
original algorithm, which makes it possible get rid of the local optimal solution as much
as possible. The effective combination of the two greatly improves the performance of the
original BOA. The pseudo-code of the RCCBOA is shown in Algorithm 2. Based on the
BOA, random replacement and crisscross search mechanisms are mainly used in the second
stage of the BOA. At the beginning of each iteration, a random replacement mechanism is
used to replace the current position with the position of the optimal solution with a certain
probability and then evaluate it. At the end of each iteration, the population is updated and
evaluated again using the crisscross search mechanism. For a better view, the flowchart of
the RCCBOA is offered in Figure 1.
Algorithm 2: Pseudo-code of the RCCBOA.
Initialize population number n, dimensions d, max evaluations Max_FEs, objective function f ( x );
Initialize sensor modality c, power exponent a, switch probability p and evaluations t;
Initialize the population of butterflies xi (i = 1, 2, . . . , n);
Gain intensity Ii by f ( xi )
While (t ≤ Max_FEs)
Calculate the fragrance b f of each butterfly using Equation (2);
Gain the best b f ;
Gain butterfly individuals by the random replacement strategy;
Update the best solution and position;
For i = 1 to n
Update r in [0, 1];
If r < p
Move to the best solution using Equation (1);
Else
Move randomly using Equation (1);
End if
End for
Update the population of butterflies using Equations (9) and (10);
t = t + 1;
Update parameter a;
End while
Output best solution;
148
Electronics 2022, 11, 1080
Figure 1. The flowchart of the RCCBOA.
4. Proposed RCCBOA-SVM Method
Firstly, we subject the proposed RCCBOA to data-level feature selection, aiming to
obtain effective features in the dataset. Secondly, it is used to optimize the penalty factor C
and kernel parameter γ of the SVM. The framework of RCCBOA-SVM is shown in Figure 2.
Finally, the model mainly includes two important components in the left half for feature
selection and uses the RCCBOA to optimize the two parameters C and γ in the SVM model.
In the right half, the best model obtains the classification accuracy (ACC) through 10-fold
cross-validation.
Figure 2. Flowchart of the suggested RCCBOA-SVM model.
149
Electronics 2022, 11, 1080
For feature selection problems, the focus of the algorithm is to select or not to select
a certain feature in the dataset, thus maximizing the classification accuracy of the most
effective feature. RCCBOA is inconsistent with the two-dimensionality required by the
feature selection problem when solving the problem, and these algorithms cannot be used
to directly solve the feature selection problem. Therefore, it is necessary to convert each
solution vector in this algorithm to binary form through the sigmoid transfer function,
which consists of only ‘0’ and ‘1’. To achieve this transformation, an S-shaped transforma-
tion function is used, which gives the probability of selecting a particular feature in the
solution vector.
Through feature selection, the minimum number of key features can be successfully
obtained. However, the fitting accuracy of the SVM depends on the values of the parameters
(C, γ), and different parameters are suitable for different sample data sets. Therefore, it is
necessary to further optimize the SVM parameters using RCCBOA to achieve the optimal
effect.
5. Experiments
5.1. Collection of Data
The data involved in this paper were mainly obtained from overseas Chinese citizens;
1050 people were selected as the research objects. The 28 attributes of the test subjects
were gender; age range; location of hometown; current identity; place of birth; when they
went abroad; reason for going abroad; in which year they became permanent residents
in their country of residence; highest level of education (degree); major; type of work
currently engaged in; whether they had relatives living together in their native country;
their position held in their native country; whether they had joined an overseas Chinese
association; whether they were a founder of an overseas Chinese association; their reason
for founding an overseas Chinese association; their motivation for joining an overseas
Chinese association; their position held in the overseas Chinese association; whether
their overseas Chinese association had a clear division of duties; whether their overseas
Chinese association is harmonious; whether their overseas Chinese association is a non-
profit organization; whether the charter of the overseas Chinese association is reasonable;
whether the overseas Chinese association holds regular meetings; whether every member of
the association has the right to vote and be elected; whether every member of the association
has the right to criticize, make suggestions, and supervise the overseas Chinese association;
whether the membership fee of the association is paid according to the regulations; the
main source of funding for the overseas Chinese association; and, lastly, their expectations
and suggestions for the overseas Chinese association. The importance of these 28 attributes
and their internal connections were explored, and based on this a model was built. Table 2
details the 28 attributes.
Table 2. Description of the 28 attributes.
Attributes Name Description
A1 Gender Male—1; Female—0
0–30 years old—1; 30–60 years old—2; 60–80 years
A2 Age range
old—3.
Wenzhou—1; Lishui—2;
A3 Location of hometown
other places—3.
Overseas Chinese with Chinese nationality or
international students—1; descendants of overseas
Chinese who were born in the country of residence and
A4 Current identity
obtained the nationality of the residence country—2;
returned overseas Chinese and family members of
returned overseas Chinese—3.
150
Electronics 2022, 11, 1080
Table 2. Cont.
Attributes Name Description
China (Hong Kong, China)—1; foreign countries—2;
A5 Place of birth
unable to confirm—0.
Before 1949—1; between 1950 and 1978—2; 1979 till
A6 When they went abroad
now—3.
Family visit—1; work, trade, or investment—2; studying
A7 Reasons for going abroad abroad or skilled immigrants—3;
other reasons or no reasons—4.
Before 2000—1; 2000 till now—2; no permanent
A8 In which year they became permanent residents
residence—0
High school/technical secondary school/secondary
vocational school/technical school or below—1; junior
A9 Highest level of education (degree)
college/higher vocational college—2; Bachelor degree
or above—3.
Liberal arts—1; science—2; others (catering, party school
A10 Major cadre training, entertainment, tourism, army
academy)—3; none or unknown—0
worker, trade, business and investment—1; research and
A11 Type of work currently engaged in development, knowledge or education—2; catering—3;
other or none—4.
Immediate family member—1; non-immediate
A12 Relatives living together in China relatives—2; both 1 and
2–3; none—0.
National level—1; provincial level—2; city/county
A13 Their position held in China
level—3; other or none—0.
Whether they had joined an overseas Chinese
A14 Yes—1; no—0.
association
Whether they had acted as the founder of an overseas
A15 Yes—1; no—0.
Chinese association
Business relations—1; geographical relations—2;
A16 Reason for founding the overseas Chinese association
learning relations—3; other reasons or none—4.
Motivation for joining the overseas Chinese Active—1; passive (invited by friends)—2; other or
A17
association skip—3.
A18 Position held in the overseas Chinese association Positive—1; deputy—2; others—3; none—0.
Whether the overseas Chinese association has a clear
A19 Yes—1; none or other—0.
division of duties
Whether the overseas Chinese association is
A20 Harmony—1; so-so or unknown—2; skip—0.
harmonious
Whether the overseas Chinese association is a
A21 Yes—1; no—2; unknown or skip—0.
non-profit organization
Whether the charter of the overseas Chinese
A22 Yes—1; none—0.
association is reasonable
Whether the overseas Chinese association holds
A23 Yes—1; no—0.
regular meetings
Whether every member of the association has the right
A24 Yes—1; no—0.
to vote and be elected
Whether every member of the association has the right
A25 to criticize, make suggestions, and supervise the Yes—1; no—0.
overseas Chinese association
Whether the membership fee of the association is paid
A26 Yes—1; no—0.
according to the regulations
Other fixed income—1; membership fees (including
Main source of funding for the overseas Chinese
A27 membership fees and donation)—2; no dues, only
association
donations—3; unknown or other—0.
Expectations and suggestions for the overseas Chinese
A28 Positive—1; so-so or no (skip)—2; negative—3.
association
151
Electronics 2022, 11, 1080
Among these, whether the overseas Chinese group/association is standardized is
considered among the 28 attributes (attribute A17 (motivation of joining the overseas
Chinese association), A19 (whether the overseas Chinese association has a clear division of
duties), A21 (whether the overseas Chinese association is a non-profit organization), A22
(whether the charter of the overseas Chinese association is reasonable), A23 (whether the
overseas Chinese association holds regular meetings), A24 (whether every member of the
association has the right to vote and be elected)) are the basis of determining whether the
overseas Chinese association is standard.
5.2. Experimental Setup
Ensuring the independence of experimental procedures is extremely important, as in
computational science and molecular characterization [89,90], location-based services [91,92],
drug discovery [93,94], pharmacoinformatic data mining [95,96], and information retrieval
services [97–99]. The comparison test described in this section was carried out on a com-
puter with a main central processing unit (CPU) frequency of 3.4 GHz and the win10 oper-
ating system (Microsoft, Redmond, WA, USA). Simulation experiments were performed
in MATLAB R2016a (MathWorks, Natick, MA, USA). In benchmarking experiments, each
comparison algorithm ran 30 experiments simultaneously. When dealing with classification
problems, the data were scaled to [−1,1]. k-fold cross-validation (CV) was used to split the
data, where k was set to 10.
6. Experimental Results
6.1. Benchmark Function Validation
We mainly conducted test experiments using RCCBOA on the CEC2014 benchmark
function set, including mechanism combination experiments and comparative experiments
with existing advanced algorithms. Detailed information about the CEC2014 benchmark
set can be found in Appendix A (see Table A1), coming from congress on evolutionary
computation of the world’s highest conference. The experimental results obtained from
30 independent repeated experiments under the same conditions were analyzed, including
the average and standard results obtained by the algorithm on each benchmark function.
We used the Wilcoxon signed-rank test non-parametric statistical test and the Friedman
test, which have used in many other works, to estimate the performance [100–104].
6.1.1. The Component Foundation
To assess the contribution of random replacement and horizontal crossover search
mechanisms to the original BOA, a mechanism combination experiment was conducted. By
randomly combining the two mechanisms, three additional algorithms were developed—
namely, RCCBOA, RBOA, and CCBOA. As shown in Table 3, where “R” and “CC” represent
the random replacement strategy and the crossover strategy, respectively, “1” indicates that
the BOA incorporates the policy and “0” indicates that the BOA does not incorporate the
policy. For example, RCCBOA means that the BOA combines both the random replacement
strategy and the horizontal crossover search strategy. Each algorithm was tested on the
CEC 2014 benchmark function test set. The experimental results are shown in Table 4. For
fair comparison, the parameters commonly used in the experiment were not set to 30. In
addition, we utilized the Wilcoxon signed-rank test and average value (ARV) to examine
the average ranking values of the algorithms involved to further investigate the difference
between the two. It can be seen that the average performance of the RCCBOA combining
both strategies was the best.
To further visualize the performance of RCCBOA, Figure 3 shows the convergence
curves of RCCBOA, CCBOA, RBOA, and BOA on F3, F7, F11, F13, F16, F20, F23, F27,
and F29. Obviously, RCCBOA had a faster convergence speed and smaller convergence
value on these benchmark functions than on the other algorithms. In conclusion, the
BOA performance achieved by combining both the random replacement strategy and the
horizontal crossover search strategy was the best.
152
Electronics 2022, 11, 1080
Table 3. Four BOA variants with two strategies.
Algorithms R CC
RCCBOA 1 1
CCBOA 0 1
RBOA 1 0
BOA 0 0
Table 4. Average ranking of four BOA variants.
Algorithm Rank ARV
RCCBOA 1 1.426667
CCBOA 2 1.704444
RBOA 3 2.908889
BOA 4 3.96
Figure 3. Mechanism combination experiment.
153
Electronics 2022, 11, 1080
6.1.2. Comparison with Advanced Methods
To evaluate the superiority of the RCCBOA algorithm, this section compares the
RCCBOA algorithm with nine improved optimization algorithms, including CDLOBA [30],
CBA [31], RCBA J [32], MWOA [33], LWOA [34], IWOA [35], CEFOA [36], CIFOA [37], and
AMFOA [38]. These nine advanced algorithms are improved compared to classic algorithms
and have strong optimization abilities. We chose to use the CEC 2014 benchmark function
as the test set and set the search agent to 30, the dimension to 30, and the maximum number
of evaluations to 300,000. In addition, each algorithm was run separately for 30 experiments
to obtain the average value; the parameter settings are shown in Table 5.
Table 5. Parameters setting of the RCCBOA and other algorithms.
Method Parameter
RCCBOA p = 0.8
CDLOBA r = [1, 30]; Qmin = 0; Qmax = 2
CBA p = [0, 1]; Qmin = 0; Qmax = 2
RCBA A = [0, 1]; r = 0.5; Qmin = 0; Qmax = 2
MWOA a1 = [0, 2]; a2 = [−2, −1]
LWOA a1 = [0, 2]; a2 = [−2, −1]; b = 1
IWOA a1 = [0, 2]; a2 = [−2, −1]; b = 1; Cr = 0.1
CEFOA initiallocation [−10, 10]
CIFOA mr = 0.8
AMFOA σ1 = 0; σ2 = 0
Table 6 shows the average fitness value and standard deviation of each algorithm on
the 30 benchmark function test sets. It can be seen that the performance of RCCBOA on
some test functions is better than that of other algorithms. It is proven that the proposed
algorithm has significant advantages compared with other algorithms on the IEEE CEC2014
test set. First, the average result (Avg) and standard deviation (Std) of the optimization
values were used to evaluate the potential of the relevant optimizer. Furthermore, we
employed the Wilcoxon signed-rank test to evaluate whether the performance of RCCBOA
was significantly better than that of other state-of-the-art algorithms in this experiment.
It can be seen that the p-values calculated on most test functions were all lower than
0.05, indicating that the RCCBOA had a good performance on most benchmark functions.
Furthermore, we screened nine representative convergence plots on the IEEE CEC2014
test benchmark function, as shown in Figure 4. It can be seen that the RCCBOA had an
excellent convergence speed and convergence value on nine test functions.
154
Table 6. Comparison of the results of the RCCBOA and different advanced algorithms.
Fuctions Indicators RCCBOA CDLOBA CBA RCBA MWOA LWOA IWOA CEFOA CIFOA AMFOA
Avg 1.30 ×107 1.25 ×106 1.23 ×107 4.81 ×106 5.72 ×109 1.02 ×107 1.85 ×109 1.64 ×1010 1.21 ×1010 1.31 × 1010
Std 3.36 × 106 5.59 × 105 4.89 × 106 1.75 × 106 1.90 × 109 2.99 × 106 5.26 × 108 7.19 × 108 2.46 × 109 8.28 × 108
F1
Rank 5 1 4 2 7 3 6 10 8 9
p-value - 1.73 × 10−6 3.71 × 10−1 1.73 ×10−6 1.73 × 10−6 2.25 × 10−3 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Electronics 2022, 11, 1080
Avg 4.41 × 103 1.51 × 104 1.87 × 105 1.38 × 105 2.01× 11 3.52× 06 1.25 × 1011 1.99 × 1011 1.91 × 1011 1.89 × 1011
Std 3.71 × 103 1.12 × 104 9.54 × 105 3.89 × 104 2.85 × 1010 8.38 × 105 1.33 × 1010 5.37 × 108 5.11 × 108 6.09 × 109
F2
Rank 1 2 4 3 10 5 6 9 8 7
p-value - 1.74 ×10−4 4.71 × 10−2 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 3.69 × 104 1.12 × 10−5 8.37 × 103 3.89 × 102 5.33 × 105 3.35 × 103 1.73 × 105 6.81 × 108 1.31 × 107 5.27 × 107
Std 4.89 × 103 2.36 × 104 8.78 × 103 3.63 × 101 1.83 × 105 1.50 × 103 3.12 × 104 1.95 × 107 2.26 × 107 5.71 × 107
F3
Rank 4 5 3 1 7 2 6 10 8 9
p-value - 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 5.28 × 102 5.19 × 102 5.30 × 102 5.16 × 102 6.41 × 104 5.51 × 102 3.16 × 104 7.18 × 104 6.65 × 104 6.02 × 104
Std 2.91 × 101 3.84 × 101 4.41 × 101 4.58 × 101 1.58 × 104 4.31 × 101 7.29 × 103 7.73 × 102 3.85 × 102 1.95 × 103
F4
Rank 3 2 4 1 8 5 6 10 9 7
p-value - 3.18 × 10−1 8.77 × 10−1 1.30 × 10−1 1.73 × 10−6 2.18 × 10−2 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 5.21 × 102 5.21 × 102 5.20 × 102 5.20 × 102 5.21 × 102 5.21× 102 5.21 × 102 5.22 × 102 5.21 × 102 5.21 × 102
Std 4.65 × 10−2 2.38 × 10−1 2.30 × 10−1 9.69 × 10−2 4.02 × 10−2 9.07 × 10−2 4.58 × 10−2 4.33 × 10−2 2.94 × 10−2 6.99 × 10−2
F5
Rank 5 4 2 1 9 3 7 10 6 8
p-value - 2.25 × 10−3 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 2.35 × 10−6 1.73 × 10−6
Avg 6.35 × 102 6.65 × 102 6.73 × 102 6.70 × 102 6.80 × 102 6.55 × 102 6.71 × 102 6.90 × 102 6.85 × 102 6.85 × 102
Std 1.19 × 101 3.32 × 100 4.38 × 100 4.81 × 100 3.63 × 100 4.89 × 100 3.59 × 100 3.78 × 10−1 1.31 × 100 7.42 × 101
F6
Rank 1 3 6 4 7 2 5 10 8 9
155
p-value - 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 7.00 × 102 7.00 × 102 7.00 × 102 7.00 × 102 2.56 × 103 7.01 × 102 1.84 × 103 2.56 × 103 2.49 × 103 2.43 × 103
Std 3.53 × 10−3 1.09 × 10−2 1.57 × 10−1 5.11 × 10−2 3.60 × 102 1.58 × 10−2 1.35× 102 2.14 × 101 4.91 × 100 1.53 × 101
F7
Rank 1 2 3 4 9 5 6 10 8 7
p-value - 1.6 × 10−4 9.91 × 10−3 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 9.55 × 102 1.30 × 103 1.17 × 103 1.19 × 103 1.60 × 103 9.95 × 102 1.38 × 103 1.69 × 103 1.60 × 103 1.65 × 103
Std 1.26 × 101 5.35 × 101 6.30 × 101 5.38 × 101 6.30 × 101 3.24 × 101 4.30 × 101 1.59 × 101 6.13 × 100 2.20 × 101
F8
Rank 1 5 3 4 8 2 6 10 7 9
p-value - 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.02 × 10−5 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Table 6. Cont.
Fuctions Indicators RCCBOA CDLOBA CBA RCBA MWOA LWOA IWOA CEFOA CIFOA AMFOA
Avg 1.26 ×103 1.61 ×103 1.41 ×103 1.42 ×103 1.84 ×103 1.32 ×103 1.57 ×103 1.88 ×103 1.78 ×103 1.78 × 103
Std 2.84 × 101 9.97 × 101 8.96 × 101 9.41 × 101 1.02 × 102 7.42 × 101 5.94 × 101 2.15 × 101 7.13 × 100 3.09 × 101
F9
Rank 1 6 3 4 9 2 5 10 7 8
p-value - 1.73 × 10−6 2.35 × 10−6 1.92 × 10−6 1.73 × 10−6 1.18 × 10−3 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Electronics 2022, 11, 1080
Avg 3.62 × 103 8.95 × 103 8.81× 103 8.87 × 103 1.68 × 104 4.81 × 103 1.37 × 104 1.92 × 104 1.69 × 104 1.82 × 104
Std 2.63 × 102 9.69 × 102 9.68 × 102 1.08 × 103 6.87 × 102 7.58 × 102 7.53 × 102 1.70 × 102 3.12 × 102 4.85 × 102
F10
Rank 1 5 3 4 7 2 6 10 8 9
p-value - 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 3.88 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 1.14 × 104 8.54 × 103 8.80 × 103 8.92 × 103 1.70 × 104 8.57 × 103 1.52 × 104 1.91 × 104 1.67 × 104 1.77 × 104
Std 6.78 × 102 6.41 × 102 9.33 × 102 7.13 × 102 8.18 × 102 9.88 × 102 1.04 × 103 2.33 × 102 1.28 × 102 1.36 × 102
F11
Rank 5 1 3 4 8 2 6 10 7 9
p-value - 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 1.20 × 103 1.20 × 103 1.20 × 103 1.20 × 103 1.21 × 103 1.20 × 103 1.20 × 103 1.21 × 103 1.20 × 103 1.21 × 103
Std 4.15 × 10−1 4.24 × 10−1 6.59 × 10−1 6.04 × 10−1 9.86 × 10−1 4.91 × 10−1 8.92 × 10−1 9.80 × 10−1 2.76 × 10−1 9.65 × 10−1
F12
Rank 5 1 4 2 9 3 6 10 7 8
p-value - 1.73 × 10−6 4.90 × 10−4 2.35 × 10−6 1.73 × 10−6 2.13 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 1.30 × 103 1.30 × 103 1.30 × 103 1.30 × 103 1.31 × 103 1.30 × 103 1.31 × 103 1.31 × 103 1.31 × 103 1.31 × 103
Std 4.30 × 10−2 9.22 × 10−2 8.32 × 10−2 1.08 × 10−1 9.09 × 10−1 1.08 × 10−1 5.31 × 10−1 1.25 × 10−2 1.48 × 10−2 7.65 × 10−2
F13
Rank 3 1 2 4 9 5 6 10 8 7
p-value - 2.37 × 10−1 2.29 × 10−1 6.00 × 10−1 1.73 × 10−6 3.16 × 10−2 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 1.40 × 103 1.40 × 103 1.40 × 103 1.40 × 103 1.83 × 103 1.40 × 103 1.65 × 103 1.87 × 103 1.86 × 103 1.82 × 103
Std 3.13 × 10−2 6.86 × 10−2 1.13 × 10−1 1.13 × 10−1 5.66 × 101 1.93 × 10−1 2.58 × 101 5.45 × 100 1.46 × 100 1.38 × 101
F14
Rank 1 4 2 3 8 5 6 10 9 7
156
p-value - 3.38 × 10−3 1.78 × 10−1 3.68 × 10−2 1.73 × 10−6 8.94 × 10−4 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 1.53 × 103 2.04 × 103 1.63 × 103 1.58 × 103 4.03 × 107 1.55 × 103 3.66 × 106 2.54 × 107 1.59 × 107 7.64 × 106
Std 2.08 × 100 1.49 × 102 3.91× 101 2.18× 101 3.26 × 107 1.09 × 101 1.87 × 106 1.19 × 106 5.14 × 105 2.07 × 106
F15
Rank 1 5 4 3 10 2 6 9 8 7
p-value - 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 2.35 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 1.62 × 103 1.62 × 103 1.62 × 103 1.62 × 103 1.62 × 103 1.62 × 103 1.62 × 103 1.62 × 103 1.62 × 103 1.62 × 103
Std 3.17 × 10−1 4.08 × 10−1 4.78 × 10−1 4.66 × 10−1 2.09 × 10−1 6.33 × 10−1 3.88 × 10−1 1.80 × 10−1 6.98 × 10−2 1.80 × 10−1
F16
Rank 1 5 7 4 9 2 3 10 6 8
p-value - 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 2.30 × 10−2 2.35 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Table 6. Cont.
Fuctions Indicators RCCBOA CDLOBA CBA RCBA MWOA LWOA IWOA CEFOA CIFOA AMFOA
Avg 1.54 ×106 7.30 ×104 9.46 ×105 5.26 ×105 9.85 ×108 1.67 ×106 5.08 ×108 3.87 ×109 1.98 ×109 1.88 × 109
Std 8.74 × 105 3.66 × 104 4.18 × 105 2.53 × 105 4.56 × 108 7.03 × 105 2.87 × 108 1.97 × 107 7.28 × 108 4.50 × 108
F17
Rank 4 1 3 2 7 5 6 10 9 8
p-value - 1.73 × 10−6 1.04 × 10−3 2.35 × 10−6 1.73 × 10−6 3.82 × 10−1 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Electronics 2022, 11, 1080
Avg 3.54 × 103 5.03 × 103 4.57 × 103 5.52 × 103 2.09 × 1010 2.84 × 104 6.75 × 109 3.78 × 1010 3.45 × 1010 3.14 × 1010
Std 1.03 × 103 1.44 × 103 2.11 × 103 1.87 × 103 5.86 × 109 1.57 × 104 2.90 × 109 3.15 × 108 2.44 × 109 2.13 × 109
F18
Rank 1 3 2 4 7 5 6 10 9 8
p-value - 3.59 × 10−4 2.85 × 10−2 9.71 × 10−5 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 1.95 × 103 1.99 × 103 1.96 × 103 1.96 × 103 5.04 × 103 1.95 × 103 2.94 × 103 1.08 × 104 9.08 × 103 8.12 × 103
Std 3.14 × 101 2.77 × 101 2.58 × 101 2.85 × 101 1.53 × 103 2.84 × 101 2.73 × 102 1.23 × 102 7.93 × 102 6.17 × 102
F19
Rank 1 5 3 4 7 2 6 10 9 8
p-value - 2.84 × 10−5 7.03 × 10−1 2.71 × 10−1 1.73 × 10−6 7.81 × 10−1 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 1.13 × 104 4.43 × 104 4.24 × 103 2.82 × 103 9.50 × 106 8.83 × 103 6.70 × 105 3.22 × 109 7.50 × 107 2.69 × 109
Std 2.99 × 103 1.83 × 104 3.14 × 103 1.52 × 102 7.96 × 106 5.66 × 103 8.59 × 105 0.00 × 100 4.87 × 107 9.58 × 108
F20
Rank 4 5 2 1 7 3 6 10 8 9
p-value - 1.73 × 10−6 8.47 × 10−6 1.73 × 10−6 1.73 × 10−6 3.68 × 10−2 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 1.67 × 106 8.75 × 104 5.42 × 105 3.43 × 105 2.19 × 108 8.61 × 105 8.04 × 107 1.80 × 109 8.18 × 108 4.95 × 108
Std 4.61 × 105 3.81 × 104 2.70 × 105 1.79 × 105 1.04 × 108 4.24 × 105 4.69 × 107 3.19 × 107 3.40 × 108 1.83 × 108
F21
Rank 5 1 3 2 7 4 6 10 9 8
p-value - 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.36 × 10−5 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 3.13 × 103 4.09 × 103 4.26 × 103 4.19 × 103 3.27 × 105 3.93 × 103 1.91 × 104 6.11 × 106 1.89 × 106 4.64 × 106
Std 2.26 × 102 3.71 × 102 3.50 × 102 4.44 × 102 5.28 × 105 3.76 × 102 2.20 × 104 2.01 × 104 1.45 × 106 6.69 × 105
F22
Rank 1 3 5 4 7 2 6 10 8 9
157
p-value - 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 2.63 × 103 2.65 × 103 2.65 × 103 2.64 × 103 4.89 × 103 2.64 × 103 3.11 × 103 2.50 × 103 2.50 × 103 2.50 × 103
Std 4.39 × 101 3.11 × 100 2.16 × 100 2.12 × 10−1 6.99 × 102 2.96 × 10−1 5.70 × 102 0.00 × 100 4.05 × 10−1 5.09 × 10−4
F23
Rank 4 7 8 5 10 6 9 1 3 2
p-value - 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 3.61 × 10−3 1.73 × 10−6 1.73 × 10−6 3.18 × 10−6
Avg 2.60 × 103 2.79 × 103 2.77 × 103 2.76 × 103 3.07 × 103 2.62 × 103 2.60 × 103 2.60 × 103 2.60 × 103 2.60 × 103
Std 1.14 × 10−8 8.48 × 101 5.14 × 101 5.89 × 101 6.62 × 101 2.11 × 101 7.38 × 10−1 0.00 × 100 1.21 × 10−1 2.82 × 10−1
F24
Rank 2 9 8 7 10 6 5 1 3 4
p-value - 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 3.11 × 10−5 1.73 × 10−6
Table 6. Cont.
Fuctions Indicators RCCBOA CDLOBA CBA RCBA MWOA LWOA IWOA CEFOA CIFOA AMFOA
Avg 2.70 ×103 2.75 ×103 2.76 ×103 2.76 ×103 3.00 ×103 2.72 ×103 2.70 ×103 2.70 ×103 2.70 ×103 2.70 × 103
Std 0.00 × 100 1.84 × 101 2.67 × 101 2.14 × 101 8.62 × 101 2.48 × 101 0.00 × 100 0.00 × 100 0.00 × 100 1.41 × 10−5
F25
Rank 1 7 9 8 10 6 1 1 1 5
p-value - 1.73 × 10-6 1.73 × 10-6 1.73 × 10-6 1.73 × 10-6 1.73 × 10-6 1.00 × 100 1.00 × 100 1.00 × 100 1.73 × 10-6
Electronics 2022, 11, 1080
Avg 2.76 × 103 2.75 × 103 2.73× 03 2.80 × 103 2.91 × 103 2.70 × 103 2.77 × 103 2.80 × 103 2.80 × 103 2.80 × 103
Std 5.00 × 101 1.18 × 102 1.02 × 102 1.43 × 102 1.96 × 102 1.82 × 101 4.16 × 101 0.00 × 100 0.00 × 100 7.13 × 10-8
F26
Rank 4 3 2 9 10 1 5 6 6 8
p-value - 4.78 × 10−1 4.95 × 10−2 1.98 × 10−1 1.28 × 10−3 7.16 × 10−4 2.78 × 10−2 2.44 × 10−4 2.44 × 10−4 1.73 × 10−6
Avg 3.13 × 103 4.89 × 103 5.04 × 103 4.98 × 103 5.55 × 103 4.48 × 103 5.01 × 103 2.90 × 103 2.90 × 103 2.90 × 103
Std 5.64 × 101 1.26 × 102 3.82 × 102 3.88 × 102 2.81 × 102 2.98 × 102 1.34 × 102 1.39 × 10−12 1.39 × 10−12 7.74 × 10−5
F27
Rank 4 6 9 7 10 5 8 1 1 3
p-value - 1.73 × 10−6 1.92 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 3.99 × 103 8.63 × 103 8.77 × 103 9.10 × 103 1.56 × 104 7.03 × 103 8.46 × 103 3.00 × 103 3.00 × 103 3.00 × 103
Std 7.15 × 101 1.77 × 103 1.75 × 103 1.66 × 103 2.30 × 103 1.06 × 103 4.44 × 103 1.39 × 10−12 3.10 × 10−1 8.84 × 10−4
F28
Rank 4 7 8 9 10 5 6 1 3 2
p-value - 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 6.16 × 10−4 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6
Avg 5.34 × 103 1.49 × 108 4.27 × 108 1.73 × 108 8.94 × 108 2.16 × 107 2.25 × 108 3.10 × 103 1.68 × 105 7.96 × 103
Std 5.24 × 102 1.20 × 108 2.17 × 108 1.10 × 108 3.63 × 108 2.08 × 107 1.94 × 108 0.00 × 100 9.01 × 105 1.05 × 103
F29
Rank 2 6 9 7 10 5 8 1 4 3
p-value - 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 5.31 × 10−5 1.73 × 10−6 3.11 × 10−5 1.73 × 10−6
Avg 1.41 × 104 2.32 × 105 4.93 × 105 3.12 × 104 3.35 × 107 2.34 × 104 7.34 × 106 3.20 × 103 5.60 × 103 3.44 × 103
Std 1.71 × 103 5.90 × 105 1.55 × 106 7.14 × 103 1.68 × 107 4.07 × 103 3.89 × 106 0.00 × 100 1.32 × 104 6.38 × 101
F30
Rank 4 7 8 6 10 5 9 1 3 2
158
p-value - 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 1.73 × 10−6 3.11 × 10−5 1.73 × 10−6
Electronics 2022, 11, 1080
Figure 4. Convergence tendency of the RCCBOA and other advanced algorithms.
In order to further study the effect of random replacement and the crisscross search
mechanism on the computation time of BOA, computation time experiments were con-
ducted under the same environment. The experimental results are shown in Figure 5.
It can be seen that, compared with the original BOA, the calculation time of RCCBOA
was greatly improved in the IEEE CEC2014 benchmark test set. Overall, MWOA was the
most time-consuming to calculate, followed by RCCBOA. In addition, the times taken by
CDLOBA, CBA, RCBA, LWOA, IWOA, CEFOA, CIFOA, and AMFOA were very close. In
conclusion, the introduction of the two mechanisms effectively improved the performance
of the BOA as well as improving the execution time. Therefore, when solving practical
problems, there is a trade-off between performance and time consumption.
159
Electronics 2022, 11, 1080
Figure 5. The percentage of computational time taken by RCCBOA and other advanced algorithms.
6.2. Research of Overseas Chinese Associations
In this section, we describe ten independent experimental evaluations of the RCCBOA-
SVM (RCCBOA-SVM-FS) model with feature selection, the detailed results of which are
shown in Table 7. It can easily be seen that the average accuracy obtained using RCCBOA-
SVM-FS was 95%, the sensitivity was 99%, the specificity was 91%, and the MCC index
was 90%, with mean standard deviations of 0.02, 0.02, 0.04, and 0.03. Furthermore, the
optimal parameters and feature subsets in this experiment were obtained directly through
the RCCBOA method, indicating that the constructed model was helpful for guiding the
orderly and healthy development of overseas Chinese groups.
Table 7. Classification results obtained for RCCBOA-SVM-FS with four metrics.
Fold Accuracy Sensitivity Specificity MCC
Num.1 0.94 1.00 0.89 0.89
Num.2 0.91 1.00 0.82 0.84
Num.3 0.99 1.00 0.97 0.97
Num.4 0.96 0.96 0.93 0.91
Num.5 0.96 0.97 0.94 0.91
Num.6 0.94 0.97 0.90 0.88
Num.7 0.93 1.00 0.86 0.86
Num.8 0.96 1.00 0.92 0.91
Num.9 0.96 1.00 0.92 0.91
Num.10 0.94 1.00 0.97 0.88
Avg 0.95 0.99 0.91 0.90
Std 0.02 0.02 0.04 0.03
To further verify the performance of the algorithm, we conducted comparative ex-
periments with another five machine learning models, RCCBOA-SVM, BOA-SVM, ANN,
RF, and KELM; the detailed results are shown in Figure 6. The experimental results show
that RCCBOA-SVM-FS was better than RCCBOA-SVM, ANN, RF, and KELM in all four
evaluation metrics. For the accuracy rate, RCCBOA-SVM-FS had an accuracy rate of about
95%, while the accuracy rates of the other five comparison models were 93%, 91%, 87%,
93%, and 91%, respectively. Regarding the sensitivity index, both RCCBOA-SVM-FS and
KELM had values of 99%, 0.06% higher than the that of the lowest ANN. For the specificity
index, RCCBOA-SVM-FS, RCCBOA-SVM, and RF surpassed the proportion of 91%. The
160
Electronics 2022, 11, 1080
specificity values of RBOA-SVM, ANN, and KELM were 83%, 80%, and 83%, respectively.
In terms of the MCC indicator, RCCBOA-SVM-FS performed the best, with a value of up
to 90%. The worst performer was ANN, with a value of 73%. In short, from the above
four indicators, it can be seen that the performance of RCCBOA-SVM-FS was better than
that of the other five models, and the model accuracy rate was as high as 95%. Therefore,
RCCBOA-SVM-FS was effective and reliable for constructing a standardized construction
model of overseas Chinese communities.
Figure 6. Classification results obtained by the five models in terms of four metrics.
Moreover, the proposed RCCBOA obtained the optimal settings of the SVM hyperpa-
rameters as well as the optimal feature set. Here, we used the 10-fold cross-validation tech-
nique combined with the RCCBOA algorithm to identify features that have an important
impact on the normalization of overseas Chinese groups. Figure 7 illustrates the frequencies
of dominant features identified by RCCBOA-SVM-FS via 10-fold cross-validation.
Figure 7. Frequency of the feature selection from RCCBOA-SVM through the 10-fold CV procedure.
As shown in Figure 7, whether the charter of the overseas Chinese association is
reasonable (A22), whether the overseas Chinese association holds regular meetings (A23),
and whether every member of the association has the right to vote and be elected (A24)
were the top three features in terms of frequency, appearing 9, 8, and 9 times, respectively.
161
Electronics 2022, 11, 1080
Therefore, it can be concluded that these characteristics may play an important role in the
standardized construction of overseas Chinese groups.
7. Discussion
The normative nature of overseas Chinese associations is subject to various conditions.
Based on the data of overseas Chinese associations, this paper obtained the most important
features and models by combining the support vector machine model with RCCBOA. The
RCCBOA was introduced and compared with advanced algorithms. It can be seen that
when solving related benchmark problems, it had a strong performance. The performance
of SVM models can easily be affected by hyperparameters. Therefore, the RCCBOA was
combined with SVM and used to extract important features and obtain the best model.
From the experimental results found in the study, it can be seen that three attributes—
namely, attributes A22, A23, and A24—made up the most important characteristics of
overseas Chinese associations, having prominent impacts on the standardized construction
of overseas Chinese associations. Generally speaking, an overseas Chinese association
which formulates reasonable policies; holds regular meetings; and grants every member
of the association the right to vote, stand for election, and vote is standardized. Taking
these three features as the main reference attributes, combined with other attributes, a
fast judgement of the formality and regularity of an overseas Chinese association can be
made using computer algorithm calculation. The advantage of the proposed RCCBOA
method is that it can fully mine the key features of data. Based on this advantage, this
method also has potential applications in other problems, such as kayak cycle phase seg-
mentation [105], recommender systems [106–109], text clustering [110], human motion
capture [111], energy storage planning and scheduling [112], urban road planning [113], mi-
crogrid planning [114], active surveillance [115], image super resolution [116,117], anomaly
behavior detection [118], and multivariate time series analysis [119].
This study still has several limitations that need to be further discussed. First of
all, the samples used in this study were limited; in order to obtain more accurate results,
more continuous samples need to be collected to train a more unbiased learning model.
Secondly, this study mainly focused on overseas Chinese associations composed of Zhejiang
nationals, most of whom were Chinese citizens newly overseas and living mostly in Europe
and the United States; therefore, the research data obtained for global overseas Chinese
associations were not sufficient and had regional limitations. The determination of the
model used in multicenter research made the model more reliable for decision support. In
addition, the attributes involved in the study were limited, and future research should seek
to use more attributes that have an impact on the standardization construction of overseas
Chinese associations.
8. Conclusions and Future Work
In this paper, an improved BOA algorithm combining random replacement and criss-
cross search is proposed to study the normalized construction of overseas Chinese groups.
The main innovation of the proposed RCCBOA is the introduction of two mechanisms,
which effectively improves the convergence speed and convergence accuracy of the origi-
nal BOA. The comparison experiments performed with other nine advanced algorithms
on the CEC2014 benchmark function test set show that the RCCBOA can obtain better
solutions and a better stability. Further, the RCCBOA is combined with SVM for better
hyperparameter combinations and feature subsets. From the experimental results, it can
be seen that the features of A22, A23 and A24 are of great significance to its planning and
standardized construction. Compared with other machine learning methods, the proposed
method is 95% accurate when dealing with the normative prediction problem of overseas
Chinese citizens.
In follow-up studies, the RCCBOA-SVM-FS model will be applied to other problems,
such as disease diagnosis and bankruptcy prediction. Of course, it is expected that the
162
Electronics 2022, 11, 1080
proposed RCCBOA can be extended to solve optimization problems in other fields, such as
photovoltaic cell parameter identification and image segmentation.
Author Contributions: Funding acquisition, G.L. and H.C.; Writing—original draft, H.B.; Writing—
review & editing, Z.C. All authors have read and agreed to the published version of the manuscript.
Funding: This article contains the phased research results of “Research on the Formation and Cultivation
Mechanism of Overseas Chinese’s Home and Country Feelings from the Perspective of Embodiment
Theory (project code: 22JCXK02ZD)”, an emerging (intersecting) major project on philosophy and
social sciences in Zhejiang Province, and the phased research results of “Research on the Mechanism
of Contributions that Overseas Chinese Schools Make to Public Diplomacy”, a 2021 Overseas Chinese
Characteristic Research Project of Wenzhou University (project code: WDQT21-YB008)”.
Data Availability Statement: The data involved in this study are all public data, which can be
downloaded through public channels.
Conflicts of Interest: The authors declare no conflict of interest.
Appendix A
Table A1. Summary of the CEC2014 benchmark problem [120].
Type No. Function Optimum Value
1 Rotated High Conditioned Elliptic Function f 1 { Xmin } = 100
Unimodal Functions 2 Rotated Bent Cigar Function f 2 { Xmin } = 200
3 Rotated Discus Function f 3 { Xmin } = 300
4 Shifted and Rotated Rosenbrock’s Function f 4 { Xmin } = 400
5 Shifted and Rotated Ackley’s Function f 5 { Xmin } = 500
6 Shifted and Rotated Weierstrass Function Function f 6 { Xmin } = 600
Multimodal Functions 7 Shifted and Rotated Griewank’s Function f 7 { Xmin } = 700
8 Shifted Rastrigin’s Function f 8 { Xmin } = 800
9 Shifted and Rotated Rastrigin’s Function f 9 { Xmin } = 900
10 Shifted Schwefel’s Function f 10 { Xmin } = 1000
11 Shifted and Rotated Schwefel’s Function f 11 { Xmin } = 1100
12 Shifted and Rotated Katsuura Function f 12 { Xmin } = 1200
13 Shifted and Rotated Happycat Function f 13 { Xmin } = 1300
14 Shifted and Rotated Hgbat Function f 14 { Xmin } = 1400
Shifted and Rotated Expanded Griewank’s Plus
Hybrid Functions 15 f 15 { Xmin } = 1500
Rosenbrock’s Function
16 Shifted and Rotated Expanded Scaffer’s Function f 16 { Xmin } = 1600
17 Hybrid Function 1 (N = 3) f 17 { Xmin } = 1700
18 Hybrid Function 2 (N = 3) f 18 { Xmin } = 1800
19 Hybrid Function 3 (N = 4) f 19 { Xmin } = 1900
20 Hybrid Function 4 (N = 4) f 20 { Xmin } = 2000
21 Hybrid Function 5 (N = 5) f 21 { Xmin } = 2100
22 Hybrid Function 6 (N = 5) f 22 { Xmin } = 2200
23 Composition Function 1 (N = 5) f 23 { Xmin } = 2300
24 Composition Function 2 (N = 3) f 24 { Xmin } = 2400
25 Composition Function 3 (N = 3) f 25 { Xmin } = 2500
Composition Functions
26 Composition Function 4 (N = 5) f 26 { Xmin } = 2600
27 Composition Function 5 (N = 5) f 27 { Xmin } = 2700
28 Composition Function 6 (N = 5) f 28 { Xmin } = 2800
29 Composition Function 7 (N = 3) f 29 { Xmin } = 2900
30 Composition Function 8 (N = 3) f 30 { Xmin } = 3000
References
1. Li, M. Transnational Links among the Chinese in Europe: A Study on European-wide Chinese Voluntary Associations. In The
Chinese in Europe; Palgrave Macmillan: London, UK, 1998.
2. Sheng, F.; Smith, G. The Shifting Fate of China’s Pacific Diaspora. 2021: The China Alternative: Changing Regional Order in the
Pacific Islands. China Altern. 2021, 1, 142.
163
Electronics 2022, 11, 1080
3. Freedman, M. Immigrants and Associations: Chinese in nineteenth-century Singapore. Comp. Stud. Soc. Hist. 1960, 3, 25–48.
[CrossRef]
4. Ma, L.E.A. Revolutionaries, Monarchists, and Chinatowns Chinese Politics in the Americas and the 1911 Revolution; University Hawai’i
Press: Honolulu, HI, USA, 1990.
5. Litofcenko, J.; Karner, D.; Maier, F. Methods for Classifying Nonprofit Organizations According to their Field of Activity: A
Report on Semi-automated Methods Based on Text. Volunt. Int. J. Volunt. Nonprofit Organ. 2020, 31, 227–237. [CrossRef]
6. Arora, S.; Singh, S. Butterfly optimization algorithm: A novel approach for global optimization. Soft Comput. 2019, 23, 715–734.
[CrossRef]
7. Wolpert, D.H.; Macready, W.G. No free lunch theorems for optimization. IEEE Trans. Evol. Comput. 1997, 1, 67–82. [CrossRef]
8. Long, W.; Wu, T.; Xu, M.; Tang, M.; Cai, S. Parameters identification of photovoltaic models by using an enhanced adaptive
butterfly optimization algorithm. Energy 2021, 229, 120750. [CrossRef]
9. Sharma, T.K.; Sahoo, A.K.; Goyal, P. Bidirectional butterfly optimization algorithm and engineering applications. Mater. Today
Proc. 2021, 34, 736–741. [CrossRef]
10. Mortazavi, A.; Moloodpoor, M. Enhanced Butterfly Optimization Algorithm with a New fuzzy Regulator Strategy and Virtual
Butterfly Concept. Knowl. Based Syst. 2021, 228, 107291. [CrossRef]
11. Sundaravadivel, T.; Mahalakshmi, V. Weighted butterfly optimization algorithm with intuitionistic fuzzy Gaussian function
based adaptive-neuro fuzzy inference system for COVID-19 prediction. Mater. Today Proc. 2021, 42, 1498–1501. [CrossRef]
12. Zhou, H.; Zhang, G.; Wang, X.; Ni, P.; Zhang, J. Structural identification using improved butterfly optimization algorithm with
adaptive sampling test and search space reduction method. Structures 2021, 33, 2121–2139. [CrossRef]
13. Thawkar, S.; Sharma, S.; Khanna, M.; Singh, L.K. Breast cancer prediction using a hybrid method based on Butterfly Optimization
Algorithm and Ant Lion Optimizer. Comput. Biol. Med. 2021, 139, 104968. [CrossRef]
14. Long, W.; Jiao, J.; Liang, X.; Wu, T.; Xu, M.; Cai, S. Pinhole-imaging-based learning butterfly optimization algorithm for global
optimization and feature selection. Appl. Soft Comput. 2021, 103, 107146. [CrossRef]
15. Sowjanya, K.; Injeti, S.K. Investigation of butterfly optimization and gases Brownian motion optimization algorithms for optimal
multilevel image thresholding. Expert Syst. Appl. 2021, 182, 115286. [CrossRef]
16. Hu, J.; Han, Z.; Heidari, A.A.; Shou, Y.; Ye, H.; Wang, L.; Huang, X.; Chen, H.; Chen, Y.; Wu, P. Detection of COVID-19 severity
using blood gas analysis parameters and Harris hawks optimized extreme learning machine. Comput. Biol. Med. 2021, 142, 105166.
[CrossRef] [PubMed]
17. Fan, Y.; Wang, P.; Heidari, A.A.; Chen, H.; Turabieh, H.; Mafarja, M. Random reselection particle swarm optimization for optimal
design of solar photovoltaic modules. Energy 2022, 239, 121865. [CrossRef]
18. Shi, B.; Ye, H.; Zheng, L.; Lyu, J.; Chen, C.; Heidari, A.A.; Hu, Z.; Chen, H.; Wu, P. Evolutionary warning system for COVID-19
severity: Colony predation algorithm enhanced extreme learning machine. Comput. Biol. Med. 2021, 136, 104698. [CrossRef]
19. Zhou, W.; Wang, P.; Heidari, A.A.; Zhao, X.; Turabieh, H.; Mafarja, M.; Chen, H. Metaphor-free dynamic spherical evolution for
parameter estimation of photovoltaic modules. Energy Rep. 2021, 7, 5175–5202. [CrossRef]
20. Yu, C.; Heidari, A.A.; Xue, X.; Zhang, L.; Chen, H.; Chen, W. Boosting quantum rotation gate embedded slime mould algorithm.
Expert Syst. Appl. 2021, 181, 115082. [CrossRef]
21. Zhou, W.; Wang, P.; Heidari, A.A.; Zhao, X.; Turabieh, H.; Chen, H. Random learning gradient based optimization for efficient
design of photovoltaic models. Energy Convers. Manag. 2021, 230, 113751. [CrossRef]
22. Xu, Y.; Huang, H.; Heidari, A.A.; Gui, W.; Ye, X.; Chen, Y.; Chen, H.; Pan, Z. MFeature: Towards high performance evolutionary
tools for feature selection. Expert Syst. Appl. 2021, 186, 115655. [CrossRef]
23. Liu, L.; Zhao, D.; Yu, F.; Heidari, A.A.; Li, C.; Ouyang, J.; Chen, H.; Mafarja, M.; Turabieh, H.; Pan, J. Ant colony optimization with
Cauchy and greedy Levy mutations for multilevel COVID 19 X-ray image segmentation. Comput. Biol. Med. 2021, 136, 104609.
[CrossRef] [PubMed]
24. Zhao, S.; Wang, P.; Heidari, A.A.; Chen, H.; He, W.; Xu, S. Performance optimization of salp swarm algorithm for multi-threshold
image segmentation: Comprehensive study of breast cancer microscopy. Comput. Biol. Med. 2021, 139, 105015. [CrossRef]
25. Yu, H.; Li, W.; Chen, C.; Liang, J.; Gui, W.; Wang, M.; Chen, H. Dynamic Gaussian bare-bones fruit fly optimizers with
abandonment mechanism: Method and analysis. Eng. Comput. 2020, 1–29. [CrossRef]
26. Chen, H.; Heidari, A.A.; Chen, H.; Wang, M.; Pan, Z.; Gandomi, A.H. Multi-population differential evolution-assisted Harris
hawks optimization: Framework and case studies. Future Gener. Comput. Syst. 2020, 111, 175–198. [CrossRef]
27. Chen, H.; Heidari, A.A.; Zhao, X.; Zhang, L.; Chen, H. Advanced orthogonal learning-driven multi-swarm sine cosine optimiza-
tion: Framework and case studies. Expert Syst. Appl. 2020, 144, 113113. [CrossRef]
28. Tu, J.; Lin, A.; Chen, H.; Li, Y.; Li, C. Predict the Entrepreneurial Intention of Fresh Graduate Students Based on an Adaptive
Support Vector Machine Framework. Math. Probl. Eng. 2019, 2019, 2039872. [CrossRef]
29. Chen, H.; Xu, Y.; Wang, M.; Zhao, X. A balanced whale optimization algorithm for constrained engineering design problems.
Appl. Math. Model. 2019, 71, 45–59. [CrossRef]
30. Yong, J.; He, F.; Li, H.; Zhou, W. A Novel Bat Algorithm based on Collaborative and Dynamic Learning of Opposite Population.
In Proceedings of the 2018 IEEE 22nd International Conference on Computer Supported Cooperative Work in Design (CSCWD),
Nanjing, China, 9–11 May 2018.
31. Zhou, Y.; Xie, J.; Li, L.; Ma, M. Cloud Model Bat Algorithm. Sci. World J. 2014, 2014, 237102. [CrossRef]
164
Electronics 2022, 11, 1080
32. Liang, H.; Liu, Y.; Shen, Y.; Li, F.; Man, Y. A Hybrid Bat Algorithm for Economic Dispatch with Random Wind Power. IEEE Trans.
Power Syst. 2018, 33, 5052–5061. [CrossRef]
33. Sun, Y.; Wang, X.; Chen, Y.; Liu, Z. A modified whale optimization algorithm for large-scale global optimization problems. Expert
Syst. Appl. 2018, 114, 563–577. [CrossRef]
34. Ling, Y.; Zhou, Y.; Luo, Q. Lévy Flight Trajectory-Based Whale Optimization Algorithm for Global Optimization. IEEE Access
2017, 5, 6168–6186. [CrossRef]
35. Tubishat, M.; Abushariah, M.; Idris, N.; Aljarah, I. Improved whale optimization algorithm for feature selection in Arabic
sentiment analysis. Appl. Intell. 2019, 49, 1688–1707. [CrossRef]
36. Han, X.; Liu, Q.; Wang, H.; Wang, L. Novel fruit fly optimization algorithm with trend search and co-evolution. Knowl. Based Syst.
2018, 141, 1–17. [CrossRef]
37. Ye, F.; Lou, X.Y.; Sun, L.F. An improved chaotic fruit fly optimization based on a mutation strategy for simultaneous feature
selection and parameter optimization for SVM and its applications. PLoS ONE 2017, 12, e0173516. [CrossRef] [PubMed]
38. Wang, W.; Liu, X. Melt index prediction by least squares support vector machines with an adaptive mutation fruit fly optimization
algorithm. Chemom. Intell. Lab. Syst. 2015, 141, 79–87. [CrossRef]
39. Yang, Y.; Chen, H.; Heidari, A.A.; Gandomi, A.H. Hunger games search: Visions, conception, implementation, deep analysis,
perspectives, and towards performance shifts. Expert Syst. Appl. 2021, 177, 114864. [CrossRef]
40. Heidari, A.A.; Mirjalili, S.; Faris, H.; Aljarah, I.; Mafarja, M.; Chen, H. Harris hawks optimization: Algorithm and applications.
Future Gener. Comput. Syst. Int. J. Escience 2019, 97, 849–872. [CrossRef]
41. Li, S.; Chen, H.; Wang, M.; Heidari, A.A.; Mirjalili, S. Slime mould algorithm: A new method for stochastic optimization. Future
Gener. Comput. Syst. 2020, 111, 300–323. [CrossRef]
42. Ahmadianfar, I.; Heidari, A.A.; Gandomi, A.H.; Chu, X.; Chen, H. RUN beyond the metaphor: An efficient optimization algorithm
based on Runge Kutta method. Expert Syst. Appl. 2021, 181, 115079. [CrossRef]
43. Tu, J.; Chen, H.; Wang, M.; Gandomi, A.H. The Colony Predation Algorithm. J. Bionic Eng. 2021, 18, 674–710. [CrossRef]
44. Ahmadianfar, I.; Heidari, A.A.; Noshadian, S.; Chen, H.; Gandomi, A.H. INFO: An efficient optimization algorithm based on
weighted mean of vectors. Expert Syst. Appl. 2022, 195, 116516. [CrossRef]
45. Xia, J.; Wang, Z.; Yang, D.; Li, R.; Liang, G.; Chen, H.; Heidari, A.A.; Turabieh, H.; Mafarja, M.; Pan, Z. Performance optimization
of support vector machine with oppositional grasshopper optimization for acute appendicitis diagnosis. Comput. Biol. Med. 2022,
143, 105206. [CrossRef] [PubMed]
46. Xia, J.; Yang, D.; Zhou, H.; Chen, Y.; Zhang, H.; Liu, T.; Heidari, A.A.; Chen, H.; Pan, Z. Evolving kernel extreme learning machine
for medical diagnosis via a disperse foraging sine cosine algorithm. Comput. Biol. Med. 2021, 141, 105137. [CrossRef] [PubMed]
47. Dong, R.; Chen, H.; Heidari, A.A.; Turabieh, H.; Mafarja, M.; Wang, S. Boosted kernel search: Framework, analysis and case
studies on the economic emission dispatch problem. Knowl.-Based Syst. 2021, 233, 107529. [CrossRef]
48. Abbasi, A.; Firouzi, B.; Sendur, P.; Heidari, A.A.; Chen, H.; Tiwari, R. Multi-strategy Gaussian Harris hawks optimization for
fatigue life of tapered roller bearings. Eng. Comput. 2021, 1–27. [CrossRef] [PubMed]
49. Nautiyal, B.; Prakash, R.; Vimal, V.; Liang, G.; Chen, H. Improved Salp Swarm Algorithm with mutation schemes for solving
global optimization and engineering problems. Eng. Comput. 2021, 1–23. [CrossRef]
50. Zhang, H.; Liu, T.; Ye, X.; Heidari, A.A.; Liang, G.; Chen, H.; Pan, Z. Differential evolution-assisted salp swarm algorithm with
chaotic structure for real-world problems. Eng. Comput. 2022, 1–35. [CrossRef]
51. Zhang, Y.; Liu, R.; Heidari, A.A.; Wang, X.; Chen, Y.; Wang, M.; Chen, H. Towards augmented kernel extreme learning models for
bankruptcy prediction: Algorithmic behavior and comprehensive analysis. Neurocomputing 2021, 430, 185–212. [CrossRef]
52. Wu, S.; Mao, P.; Li, R.; Cai, Z.; Heidari, A.A.; Xia, J.; Chen, H.; Mafarja, M.; Turabieh, H.; Chen, X. Evolving fuzzy k-nearest
neighbors using an enhanced sine cosine algorithm: Case study of lupus nephritis. Comput. Biol. Med. 2021, 135, 104582.
[CrossRef]
53. Hussien, A.G.; Heidari, A.A.; Ye, X.; Liang, G.; Chen, H.; Pan, Z. Boosting whale optimization with evolution strategy and
Gaussian random walks: An image segmentation method. Eng. Comput. 2022, 1–45. [CrossRef]
54. Chen, X.; Huang, H.; Heidari, A.A.; Sun, C.; Lv, Y.; Gui, W.; Liang, G.; Gu, Z.; Chen, H.; Li, C.; et al. An efficient multilevel
thresholding image segmentation method based on the slime mould algorithm with bee foraging mechanism: A real case with
lupus nephritis images. Comput. Biol. Med. 2022, 142, 105179. [CrossRef] [PubMed]
55. Yu, H.; Song, J.; Chen, C.; Heidari, A.A.; Liu, J.; Chen, H.; Zaguia, A.; Mafarja, M. Image segmentation of Leaf Spot Diseases on
Maize using multi-stage Cauchy-enabled grey wolf algorithm. Eng. Appl. Artif. Intell. 2022, 109, 104653. [CrossRef]
56. Yu, H.; Cheng, X.; Chen, C.; Heidari, A.A.; Liu, J.; Cai, Z.; Chen, H. Apple leaf disease recognition method with improved residual
network. Multimed. Tools Appl. 2022, 81, 7759–7782. [CrossRef]
57. Hu, J.; Chen, H.; Heidari, A.A.; Wang, M.; Zhang, X.; Chen, Y.; Pan, Z. Orthogonal learning covariance matrix for defects of grey
wolf optimizer: Insights, balance, diversity, and feature selection. Knowl. Based Syst. 2021, 213, 106684. [CrossRef]
58. Hu, J.; Gui, W.; Heidari, A.A.; Cai, Z.; Liang, G.; Chen, H.; Pan, Z. Dispersed foraging slime mould algorithm: Continuous and
binary variants for global optimization and wrapper-based feature selection. Knowl. Based Syst. 2022, 237, 107761. [CrossRef]
59. Cai, Z.; Gu, J.; Luo, J.; Zhang, Q.; Chen, H.; Pan, Z.; Li, Y.; Li, C. Evolving an optimal kernel extreme learning machine by using an
enhanced grey wolf optimization strategy. Expert Syst. Appl. 2019, 138, 112814. [CrossRef]
165
Electronics 2022, 11, 1080
60. Xu, Y.; Chen, H.; Heidari, A.A.; Luo, J.; Zhang, Q.; Zhao, X.; Li, C. An efficient chaotic mutative moth-flame-inspired optimizer
for global optimization tasks. Expert Syst. Appl. 2019, 129, 135–155. [CrossRef]
61. Wei, Y.; Lv, H.; Chen, M.; Wang, M.; Heidari, A.A.; Chen, H.; Li, C. Predicting Entrepreneurial Intention of Students: An Extreme
Learning Machine with Gaussian Barebone Harris Hawks Optimizer. IEEE Access 2020, 8, 76841–76855. [CrossRef]
62. Wei, Y.; Ni, N.; Liu, D.; Chen, H.; Wang, M.; Li, Q.; Cui, X.; Ye, H. An Improved Grey Wolf Optimization Strategy Enhanced SVM
and Its Application in Predicting the Second Major. Math. Probl. Eng. 2017, 2017, 9316713. [CrossRef]
63. Zeng, G.-Q.; Lu, K.; Dai, Y.-X.; Zhang, Z.; Chen, M.-R.; Zheng, C.-W.; Wu, D.; Peng, W.-W. Binary-coded extremal optimization for
the design of PID controllers. Neurocomputing 2014, 138, 180–188. [CrossRef]
64. Zeng, G.-Q.; Chen, J.; Dai, Y.-X.; Li, L.-M.; Zheng, C.-W.; Chen, M.-R. Design of fractional order PID controller for automatic
regulator voltage system based on multi-objective extremal optimization. Neurocomputing 2015, 160, 173–184. [CrossRef]
65. Zhao, X.; Li, D.; Yang, B.; Ma, C.; Zhu, Y.; Chen, H. Feature selection based on improved ant colony optimization for online
detection of foreign fiber in cotton. Appl. Soft Comput. 2014, 24, 585–596. [CrossRef]
66. Zhao, X.; Li, D.; Yang, B.; Chen, H.; Yang, X.; Yu, C.; Liu, S. A two-stage feature selection method with its application. Comput.
Electr. Eng. 2015, 47, 114–125. [CrossRef]
67. Wu, S.-H.; Zhan, Z.-H.; Zhang, J. SAFE: Scale-Adaptive Fitness Evaluation Method for Expensive Optimization Problems. IEEE
Trans. Evol. Comput. 2021, 25, 478–491. [CrossRef]
68. Li, J.-Y.; Zhan, Z.-H.; Wang, C.; Jin, H.; Zhang, J. Boosting Data-Driven Evolutionary Algorithm with Localized Data Generation.
IEEE Trans. Evol. Comput. 2020, 24, 923–937. [CrossRef]
69. Hua, Y.; Liu, Q.; Hao, K.; Jin, Y. A Survey of Evolutionary Algorithms for Multi-Objective Optimization Problems with Irregular
Pareto Fronts. IEEE/CAA J. Autom. Sin. 2021, 8, 303–318. [CrossRef]
70. Liu, X.-F.; Zhan, Z.-H.; Gao, Y.; Zhang, J.; Kwong, S.; Zhang, J. Coevolutionary Particle Swarm Optimization with Bottleneck
Objective Learning Strategy for Many-Objective Optimization. IEEE Trans. Evol. Comput. 2018, 23, 587–602. [CrossRef]
71. Deng, W.; Zhang, X.; Zhou, Y.; Liu, Y.; Zhou, X.; Chen, H.; Zhao, H. An enhanced fast non-dominated solution sorting genetic
algorithm for multi-objective problems. Inf. Sci. 2021, 585, 441–453. [CrossRef]
72. Deng, W.; Liu, H.; Xu, J.; Zhao, H.; Song, Y. An Improved Quantum-Inspired Differential Evolution Algorithm for Deep Belief
Network. IEEE Trans. Instrum. Meas. 2020, 69, 7319–7327. [CrossRef]
73. Zhao, H.; Liu, H.; Xu, J.; Deng, W. Performance Prediction Using High-Order Differential Mathematical Morphology Gradient
Spectrum Entropy and Extreme Learning Machine. IEEE Trans. Instrum. Meas. 2019, 69, 4165–4172. [CrossRef]
74. Deng, W.; Xu, J.; Zhao, H.; Song, Y. A Novel Gate Resource Allocation Method Using Improved PSO-Based QEA. IEEE Trans.
Intell. Transp. Syst. 2020, 1–9. [CrossRef]
75. Deng, W.; Xu, J.; Song, Y.; Zhao, H. An Effective Improved Co-evolution Ant Colony Optimization Algorithm with Multi-Strategies
and Its Application. Int. J. Bio-Inspired Comput. 2020, 16, 158–170. [CrossRef]
76. Zhao, F.; Di, S.; Cao, J.; Tang, J. Jonrinaldi A Novel Cooperative Multi-Stage Hyper-Heuristic for Combination Optimization
Problems. Complex Syst. Model. Simul. 2021, 1, 91–108. [CrossRef]
77. Yi, J.-H.; Deb, S.; Dong, J.; Alavi, A.H.; Wang, G.-G. An improved NSGA-III algorithm with adaptive mutation operator for Big
Data optimization problems. Future Gener. Comput. Syst. 2018, 88, 571–585. [CrossRef]
78. Liu, P.; Gao, H. A Novel Green Supplier Selection Method Based on the Interval Type-2 Fuzzy Prioritized Choquet Bonferroni
Means. IEEE/CAA J. Autom. Sin. 2020, 8, 1549–1566. [CrossRef]
79. Han, X.; Han, Y.; Chen, Q.; Li, J.; Sang, H.; Liu, Y.; Pan, Q.; Nojima, Y. Distributed Flow Shop Scheduling with Sequence-Dependent
Setup Times Using an Improved Iterated Greedy Algorithm. Complex Syst. Model. Simul. 2021, 1, 198–217. [CrossRef]
80. Gao, D.; Wang, G.-G.; Pedrycz, W. Solving Fuzzy Job-Shop Scheduling Problem Using DE Algorithm Improved by a Selection
Mechanism. IEEE Trans. Fuzzy Syst. 2020, 28, 3265–3275. [CrossRef]
81. Yu, H.; Yuan, K.; Li, W.; Zhao, N.; Chen, W.; Huang, C.; Chen, H.; Wang, M. Improved Butterfly Optimizer-Configured Extreme
Learning Machine for Fault Diagnosis. Complexity 2021, 2021, 6315010. [CrossRef]
82. Liu, G.; Jia, W.; Luo, Y.; Wang, M.; Heidari, A.A.; Ouyang, J.; Chen, H.; Chen, M. Prediction Optimization of Cervical Hyperexten-
sion Injury: Kernel Extreme Learning Machines with Orthogonal Learning Butterfly Optimizer and Broyden-Fletcher-Goldfarb-
Shanno Algorithms. IEEE Access 2020, 8, 119911–119930. [CrossRef]
83. Ren, H.; Li, J.; Chen, H.; Li, C. Stability of salp swarm algorithm with random replacement and double adaptive weighting. Appl.
Math. Model. 2021, 95, 503–523. [CrossRef]
84. Chen, H.; Yang, C.; Heidari, A.A.; Zhao, X. An efficient double adaptive random spare reinforced whale optimization algorithm.
Expert Syst. Appl. 2019, 154, 113018. [CrossRef]
85. Meng, A.-B.; Chen, Y.-C.; Yin, H.; Chen, S.-Z. Crisscross optimization algorithm and its application. Knowl.-Based Syst. 2014, 67,
218–229. [CrossRef]
86. Su, H.; Zhao, D.; Yu, F.; Heidari, A.A.; Zhang, Y.; Chen, H.; Li, C.; Pan, J.; Quan, S. Horizontal and vertical search artificial bee
colony for image segmentation of COVID-19 X-ray images. Comput. Biol. Med. 2022, 142, 105181. [CrossRef] [PubMed]
87. Zhao, D.; Liu, L.; Yu, F.; Heidari, A.A.; Wang, M.; Oliva, D.; Muhammad, K.; Chen, H. Ant colony optimization with horizontal
and vertical crossover search: Fundamental visions for multi-threshold image segmentation. Expert Syst. Appl. 2021, 167, 114122.
[CrossRef]
166
Electronics 2022, 11, 1080
88. Liu, Y.; Chong, G.; Heidari, A.A.; Chen, H.; Liang, G.; Ye, X.; Cai, Z.; Wang, M. Horizontal and vertical crossover of Harris hawk
optimizer with Nelder-Mead simplex for parameter estimation of photovoltaic models. Energy Convers. Manag. 2020, 223, 113211.
[CrossRef]
89. Fu, J.; Zhang, Y.; Wang, Y.; Zhang, H.; Liu, J.; Tang, J.; Yang, Q.; Sun, H.; Qiu, W.; Ma, Y.; et al. Optimization of metabolomic data
processing using NOREVA. Nat. Protoc. 2022, 17, 129–151. [CrossRef]
90. Li, B.; Tang, J.; Yang, Q.; Li, S.; Cui, X.; Li, Y.H.; Chen, Y.Z.; Xue, W.; Li, X.; Zhu, F. NOREVA: Normalization and evaluation of
MS-based metabolomics data. Nucleic Acids Res. 2017, 45, W162–W170. [CrossRef]
91. Wu, Z.; Li, G.; Shen, S.; Lian, X.; Chen, E.; Xu, G. Constructing dummy query sequences to protect location privacy and query
privacy in location-based services. World Wide Web 2021, 24, 25–49. [CrossRef]
92. Wu, Z.; Wang, R.; Li, Q.; Lian, X.; Xu, G.; Chen, E.; Liu, X. A Location Privacy-Preserving System Based on Query Range Cover-Up
or Location-Based Services. IEEE Trans. Veh. Technol. 2020, 69, 5244–5254. [CrossRef]
93. Li, Y.H.; Li, X.X.; Hong, J.J.; Wang, Y.X.; Fu, J.B.; Yang, H.; Yu, C.Y.; Li, F.C.; Hu, J.; Xue, W.; et al. Clinical trials, progression-speed
differentiating features and swiftness rule of the innovative targets of first-in-class drugs. Brief. Bioinform. 2020, 21, 649–662.
[CrossRef]
94. Zhu, F.; Li, X.X.; Yang, S.Y.; Chen, Y.Z. Clinical Success of Drug Targets Prospectively Predicted by In Silico Study. Trends Pharmacol.
Sci. 2018, 39, 229–231. [CrossRef] [PubMed]
95. Yin, J.; Sun, W.; Li, F.; Hong, J.; Li, X.; Zhou, Y.; Lu, Y.; Liu, M.; Zhang, X.; Chen, N.; et al. VARIDT 1.0: Variability of drug
transporter database. Nucleic Acids Res. 2020, 48, D1042–D1050. [CrossRef] [PubMed]
96. Zhu, F.; Shi, Z.; Qin, C.; Tao, L.; Liu, X.; Xu, F.; Zhang, L.; Song, Y.; Zhang, J.; Han, B.; et al. Therapeutic target database update
2012: A resource for facilitating target-oriented drug discovery. Nucleic Acids Res. 2012, 40, D1128–D1136. [CrossRef]
97. Wu, Z.; Li, R.; Zhou, Z.; Guo, J.; Jiang, J.; Su, X. A user sensitive subject protection approach for book search service. J. Assoc. Inf.
Sci. Technol. 2020, 71, 183–195. [CrossRef]
98. Wu, Z.; Shen, S.; Lian, X.; Su, X.; Chen, E. A dummy-based user privacy protection approach for text information retrieval. Knowl.
Based Syst. 2020, 195, 105679. [CrossRef]
99. Wu, Z.; Shen, S.; Zhou, H.; Li, H.; Lu, C.; Zou, D. An effective approach for the protection of user commodity viewing privacy in
e-commerce website. Knowl. Based Syst. 2021, 220, 106952. [CrossRef]
100. Yu, H.; Zhao, N.; Wang, P.; Chen, H.; Li, C. Chaos-enhanced synchronized bat optimizer. Appl. Math. Model. 2020, 77, 1201–1215.
[CrossRef]
101. Gupta, S.; Deep, K.; Heidari, A.A.; Moayedi, H.; Chen, H. Harmonized salp chain-built optimization. Eng. Comput. 2021, 37,
1049–1079. [CrossRef]
102. Zhang, H.; Cai, Z.; Ye, X.; Wang, M.; Kuang, F.; Chen, H.; Li, C.; Li, Y. A multi-strategy enhanced salp swarm algorithm for global
optimization. Eng. Comput. 2020, 1–27. [CrossRef]
103. Chen, H.; Li, S.; Heidari, A.A.; Wang, P.; Li, J.; Yang, Y.; Wang, M.; Huang, C. Efficient multi-population outpost fruit fly-driven
optimizers: Framework and advances in support vector machines. Expert Syst. Appl. 2020, 142, 112999. [CrossRef]
104. Zhang, Q.; Chen, H.; Heidari, A.A.; Zhao, X.; Xu, Y.; Wang, P.; Li, Y.; Li, C. Chaos-Induced and Mutation-Driven Schemes Boosting
Salp Chains-Inspired Optimizers. IEEE Access 2019, 7, 31243–31261. [CrossRef]
105. Qiu, S.; Hao, Z.; Wang, Z.; Liu, L.; Liu, J.; Zhao, H.; Fortino, G. Sensor Combination Selection Strategy for Kayak Cycle Phase
Segmentation Based on Body Sensor Networks. IEEE Internet Things J. 2021, 9, 4190–4201. [CrossRef]
106. Wang, D.; Liang, Y.; Xu, D.; Feng, X.; Guan, R. A content-based recommender system for computer science publications. Knowl.
Based Syst. 2018, 157, 1–9. [CrossRef]
107. Li, J.; Chen, C.; Chen, H.; Tong, C. Towards Context-aware Social Recommendation via Individual Trust. Knowl. Based Syst. 2017,
127, 58–66. [CrossRef]
108. Li, J.; Lin, J. A probability distribution detection based hybrid ensemble QoS prediction approach. Inf. Sci. 2020, 519, 289–305.
[CrossRef]
109. Li, J.; Zheng, X.-L.; Chen, S.-T.; Song, W.-W.; Chen, D.-R. An efficient and reliable approach for quality-of-service-aware service
composition. Inf. Sci. 2014, 269, 238–254. [CrossRef]
110. Guan, R.; Zhang, H.; Liang, Y.; Giunchiglia, F.; Huang, L.; Feng, X. Deep Feature-Based Text Clustering and Its Explanation. IEEE
Trans. Knowl. Data Eng. 2020, 99, 1. [CrossRef]
111. Qiu, S.; Zhao, H.; Jiang, N.; Wu, D.; Song, G.; Zhao, H.; Wang, Z. Sensor network oriented human motion capture via wearable
intelligent system. Int. J. Intell. Syst. 2021, 37, 1646–1673. [CrossRef]
112. Cao, X.; Cao, T.; Gao, F.; Guan, X. Risk-Averse Storage Planning for Improving RES Hosting Capacity Under Uncertain Siting
Choices. IEEE Trans. Sustain. Energy 2021, 12, 1984–1995. [CrossRef]
113. Ran, X.; Zhou, X.; Lei, M.; Tepsan, W.; Deng, W. A Novel K-Means Clustering Algorithm with a Noise Algorithm for Capturing
Urban Hotspots. Appl. Sci. 2021, 11, 11202. [CrossRef]
114. Cao, X.; Wang, J.; Wang, J.; Zeng, B. A Risk-Averse Conic Model for Networked Microgrids Planning With Reconfiguration and
Reorganizations. IEEE Trans. Smart Grid 2020, 11, 696–709. [CrossRef]
115. Pei, H.; Yang, B.; Liu, J.; Chang, K. Active Surveillance via Group Sparse Bayesian Learning. IEEE Trans. Pattern Anal. Mach. Intell.
2022, 44, 1133–1148. [CrossRef] [PubMed]
167
Electronics 2022, 11, 1080
116. Zhu, X.; Guo, K.; Fang, H.; Chen, L.; Ren, S.; Hu, B. Cross View Capture for Stereo Image Super-Resolution. IEEE Trans. Multimed.
2021, 99, 1. [CrossRef]
117. Zhu, X.; Guo, K.; Ren, S.; Hu, B.; Hu, M.; Fang, H. Lightweight Image Super-Resolution with Expectation-Maximization Attention
Mechanism. IEEE Trans. Circuits Syst. Video Technol. 2021, 32, 1273–1284. [CrossRef]
118. Guo, K.; Hu, B.; Ma, J.; Ren, S.; Tao, Z.; Zhang, J. Toward Anomaly Behavior Detection as an Edge Network Service Using a
Dual-Task Interactive Guided Neural Network. IEEE Internet Things J. 2020, 8, 12623–12637. [CrossRef]
119. Zhang, Z.-H.; Min, F.; Chen, G.-S.; Shen, S.-P.; Wen, Z.-C.; Zhou, X.-B. Tri-Partition State Alphabet-Based Sequential Pattern for
Multivariate Time Series. Cogn. Comput. 2021, 1–19. [CrossRef]
120. Liang, J.J.; Qu, B.Y.; Suganthan, P.N. Problem Definitions and Evaluation Criteria for the CEC 2014 Special Session and Competition on
Single Objective Real-Parameter Numerical Optimization; Technical Report for Computational Intelligence Laboratory, Zhengzhou
University: Zhengzhou, China; Nanyang Technological University: Singapore, 2013.
168
electronics
Article
Improved Multi-Strategy Matrix Particle Swarm Optimization
for DNA Sequence Design
Wenyu Zhang 1 , Donglin Zhu 2 , Zuwei Huang 3 and Changjun Zhou 2, *
1 Faculty of Information Science and Engineering, Ocean University of China, Qingdao 266100, China
2 College of Mathematics and Computer Science, Zhejiang Normal University, Jinhua 321004, China
3 School of Information Engineering, Jiangxi University of Science and Technology, Ganzhou 341000, China
* Correspondence: [email protected]
Abstract: The efficiency of DNA computation is closely related to the design of DNA coding se-
quences. For the purpose of obtaining superior DNA coding sequences, it is necessary to choose
suitable DNA constraints to prevent potential conflicting interactions in different DNA sequences
and to ensure the reliability of DNA sequences. An improved matrix particle swarm optimization
algorithm, referred to as IMPSO, is proposed in this paper to optimize DNA sequence design. In
addition, this paper incorporates centroid opposition-based learning to fully preserve population
diversity and develops and adapts a dynamic update on the basis of signal-to-noise ratio distance
to search for high-quality solutions in a sufficiently intelligent manner. The results show that the
proposal of this paper achieves satisfactory results and can obtain higher computational efficiency.
Keywords: DNA computing; DNA sequences design; improved matrix particle swarm optimization
algorithm (IMPSO); opposition-based learning; signal-to-noise ratio distance
1. Introduction
DNA is a macromolecular polymer composed of deoxyribonucleotides, which are com-
posed of deoxyribose, phosphate and bases including adenine (A), guanine (G), thymine
(T) and cytosine (C). In 1953, after experimentational analysis, Watson and Crick proposed
Citation: Zhang, W.; Zhu, D.; Huang, a molecular model of the double-helix structure of DNA [1] and first proposed the principle
Z.; Zhou, C. Improved Multi-Strategy of base complementary pairing, in which the bases of the nucleotide residues in a nucleic
Matrix Particle Swarm Optimization acid molecule are linked to each other by hydrogen bonds in the correspondence between
for DNA Sequence Design. Electronics A and T and G and C. That is to say four possible base pairs for the A = T, T = A, G ≡ C
2023, 12, 547. https://doi.org/ and C ≡ G. A and T form two hydrogen bonds between; G and C constitute the three
10.3390/electronics12030547 hydrogen bonds between. In 1994, Turing Award-winner Adleman [2] proposed a simple
Academic Editor: Janos Botzheim
problem computation using the principle of the base complementary pairing of DNA, thus
inaugurating DNA computing. DNA computing then continued to evolve toward general-
Received: 24 December 2022 ization. In 2006, Winfree [3] proposed the DNA strand replacement reaction, which was
Revised: 16 January 2023 a new way to construct logic circuits. In addition to circuit computing, DNA computing
Accepted: 18 January 2023 can be combined with a variety of intelligent computing methods, such as neural network
Published: 20 January 2023 chaotic systems, and used in different fields.
According to the biological composition of DNA, DNA can be considered a long string
of four symbols, they are A, G, C and T. Through the alphabet of ∑ = { A, G, C, T }, two
binary numbers or one quadratic number can be used to encode DNA to store information.
Copyright: © 2023 by the authors.
In 2012, Church [4] led the first team to store a book of 659 kb in DNA, demonstrating the
Licensee MDPI, Basel, Switzerland.
This article is an open access article
storage capacity of DNA. In 2016, Extance [5] showed that 1 g of DNA can hold the contents
distributed under the terms and
of 100 billion DVDs and that 1 kg of DNA can even hold all the information data in the
conditions of the Creative Commons world. In the same year, Zhirnov et al. [6] found that DNA information storage density
Attribution (CC BY) license (https:// is 10 million terabytes per cubic centimeter and that even simple E. coli have a storage
creativecommons.org/licenses/by/ density of about 1019 bits per cubic centimeter, further validating the powerful storage
4.0/). capacity of DNA. In addition, due to the inherent parallel mechanism of DNA, i.e., the
Electronics 2023, 12, 547. https://doi.org/10.3390/electronics12030547 https://www.mdpi.com/journal/electronics
169
Electronics 2023, 12, 547
phenomenon that the leading strand and the trailing strand are replicated simultaneously,
DNA computation can be performed simultaneously on many DNA strands, which greatly
enhances the speed of DNA computation.
DNA coding sequence design is a key step in DNA computation, which realizes the
computation and transformation of data stored in it through specific reactions between
DNA molecules. The rationality of DNA coding is directly related to whether the model
can be successfully validated by biochemical experimentations and the accuracy of DNA
computation. However, DNA encoding needs to satisfy molecular biology constraints, in-
cluding physical constraints such as GC content constraints and thermodynamic constraints
such as melting temperature (Tm).
Efficient DNA computation cannot be carried out without excellent DNA coding.
Optimal DNA coding can be obtained by optimal coding algorithms, but the cost required
for optimal coding may not be satisfied in a large problem space. Therefore, in order to
provide efficient and suitable DNA coding in acceptable computational time and space,
heuristic algorithms are widely applied to the design of DNA sequences in recent years as a
shortcut algorithm. Zhu et al. [7] proposed an IBPSO algorithm to solve the DNA sequence
design problem, as well as further improving the quality of DNA sequences. Chaves-
González et al. [8] fused artificial bee colony algorithms to propose a new evolutionary
approach to create a DNA sequence on the strength of multi-objective swarm intelligence to
automatically generate reliable DNA strands that can be applied to molecular computing.
Yang et al. [9] improved the spatial dispersion in the traditional IWO algorithm and used
the IWO algorithm and the niche crowding in the algorithm to solve the DNA sequence
design problem. Zhang et al. [10] used an improved taboo search algorithm for improving
the means for the systematic design of equal-length DNA strands, which conduces the
discovery of a range of good DNA sequences that satisfy the required certain combinatorial
and thermodynamic constraints. Cervantes-Salido et al. [11] proposed a multi-objective
evolutionary algorithm for designing a DNA sequence, taking advantage of a matrix-based
GA along with specific genetic operators to improve the performance for DNA sequence
optimization compared to previous methods. Chaves-González et al. [12] proposed an
adapted multi-objective version of the differential evolution (DE) metaheuristics approach
incorporating a multi-objective standard fast non-dominated sorting genetic algorithm to
produce high-quality DNA sequences. Vega-Rodríguez et al. [13] made several rectifications
in the noted fast non-dominated sorting genetic algorithm in conjunction with a novel
multi-objective algorithm in accordance with the behavior of fireflies and proposed a new
DNA sequence design method based on multi-objective firefly algorithm for generating
reliable DNA sequences for molecular computing. The metaheuristic algorithm as a general
heuristic algorithm can greatly reduce the number of attempts in a limited searching space,
can achieve the problem solution rapidly and is heavily applied to generate reliable DNA
coding sequences by virtue of its high efficiency. However, metaheuristic algorithms, as a
product of combining random algorithms with local search algorithms, are susceptible to
randomness or fall into a local optimum due to premature search and do not necessarily
guarantee the feasibility and reliability of the resulting DNA sequences. In recent years,
in order to improve the metaheuristic algorithm, which is prone to being caught in a
local optimality, many scholars have done a lot of corresponding research and proposed
various improved metaheuristic algorithms, among which the particle swarm algorithm
is a theoretically mature and widely used emerging metaheuristic algorithm to find the
optimal solution through collaboration and information-sharing among individuals in
the population.
Particle swarm optimization [14] (PSO) is a method to seek out the global optimum by
following the current searched optimum based on the observation of the regular behavior
of the flock activity. This algorithm has appealed to the academics with the strong points
of easy implementation, high-accuracy and fast convergence and has shown advantages
in solving practical problems. However, if the parameters are not chosen reasonably, the
particles may miss the optimal solution and subsequently appear to be non-converging.
170
Electronics 2023, 12, 547
Even if all particles move in the direction of convergence, homogenization can occur. Due
to the loss of the diversity of the population in the search space, premature convergence,
poor local search ability, etc., can occur, leading to a lack of further improvement in
accuracy as well as falling into a local optimum. In specific problems, the PSO needs
to be analyzed and improved in order to achieve better results. Houssein et al. [15]
experimentally demonstrated that the PSO algorithm suffers from premature convergence,
being trapped in a local optimum and poor performance in multi-objective optimization.
Ghatasheh et al. [16] used innovative optimization paradigms to improve the prediction
power of bankruptcy modeling to generate prediction models. Zhang et al. [17] proposed a
new vector co-evolutionary particle swarm optimization algorithm (VCPSO) to enhance
population diversity and avoid premature convergence, but it suffers from falling into local
optima or inefficient execution. The multi-objective particle swarm optimization algorithm
(MOPSO) proposed by Coello et al. [18] has good search performance but only focuses on
the generation of non-dominated vectors and maintaining population diversity, without
considering the constraint functions. The region-based selection algorithm (PESA-II) in
evolutionary multi-objective optimization proposed by Corne et al. [19] shows outstanding
performance in region-based selection multi-objective algorithms but does not deal with
runtime complexity. Eberhart et al. [20] used a dynamic neighborhood particle swarm
optimization approach to solve multi-objective optimization problems, which is easy to
implement and requires few parameters to be tuned but only deals with unconstrained
multi-objective optimization problems. Deb et al. [21] developed a fast and elitist multi-
objective genetic algorithm (NSGA-II) based on multi-objective evolutionary algorithm
(MOEA), which is able to find better solution diffusion and better convergence for most of
the problems but NSGA-II algorithm uses the no-penalty parameter constraint processing
method, which has some limitations.
In this study, an improved multi-strategy matrix particle swarm-based optimization
algorithm, referred to as IMPSO, is proposed. Compared with the previous matrix particle
swarm algorithm, the running time under the same conditions is significantly reduced
and the values of the constraints on the DNA sequences are well maintained. In addition,
centroid opposition-based learning strategy is incorporated to preserve population diver-
sity and to obtain global and sufficient results; at the same time, this strategy is used to
reinitialize the population when the iteration numbers is a multiple of 100 to prevent the
algorithm falling into the local optimal solution, while a dynamic update in accordance
with signal-to-noise ratio distance is developed and adapted to search for high-quality
solutions in a sufficiently intelligent manner and enable every individual to search for the
best position within its own near neighborhood. The application of these two strategies
puts the global optimal solution into effect. What is more, suitable DNA constraints are
chosen to avoid potential conflicting interactions between DNA molecules to prevent the
generation of secondary structures, to control non-specific hybridization and to ensure
the reliability of DNA sequences. To verify the feasibility of the IMPSO algorithm, the
DNA sequences, the values of each constraint and their running times obtained from the
optimization of IMPSO with MPSO [22], IWO [23], PSO [24] and HS [25] were compared.
MPSO continues the search processes by introducing the speed and position update mech-
anism of the global best particle, effectively ensuring the convergence. IWO is a simple
but effective algorithm employed for finding a solution for an engineering problem. PSO
is a typical SI that reproduces the new population by learning from personal and global
guidance information. HS is a optimization algorithm to solve TSP and a specific academic
optimization problem, etc., by mimicking the improvisation of music players. To show the
competitiveness of the IMPSO algorithm in solving the DNA sequence design problem, this
paper compares the experimentational DNA sequence design results of IMPSO with those
of NCIWO, HSWOA [26], MO-ABC, CPSO [27] and DMEA [28]. NCIWO and MO-ABC
are mentioned above when introducing particle swarm optimization. HSWOA [26] is
used to design DNA sequences that meet the new combination constraint. CPSO [27] is
used to solve precocious phenomena and the local optimum of PSO by chaotic mapping.
171
Electronics 2023, 12, 547
DMEA [28] is proposed to solve the DNA sequences design and to mitigate an NP-hard
problem. With the same number of iterations, the experimental results show that the
scheme is more competitive and has higher computational efficiency in solving the DNA
sequence design problem. The main contributions of this study are as follows:
(1) The matrix particle swarm optimization is introduced to improve the efficiency of the
traditional PSO.
(2) On the basis of the centroid opposition-based learning strategy, the influence of the
optimal and worst position is considered to make the position update more reasonable.
(3) The concept of signal-to-noise ratio distance is led into, and a formula conforming to
the internal state of the population is designed.
(4) During DNA sequence optimization design experimentation, the rationality and effec-
tiveness of IMPSO are verified by comparing with the variations of various algorithms.
The rest of the paper is arranged in the following way. Section 2 presents the constraints
associated with designing DNA coding sequences. Section 3 describes the strategy along
with the algorithm flow of the IMPSO. Section 4 introduces the comparison and analysis
of the IMPSO algorithm with other optimization algorithms for DNA sequence design.
Section 5 outlines the conclusions of this paper and indicates the next steps.
2. Constraints Formulation for DNA Sequence Design
Reliable DNA sequence design is a two-dimensional discrete optimization problem,
and the relevant constraints can be partitioned into two categories, one is the combination
of constraints including continuity, hairpin, H-measure and similarity, aiming to improve
the specificity of DNA molecule recognition, and the other is thermodynamic constraints,
mainly including melting temperature (Tm) and free energy, aiming to ensure the consis-
tency of the physicochemical properties of DNA molecules.
This section describes in detail the constraints associated with designing DNA se-
quences. In the following constraint equation, S stands for the DNA sequence set; u and v,
respectively, represent two certain DNA sequences selected from the DNA sequence set S;
α is the DNA sequences number contained in DNA sequence set S, and β is the number
of bases contained in a given DNA sequence in S. T ( a, Tvalue ) is a threshold function that
returns a when the value is a > Tvalue , and 0 otherwise. If u and v are complementary, the
function cd(u, v) returns 1; otherwise, the result of the equation is 0.
2.1. Continuity
Continuity is the amount of contiguous identical bases (A,C,G,T) in a given single
strand of DNA. Too large a continuity value in the DNA sequence makes the DNA sequence
easily twisted and folded in the hybridization process, thus creating a secondary structure
that is not conducive to DNA computation. Assuming the continuity threshold is 3, for the
DNA sequence CAATGCGTTAGCCCCGATCTTAC, it reaches the continuity threshold,
after which the sequence will use the continuity function to calculate its continuity value,
and other sequences that do not trigger the threshold will be considered discontinuous.
The formula to calculate the continuity of a certain DNA strand is as shown below [12].
α
f continuity (S) = ∑ Continuity Sρ (1)
ρ =1
β−CT
Continuity(u) = ∑ T (contσ (u, i ), CT ) (2)
i =1
θ, i f ∃θ s.t.ui = σ, ui+θ +1 = σ, ui+ j = σ f or 1 < j ≤ θ
contσ (u, i ) = (3)
0, otherwise
172
Electronics 2023, 12, 547
σ ∈ { A, G, C, T }; CT is the threshold value; T ( A, CY ) is a count of the number of contiguous
bases in DNA above a threshold; if A > CY, then return A; otherwise, return 0. contσ (u, i )
returns the number of consecutive bases of sequence u.
2.2. Hairpin
During the process of DNA sequence self-hybridization, the overlapping part of the
sequence will fold and the corresponding bases will complementarily pair, and the pairing
forms a secondary structure called a hairpin structure. The hairpin structure consists of a
hair stem and a hair loop. If the hairpin structure is present in the DNA sequence, it will
undergo self-folding in the biochemical reaction. For avoiding self-hybridization in DNA
sequences, making the hairpin structure in DNA sequences as small as possible is of great
importance. There are two types of hairpin structures, hair stem and hair loop. Lmin is the
minimum hair loop length required for the hairpin structure; Tmin is the minimum hairpin
stem length required; l is the length of the hair loop; t is the length of the hair stem, and the
formula to calculate a DNA hairpin is as shown below [12].
α
f hairpin (S) = ∑ Hairpin Sρ (4)
ρ =1
( β− Lmin ) β−2t β−2t−l PLtil
PLtil
Hairpin(u) = ∑ ∑ ∑ T ( ∑ cb ui+ j , u β− j ,
2
) (5)
t= Tmin l = Lmin i =1 j =1
where PLtil = min(t + i, β − l − i − t) represents the maximum number of base pairs
possible when t + i + 2l is the center of the hairpin structure. cb(u, v) determines whether
u and v are complementary; if u and v are complementary, the result is 1; otherwise, the
result is 0.
2.3. H-Measure
In DNA sequences, H-Measure is adapted to count the Hamming distance, which
indicates the number of different bases at the same position of two complementary DNA
sequences. The likelihood of hybridization between complementary strands of the same
DNA molecule is closely linked to the H-Measure, showing a positive correlation. With this
constraint, non-specific hybridization between a DNA sequence and its complementary
sequences can be controlled. H-Measure is calculated by the following formula [12].
α α
f H −measure (S) = ∑ ∑ H − measure Sρ , Sθ (6)
ρ=1 θ =1,ρ=θ
where Sρ , Sθ respectively represent two reverse parallel DNA sequences. H-Measure calcu-
lation consists of two parts: continuous and discontinuous calculations.
H − measure(u, v) = Max g,t (hdis (u, FShi f t(v(−) g v, t))
(7)
+hcont (u, FShi f t(v(−) g v, t))
β
hdis (u, v) = T ( ∑ cb(ui , vi ), DH × β) (8)
i =1
β
hcont (u, v) = ∑ T (subcb(u, v, i), CH ) (9)
i =1
hdis (u, v) calculates the number of complementary bases in the DNA sequence u, v. hcont (u, v)
figures the penalty value of the consecutive base pairing of DNA sequences u and v.
v(−) g v is a sequence formed by splicing two fragments of sequence v with a splice gap
of g. H-Measure is the maximum value after the summation of the above two functions.
subcb(u, v, i ) defines the number of consecutive complementary paired bases of the u, v
173
Electronics 2023, 12, 547
sequence to begin with position i. DH is a real number in [0, 1], and CH is a positive integer
in [1, N].
2.4. Similarity
In DNA calculations, similarity indicates how close two DNA sequences are to each
other in terms of bases at the same position. Similarity takes into account the complemen-
tary Hamming distance after shifting in addition to the Hamming distance. The similarity
value is the maximum value of the totality of the amount of bases with the same displace-
ment and the amount of consecutive identical bases between sequences u and splicing
sequence v(−)g v. The similarity is calculated as follows [12].
α α
f similarity (S) = ∑ ∑ Similarity(Sε , Sδ ) (10)
ε=1 δ=1,ε=δ
where Sε, Sδ denotes two sequences in the DNA sequence set S. The similarity is calculated
in two parts: the similarity of discontinuous sequences and the similarity of the largest
continuous common subset.
Similarity(u, v) = Max g,t (sdis (u, FShi f t(v(−) g v, t))
(11)
+scont (u, FShi f t(v(−) g v, t)))
β
sdis (u, v) = T ( ∑ eq(ui , vi ), DS × β) (12)
i =1
β
scont (u, v) = ∑ T (subeb(u, v, i), CS) (13)
i =1
FShi f t(v(−) g v, t) denotes the shift of v(−) g v by t positions, eq(u, v) is used to determine
whether u and v are equal; equal returns 1; otherwise, the result is 0; DS is a real number in
[0, 1], and CS is a positive integer in [1, N]. subeb(u, v, i ) shows the amount of consecutive
equal bases from DNA sequence u and v starting from position i. Sdis (u, v) calculates the
Hamming distance of two DNA strands; Scont (u, v) calculates the sum of the consecutive
equal numbers of bases starting from positions 1 to β.
2.5. GC Content [29]
GC content stands for the amount of guanines as well as cytosines in the DNA sequence
as a percentage of the overall number of bases. GC content is directly related to the
biochemical stability of DNA sequences because G ≡ C base pairs contain three hydrogen
bonds and release more heat energy when broken than A = T base pairs containing two
hydrogen bonds, so GC content also influences the melting temperature of DNA sequences.
For the DNA sequence ACGTCGTTCGTACGC, the GC content is 60% (9/15). The GC
content (in percentage form) is calculated by the following formula.
β
GC (ui )
GC (u) = 100 ∑ (14)
i =1
β
1, τ = G or τ = C
GC (τ ) = (15)
0, τ = A or τ = T
2.6. Melting Temperature (Tm)
Melting temperature is the temperature required for half of the base pairs of a DNA
double-stranded structure to be disrupted into a single-stranded structure. Melting tem-
perature is an important thermodynamic constraint of DNA molecules that influences
the reaction efficiency of DNA sequences, and a steady Tm allows for the better control
of hybridization reactions between DNA molecules. The G ≡ C base pair contains three
174
Electronics 2023, 12, 547
hydrogen bonds and releases more thermal energy upon breaking than the A = T base
pair containing two hydrogen bonds. Tm is usually calculated in accordance with the
nearest-neighbor thermodynamic model [30], with the following relevant equation.
◦
ΔH
f Tm (S) = ◦ [ CT ]
− 273.15 (16)
ΔS + R ln ( 4 )
◦
where ΔH represents the enthalpy change from reactants to products, which is the total
◦
enthalpy of adjacent bases; ΔS represents the entropy change from reactants to products,
which is the total entropy of adjacent bases. R represents the gas constant (1.987 cal/kmol),
and CT is the concentration of DNA molecules.
2.7. Fitness Function
The optimization problem of this paper belongs to the minimum optimization prob-
lem. The fitness function of the DNA sequence is determined by the constraint function
described above and is the minimum of the above constraint functions, expressed by the
following formula.
Minimize f i ( x ), i ∈ {Continuity, Hairpin, H − measure,
(17)
Similarity} subject to GC = 50%, Tm
3. Improved Multi-Strategy Matrix Particle Swarm Optimization
3.1. Basic Information of Matrix Particle Swarm
In order to describe the IMPSO algorithm more clearly, this section first introduces
information about matrix particle swarm, some important formulas used by the algorithm
and the operations between matrices.
3.1.1. Representation Information
Assume there exists a N individuals population to solve the D-dimensional problem.
This population is represented by a matrix X of size N × D, defined as follows.
⎛ ⎞
x11 ··· x1D
⎜ .. .. .. ⎟
X=⎝ . . . ⎠ (18)
x N1 ··· x ND
where xij represents the individual i and dimension j.
To accommodate the matrix-based representation, the upper bound of the variables is
represented by a matrix XB of size 1 × D, the lower bound of the variables is represented
by a matrix XM of size 1 × D, and the fitness values of every individual are represented by
a matrix Fit of size N × 1. The matrix Ones is an all-1 matrix, and the matrix R is a matrix
consisting of random numbers of [0, 1].
3.1.2. Common Matrix Operations
Table 1 lists the relevant matrix operations used in this paper and shows their corre-
sponding descriptions. For convenience of description, the size of matrices A and B defaults
to N × D if not specifically mentioned.
3.1.3. Initialization of Particle Swarm Related Variables
Matrix X, also called the population matrix, represents the position of individuals.
Matrix V represents the velocity, and pBest represents the personal best positions of all the
individuals in the population, respectively. Where X is initialized as follows.
X N × D = Ones N ×1 × ( XB − XM ) ◦ R N × D + Ones N ×1 × XM (19)
175
Electronics 2023, 12, 547
Table 1. Typical operations in matrix and their notations [22].
Name Description
⎛ ⎞
a11 + b11 ··· a1D + b1D
Addition operation (+) ⎜ .. .. .. ⎟
A+B = ⎝ . . . ⎠
a N1 + b N1 ··· a ND + b ND
⎛ ⎞
a11 − b11 ··· a1D − b1D
Subtraction operation (−) ⎜ .. .. .. ⎟
A−B = ⎝ . . . ⎠
a N1 − b N1 ··· a ND − b ND
⎛ ⎞
D D
⎜ ∑ a1i × bi1 ··· ∑ a1i × biN ⎟
⎜ i =1 i =1 ⎟
⎜ .. .. ⎟
Multiplication operation (×) A N × D × BD × N =⎜
⎜ .
..
. .
⎟
⎟
⎜D ⎟
⎝ D ⎠
∑ Ni × bi1
a ··· ∑ Ni a × b iN
i =1 i =1
⎛ ⎞
c × a11 ··· c × a1D
Scalar multiplication (·) ⎜ .. .. .. ⎟
c· A = ⎝ . . . ⎠
c × a N1 ··· c × a ND
⎛ ⎞
a11 × b11 ··· a1D × b1D
Hadamard product (◦) ⎜ .. .. .. ⎟
A◦B = ⎝ . . . ⎠
a N1 × b N1 ··· a ND × b ND
⎛ ⎞
a11 ··· a D1
⎜ .. ⎟
Transposition operation X T A T = ⎝ ... ..
. . ⎠
a1N · · · a DN
1, i f ai,j ≤ bi,j
Logical operation (≤) A ≤ B = C, ci,j =
0, otherwise
Maximum operation (max ) a = max ( A), where a is the maximum element in A
Minimum operation (min) a = min( A), where a is the minimum element in A
k = maxind( A N ×1 ), where k is the row index of the
Maximum indexing (maxind)
maximum element in A N ×1
k = minind( A N ×1 ), where k is the row index of the
Minimum indexing (minind)
minimum element in A N ×1
⎛ ⎞
X I1 J1 · · · X I1 Jj
⎜ . ⎟
Index operation ( X [ I | J ]) X[ I | J] = ⎜⎝ ..
..
. ... ⎟ ⎠
X Ii J1 · · · X Ii Jj
The initialization process of V is as follows.
VN × D = Ones N ×1 × (VB − V M ) ◦ R N × D + Ones N ×1 × V M (20)
After the initialization of matrices X and V is completed, IMPSO obtains the fitness
values of all individuals, represented by a matrix Fit of size N × 1, according to the
following equation.
Fit N ×1 = f ( X ) (21)
The initialization process of pBest is as follows.
pBest N × D = Ones N ×1 × ( XB − XM) ◦ R N × D + Ones N ×1 × XM (22)
176
Electronics 2023, 12, 547
The initialization process of pBest_Fit is as follows.
pBest_Fit N × D = Ones N ×1 × (VB − V M ) ◦ R N × D + Ones N ×1 × V M (23)
After completing the above variable initialization process, the globally best fitness
value can be obtained by the following formula, represented by gBest_Fit.
min( Fit), i f it is a minimum problem
gBest_Fit = (24)
max( Fit), i f it is a maximum problem
Furthermore, the optimization problem considered in this experimentation is the mini-
mum value problem; IMPSO can use minind() formula in Table 1 to obtain the corresponding
number of rows for individuals with the best pBest fitness value, as follows.
Index = minind ( pBest_Fit) (25)
3.1.4. Velocity and Position Update
In the process of IMPSO iterations, the population continuously performs velocity
update as well as position updates from generation to generation in order to get as close as
possible to the global optimum, and the equations for velocity and position updates are
shown below.
V = ω × V + c1 × R1 ◦ ( pBest − X ) + c2 × R2 ◦ (Ones × gBest − X ) (26)
X = X+V (27)
It is worth noting that the matrix gBest of size 1 × D is actually the individual with the
best fitness value in the matrix pBest of N × D, which is the index row corresponding to
pBest. The N × D matrix X extended from the 1 × D matrix gBest can be obtained by the
following matrix multiplication formula, which shows that the value of each row of the
matrix X is equal to the value of gBest.
X N × D = Ones N ×1 × gBest1× D (28)
In order to avoid the elements of matrices V and X to exceed the space boundary, the
boundary should be detected and processed once the matrix V or X is updated. The specific
method can be implemented by logical operations and Hadamard products. For a more
visual description, IMPSO is illustrated with the matrix X as an example, where XB is the
upper boundary, and the detection and processing of the upper boundary can be based on
the following equation.
LOGICN × D = X > (Ones × XB) (29)
where the 1 × D matrix XB is first expanded into an N × D matrix with each row equal to
XB. Further, it is then compared with the N × D matrix X. If the elements of the matrix
X at the corresponding position are greater than the value of the upper boundary, the
corresponding element position of the N × D matrix LOGIC is set to 1, and otherwise 0.
With reference to this approach, the processing of the upper boundary can be implemented
with the following equation.
X = LOGIC ◦ XB + (1 − LOGIC ) ◦ X (30)
The result of the operation is the element of matrix X that is greater than the upper
bound is set to the value of the upper bound. More specifically, the element of the matrix X
that is greater than the upper bound is set to 1 at the corresponding position in the matrix
LOGIC, and thus the element of the matrix X needs to be set to the value of the upper
bound. Conversely, if an element of the matrix LOGIC is 0, it means that the element in the
corresponding position of the matrix X does not exceed the upper bound, then the element
177
Electronics 2023, 12, 547
of the matrix X in the corresponding position of that element does not need to be changed
either. The elements of the matrix X that are smaller than the lower bound also need to be
set to the value of the lower bound by a similar operation, which is not repeated here.
The next subsection describes in detail the two strategies used by the IMPSO algorithm
to improve the population best fitness value, wherein the signal-to-noise distance is used to
further update population best position on top of the basic update population position, and
improved centroid opposition-based learning strategy is used to reinitialize population-
related variables when the number of iterations is a multiple of 100 to exclude the influence
of extreme values on the best fitness value, making the center of gravity of the population
more representative.
3.2. Improved Opposition-Based Learning to Reinitialize the Population-Related Parameters
Opposition-based learning is a computational intelligence scheme proposed by
Tizhoosh [31] in 2005, which has been successfully applied to a variety of population-
based evolutionary algorithms. Traditional learning strategies are essentially based on
randomness, and once the worst-case scenario occurs, the search or optimization becomes
unmanageable and the results take a lot of time to converge. The main idea of OBL is
to consider both the points in the current space and their opposites and to select them
meritedly with a view to obtaining results closer to the global optimum. In order to fully
explore the current space and to make full use of the favorable information carried by
the population as a merit-seeking whole, the COBL centroid opposition-based learning
proposed by Rahnamayan et al. [32] was introduced on the basis of OBL.
Theorem 1. The opposite point.
Suppose there exists a number x in [l, u], then the opposite point of x is defined as
x = l + u − x (31)
Extending the definition of the opposite point to the D-dimension space, let p = ( x1 , x2 , . . . , x D )
be a point in the D-dimension space, where xi ∈ [li , ui ], i = 1, 2, . . . , D, then its opposite point is
defined as
p = x1 , x2 , . . . , x D (32)
where xi = li + ui − xi .
Theorem 2. Center of gravity.
( X1, . . . , Xn) is a group of n points with unit mass distributed in D-dimension space, and the
center of gravity of the group is defined as
( X1 + X2 + . . . + Xn)
M= (33)
n
It can also be expressed as.
1 n
n ∑i=1 Xi,j , j = 1, 2, . . . , D (34)
Theorem 3. Center of gravity of the opposite point.
If the location of the center of gravity of a discrete uniform whole is M, then the opposite point
of a point Xi in the group is defined as
Xi = 2M − Xi , i = 1, 2, . . . , n (35)
178
Electronics 2023, 12, 547
# $
The opposite point is located in a search space with dynamic boundary, denoted Xi,j ∈ a j , b j .
The dynamic boundary allows the search space to shrink continuously, which is calculated as
a j = min Xi,j , b j = max Xi,j (36)
where a j is the lower boundary of the search space, and b j is the upper boundary of the search space.
If the opposite point is outside the search boundary, the opposite point can be recalculated
according to the following formula.
a j + rand(0, 1) × M j − a j , i f Xi,j < a j
(37)
M j + rand(0, 1) × b j − M j , i f Xi,j > b j
From the above, it is clear that the center-of-gravity position is chosen from the
information of the average position of the population. In real life, people calculate the
average value by removing the maximum and minimum values, so as to get rid of the
influence of extreme values. In this paper, the center-of-gravity position is also calculated
by subtracting the optimal position and the worst position to make the center-of-gravity
position more representative. Using it for the initialization of the population will produce
individuals that will be spread throughout the space, which is well prepared for the
subsequent search for the best.
3.3. Signal-to-Noise Ratio Distance for Further Update the Position
In the field of computer artificial intelligence, distance is a frequent and fundamental
concept that has important applications in subfields such as natural language processing
and computer vision. The concept of distance originates from the concepts of metrics and
measurement in the field of mathematics. Distance is used in the computer field to represent
the similarity between data; the greater the distance, the greater the degree of difference
between the data. Common distance algorithms are Euclidean distance, Mahalanobis
distance, Minkowski distance, etc. Among them, Euclidean distance is the most common
representation of the distance between two or more points, but as the number of dimensions
increases, the computation of the Euclidean distance increases substantially, which greatly
increases the time overhead, and the difference between any two points in the space
becomes weaker, leading to a uniform distribution of the data [33]. Hassanat et al. [34] uses
the Euclidean norms and greedy algorithm to find the furthest pair of points (diameter) of
a set of points in d-dimensional Euclidean feature space. On the other hand, the Euclidean
distance treats the differences between the various dimensions of points in a space as
equivalent, which sometimes does not satisfy the practical requirements. The Mahalanobis
distance is a representation of the covariance distance of the data, and the Minkowski
distance is a generalization of the Euclidean distance. In other words, the Minkowski
distance can be expressed by a generalized formulation of several distance metric formulas,
which can be degraded to Manhattan distance or Euclidean distance depending on the
parameters, and the Chebyshev distance is the form in which the Minkowski distance
takes its limit. Gueorguieva et al. [35] proposed an optimized fuzzy C-means clustering
algorithm to improve the FCM clustering results by combining Mahalanobis distances and
Minkowski distance metrics. Yang et al. [36] introduced signal-to-noise distance to measure
the degree of difference between data, which can produce more discriminative features
than the distance metric based on Euclidean distance [37], and the SNR distances of a pair
of data pi and p j are defined as
var p j − pi var hij
d S pi , p j = = (38)
var ( pi ) var ( pi )
179
Electronics 2023, 12, 547
∑n ( x − μ )2 ∑n xi
where var ( x ) = i=1 n i denotes the variance of x, μ = i=n1 denotes the mean of x,
and n denotes the dimension of x. The larger the SNR distance, the greater the degree of
variance between the anchored and compared data.
Therefore, a new update mechanism that uses signal-to-noise ratio distance to deter-
mine the distance information between individuals and the optimal position was proposed
in this paper. Through this distance, the worst position can be moved away from. The
specific design formula is as follows.
d = var ( xi (t) − best(t))/var (best(t)) (39)
xi (t + 1) = xi (t) + sigmod(d)·( xi (t) − worst(t)) (40)
In the formula, xi (t) denotes the position of the i-th individual in the tth generation,
best(t) denotes the best position in the tth generation, and worst(t) denotes the worst
position in the tth generation. It can be seen that d determines the magnitude of individual
search; the smaller d is, the smaller the distance of individual xi (t) away from the worst
position. On the contrary, the larger d is, the larger the distance is. By adjusting individual
position in this dynamic update, high-quality solutions can be searched adequately. The
intelligence of the search is enhanced.
3.4. IMPSO Algorithm
3.4.1. IMPSO Algorithm Process
Input: The size of population PopSize, the dimension of the problem PerLen, the
parameters ω, c1, c2, maximal generation max_iterations.
Step 1. Initialize the matrices X and V according to Equations (19) and (20), control
the elements of the matrix X no greater than XB and no less than XM; the elements of the
matrix V no greater than VB and no less than VM.
Step 2. The fitness value of each individual of the matrix X, represented by the matrix
Fit, is obtained from the Equation (21) in terms of individuals within the population.
Step 3. Update the best solution in terms of dimensions and select the individual with
the best adaptation value for each dimension, i.e., each column, to form a matrix gBest of
size PopSize × 1.
Step 4. The best fitness value gBest_Fit is updated by the element with the best fitness
value from the fitness value matrix Fit.
Step 5. Update the best position of an individual, specifically by using the matrix X
representing the position of the individual to obtain the personal best position matrix pBest.
Step 6. Update the matrix pBest_Fit, which represents the fitness values of the personal
best positions with the matrix Fit representing the fitness values of all the individuals in
the population.
Step 7. Perform max_iterations iterations for the following operations.
Step 8. Update velocity according to Equation (26).
Step 9. Using matrix V as reference, if the element in matrix V is greater than VB, set
the element in the corresponding position in matrix LOGIC to 1; otherwise, set it to 0.
Step 10. Using the matrix LOGIC, the elements of the matrix V greater than VB are set
to VB; otherwise, they remain unchanged.
Step 11. Using matrix V as reference, if the element in matrix V is smaller than VM,
set the element in the corresponding position in matrix LOGIC to 1; otherwise, set it to 0.
Step 12. Using the matrix LOGIC, the elements of the matrix V smaller than VM are
set to VM; otherwise, they remain unchanged.
Step 13. The personal position matrix X is updated with the matrix X and the latest
obtained matrix V according to Equation (27).
Step 14. Using matrix X as reference, if the element in matrix X is greater than XB, set
the element in the corresponding position in matrix LOGIC to 1; otherwise, set it to 0.
Step 15. Using the matrix LOGIC, the elements of the matrix X greater than XB are set
to XB; otherwise, they remain unchanged.
180
Electronics 2023, 12, 547
Step 16. Using matrix X as reference, if the element in matrix X is smaller than XM, set
the element in the corresponding position in matrix LOGIC to 1; otherwise, set it to 0.
Step 17. Using the matrix LOGIC, the elements of the matrix X smaller than XM are
set to XM; otherwise, they remain unchanged.
Step 18. Update the matrix Fit representing the fitness values of all the individuals
with the latest obtained matrix X according to Equation (21).
Step 19. Update the matrix pBest and the matrix pBest_Fit. If the matrix pBest_Fit is
larger than the corresponding value in the matrix Fit, the corresponding element in the
matrix LOGIC is set to 1; otherwise, it is set to 0.
Step 20. If the matrix pBest_Fit is smaller than the corresponding value in the matrix
Fit, it means that the updated personal position matrix is not as good as the previous
personal position matrix, so the matrix pBest that represents the personal best positions of
all the individuals in the population does not need to be updated. Conversely, it means that
the latest personal position matrix is better than the previous individual matrix, because
the personal best fitness value is optimized, so it needs to be updated to the latest personal
position matrix X.
Step 21. The matrix Fit corresponds to the personal best fitness values of the population
matrix X. The matrix pBest_Fit corresponds to the matrix pBest, and the best personal fitness
values matrix is updated based on the personal best position matrix by comparing the
previous equation.
Step 22. Using Equations (38)–(40) to further update the position of the population particles.
Step 23. Individuals with the best fitness values are selected in terms of dimensions,
and the corresponding elements are assigned to the matrix gBest according to the obtained
individuals and dimensions in the matrix pBest.
Step 24. The element with the best fitness value is selected in the personal best fitness
value matrix pBest, which is the best solution fitness value.
Step 25. When the number of iterations is a multiple of 100, the population-related
variables are reinitialized using Equations (31)–(37). Exit the loop at the end of the iteration
count; otherwise, go back to step8 to continue the iterations.
Output: The found best solution fitness gBest_Fit.
The matrix pBest represents the best personal positions of all the individuals in the
IMPSO population. pBest_Fit is a matrix that selects the element with the best fitness value
in all dimensions in terms of individuals, with a matrix size of PopSize × 1. gBest is a matrix
that finds the corresponding row number of the best personal fitness value matrix pBest_Fit,
i.e., the individual with the best personal fitness value, in terms of dimensions, to achieve
the goal of finding the individual with the best fitness value for each dimension, and the
matrix size is 1 × PerLen. gBest_Fit is the matrix with the best fitness value in the personal
best fitness value matrix pBest_Fit.
3.4.2. Flowchart Based on IMPSO Algorithm to Optimize DNA Sequence
To solve the problem of excessive time consumption and low quality in DNA sequence
design optimization problems, this study proposes a multi-strategy matrix particle swarm
and introduces an efficient matrix particle swarm to reduce the time consumption of
the algorithm, then introduces novel centroid opposition-based learning to initialize the
population during the optimization search to avoid the population falling into local states
and finally introduces a signal-to-noise ratio to judge the distance between individuals for
updates with high quality. The efficiency and reliability of DNA computing are inseparable
from the design of the DNA chain. In order to design more excellent DNA sequences, it
can be effective to combine the objective function and the constraints of the DNA chain.
Before applying the objective function for calculation, the population particles are coded by
dividing them by four, so that the matrix particle swarm can be coded with the four bases
(A, C, G, T) of DNA. The specific algorithm flowchart is shown as Figure 1.
181
Electronics 2023, 12, 547
VWDUW
,QSXWWKHUHOHYDQWSDUDPHWHUV
DQGWKHPD[LPXPQXPEHURI
LWHUDWLRQV
,QLWLDOL]HWKHSRSXODWLRQPDWUL[
UHSUHVHQWLQJWKHORFDWLRQRI
LQGLYLGXDOVXVLQJ(TXDWLRQ
QR
8SGDWHWKHSRVLWLRQDQG 5HLQLWLDOL]HWKHSRSXODWLRQ
YHORFLW\RIWKH0DWUL[3DUWLFOH UHODWHGSDUDPHWHUV
,HUDWLRQV LWHUDWLRQV DFFRUGLQJWR(TXDWLRQV ,WHUDWLRQV "
6ZDUPXVLQJ(TXDWLRQV ā
ā \HV
&DOFXODWHWKHILWQHVVYDOXHV
DFFRUGLQJWR(TXDWLRQ
QR
1HZILWQHVVYDOXHVDUHVPDOOHU
\HV 8SGDWHWKHORFDWLRQRI 5HFDOFXODWHILWQHVV
:KHWKHUWKHPD[LPXP
8SGDWHEHVWSRVLWLRQ WKHSRSXODWLRQDFFRUGLQJ YDOXHVWRJHWJOREDO
WKDQRULJLQDOILWQHVVYDOXHV QXPEHURIWKHLWHUDWLRQVKDV
WR(TXDWLRQV ā EHVWSRVLWLRQ
EHHQUHDFKHG"
\HV
QR
2XWSXW0LQLPXP
/RFDWLRQDQG&RVW
HQG
Figure 1. IMPSO algorithm flowchart.
4. Results and Analysis
4.1. Algorithm Parameters
In this section, IMPSO is applied to DNA sequence design experimentation to demon-
strate the high efficiency of the IMPSO in solving the DNA coding sequence design prob-
lem. All experiments were carried out on a computer with Intel (R) Core (TM) i5-10200H
(2.40 Ghz) CPU, 16 GB RAM, 64-bit OS, and MATLAB R2020b simulation platform. In this
experiment, the DNA molecule concentration is set to 10 nm, the salt solution concentration
in the experimentation is set to 1 mol/L, the minimum values of the hair stem and hair loop
were set to 6, and in the experiment on similarity and H-Measure, the penalty threshold for
base continuity equality is set to 6, and, for discontinuity, it is set to 0.17. The continuity
threshold for a single DNA strand is set to 2. The other parameters used in this study are
described in Table 2.
4.2. Algorithm Results
4.2.1. Experimentation on the Effectiveness of IMPSO in Solving DNA Coding
To verify the feasibility of the IMPSO algorithm, the DNA sequences, the values of
each constraint and their running times obtained from the optimization of IMPSO with
MPSO, IWO, PSO and HS were compared. The results in Table 3 show that the IWO,
PSO and HS algorithms take a long time to solve the DNA sequence design problem, all
182
Electronics 2023, 12, 547
above 20,000 s, and IWO even takes more than 35,000 s. The performance of MPSO shows
that the running time of the swarm intelligence algorithm based on matrix operations is
significantly reduced under the same conditions and that the values of each constraint
of the DNA sequence do not become worse. The IMPSO algorithm requires more than
two times more time compared to MPSO, which is due to the time required to add the
improvement strategy. Although the time consumed increases, all the metrics of the DNA
sequences obtained by IMPSO are better than those of MPSO, so the extra time consumption
is worthwhile to obtain higher computational efficiency.
Table 2. Related parameters in IMPSO algorithm.
Symbol Implication Value
Max_iteration Maximum number of iterations 3000
PopSize Size of the population 20
PerLen Length of the individual 20
XB Upper bound 3
XM Lower bound 0
VB Maximum velocity constraint 3
VM Minimum velocity constraint 0
ωmin Minimum number of dynamic constant 0.4
ωmax Maximum number of dynamic constant 0.9
C10 Initial factor for self-learning 2.5
C1min Minimum factor for self-learning 0.5
C20 Initial factor for social learning 2.5
C2min Minimum factor for social learning 0.5
D The size of Hamming Distance 11
4.2.2. Experimentations on the Competitiveness of IMPSO in Designing DNA Sequence
For demonstrating the competitiveness of IMPSO to solve DNA sequence design,
this paper compares the experimentational DNA sequence design results of IMPSO with
those of NCIWO, HSWOA, MO-ABC, CPSO and DMEA by comparing the average values
of continuity, hairpin, H-Measure, similarity and the variance of Tm to assess sequence
quality. Among these metrics, H-Measure and similarity are beneficial in preventing DNA
strands from mismatching, and hairpin and continuity are beneficial in avoiding secondary
structures in DNA strands. To ensure the fairness of the experimentations, parameters in the
mentioned algorithm are set in accordance with their relevant references, and population
size and iterations numbers were kept consistent.
4.3. Comparisons and Analysis
Controlling continuity and hairpin structure in DNA sequences can prevent self-
hybridization in DNA molecules to produce secondary structures and to ensure the re-
liability of DNA calculations. By constraining similarity and H-Measure, non-specific
hybridization between a DNA sequence and its complementary sequences can be con-
trolled. Melting temperature and free energy are important thermodynamic constraints of
DNA molecules, and maintaining their stability is conducive to control the hybridization
reaction between DNA molecules and to improve the reaction efficiency of DNA sequences.
4.3.1. Control Secondary Structures
From the results in Table 4 and Figure 2, it can be seen that the continuity and hairpin
of IMPSO and HSWOA are 0; however, the continuity or hairpin structures of NCIWO,
MO-ABC, CPSO and DMEA exceed 0. This indicates that the DNA sequences created by
IMPSO and HSWOA prevent secondary structures with advantage.
183
Electronics 2023, 12, 547
Table 3. Comparison of DNA sequences and their constraint values and Cputime.
DNA Sequences (5 -3 ) Continuity Hairpin H-Measure Similarity Tm GC%
IWO [23]
CCAACCTCCGAACCTACATA 0 0 50 57 63.24 50
CAGAACCAGAACAACGCCAA 0 0 52 56 65.76 50
ATTAACCACCTGCCTCTCTG 0 0 54 54 63.85 50
CGATTACACTCCTCACACCA 0 0 51 56 63.78 50
CAGCCAGGTGAAGATAAGAC 0 0 59 53 62.33 50
ACGGTGCTACCTGTTCCTAT 0 0 61 54 65.13 50
AGTATTGCGACGGCCTTCAA 0 0 61 50 66.89 50
Average 0 0 55.43 54.29 64.42 50
Cputime(s) 35,379.59
PSO [24]
TACCTCCGTTCTTGCCACTT 0 0 58 49 65.91 50
CGGTGAGAGATGACGATTAG 0 0 60 48 61.85 50
ATAGCGTGACCAGCCAACAA 0 0 63 49 66.88 50
GTTGGATTGCGTACTCTCTG 0 0 61 47 62.92 50
TGTTGGTCAACCTGATGCTG 0 0 64 49 65.25 50
AGTTCTTAGGAGCGTGCAGA 0 0 61 49 65.64 50
CCGCCACACGAATCAATCTA 0 0 63 47 64.81 50
Average 0 0 61.43 48.29 64.75 50
Cputime(s) 20,814.27
HS [25]
AGGAGAGACCTGGATTGAGT 0 0 60 51 64.16 50
TGTAGGAAGAGTGTGAACGG 0 0 61 46 63.71 50
GCAACCAACCATTACTCGAC 0 0 57 50 63.78 50
CCTTCCTTCCGCCTTATATC 0 0 64 44 61.9 50
AGGACATGAGAATCACACGG 0 0 60 52 64.15 50
GCAGAGACAATAACAAGCGG 0 0 56 53 63.83 50
GCCAATCAACATCGACACCT 0 0 58 54 65.35 50
Average 0 0 59.43 50 63.84 50
Cputime(s) 21,364.64
MPSO [22]
TCCAAGCACACCATACCTCT 0 0 58 50 65.39 50
CGGAGAAGAAGTAGAACTGG 0 0 55 51 61.66 50
GACCACACTCAGGATCCATA 0 0 58 55 62.96 50
GCCAATATAGGCCACAGAGA 0 0 64 50 63.69 50
TCGCGTATCGTTGGTGTCTA 0 0 65 48 65.66 50
TTAACCGAGAATCTCGCAGG 0 0 61 51 64.18 50
ACATGAAGGTGCGGAAGCTT 0 0 61 51 67.18 50
Average 0 0 60.29 50.86 64.39 50
Cputime(s) 6691.05
IMPSO
GGAGGTTAGGTTAGTGTTGG 0 0 53 53 61.90 50
CGACAAGAGATGAGAACACC 0 0 54 49 62.57 50
GAGTAGGTGAGATGGTAAGG 0 0 47 55 60.80 50
CAACGAACACGAACCAGTCA 0 0 64 45 65.40 50
GTTGGTGGTTGGTCCTTGTA 0 0 58 47 64.57 50
TATACCTAGAGTGAACGGCG 0 0 61 50 63.04 50
CCGCCATGAGGAAGTGTATA 0 0 59 51 63.66 50
Average 0 0 56.57 50 63.13 50
Cputime(s) 15,008.97
184
Electronics 2023, 12, 547
Table 4. Comparison of DNA sequences and corresponding constraint values.
DNA Sequences (5 -3 ) Continuity Hairpin H-Measure Similarity Tm GC%
IMPSO
GGAGGTTAGGTTAGTGTTGG 0 0 53 53 61.90 50
CGACAAGAGATGAGAACACC 0 0 54 49 62.57 50
GAGTAGGTGAGATGGTAAGG 0 0 47 55 60.80 50
CAACGAACACGAACCAGTCA 0 0 64 45 65.40 50
GTTGGTGGTTGGTCCTTGTA 0 0 58 47 64.57 50
TATACCTAGAGTGAACGGCG 0 0 61 50 63.04 50
CCGCCATGAGGAAGTGTATA 0 0 59 51 63.66 50
Average 0 0 56.57 50 63.13 50
HSWOA [26]
CTCGTCTAACCTTCTTCAGC 0 0 63 51 62.28 50
CTGTGTGGAATGCAAGGATG 0 0 64 48 63.82 50
CGAGCGTAGTGTAGTCATCA 0 0 63 69 63.56 50
AGTTACAGGACACCACCGAT 0 0 65 51 66.39 50
CAGTAGCAGTCATAACGAGC 0 0 64 56 62.69 50
GCATAGCACATCGTAGCGTA 0 0 59 54 64.60 50
TGGACCTTGAGAGTGGAGAT 0 0 62 50 64.44 50
Average 0 0 62.86 54.14 63.97 50
NCIWO [9]
ACACCAGCACACAGAAACA 9 0 55 46 66.99 50
GTTCAATCGCCTCTCGGTAT 0 0 57 52 64.26 50
GCTACCTCTTCCACCATTCT 0 0 55 53 63.55 50
GAATCAATGGCGGTCAGAAG 0 0 66 47 63.58 50
TTGGTCCGGTTATTCCTTCG 0 0 65 52 64.44 50
CCATCTTCCGTACTTCACTG 0 0 56 56 62.30 50
TTCGACTCGGTTCCTTGCTA 0 0 58 54 65.61 50
Average 1.29 0 58.86 51.43 64.39 50
MO-ABC [8]
GTAAGGAAGGCAAGGCAGAA 0 0 42 54 64.70 50
GTTGGTGGTTGTTGGTGGTT 0 0 46 36 66.00 50
GGAGACGGAATGGAAGAGTA 0 0 44 55 62.93 50
CCATTCTTCTCTTCTCTCCC 9 0 67 22 61.39 50
AGGAGAGGAGAGGAGGAAAA 16 0 31 53 63.80 50
ATAAGAGAGAGAGAGAGGGG 16 0 34 51 61.11 50
GAGCCAACAGCCAACCAAAA 16 0 48 45 66.40 50
Average 8.14 0 44.57 45.14 63.76 50
CPSO [27]
GACCGGTAAGATGAAGAGGA 0 0 60 50 62.94 50
CTATGCTTCTATCGCCTTCC 0 0 61 51 62.23 50
TAGTTGCACGAGAGAAGCAG 0 0 60 51 64.38 50
CGTGTACGAGCCTAATAAGG 0 0 64 54 62.14 50
CTTTGTCCATTGCACATCCG 9 0 61 53 64.42 50
TCCTATCCGAGATGATCCGT 0 3 63 55 64.08 50
TTCAACTTACGCTGTACGGC 0 6 63 54 65.25 50
Average 1.29 1.29 61.71 52.57 63.63 50
DMEA [28]
TGAGTTGGAACTTGGCGGAA 0 0 70 52 66.76 50
CAGCATGTTAGCCAGTACGA 0 0 60 55 64.65 50
TTGAGTCCGCGTGGTTGGTC 0 0 63 53 69.79 60
AATTGACACTCTGATTCCGC 0 0 73 58 62.89 45
CATACATTGCATCAACGGCG 0 0 67 53 64.84 50
ATACACGCACCTAGCCACAC 0 0 59 50 66.93 55
GTTCCACAACAGGTCTAATG 0 3 61 53 60.65 45
Average 0 0.43 64.71 53.43 65.22 50.71
185
Electronics 2023, 12, 547
Figure 2. Comparison results among average values of IMPSO, HSWOA, NCIWO, MO-ABC, CPSO,
DMEA and IMPSO in continuity and hairpin.
4.3.2. Control Nonspecific Hybridization
From Table 4 and Figure 3, H-Measure and similarity values of IMPSO are more
desirable than other algorithms, only second to MO-ABC, due to their priority to the
constraints set of H-Measure and similarity at the expense of continuity and hairpin structure,
so the sequences of IMPSO are overall superior to those of MO-ABC.
Figure 3. Comparison results among average values of HSWOA, NCIWO, MO-ABC, CPSO, DEMA
and IMPSO in H-Measure and similarity.
4.3.3. Thermodynamics of Tm
In DNA calculation, DNA sequences need to be as consistent as possible in terms
of Tm to dominate biochemical reactions. In this experiment, the variance was used to
measure the fluctuation of the Tm of the DNA sequences generated by each algorithm.
186
Electronics 2023, 12, 547
From Table 4 and Figure 4, the variance of Tm of IMPSO is superior to MO-ABC and DMEA
and slightly inferior to CPSO, HSWOA and NCIWO.
Figure 4. Comparison results among average values of HSWOA, NCIWO, MO-ABC, CPSO, DEMA
and IMPSO in Tm variance.
5. Conclusions
To preferably solving the problem of DNA sequence optimization design, an improved
multi-strategy matrix particle swarm optimization algorithm is proposed in this paper,
which uses an approach in accordance with the signal-to-noise ratio distance to dynamically
update the optimal and worst positions of individuals within the population and can
adequately search for high-quality solutions. The centroid opposition-based learning
strategy is introduced to improve the search range of the algorithm and to exclude the
extreme differences brought by the optimal and worst positions when calculating the center-
of-gravity positions, so that the center-of-gravity positions are more representative. The
individuals generated in the initialization of the population of matrix particles can be spread
over the whole space, making full use of the favorable information carried by the population
as a whole in the search for the global best, avoiding the premature convergence of the
population into a local optimum and fully preparing for the subsequent search for the global
optimum. Finally, matrix operations are used to greatly reduce the algorithm running time
and to obtain higher computational efficiency without sacrificing the DNA constraint values.
Experiments comparing with other particle swarm algorithms confirm that, excluding
the MPSO algorithm, the runtime of the swarm intelligence algorithm based on matrix
operations is significantly reduced under the same conditions, that various constraint
values of DNA sequences do not become worse compared with other algorithms and that
the comprehensive capability and reliability of DNA computation are outstanding. The
improved multi-strategy matrix particle swarm algorithm (IMPSO) does not underperform
in terms of DNA constraint values compared with other DNA sequence design experiments,
taking into account the global picture and obtaining optimized sequences of high quality,
verifying the effectiveness of the algorithm and meeting the requirements for application
to DNA computation. However, the individual capabilities under the combined capability,
especially the melting temperature variance, need to be improved. By not sacrificing the
DNA constraint values and making full use of the whole population diversity, the CPU
running time will also be increased. How to find a breakthrough point to gradually improve
187
Electronics 2023, 12, 547
the single-item capability without sacrificing any necessary constraint to achieve a more
excellent DNA computation capability is also something that needs further consideration
in future work.
Author Contributions: Data curation, W.Z.; formal analysis, W.Z. and Z.H.; funding acquisition,
C.Z.; software, W.Z. and D.Z.; supervision, D.Z.; validation, C.Z. and Z.H.; writing—review and
editing, W.Z. and D.Z. All authors have read and agreed to the published version of the manuscript.
Funding: This work was supported in part by the National Natural Science Foundation of China
under Grant numbers 62272418, and 62002046.
Data Availability Statement: Dataset used in this study may be available on demand.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Watson, J.D.; Crick, F.H. Molecular Structure of Nucleic Acids: A Structure for Deoxyribose Nucleic Acid. Nature 1953, 171,
737–738. [CrossRef]
2. Adleman, L.M. Molecular Computation of Solutions to Combinatorial Problems. Science 1994, 266, 1021–1024. [CrossRef]
[PubMed]
3. Seelig, G.; Soloveichik, D.; Zhang, D.Y.; Winfree, E. Enzyme-free Nucleic Acid Logic Circuits. Science 2006, 314, 1585–1588.
[CrossRef] [PubMed]
4. Church, G.M.; Gao, Y.; Kosuri, S. Next-generation Digital Information Storage in DNA. Science 2012, 337, 1628. [CrossRef]
[PubMed]
5. Extance, A. How DNA Could Store All the World’s Data. Nature 2016, 537, 22–24. [CrossRef]
6. Zhirnov, V.; Zadegan, R.M.; Sandhu, G.S.; Church, G.M.; Hughes, W.L. Nucleic Acid Memory. Nat. Mater. 2016, 15, 366–370.
[CrossRef]
7. Zhu, D.L.; Huang, Z.W.; Liao, S.G.; Zhou, C.J.; Yan, S.Q.; Chen, G. Improved Bare Bones Particle Swarm Optimization for DNA
Sequence Design. IEEE Trans. NanoBioscience 2022. [CrossRef]
8. Chaves-González, J.M.; Vega-Rodríguez, M.A.; Granado-Criado, J.M. Multiobjective Swarm Intelligence Approach Based on
Artificial Bee Colony for Reliable DNA Sequence Design. Eng. Appl. Artif. Intell. 2013, 26, 2045–2057. [CrossRef]
9. Yang, G.J.; Wang, B.; Zheng, X.; Zhou, C.J.; Zhang, Q. IWO Algorithm Based on Niche Crowding for DNA Sequence Design.
Interdiscip. Sci. Comput. Life Sci. 2017, 9, 341–349. [CrossRef]
10. Zhang, K.; Xu, J.; Geng, X.T.; Xiao, J.H.; Pan, L.Q. Improved Taboo Search Algorithm for Designing DNA Sequences. Prog. Nat.
Sci. 2008, 18, 623–627. [CrossRef]
11. Cervantes-Salido, V.M.; Jaime, O.; Brizuela, C.A.; Martínez-Pérez, I.M. Improving the Design of Sequences for DNA Computing:
A Multiobjective Evolutionary Approach. Appl. Soft Comput. 2013, 13, 4594–4607. [CrossRef]
12. Chaves-González, J.M.; Vega-Rodríguez, M.A. DNA Strand Generation for DNA Computing by Using A Multi-objective
Differential Evolution Algorithm. Biosystems 2014, 116, 49–64. [CrossRef]
13. Chaves-González, J.M.; Vega-Rodríguez, M.A. A Multiobjective Approach Based on The Behavior of Fireflies to Generate Reliable
DNA Sequences for Molecular Computing. Appl. Math. Comput. 2014, 227, 291–308. [CrossRef]
14. Eberhart, R.; Kennedy, J. A New Optimizer Using Particle Swarm Theory. In Proceedings of the Sixth International Symposium
on Micro Machine and Human Science, Nagoya, Japan, 4–6 October 1995; pp. 39–43. [CrossRef]
15. Houssein, E.H.; Gad, A.G.; Hussain, K.; Suganthan, P.N. Major Advances in Particle Swarm Optimization: Theory, Analysis, and
Application. Swarm Evol. Comput. 2021, 63, 100868. [CrossRef]
16. Ghatasheh, N.; Faris, H.; Abukhurma, R.; Castillo, P.A.; Al-Madi, N.; Mora, A.M.; Al-Zoubi, A.M.; Hassanat, A. Cost-sensitive
Ensemble Methods for Bankruptcy Prediction in A Highly Imbalanced Data Distribution: A Real Case from the Spanish Market.
Prog. Artif. Intell. 2020, 9, 361–375. [CrossRef]
17. Zhang, Q.K.; Liu, W.G.; Meng, X.X.; Yang, B.; Vasilakos, A.V. Vector coevolving particle swarm optimization algorithm. Inf. Sci.
2017, 394, 273–298. [CrossRef]
18. Coello, C.A.C.; Lechuga, M.S. MOPSO: A Proposal for multiple objective particle swarm optimization. In Proceedings of the 2002
Congress on Evolutionary Computation Part of the 2002 IEEE World Congress on Computational Intelligence, Honolulu, HI,
USA, 12–17 May 2002; Volume 2, pp. 1051–1056. [CrossRef]
19. Corne, D.W.; Jerram, N.R.; Knowles, J.D.; Oates, M.J. PESA-II: Region-based Selection in Evolutionary Multiobjective Optimization.
In Proceedings of the 3rd Annual Conference on Genetic And Evolutionary Computing Conference, San Francisco, CA, USA,
7–11 July 2001; pp. 283–290. [CrossRef]
20. Hu, X.H.; Eberhart, R. Multiobjective Optimization Using Dynamic Neighborhood Particle Swarm Optimization. In Proceedings
of the 2002 Congress on Evolutionary Computation, Honolulu, HI, USA, 12–17 May 2002; pp. 1677–1681. [CrossRef]
21. Deb, K.; Pratap, A.; Agarwal, S.; Meyarivan, T.A.M.T. A Fast And Elitist Multiobjective Genetic Algorithm: NSGA-II. IEEE Trans.
Evol. Comput. 2022, 6, 182–197. [CrossRef]
188
Electronics 2023, 12, 547
22. Zhan, Z.H.; Zhang, J.; Lin, Y.; Li, J.Y.; Huang, T.; Guo, X.Q.; Wei, F.F.; Kuang, S.X.; Zhang, X.Y.; You, R. Matrix-Based Evolutionary
Computation. IEEE Trans. Emerg. Top. Comput. Intell. 2021, 6, 315–328. [CrossRef]
23. Mehrabian, A.R.; Lucas, C. A Novel Numerical Optimization Algorithm Inspired from Weed Colonization. Ecol. Inform. 2006, 1,
355–366. [CrossRef]
24. Poli, R.; Kennedy, J.; Blackwell, T. Particle Swarm Optimization. Swarm Intell. 2007, 1, 33–57. [CrossRef]
25. Geem, Z.W.; Kim, J.H.; Loganathan, G.V. A New Heuristic Optimization Algorithm: Harmony Search. Simulation 2001, 76, 60–68.
[CrossRef]
26. Xue, L.; Wang, B.; Lv, H.; Yin, Q.; Zhang, Q.; Wei, X.P. Constraining DNA Sequences with A Triplet-bases Unpaired. IEEE Trans.
NanoBiosci. 2020, 19, 299–307. [CrossRef]
27. Liu, Y.Y.; Zheng, X.D.; Wang, B.; Zhou, S.H. The Optimization of DNA Encoding Based on Chaotic Optimization Particle Swarm
Algorithm. J. Comput. Theor. Nanosci. 2016, 13, 443–449. [CrossRef]
28. Xiao, J.H.; Jiang, Y.; He, J.J.; Cheng, Z. A Dynamic Membrane Evolutionary Algorithm for Solving DNA Sequences Design with
Minimum Free Energy. MATCH Commun. Math. Comput. Chem. 2013, 70, 971–986.
29. Shin, S.Y.; Lee, I.H.; Kim, D.; Zhang, B.T. Multiobjective Evolutionary Optimization of DNA Sequences for Reliable DNA
Computing. IEEE Trans. Evol. Comput. 2005, 9, 143–158. [CrossRef]
30. Watkins, N.E., Jr.; SantaLucia, J., Jr. Nearest-neighbor Thermodynamics of Deoxyinosine Pairs in DNA Duplexes. Nucleic Acids
Res. 2005, 33, 6258–6267. [CrossRef] [PubMed]
31. Tizhoosh, H.R. Opposition-based Learning: A New Scheme for Machine Intelligence. In Proceedings of the International
Conference on Computational Intelligence for Modelling, Control and Automation and International Conference on Intelligent
Agents, Web Technologies and Internet Commerce, Vienna, Austria, 28–30 November 2005; Volume 1, pp. 695–701. [CrossRef]
32. Rahnamayan, S.; Jesuthasan, J.; Bourennani, F.; Salehinejad, H.; Naterer, G.F. Computing Opposition by Involving Entire
Population. In Proceedings of the IEEE Congress on Evolutionary Computation, Beijing, China, 6–11 July 2014; pp. 1800–1807.
[CrossRef]
33. Milman, V.D. New Proof of the Theorem of A. Dvoretzky on Intersections of Convex Bodies. Funct. Anal. Its Appl. 1971, 5,
288–295. [CrossRef]
34. Hassanat, A.B.A. Furthest-Pair-Based Decision Trees: Experimentational Results on Big Data Classification. Information 2018,
9, 284. [CrossRef]
35. Gueorguieva, N.; Valova, I.; Georgiev, G. M&MFCM: Fuzzy C-means Clustering with Mahalanobis and Minkowski Distance
Metrics. Procedia Comput. Sci. 2017, 114, 224–233. [CrossRef]
36. Yang, J.H.; Yu, J.H.; Huang, C. Adaptive Multistrategy Ensemble Particle Swarm Optimization with Signal-to-Noise Ratio
Distance Metric. Inf. Sci. 2022, 612, 1066–1094. [CrossRef]
37. Yuan, T.T.; Deng, W.H.; Tang, J.; Tang, Y.N.; Chen, B.H. Signal-To-Noise Ratio: A Robust Distance Metric for Deep Metric Learning.
In Proceedings of the Conference on Computer Vision and Pattern Recognition (CVPR), Long Beach, CA, USA, 15–20 June 2019;
pp. 4810–4819. [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
189
electronics
Article
A Multi-Strategy Adaptive Particle Swarm Optimization
Algorithm for Solving Optimization Problem
Yingjie Song 1 , Ying Liu 2 , Huayue Chen 3, * and Wu Deng 4,5, *
1 School of Computer Science and Technology, Shandong Technology and Business University,
Yantai 264005, China
2 School of Statistics, Shandong Technology and Business University, Yantai 264005, China
3 School of Computer Science, China West Normal University, Nanchong 637002, China
4 Traction Power State Key Laboratory, Southwest Jiaotong University, Chengdu 610031, China
5 College of Electronic Information and Automation, Civil Aviation University of China, Tianjin 300300, China
* Correspondence: [email protected] (H.C.); [email protected] (W.D.)
Abstract: In solving the portfolio optimization problem, the mean-semivariance (MSV) model is
more complicated and time-consuming, and their relations are unbalanced because they conflict with
each other due to return and risk. Therefore, in order to solve these existing problems, multi-strategy
adaptive particle swarm optimization, namely APSO/DU, has been developed to solve the portfolio
optimization problem. In the present study, a constraint factor is introduced to control velocity weight
to reduce blindness in the search process. A dual-update (DU) strategy is based on new speed, and
position update strategies are designed. In order to test and prove the effectiveness of the APSO/DU
algorithm, test functions and a realistic MSV portfolio optimization problem are selected here. The
results demonstrate that the APSO/DU algorithm has better convergence accuracy and speed and
finds the least risky stock portfolio for the same level of return. Additionally, the results are closer to
the global Pareto front (PF). The algorithm can provide valuable advice to investors and has good
practical applications.
Keywords: PSO; multi-strategy; dual-update strategy; mean-semivariance model; portfolio optimization
Citation: Song, Y.; Liu, Y.; Chen, H.;
Deng, W. A Multi-Strategy Adaptive
1. Introduction
Particle Swarm Optimization
Algorithm for Solving Optimization The portfolio optimization problem (POP) aims to improve portfolio returns and
Problem. Electronics 2023, 12, 491. reduce portfolio risk in the complex financial market. The mean-variance (MV) model
https://doi.org/10.3390/ was first proposed by economist Markowitz in 1952 to calculate the POP [1,2] and is a
electronics12030491 cornerstone of financial theory, providing a theoretical basis for investors to choose the
optimal portfolio. However, there are significant limitations in its practical application.
Academic Editor: Young-Koo Lee
The use of variance to assess risk usually requires the calculation of a covariance matrix
Received: 22 December 2022 for all stocks, which is difficult to use in practice due to its computational complexity.
Revised: 14 January 2023 Additionally, this risk measurement only considers the extent to which actual returns
Accepted: 16 January 2023 deviate from expected returns, whereas true losses refer to fluctuations below the mean of
Published: 17 January 2023 returns [3–8]. In order to be more in line with social reality, mean-semivariance portfolio
models have been proposed and are widely used [9–12].
Traditional optimization algorithms for solving POPs require the application of many
complex statistical methods and reference variables provided by experts, so solving large-
Copyright: © 2023 by the authors.
scale POPs suffers from slow computational speed and poor solution accuracy, while
Licensee MDPI, Basel, Switzerland.
heuristic algorithms can solve these problems well. In recent years, many scholars have
This article is an open access article
distributed under the terms and
used evolutionary computation algorithms to solve POPs, including the genetic algo-
conditions of the Creative Commons
rithm (GA) [13], particle swarm optimization (PSO) [14,15], artificial bee colony algorithm
Attribution (CC BY) license (https://
(ABC) [16], and squirrel search algorithm (SSA) [17]. The particle swarm optimization
creativecommons.org/licenses/by/ algorithm (Eberhart & Kennedy, 1995) belongs to a class of swarm intelligence algorithms,
4.0/). which are designed by simulating the predatory behavior of a flock of birds [18–23]. Due
Electronics 2023, 12, 491. https://doi.org/10.3390/electronics12030491 https://www.mdpi.com/journal/electronics
191
Electronics 2023, 12, 491
to its simple structure, fast convergence, and good robustness, it has been widely used in
complex nonlinear portfolio optimization [24–29]. In addition, some new methods have
also been proposed in some fields in recent years [30–39].
The improvement directions of the PSO algorithm are mainly divided into param-
eter improvement, update formula improvement, and integration with other intelligent
algorithms. Setting the algorithm’s parameters is the key to ensuring the reliability and
robustness of the algorithm. With the determined population size and iteration time, the
search capability of the algorithm is mainly decided by three core control parameters,
namely the inertia weight (w), the self-learning factor (C1 ), and the social-learning factor
(C2 ). To improve the performance of the algorithm, PSO algorithms based on the dual
dynamic adaptation mechanism of inertia weights and learning factors have been proposed
successively in recent years [40–42], considering that adjusting the core parameters alone
weakens the uniformity of the algorithm evolution process and make it difficult to adapt
to complex nonlinear optimization problems. Clerc et al. [43] proposed the concept of the
shrinkage factor, and this method adds a multiplicative factor to the velocity formulation in
order to allow the three core parameters to be tuned simultaneously, ultimately resulting in
better algorithm convergence performance. Since then, numerous scholars have explored
the full-parameter-tuning strategy to mix the three core parameters for tuning experiments.
Zhang et al. [44] used control theory to optimize the core parameters of the standard
PSO. Harrison et al. [45] empirically investigated the convergence behavior of 18 adaptive
optimization algorithms.
The parameter improvement of PSO only involves improving the velocity update and
does not consider the position update. Different position-updating strategies have different
exploration and exploitation capabilities. In position updating, because the algorithm’s
convergence is highly dependent on the position weighting factor, a constraint factor needs
to be introduced to control the velocity weight and reduce blindness in the search process.
Liu et al. [46] proposed that the position weighting factor facilitates global algorithm
exploration. The paper synthesizes the advantages of the two improvement methods and
proposes a dual-update (DU) strategy. The method not only adjusts the core parameters of
velocity update to make the algorithm more adaptable to nonlinear complex optimization
problems, it also considers the position update formula and introduces a constraint factor
to control the weight of velocity to reduce blindness in the search process and improve the
convergence accuracy and convergence speed of the algorithm.
The main contributions of this paper are described as follows.
(1) This paper makes improvements based on fundamental particle swarm and pro-
poses a multi-strategy adaptive particle swarm optimization algorithm, namely APSO/DU,
to solve the portfolio optimization problem. Modern portfolio models are typically complex
nonlinear functions, which are more challenging to solve.
(2) A dual-update strategy is designed based on new speed and position update
strategies. The approach uses inertia weights to modify the learning factor, which can
balance the capacity for learning individual particles and the capacity for learning the
population and enhance the algorithm’s optimization accuracy.
(3) A position update approach is also considered to lessen search blindness and
increase the algorithm’s convergence rate.
(4) Experimental findings show that the two strategies work better together than they
do separately.
2. Multi-Strategy Adaptive PSO
2.1. Basic PSO Algorithm
The PSO algorithm is a population-based stochastic search algorithm in which the
position of each particle represents a feasible solution to the problem to be optimized, and
the position of the particle is evaluated in terms of its merit by the fitness value derived
from the optimization function. The particle population is initialized randomly as a set
of random candidate solutions in the PSO algorithm, and then each particle moves in the
192
Electronics 2023, 12, 491
search space with a certain speed, which is dynamically adjusted according to its own and
its companion’s flight experience. The optimal solution is obtained after cyclic iterations
until the convergence condition is satisfied.
Suppose a population X = { x1 , . . . , xi , . . . , xn } of n particles without weight and vol-
ume in a D-dimensional search space, at the tth iteration, xi (t) = [ xi1 (t), xi2 (t), . . . , xiD (t)]
denotes the position of ith particle, Vi (t) = [vi1 (t), vi2 (t), . . . , viD (t)] denotes the velocity
of ith particle. Up to generation t, pi (t) = [ pbesti1 (t), pbesti2 (t), . . . , pbestiD (t)] denotes the
personal best position particle i has visited since the first-time step. gbest denote the best
position discovered by all particles so far. In every generation, the evolution process of the
ith particle is formulated as
vi (t + 1) = wvi (t) + c1 × rand() × ( pi (t) − xi (t) + c2 × rand() × ( gbest(t) − xi (t)) (1)
x i ( t + 1) = x i ( t ) + v i ( t + 1) (2)
where i = 1, 2, . . . , D. w is the inertia weight. c1 and c2 are constants of the PSO algorithm
with a value range of [0, 2], while rand () represents the random numbers in [0, 1].
An iteration of PSO-based particle movement is demonstrated in Figure 1.
Figure 1. An iterative particle movement in PSO.
2.2. APSO/DU
PSO is an intelligent algorithm with global convergence, which requires fewer pa-
rameters to be adjusted. However, basic PSO has the problem of easily falling into local
optimum and slow convergence. The APSO/DU algorithm can reduce the blindness of the
search process and improve the convergence accuracy and speed of the algorithm, making
it more adaptable to complex optimization problems. The APSO/DU algorithm can reduce
the blindness of the search process and make the algorithm more adaptable to complex
optimization problems.
2.2.1. Speed Update Strategy
The improvement strategies for inertia weights (w) and learning factors (c1 , c2 ) can
be classified as constant or stochastic, linear or nonlinear, and adaptive. The existing
research on the dual dynamic adaptation mechanism has experimentally shown that using
nonlinear decreasing weights is better than using linear decreasing weights. The functional
relationship with nonlinear learning factors can be more adapted to complex optimization
objectives. The strategy uses inertia weights to adjust the learning factors, which can
balance the learning ability of individual particles and the group’s learning ability and
193
Electronics 2023, 12, 491
improve the algorithm’s optimization accuracy. This paper uses a combination of the two
with better results.
• Nonlinear Decreasing w
w is the core parameter that affects the performance and efficiency of the PSO algo-
rithm. Smaller weights can strengthen the local search ability and improve convergence
accuracy, while larger weights are beneficial to the global search and prevent the particles
from falling into the optimal local position, but the convergence speed is slow. Most of
the current improvements are related to the adjustment of w. In this paper, we use the
nonlinear w exponential function decreasing way, and the formula is as follows.
# t $
w = wmin + (wmax + wmin ) × exp − 20 × ( )6 (3)
T
where T is the maximum number of time steps, usually wmax = 0.9, wmin = 0.4.
• The learning factor (c1 , c2 ) varies according to w
c1 and c2 in the velocity update formula determine the size of the amount of learning
of the particle in the optimal position. c1 is used to adjust the amount of self-learning of
the particle and c2 is used to adjust the amount of social learning of the particle, and the
change of the learning factor coefficient is used to change the trajectory of the particle. In
this paper, referring to the previous summary, the adjustment strategy is better when the
learning factor and inertia weights are a nonlinear function. The coefficient combination is
A = 0.5, B = 1, C = 0.5, and the formula is described as follows.
C1 = Aw2 + Bw + C
(4)
C2 = 2.5 − C1
2.2.2. Position Update Policy
The convergence and convergence speed of the algorithm are greatly related to the
position weighting factor, and the core parameter-tuning strategy only considers improving
the velocity update without considering the position update. In order to control the
influence of velocity on position, the constraint factor (α) is added to the position update
formula, and α is introduced in order to achieve the weight of the control velocity to reduce
blindness in the search process and improve the convergence rate.
• The Constraint Factors
In basic PSO, the new position of a particle is equal to its current position plus the
current velocity, but the position vector and velocity vector cannot be added directly, so
there must be a constraint factor between the two in the position update formula, and the
constraint factor in the traditional PSO algorithm is equal to 1. α guides the particle to
hover around the best position, and the improvement of α controls the influence of velocity
on position so that the convergence of the algorithm is better improved. α based on w
change is used in this paper which, in the early stage, is influenced by particle velocity and
has strong exploration ability. In the later stage, it is less influenced by particle velocity and
has strong local search ability.
xij (t + 1) = xij (t) + αvij (t + 1)
(5)
α = 0.1 + w
2.2.3. Model of APSO/DU
The flow of the APSO/DU is shown in Figure 2.
194
Electronics 2023, 12, 491
Figure 2. The flow of the APSO/DU.
2.3. Numerical Experiments and Analyses
In order to test the performance of the APSO/DU algorithm, three commonly used
test functions were selected for the experiment. The test functions are shown in Table 1.
Table 1. Three test functions.
Selection Function Search Range Global Optimum
D
Sphere f 1 = ∑ xi2 [−100, 100] min f 1 = 0
i =1
D D
Schwefelsp2.22 f 2 = ∑ | xi | + ∏ | xi | [−10, 10] min f 2 = 0
i =1 i =1
D D
Griewank f3 = 1 x
∑ xi2 − ∏ cos √ii + 1 [−600, 600] min f 3 = 0
4000
i =1 i =1
• Contrast algorithms
The parameters of each PSO algorithm are shown in Table 2. To facilitate the compari-
son of the effectiveness of the APSO/DU algorithm, this paper chose to compare it with
three classical adaptive improved PSO algorithms: PSO-TVIW; PSO-TVAC; and PSOCF.
The parameter settings summarized in the literature of Kyle Robert Harrison (2018) [45]
were also used, where the time-varying inertia weight values of the PSO-TVIW algorithm
are set according to the study in Harrison’s paper. The PSO-TVIW algorithm is also known
as the standard particle swarm algorithm. The PSO-TVAC algorithm with time-varying
acceleration coefficient adjusts the values of the w, c1 , and c2 parameters and introduces
six additional control parameters. Clerc’s proposed PSO algorithm with shrinkage factor
(PSOCF) has good convergence, but its computational accuracy is not high and its stability
is not as good as that of standard PSO, so Eberhart proposed to limit the speed param-
eter Vmax = Xmax of the algorithm so as to improve the convergence speed and search
performance of the algorithm, and the PSOCF algorithm used this improved method for
comparison experiments.
The new algorithm is based on a combination of two strategies. In order to verify
whether the combination of two strategies is superior to one strategy, namely PSO/D
(which updates only the core parameters), the formula and parameters are detailed in
Section 2.2.1. Additionally, PSO/U, which only updates the velocity update formula, is
195
Electronics 2023, 12, 491
improved is by adding a constraint factor to the position formula, which needs to be
combined with inertia weights. The basic particle swarm does not contain inertia weights,
so the standard particle swarm algorithm (PSO-TVIW), by adding a constraint factor, can
verify that the combination of update strategies proposed in this paper is superior.
Table 2. Parameter setting of each PSO algorithm.
Algorithm w c1 c2
PSO-TVAC [0.4, 0.9] [0.5, 2.5] [0.5, 2.5]
PSO-TVIW [0.4, 0.9] 1.49618 1.49618
PSOCF 0.729 2.8 1.3
PSO/D [0.4, 0.9] [0.695, 1.805] [0.695, 1.805]
PSO/U [0.4, 0.9] 1.49618 1.49618
APSO/DU [0.4, 0.9] [0.695, 1.805] [0.695, 1.805]
In the experiments, to ensure fairness in the testing of each algorithm, different
PSO algorithms were set with the same population size (N = 30), maximum number of
iterations (Tmax = 500), and variable dimension (D = 15). Each algorithm was run 30 times,
and the test results are shown in Table 3. The bold part of the text indicates the best
optimization results.
• Test Results:
Table 3. Optimization results of six algorithms.
Function Contrast Algorithms fmin fmean fmax fsd
PSO − TVAC 2.26 × 10−3 6.84 × 10−3 1.37 × 10−2 2.86 × 10−3
PSO − TVIW 1.22 × 10−3 5.47 × 10−3 1.16 × 10−2 2.65 × 10−3
PSOCF 1.65 × 10−1 1.90 6.08 1.69
F1
PSO/D 9.58 × 10−5 4.92 × 10−3 3.83 × 10−2 8.08 × 10−3
PSO/U 3.36 × 10−3 8.90 × 10−3 2.10 × 10−2 3.68 × 10−3
APSO/DU 4.57 × 10−5 2.43 × 10−3 1.37 × 10−2 2.54 × 10−3
PSO − TVAC 2.0110 3.8211 7.2185 0.9937
PSO − TVIW 1.7082 3.3503 5.0343 0.7761
PSOCF 0.8047 2.5967 4.6286 0.9490
F2
PSO/D 0.4045 1.3387 3.0566 3.0566
PSO/U 2.1516 3.6639 5.1408 5.1408
APSO/DU 0.4246 1.3033 2.5632 0.5253
PSO − TVAC 1.2174 1.8248 2.9463 4.03 × 10−1
PSO − TVIW 1.2724 1.9454 2.8534 4.06 × 10−1
PSOCF 1.0061 1.1614 1.5375 1.49 × 10−1
F3
PSO/D 1.0018 1.0229 1.0959 2.57 × 10−2
PSO/U 1.5057 2.1557 3.3043 4.79 × 10−1
APSO/DU 0.8140 1.0119 1.0913 4.18 × 10−2
It can be seen from Table 3 that APSO/DU outperforms the other algorithms overall.
(i) The APSO/DU algorithm is compared with the classical adaptive algorithms (PSO-
TVAC, PSO-TVIW, and PSOCF). APSO/DU takes the smallest optimal value in the three
test functions and is closest to the optimal solution. The standard deviation is also the best
among the three algorithms, which indicates that APSO/DU has a stable performance.
(ii) To verify whether the combination of two strategies is better than one, the APSO/DU
algorithm is compared with a single-strategy algorithm (PSO/D and PSO/U), and the
results of PSO/U and APSO/DU are closer to each other. In the Griewank function,
APSO/DU takes the smallest optimal value and is closest to the optimal solution with a
standard deviation not much different from PSO/D. On balance, the APSO/DU algorithm
outperforms the comparison algorithm.
196
Electronics 2023, 12, 491
In order to reflect more intuitively on the solution accuracy and convergence speed of
each algorithm, the variation curves of the fitness values when each algorithm solves the
three test functions are given in Figure 3. The horizontal coordinate indicates the number
of iterations, and the vertical coordinate indicates the fitness value.
Figure 3. Curves of the convergence process of the benchmark test functions F1–F3.
The average convergence curves of each algorithm for the three tested functions are
given in Figure 3. The single-peak test function shows whether the algorithm achieves
the target value of the search accuracy. On single-peak functions F1 (sphere) and F2
(Schwefel’sp2.22), the relatively high convergence accuracy is achieved by the APSO/DU
algorithm and the PSO/D algorithm, with PSOCF easily falling into local optimality.
A multi-peaked test function can test the global searchability of an algorithm. In
multi-peak function F3 (Griewank) optimization, the APSO/DU algorithm performs best,
followed by the PSO/D algorithm and the PSOCF algorithm, in that order. Among the dif-
ferent functions, APSO/DU has the fastest convergence speed and the highest convergence
accuracy and, collectively, the APSO/DU algorithm is the best in terms of finding the best
results and showing better stability.
3. Portfolio Optimization Problem
3.1. Related Definitions
The essential parameters in the POP are expected return and risk, and investors usually
prefer to maximize return and minimize risk. Assuming a fixed amount of money to buy
n stocks, the POP can be described as how to choose the proportion of investments that
minimizes ρ the investor’s risk (variance or standard deviation) given a minimum rate
of return, or how to choose the proportion of investments that maximizes the investor’s
return given a level of risk.
The investor holds fixed assets invested in n stocks Ai (i = 1, 2, .., m), let Ri be the
return rate of Ai , which is a random variable. μi is the expected return on stock Ai . Let
E( Ri ) denote the mathematical expectation of a random variable R. Define
μi = E ( R i ) (6)
In a certain period, the stock return is the relative number of the difference between
the opening and closing prices of that stock, where Vij is the return of stock i in period t, as
in Equation (7).
pi,t − pi,t−1
Vij = , i = 1, 2, . . . , T (7)
pi,t−1
where pi,t and pi,t−1 are the closing prices of stock i in periods t and t − 1, respectively. The
expected return on the ith stock is given by Equation (8)
1
μi =
T ∑ Tj=1 Vij (8)
197
Electronics 2023, 12, 491
3.2. Mean-Semivariance Model
A large number of empirical analysis results show that asset returns are characterized
by spikes and thick tails, which contradicts the assumption that asset returns are normally
distributed in the standard mean-variance model. Additionally, the variance reflects the
degree of deviation between actual returns and expected returns, while actual losses (loss
risk) are fluctuations below the mean of returns. Thus, the portfolio optimization model
based on the lower half-variance risk function is more realistic. Equations (9)–(12) present
the mean-semivariance model. Assume that the short selling of assets is not allowed.
1 − 2
min f =
T ∑ tT=1 [(∑ im=1 xi rit − ρ) ] (9)
Subject to
E (μ P ) = ∑ im=1 μi xi ≥ ρ (10)
∑ im=1 0 ≤ xi ≤ 1, i = 1, 2, . . . , m (11)
∑ im=1 xi = 1 (12)
where:
m is the number of stocks in the portfolio;
ρ is the rate of return required by the investor;
xi is the proportion (0 ≤ xi ≤ 1) of the portfolio held in assets i (i = 1, 2, . . . , m);
μi is the mean return of asset i in the targeted period;
μ p is the mean return of the portfolio in the targeted period.
Equation (9) is the objective function of the model and represents minimizing the risk
of the portfolio (the lower half of the variance); Equation (10) ensures that the return of
the portfolio is greater than the investor’s expected return ρ; and Equations (11) and (12)
indicate that the variables take values in the range [0, 1], and the total investment ratio is 1.
4. Case Analysis
4.1. Experiment Settings
(1) Individual composition
The vector X = ( X1 , X2 , . . . , Xn ) represents a portfolio strategy whose ith dimensional
component xi represents the allocation of funds to hold the ith stock in that portfolio,
namely the weight of that asset in the portfolio.
(2) Variable constraint processing
Equation (10): the feasibility of the particle is checked after the initial assignment of
the algorithm and the update of the position vector and if it does not work, the position
vector of the particle is recalculated until it is satisfied before the calculation of the objective
function is carried out.
Equation (11): the variables take values in the interval [0, 1] and the iterative process
uses the boundary to restrict within the interval.
Equation (12): variables on a non-negative constraint basis, sets = x1 + x2 + . . . + xn
when s = 0, so that all variables in the portfolio are 1n ; when s = 0, let xi = xni ,
i = 1, 2, . . . , n.
(3) Parameter values
The particle dimension D is the number of stocks included in the portfolio, and
the number of stocks selected in this paper is 15, hence D = 15. The parameters of this
experimental algorithm are set as described in Section 2.3. of this paper, and the results
show the average of 30 independent runs of each algorithm. All PSO algorithms in this
paper were written in Python and run on a Windows system for testing.
198
Electronics 2023, 12, 491
4.2. Sample Selection
Regarding the selection of stock data, firstly, recent stock data should be selected for
analysis to have a certain practical reference value. Secondly, the number of shares is too
small to be credible, and the number of shares is too large for the average investor to be
distracted with at the same time. Finally, Markowitz’s investment theory states that the risk
of a single asset is fixed and cannot be reduced on its own, whereas investing in portfolio
form diversifies risk without reducing returns. The lower the correlation between any two
assets in a portfolio (preferably negative), the more significant the reduction in overall
portfolio unsystematic risk [47]. Some methods can be used to solve this problem [48–52].
Based on the above considerations, 30 stocks from different sectors were selected from
Choice Financial Terminal, with a time range of 1 January 2019 to 31 December 2021, for a
total of 155 weeks of closing price data. Correlation analysis was conducted on the stock
data, and 15 stocks with relatively low correlation coefficients were selected for empirical
analysis. The price trend charts and correlation coefficients for the 15 stocks are given in
Figures 4 and 5.
Figure 4 shows the weekly closing price trend for the 15 stocks data, which provides a
visual indication of the trend in stock data. Stocks vary widely in price from one another,
with 600612 being the most expensive. As shown in Figure 5, the fifteen stocks have low
correlations, with only two portfolios having correlation coefficients greater than 0.5 for
any two stocks. Stock 6 and Stock 8 have strong correlations with Stock 12, with correlation
coefficients of 0.6 and 0.5, respectively, while all other correlations are below 0.5. Stock 4
and Stock 14 have the lowest correlation, with a correlation coefficient of −0.045. After
calculation, the correlation of the stock data in this paper is low, and the mean correlation
coefficient is only 0.198. The lower the correlation between stocks is, the more effective
the portfolio choice is in reducing unsystematic risk, thus indicating that investing with a
portfolio strategy is effective in reducing risk.
Figure 4. The weekly closing price trend for the 15 stocks data.
199
Electronics 2023, 12, 491
Figure 5. Correlation matrix of 15 stocks.
Table 4 gives the basic statistical characteristics of 15 stocks for 2019–2021, and the
returns are the weekly averages of the relative number of closing prices of the stock data.
The p-values for most of the stock returns in Table 4 are less than 0.05, which should reject
the original hypothesis and indicates that the stock returns do not conform to a normal
distribution at the 5% significance level. The p-values for 600793 and 600135 are greater than
0.05 at a level that does not present significance and cannot reject the original hypothesis,
so the data satisfies a normal distribution.
Table 4. Basic characteristics and normality test of 15 stocks from 2019 to 2021.
NO. Code Price/(yuan) Return (%) Std Prob Conclusion at the (5%) Level
1 600612 47.930 0.131 0.043 0.003 *** Distribution not normally distributed
2 603568 24.329 0.408 0.055 0.000 *** Distribution not normally distributed
3 600690 21.992 0.662 0.052 0.000 *** Distribution not normally distributed
4 600793 14.396 0.288 0.087 0.060 * Normality cannot be ruled out
5 000625 13.432 0.810 0.082 0.000 *** Distribution not normally distributed
6 600019 6.526 0.207 0.046 0.000 *** Distribution not normally distributed
7 600135 7.158 0.368 0.060 0.069 * Normality cannot be ruled out
8 600497 4.558 0.253 0.053 0.030 ** Distribution not normally distributed
9 601111 8.095 0.259 0.049 0.000 *** Distribution not normally distributed
10 600107 7.522 0.221 0.075 0.000 *** Distribution not normally distributed
11 002327 7.704 0.208 0.038 0.000 *** Distribution not normally distributed
12 601225 9.689 0.432 0.049 0.000 *** Distribution not normally distributed
13 002737 14.959 0.204 0.042 0.000 *** Distribution not normally distributed
14 002780 18.442 0.474 0.063 0.000 *** Distribution not normally distributed
15 603050 13.506 0.304 0.060 0.000 *** Distribution not normally distributed
Note: ***, **, and * represent the significance level of 1%, 5%, and 10%, respectively.
Figure 6 shows the histogram of the normality test for 15 stocks. If the normality plot is
roughly bell-shaped (high in the middle and low at the ends), the data are largely accepted
as normally distributed. It can be seen from the figure that the normal distribution plots
of the 600793 and 600135 stock data roughly show a bell shape, which is consistent with
normal distribution. However, the normal distribution of most stocks does not show a bell
shape and does not conform to normal distribution.
200
Electronics 2023, 12, 491
600612 603568 600690
600793 000625 600019
600135 600497 601111
600107 002327 601225
002737 002780 603050
Figure 6. Histogram of normality test.
It is difficult for all the stock data to conform to the assumption that asset returns are
normally distributed in MV. Secondly, the real loss refers to the fluctuation below the mean
of returns; thus, the portfolio model based on the lower half-variance risk function is more
realistic, so the MSV model is used for empirical analysis later in the paper.
4.3. Interpretation of Result
In order to verify the effectiveness of the semi-variance risk measure in practice, six
different levels of return (0.005 to 0.0030) are set in this paper. Table 5 gives the risk
values obtained by different algorithms at the same return level, and the best results are
identified in bold font. A visualization of the Pareto frontier (PF) obtained by solving the
201
Electronics 2023, 12, 491
four algorithms is given in Figure 7. The optimal investment ratios derived from each
algorithm solved at the expected return level of 0.03 are given in Table 6 to visually compare
the effectiveness of the APSO/DU algorithm in solving the MSVPOP.
Table 5. Experimental results of five algorithms.
MSV
NO. μ
PSO-TVIW PSO-TVAC PSOCF APSO/DU
1 0.0030 3.70 ×10−4 3.82 × 10−4 3.63 × 10−4 3.33 × 10−4
2 0.0025 3.52 × 10−4 3.69 × 10−4 3.57 × 10−4 3.16 × 10−4
3 0.0020 3.34 × 10−4 3.48 × 10−4 3.37 × 10−4 3.08 × 10−4
4 0.0015 3.20 × 10−4 3.37 × 10−4 3.27 × 10−4 3.02 × 10−4
5 0.0010 3.16 × 10−4 3.26 × 10−4 3.10 × 10−4 2.84 × 10−4
6 0.0005 2.99 × 10−4 3.04 × 10−4 2.95 × 10−4 2.78 × 10−4
Figure 7. The obtained PF by five algorithms.
Table 6. The optimal investment ratio solved by each algorithm at μ = 0.03.
Code PSO-TVIW PSO-TVAC PSOCF APSO/DU
1 600612 0.1166 0.0782 0.0932 0.0729
2 603568 0.0000 0.0655 0.0817 0.1129
3 600690 0.1015 0.0861 0.0055 0.0277
4 600793 0.0000 0.0832 0.0062 0.0168
5 000625 0.0000 0.0186 0.0360 0.0078
6 600019 0.0767 0.0504 0.0091 0.0692
7 600135 0.0692 0.0317 0.1147 0.0038
8 600497 0.0000 0.0812 0.0000 0.0031
9 601111 0.0563 0.0802 0.0573 0.0611
10 600107 0.1311 0.0589 0.0518 0.0081
11 002327 0.1057 0.0760 0.1935 0.1773
12 601225 0.0276 0.0839 0.1324 0.0992
13 002737 0.1338 0.0718 0.0019 0.1273
14 002780 0.1322 0.0746 0.1378 0.0725
15 603050 0.0493 0.0596 0.0790 0.1402
MSV 3.70 × 10−4 3.82 × 10−4 3.63 × 10−4 3.33 × 10−4
Table 5 and Figure 7 show that as returns increase, the portfolio’s risk also increases,
in line with the law of high returns accompanied by high risk in the equity market. Taking
the expected return u = 0.003 as an example, APSO/DU has the smallest value of risk
(2.78 × 10−4 ) and the PSO-TVAC algorithm has the largest value of risk (3.82 × 10−4 ), so
202
Electronics 2023, 12, 491
the portfolio solved by the APSO/DU algorithm is chosen at the expected return level of
0.03, corresponding to the smallest value of risk. A sensible person should choose this
portfolio. Similar to the other return levels analyzed, the APSO/DU algorithm proposed
in this paper is always lower than the results calculated by the other algorithms. The
APSO/DU algorithm calculates a lower value of risk than the three classical adaptive
improved particle swarm algorithms when the expected returns are the same, indicating
that the combination of improved particle swarm solutions obtains relatively better results
at the same expected return, and APSO/DU has stronger global search capability and more
easily finds the optimal global solution.
The optimal investment ratios derived from each algorithm solved at the expected re-
turn level of 0.03 are given in Table 6 to visually compare the effectiveness of the APSO/DU
algorithm in solving the MSVPOP.
5. Conclusions
In order to cope with the POPMSV challenge well, a multi-strategy adaptive particle
swarm optimization, namely APSO/DU, was developed, which has the following two ad-
vantages. Firstly, the variable constraint (1) is set to better represent the stock selection, and
asset weights of the solution in the POP help to cope with the MSVPOP challenge efficiently.
Secondly, an improved particle swarm optimization algorithm (APSO/DU) with adaptive
parameters was proposed by adopting a dual-update strategy. It can adaptively adjust the
relevant parameters so that the search behavior of the algorithm can match the current
search environment to avoid falling into local optimality and effectively balance global
and local search. The sole adjustment of w and c1 and c2 would weaken the uniformity of
the algorithm’s evolutionary process and make it difficult to adapt to complex nonlinear
optimization, so a dual dynamic adaptation mechanism is chosen to adjust the core pa-
rameters. The APSO/DU algorithm is more adaptable to nonlinear complex optimization
problems, improving solution accuracy and approximating the global PF. The results show
that APSO/DU exhibits stronger solution accuracy than the comparison algorithm, i.e., the
improved algorithm finds the portfolio with the least risk at the same level of return, more
closely approximating PF. The above research results can be used for investors to invest in
low-risk portfolios with valuable suggestions with good practical applications.
Author Contributions: Conceptualization, Y.S. and Y.L.; methodology, Y.S. and W.D.; software, Y.L.;
validation, H.C. and Y.L.; resources, Y.S.; data curation, Y.S.; writing—original draft preparation,
Y.S. and Y.L.; writing—review and editing, H.C.; visualization, Y.S.; supervision, H.C.; project
administration, H.C.; funding acquisition, H.C. and W.D. All authors have read and agreed to the
published version of the manuscript.
Funding: This work was supported by the National Natural Science Foundation of China (61976124,
61976125, U2133205), the Yantai Key Research and Development Program (2020YT06000970), Wealth
management characteristic construction project of Shandong Technology and Business University
(2022YB10), the Natural Science Foundation of Sichuan Province under Grant 2022NSFSC0536;
and the Open Project Program of the Traction Power State Key Laboratory of Southwest Jiaotong
University (TPL2203).
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: Not applicable.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Markowitz, H. Portfolio selection. J. Financ. 1952, 7, 77–79.
2. Markowitz, H. Portfolio Selection: Efficient Diversification of Investments; Wiley: New York, NY, USA, 1959.
3. Xu, G.; Bai, H.; Xing, J.; Luo, T.; Xiong, N.N.; Cheng, X.; Liu, S.; Zheng, X. SG-PBFT: A secure and highly efficient distributed
blockchain PBFT consensus algorithm for intelligent Internet of vehicles. J. Parallel Distrib. Comput. 2022, 164, 1–11. [CrossRef]
203
Electronics 2023, 12, 491
4. Yu, C.; Liu, C.; Yu, H.; Song, M.; Chang, C.-I. Unsupervised Domain Adaptation with Dense-Based Compaction for Hyperspectral
Imagery. IEEE J. Sel. Top. Appl. Earth Obs. Remote Sens. 2021, 14, 12287–12299. [CrossRef]
5. Jin, T.; Yang, X. Monotonicity theorem for the uncertain fractional differential equation and application to uncertain financial
market. Math. Comput. Simul. 2021, 190, 203–221. [CrossRef]
6. Li, N.; Huang, W.; Guo, W.; Gao, G.; Zhu, Z. Multiple Enhanced Sparse Decomposition for Gearbox Compound Fault Diagnosis.
IEEE Trans. Instrum. Meas. 2019, 69, 770–781. [CrossRef]
7. Bi, J.; Zhou, G.; Zhou, Y.; Luo, Q.; Deng, W. Artificial Electric Field Algorithm with Greedy State Transition Strategy for Spherical
Multiple Traveling Salesmen Problem. Int. J. Comput. Intell. Syst. 2022, 15, 5. [CrossRef]
8. Zhong, K.; Zhou, G.; Deng, W.; Zhou, Y.; Luo, Q. MOMPA: Multi-objective marine predator algorithm. Comput. Methods Appl.
Mech. Eng. 2021, 385, 114029.
9. Venkataraman, S.V. A remark on mean: Emivariance behaviour: Downside risk and capital asset pricing. Int. J. Financ. Econ. 2021.
[CrossRef]
10. Kumar, R.R.; Stauvermann, P.J.; Samitas, A. An Application of Portfolio Mean-Variance and Semi-Variance Optimization
Techniques: A Case of Fiji. J. Risk Financial Manag. 2022, 15, 190. [CrossRef]
11. Wu, Q.; Gao, Y.; Sun, Y. Research on Probability Mean-Lower Semivariance-Entropy Portfolio Model with Background Risk.
Math. Probl. Eng. 2020, 2020, 2769617. [CrossRef]
12. Wu, X.; Gao, A.; Huang, X. Modified Bacterial Foraging Optimization for Fuzzy Mean-Semivariance-Skewness Portfolio Selection.
In Proceedings of the International Conference on Swarm Intelligence, Cham, Switzerland, 13 July 2020; pp. 335–346. [CrossRef]
13. Ivanova, M.; Dospatliev, L. Constructing of an Optimal Portfolio on the Bulgarian Stock Market Using Hybrid Genetic Algorithm
for Pre and Post COVID-19 Periods. Asian-Eur. J. Math. 2022, 15, 2250246. [CrossRef]
14. Sun, Y.; Ren, H. A GD-PSO Algorithm for Smart Transportation Supply Chain ABS Portfolio Optimization. Discret. Dyn. Nat. Soc.
2021, 2021, 6653051. [CrossRef]
15. Zhao, H.; Chen, Z.G.; Zhan, Z.H.; Kwong, S.; Zhang, J. Multiple populations co-evolutionary particle swarm optimization for
multi-objective cardinality constrained portfolio optimization problem. Neurocomputing 2021, 430, 58–70.
16. Deng, X.; He, X.; Huang, C. A new fuzzy random multi-objective portfolio model with different entropy measures using fuzzy
programming based on artificial bee colony algorithm. Eng. Comput. 2021, 39, 627–649. [CrossRef]
17. Dhaini, M.; Mansour, N. Squirrel search algorithm for portfolio optimization. Expert Syst. Appl. 2021, 178, 114968. [CrossRef]
18. Shi, Y.; Eberhart, R.C. Empirical study of particle swarm optimization. In Proceedings of the 1999 Congress on Evolutionary
Computation-CEC99 (Cat. No. 99TH8406), Washington, DC, USA, 6–9 July 1999; pp. 1945–1950. [CrossRef]
19. Shi, Y.H.; Eberhart, R.C. A modified particle swarm optimizer. In Proceedings of the 1998 IEEE International Conference on
Evolutionary Computation, Anchorage, AK, USA, 4–9 May 1998; pp. 69–73.
20. Xiao, Y.; Shao, H.; Han, S.; Huo, Z.; Wan, J. Novel Joint Transfer Network for Unsupervised Bearing Fault Diagnosis from
Simulation Domain to Experimental Domain. IEEE/ASME Trans. Mechatron. 2022, 27, 5254–5263. [CrossRef]
21. Yan, S.; Shao, H.; Xiao, Y.; Liu, B.; Wan, J. Hybrid robust convolutional autoencoder for unsupervised anomaly detection of
machine tools under noises. Robot. Comput. Manuf. 2023, 79, 102441. [CrossRef]
22. Deng, W.; Zhang, L.; Zhou, X.; Zhou, Y.; Sun, Y.; Zhu, W.; Chen, H.; Deng, W.; Chen, H.; Zhao, H. Multi-strategy particle swarm
and ant colony hybrid optimization for airport taxiway planning problem. Inf. Sci. 2022, 612, 576–593. [CrossRef]
23. Wei, Y.; Zhou, Y.; Luo, Q.; Deng, W. Optimal reactive power dispatch using an improved slime mould algorithm. Energy Rep.
2021, 7, 8742–8759. [CrossRef]
24. Song, Y.; Cai, X.; Zhou, X.; Zhang, B.; Chen, H.; Li, Y.; Deng, W.; Deng, W. Dynamic hybrid mechanism-based differential
evolution algorithm and its application. Expert Syst. Appl. 2023, 213, 118834. [CrossRef]
25. Jin, T.; Zhu, Y.; Shu, Y.; Cao, J.; Yan, H.; Jiang, D. Uncertain optimal control problem with the first hitting time objective and
application to a portfolio selection model. J. Intell. Fuzzy Syst. 2022. [CrossRef]
26. Zhang, X.; Wang, H.; Du, C.; Fan, X.; Cui, L.; Chen, H.; Deng, F.; Tong, Q.; He, M.; Yang, M.; et al. Custom-Molded Offloading
Footwear Effectively Prevents Recurrence and Amputation, and Lowers Mortality Rates in High-Risk Diabetic Foot Patients: A
Multicenter, Prospective Observational Study. Diabetes Metab. Syndr. Obesity Targets Ther. 2022, 15, 103–109. [CrossRef]
27. Zhao, H.; Zhang, P.; Zhang, R.; Yao, R.; Deng, W. A novel performance trend prediction approach using ENBLS with GWO. Meas.
Sci. Technol. 2023, 34, 025018. [CrossRef]
28. Ren, Z.; Han, X.; Yu, X.; Skjetne, R.; Leira, B.J.; Sævik, S.; Zhu, M. Data-driven simultaneous identification of the 6DOF dynamic
model and wave load for a ship in waves. Mech. Syst. Signal Process. 2023, 184, 109422. [CrossRef]
29. Zhang, Z.; Huang, W.; Liao, Y.; Song, Z.; Shi, J.; Jiang, X.; Shen, C.; Zhu, Z. Bearing fault diagnosis via generalized logarithm
sparse regularization. Mech. Syst. Signal Process. 2021, 167, 108576. [CrossRef]
30. Yu, Y.; Hao, Z.; Li, G.; Liu, Y.; Yang, R.; Liu, H. Optimal search mapping among sensors in heterogeneous smart homes. Math.
Biosci. Eng. 2022, 20, 1960–1980. [CrossRef]
31. Chen, H.Y.; Fang, M.; Xu, S. Hyperspectral remote sensing image classification with CNN based on quantum genetic-optimized
sparse representation. IEEE Access 2020, 8, 99900–99909. [CrossRef]
32. Zhao, H.; Yang, X.; Chen, B.; Chen, H.; Deng, W. Bearing fault diagnosis using transfer learning and optimized deep belief
network. Meas. Sci. Technol. 2022, 33, 065009. [CrossRef]
204
Electronics 2023, 12, 491
33. Xu, J.; Zhao, Y.; Chen, H.; Deng, W. ABC-GSPBFT: PBFT with grouping score mechanism and optimized consensus process for
flight operation data-sharing. Inf. Sci. 2023, 624, 110–127. [CrossRef]
34. Duan, Z.; Song, P.; Yang, C.; Deng, L.; Jiang, Y.; Deng, F.; Jiang, X.; Chen, Y.; Yang, G.; Ma, Y.; et al. The impact of hyperglycaemic
crisis episodes on long-term outcomes for inpatients presenting with acute organ injury: A prospective, multicentre follow-up
study. Front. Endocrinol. 2022, 13, 1057089. [CrossRef]
35. Chen, H.; Li, C.; Mafarja, M.; Heidari, A.A.; Chen, Y.; Cai, Z. Slime mould algorithm: A comprehensive review of recent variants
and applications. Int. J. Syst. Sci. 2022, 54, 204–235. [CrossRef]
36. Liu, Y.; Heidari, A.A.; Cai, Z.; Liang, G.; Chen, H.; Pan, Z.; Alsufyani, A.; Bourouis, S. Simulated annealing-based dynamic
step shuffled frog leaping algorithm: Optimal performance design and feature selection. Neurocomputing 2022, 503, 325–362.
[CrossRef]
37. Dong, R.; Chen, H.; Heidari, A.A.; Turabieh, H.; Mafarja, M.; Wang, S. Boosted kernel search: Framework, analysis and case
studies on the economic emission dispatch problem. Knowl. Based Syst. 2021, 233, 107529. [CrossRef]
38. Chen, M.; Shao, H.; Dou, H.; Li, W.; Liu, B. Data Augmentation and Intelligent Fault Diagnosis of Planetary Gearbox Using
ILoFGAN Under Extremely Limited Samples. IEEE Trans. Reliab. 2022. [CrossRef]
39. Tian, C.; Jin, T.; Yang, X.; Liu, Q. Reliability analysis of the uncertain heat conduction model. Comput. Math. Appl. 2022, 119,
131–140. [CrossRef]
40. Thakkar, A.; Chaudhari, K. A Comprehensive Survey on Portfolio Optimization, Stock Price and Trend Prediction Using Particle
Swarm Optimization. Arch. Comput. Methods Eng. 2020, 28, 2133–2164. [CrossRef]
41. Harrison, K.R.; Engelbrecht, A.P.; Ombuki-Berman, B.M. Self-adaptive particle swarm optimization: A review and analysis of
convergence. Swarm Intell. 2018, 12, 187–226. [CrossRef]
42. Boudt, K.; Wan, C. The effect of velocity sparsity on the performance of cardinality constrained particle swarm optimization.
Optim. Lett. 2019, 14, 747–758. [CrossRef]
43. Clerc, M. Particle Swarm Optimization; John Wiley & Sons: Hoboken, NJ, USA, 2010.
44. Zhang, W.; Jin, Y.; Li, X.; Zhang, X. A simple way for parameter selection of standard particle swarm optimization. In Proceedings
of the International Conference on Artificial Intelligence and Computational Intelligence, Berlin, Germany, 11–13 November 2011;
pp. 436–443.
45. Huang, C.; Zhou, X.B.; Ran, X.J.; Liu, Y.; Deng, W.Q.; Deng, W. Co-evolutionary competitive swarm optimizer with three-phase
for large-scale complex optimization problem. Inf. Sci. 2023, 619, 2–18. [CrossRef]
46. Liu, H.; Zhang, X.W.; Tu, L.P. A modified particle swarm optimization using adaptive strategy. Expert Syst. Appl. 2020, 152,
113353. [CrossRef]
47. Silva, Y.L.T.; Herthel, A.B.; Subramanian, A. A multi-objective evolutionary algorithm for a class of mean-variance portfolio
selection problems. Expert Syst. Appl. 2019, 133, 225–241. [CrossRef]
48. Heidari, A.A.; Mirjalili, S.; Faris, H.; Aljarah, I.; Mafarja, M.; Chen, H. Harris hawks optimization: Algorithm and applications.
Futur. Gener. Comput. Syst. 2019, 97, 849–872. [CrossRef]
49. Li, S.; Chen, H.; Wang, M.; Heidari, A.A.; Mirjalili, S. Slime mould algorithm: A new method for stochastic optimization. Future
Gener. Comput. Syst. 2020, 111, 300–323. [CrossRef]
50. Yu, C.; Zhou, S.; Song, M.; Chang, C.-I. Semisupervised Hyperspectral Band Selection Based on Dual-Constrained Low-Rank
Representation. IEEE Geosci. Remote Sens. Lett. 2021, 19, 5503005. [CrossRef]
51. Li, W.; Zhong, X.; Shao, H.; Cai, B.; Yang, X. Multi-mode data augmentation and fault diagnosis of rotating machinery using
modified ACGAN designed with new framework. Adv. Eng. Inform. 2022, 52, 101552. [CrossRef]
52. He, Z.Y.; Shao, H.D.; Wang, P.; Janet, L.; Cheng, J.S.; Yang, Y. Deep transfer multi-wavelet auto-encoder for intelligent fault
diagnosis of gearbox with few target training samples. Knowl.-Based Syst. 2019, 191, 105313. [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
205
electronics
Article
An Improved Whale Optimizer with Multiple Strategies for
Intelligent Prediction of Talent Stability
Hong Li 1 , Sicheng Ke 1 , Xili Rao 1 , Caisi Li 1 , Danyan Chen 1 , Fangjun Kuang 2, *, Huiling Chen 3, *, Guoxi Liang 4, *
and Lei Liu 5
1 Wenzhou Vocational College of Science and Technology, Wenzhou 325006, China
2 School of Information Engineering, Wenzhou Business College, Wenzhou 325035, China
3 College of Computer Science and Artificial Intelligence, Wenzhou University, Wenzhou 325035, China
4 Department of Artificial Intelligence, Wenzhou Polytechnic, Wenzhou 325035, China
5 College of Computer Science, Sichuan University, Chengdu 610065, China
* Correspondence: [email protected] (F.K.); [email protected] (H.C.); [email protected] (G.L.)
Abstract: Talent resources are a primary resource and an important driving force for economic
and social development. At present, researchers have conducted studies on talent introduction,
but there is a paucity of research work on the stability of talent introduction. This paper presents
the first study on talent stability in higher education, aiming to design an intelligent prediction
model for talent stability in higher education using a kernel extreme learning machine (KELM)
and proposing a differential evolution crisscross whale optimization algorithm (DECCWOA) for
optimizing the model parameters. By introducing the crossover operator, the exchange of information
regarding individuals is facilitated and the problem of dimensional lag is improved. Differential
evolution operation is performed in a certain period of time to perturb the population by using the
differences in individuals to ensure the diversity of the population. Furthermore, 35 benchmark
functions of 23 baseline functions and CEC2014 were selected for comparison experiments in order
Citation: Li, H.; Ke, S.; Rao, X.; Li, C.; to demonstrate the optimization performance of the DECCWOA. It is shown that the DECCWOA
Chen, D.; Kuang, F.; Chen, H.; Liang, can achieve high accuracy and fast convergence in solving both unimodal and multimodal functions.
G.; Liu, L. An Improved Whale In addition, the DECCWOA is combined with KELM and feature selection (DECCWOA-KELM-FS)
Optimizer with Multiple Strategies to achieve efficient talent stability intelligence prediction for universities or colleges in Wenzhou.
for Intelligent Prediction of Talent The results show that the performance of the proposed model outperforms other comparative
Stability. Electronics 2022, 11, 4224.
algorithms. This study proposes a DECCWOA optimizer and constructs an intelligent prediction of
https://doi.org/10.3390/
talent stability system. The designed system can be used as a reliable method of predicting talent
electronics11244224
mobility in higher education.
Academic Editor: Maciej Ławryńczuk
Keywords: swarm intelligence; whale optimization algorithm; extreme learning machine; talent
Received: 18 November 2022
stability prediction; machine learning
Accepted: 15 December 2022
Published: 18 December 2022
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in 1. Introduction
published maps and institutional affil-
Talent resources are the core resources on which universities rely for survival and
iations.
development. A reasonable flow of talent can stimulate the vitality of the organization,
improve the quality of talent, form a virtuous cycle and promote the complementary
advantages of talent resources among universities. However, the “war for talents” against
Copyright: © 2022 by the authors. the background of “double tops” has led to the disorderly and utilitarian flow of talents in
Licensee MDPI, Basel, Switzerland. colleges and universities, an increase in the introduction to talents, a continuous increase
This article is an open access article in local competition, an accelerated frequency of talent flow and a structural imbalance
distributed under the terms and of talent flow among colleges and universities in the region. This has engendered many
conditions of the Creative Commons negative effects on the development of universities. Therefore, a reasonable forecast in
Attribution (CC BY) license (https:// stable trends of university talent is crucial to the survival and development of universities.
creativecommons.org/licenses/by/ However, traditional methods have some limitations on predicting the stability of talent.
4.0/).
Electronics 2022, 11, 4224. https://doi.org/10.3390/electronics11244224 https://www.mdpi.com/journal/electronics
207
Electronics 2022, 11, 4224
It is a new trend to use artificial intelligence algorithms to achieve accurate predictions of
talent stability. There have been few studies that have used the artificial intelligence tools
to solve the prediction issue of talent stability, so we have summarized some related works
which used artificial intelligence tools to tackle the prediction problems for students; this is
shown in Table 1.
Table 1. The latest research status of prediction issues for students.
Authors Methods Overview
They suggested that attitudes, subjective norms, perceived
Yang et al. [1] The theory of planned behavior behavior, gender and parental experience have a significant
impact on students’ entrepreneurial intentions.
They demonstrated that attitudes and perceived behaviors
Gonzalez-Serrano et al. [2] Questionnaire method
were statistically significant.
Values theory and planned They found a strong link between personal values and
Gorgievski et al. [3]
behavior theory entrepreneurial career intentions.
They found emotional intelligence, entrepreneurial
Partial least squares structural
Nawaz et al. [4] self-efficacy and self-regulation also directly affect college
equation modeling (PLS-SEM)
students’ entrepreneurial intentions.
They extracted four key attributes that affect students’
Yang et al. [5] Decision tree
intentions to start a career.
They predicted the entrepreneurial intentions of youth in
Serbia based on demographic characteristics, social
Djordjevic et al. [6] Data analysis approach
environment, attitudes, awareness of incentives and
environmental assessment.
They provided a reasonable reference for the formulation of
Wei et al. [7] Kernel extreme learning machine talent training programs and guidance for the entrepreneurial
intention of students.
They predicted the current performance of students through
Bhagavan et al. [8] Data mining tools and methods their early performance and awareness, and identified
students’ expected abilities.
They designed a diversified employment recommendation
Artificial intelligence algorithms
Huang et al. [9] system, combined with students’ personal interests, and
and fuzzy logic models
provided employment plans.
The cluster analysis They achieved accurate predictions of the employment
Li et al. [10]
technology model situation of graduates.
The swarm intelligence algorithm (SIA) is a crucial optimization method by which to
predict traditional talent stability. SIA is derived from natural phenomena or group behav-
iors, etc., such as group predation and physical phenomena. Optimization principles exist
within these phenomena. As a kind of SIA, the whale optimization algorithm (WOA) [11]
has a clear algorithm structure and good performance, which was proposed in 2016. It
was designed by simulating the hunting behavior of whales. During foraging, the whales
use bubbles as tools to surround their prey. Furthermore, the algorithm has been used in
many natural science fields, such as shop scheduling problems [12,13] and engineering
design problems. Navarro et al. [14] proposed a version of the WOA with the K-means
mechanism to explore the algorithm’s search space. The proposed model was effective
against resolving complex optimization issues. Abbas et al. [15] proposed a combination
of the technique of an extremely randomized tree with the WOA for the detection and
prediction of medical diseases. Abd et al. [16] introduced a novel WOA version application
for multilevel threshold image segmentation. Abdel-Basset et al. [17] presented a new
WOA version based on local search mechanisms to optimize a scheduling problem with the
multimedia data objects field. Qiao et al. [18] presented a novel version of the WOA, which
combined the worst individual disturbance and the neighborhood mutation search strategy
for solving engineering design problems. Peng et al. [19] introduced an enhanced WOA,
which combined the information-sharing search strategy and the Nelder-Mead simplex
strategy, to evaluate the parameters of solar cells and photovoltaic modules. Abderazek
et al. [20] presented the WOA and a moth-flame optimizer for optimizing spur gear design.
208
Electronics 2022, 11, 4224
For the high-quality training of talent, in addition to focusing on the employment and
entrepreneurship of university students, the stability of talents is also an important foun-
dation for social and economic development. Employment stability reflects psychological
satisfaction with practitioners regarding the employment unit, employment environment,
remuneration package and career development. In the past five years, the average turnover
rate of several colleges and universities in Wenzhou was 28.1%. An appropriate turnover
rate is conducive to the “catfish effect” in enterprises and institutions, and stimulates the
vitality and competitiveness of the organization; however, an excessive turnover rate has a
negative impact on the human resource costs and economic efficiency of universities, as
well as their social reputation and the quality development of the economy and society.
Big data has a wide scope of application in the field of talent mobility management.
Through the effective mining of big data onto talent flows in a university, the stability of
talent employment is analyzed, and the correlation hypothesis is verified by integrating
an intelligent optimization algorithm, neural network, support vector machine and other
machine learning methods; an intelligent prediction model is then constructed. At the
same time, key factors affecting the stability of talent employment are mined, and the key
influencing factors are analyzed in depth to explore the main features affecting the stability
of talent employment and to provide reference for government decision-making and policy
formulation. The main contributions are shown as bellow:
(1) A multi-strategy hybrid modified whale optimization algorithm is proposed.
(2) Introducing the crossover operator to facilitate the exchange of information and
improve the problem of dimensional lag.
(3) DECCWOA is verified on the 35 benchmark functions to demonstrate the optimization
performance.
(4) DECCWOA is combined with KELM and feature selection to achieve efficient talent
stability intelligence prediction.
(5) Results show the proposed methods surpass other reported approaches.
The remainder of this paper is structured as follows. Section 2 reviews the whale
optimization algorithm. Section 3 provides a comprehensive description of the proposed
method. The proposed method is verified and applied using benchmark function experi-
ments and feature selection experiments in Section 4. The conclusion and future work are
outlined in Section 5.
2. Relate Work
In recent years, swarm intelligence optimization algorithms have emerged, such as
the Runge Kutta optimizer (RUN) [21], the slime mold algorithm (SMA) [22], the Harris
hawks optimization (HHO) [23], the hunger games search (HGS) [24], the weighted mean
of vectors (INFO) [25], and the colony predation algorithm (CPA) [26]. Moreover, they
have achieved very good results in many fields, such as feature selection [27,28], image
segmentation [29,30], bankruptcy prediction [31,32], plant disease recognition [33], medical
diagnosis [34,35], the economic emission dispatch problem [36], robust optimization [37,38],
expensive optimization problems [39,40], the multi-objective problem [41,42], scheduling
problems [43–45], optimization of a machine learning model [46], gate resource alloca-
tion [47,48], solar cell parameter identification [49] and fault diagnosis [50]. In addition to
the above, the whale optimization algorithm (WOA) [11] is an optimization algorithm sim-
ulating the behaviors of whales rounding up their prey. During feeding, whales surround
their prey in groups and move in a whirling motion, releasing bubbles in the process, and
thus, closing in on their prey. In the WOA, the feeding process of whales can be divided into
two behaviors, including encircling prey and forming bubble nets. During each generation
of swimming, the whale population will randomly choose between these two behaviors to
hunt. In d-dimensional space, suppose that the position of each individual in the whale
population is expressed as X = ( x1, x2, . . . , xD ).
Agrawal et al. [51] proposed an improved WOA and applied it to the field of feature
selection [52]. Bahiraei et al. [53] proposed a novel perceptron neural network, which
209
Electronics 2022, 11, 4224
combined the WOA and other algorithms, and was applied to the field of polymer materials.
Qi et al. [54] introduced a new WOA with a directional crossover strategy, directional
mutation strategy, and levy initialization strategy. The potential for using the suggested
approach to address engineering issues is very high. Bui et al. [55] proposed a neural-
network-model-based WOA, which also integrated a dragonfly optimizer and an ant
colony optimizer, and was applied to the construction field. Butti et al. [56] presented an
effective version of the WOA to optimize the stability of power systems. Cao et al. [57]
also proposed a new WOA to improve the efficiency of the proton exchange of membrane
fuel cells. Cercevik et al. [58] presented an optimization model, combined with the WOA
and others, to improve the parameters of seismic isolated structures. Zhao et al. [59]
presented a susceptible-exposed-infected-quarantined (hospital or home)-recovered model
based on the WOA and human intervention strategies to simulate and predict recent
outbreak transmission trends and peaks in Changchun. A brand-new hybrid optimizer
was developed by Fan et al. [60] to solve large-scale, complex practical situations. The
proposed hybrid optimization algorithm combined a fruit flew optimizer with the WOA.
Raj et al. [61] proposed the application of the WOA as a solution to reactive power planning
with flexible transmission systems. Guo et al. [62] proposed an improved WOA with two
strategies to improve the exploration and exploitation abilities of the WOA, including
the random hopping update mechanism and random control parameter mechanism. To
improve the algorithm’s convergence rate and accuracy, a new version of the WOA was
presented by Jiang et al. [63] to apply constraints to engineering tasks.
Although the WOA has obtained good results in many fields, the algorithm easily
falls into the local optimum in the face of complex problems. Therefore, many excellent
improvement algorithms have been proposed. For example, Hussien et al. [29] proposed
a novel version of the whale optimizer with the gaussian walk mechanism and the virus
colony search strategy to improve convergence accuracy. To solve the WOA’s susceptibility
to falling into the local optimum with slow convergence speeds, an improved WOA
with a communication strategy and the biogeography-based model was proposed by Tu
et al. [64]. Wang et al. [65] presented a novel-based elite mechanism WOA, with a spiral
motion strategy to improve the original algorithm. Ye et al. [49] introduced an enhanced
WOA version of the levy flight strategy and search mechanism to improve the algorithm’s
balance. Abd et al. [66] presented an innovative method to enhance the WOA, including
the differential evolution exploration strategy. Abdel-Basset et al. [67] introduced an
enhanced whale optimizer, which was combined with a slime mold optimizer to improve
the performance of the algorithm. To enhance the WOA’s search ability and diversity, a
novel version of the WOA with an information exchange mechanism was proposed by Chai
et al. [68]. Heidari et al. [69] presented a whale optimizer with two strategies, including an
associative learning method and a hill-climbing algorithm. Jin et al. [70] proposed a dual
operation mechanism based on the WOA to solve the slow convergence speed problem.
Therefore, the WOA is an effective optimizer by which to improve the performance of
traditional talent stability prediction.
3. Materials and Methods
This section will improve the problems existing in the traditional whale optimization
algorithm, so as to propose a new version of the algorithm. During the process of the
whale population continuously approaching the optimal position, the population appears
in an aggregation state, which is the main reason for the algorithm falling into the local
optimal. Based on this, the DE operation is performed on the whale population during a
certain period, and the whale population is disturbed by the differential information of
multiple individuals, so as to ensure the diversity of the population. By introducing the
idea of a crisscross optimization algorithm, a vertical crossover is performed in dimensions
to improve dimensional stagnation as iterations progress, and horizontal crossover is
performed between individuals to fully facilitate the exchange of information between
individuals, allowing the problem space to be fully searched, effectively improving the
210
Electronics 2022, 11, 4224
search capability of the algorithm. Overall, the proposed algorithm is named as the DE-
based crisscross whale algorithm (DECCWOA).
3.1. Whale Optimization Algorithm
3.1.1. Encircling Prey
In the process of encircling the prey, each individual will choose the position closest
to the prey in the group, that is, the global optimal solution, or will randomly select a
whale and approach it. The equation for updating the position of the whale is shown
in Equation (1).
Xit+1 = Xbest
t
− A C × Xqt − Xitt (1)
where Xqt is Xbest
t t
when the whale swims toward the optimal whale position, and Xrand when
the whale swims toward the random whale position. A is a random number with a uniform
distribution between (− a, a), and the initial value of a is 2, which linearly decreases to 0
with the number of iterations. C is a random number that satisfies the uniform distribution,
and its value is between (0, 2). The choice of whether the whale individual swims toward
the optimal whale or random position is up to the value of A. When | A < 1| , the whale
decides to swim toward the optimal individual; otherwise, the whales will select a random
location in the population and approach it.
3.1.2. Forming Bubble Nets
Whales release bubbles while hunting, thus forming a spiraling, blistering net to repel
the prey. If bubble feeding is chosen, the whale first calculates the distance between itself
and the best whale, then swims upwards in a spiral and spits out bubbles of varying sizes
to feed on the fish and prawns. At this point, the position of the whale is updated by the
equation shown in Equation (2).
t
Xit+1 = Xbest − Xit × ebl × cos(2πl ) + Xbest
t
(2)
where b is a constant, and l is a random number between [−1, 1], meeting a uniform distribution.
3.2. Differential Evolution Algorithm (DE)
The differential evolution algorithm (DE) [71] was proposed in 1997 based on the
idea of evolutionary algorithms, such as genetic algorithms, which are essentially multi-
objective optimization algorithms that can be used to solve the overall optimal solution in
a multi-dimensional space. The DE is the same as other genetic algorithms in that the main
process consists of three steps: mutation, crossover and selection. However, the variance
vector of the differential DE is generated from the parent differential vector and is crossed
with the parent individual vector to generate a new individual vector, which is directly
selected with its parent individual. Suppose the position vector of the i-th individual in the
population is Xi .
3.2.1. Crossover Operations
The basic variance vector is generated by Equation (3), and r1 = r2 = r3 . Therefore,
in the DE algorithm, the population must be greater than 3. F is the crossover operator,
with a value usually between [0, 2], which controls the amplification of the deviation vector.
Commonly, the difference between the two vectors is multiplied by the crossover operator
and added to the third vector to generate a new mutation vector.
X i = Xr 1 + F × ( Xr 2 − Xr 3 ) (3)
In this article, in order to allow for faster convergence of the population algorithm
while maintaining population diversity, we attempt to calculate the difference between the
position of the current population and the optimal population position (Xbest ), on the basis
211
Electronics 2022, 11, 4224
of which a new variant population is generated. Therefore, Equation (3) is rewritten as
shown in Equation (4).
Vi = Xi + F × ( Xbest − Xi ) (4)
3.2.2. Mutation Operations
To increase the diversity of the interference vectors, crossover operations are intro-
duced. Equation (5) presents the principle of the crossover operation.
Vji i f randb( j) ≤ CR or j = rnbr (i )
Ui,j = , i = 1, 2, . . . , NP; j = 1, 2, . . . , D (5)
Xi,j i f randb( j) > CR or j = rnbr (i )
randb( j) denotes the generation of the j-th estimate of a random number between
[0, 1] and rnbr denotes a randomly chosen sequence. CR is the crossover operator. In
simple terms, if the randomly generated randb(j) is less than CR or j = r, then the variant
population is placed in the selection population; if not, the original population is placed in
the selection population.
3.2.3. Selection Operation
In order to decide whether the vectors in the selection population can become part of
the next generation, the newly generated position vectors are compared with the current
target vectors, and, if it appears that the objective function is further optimized or the
original state is maintained, then, the newly generated individuals will appear in the next
generation. The selection operation is defined as shown in Equation (6).
Ui i f f (Ui ) < f ( Xi )
Xi = (6)
Xi i f f (Ui ) ≥ f ( Xi )
The DE is a simple and easy-to-implement algorithm that mainly performs genetic
operations by means of differential variation operators. The algorithm has shown good
robustness and efficiency in solving most optimization problems [72–75]. Furthermore, the
algorithm is intrinsically parallel and can coordinate searches, so that the DE has a faster
convergence rate for the same requirement.
3.3. Crisscross Optimization Algorithm
The crisscross optimization algorithm (CSO) [76] is a new population-based stochastic
search algorithm that performs both horizontal and vertical crossover in each generation
during each iteration, thus allowing certain dimensions of the population that are trapped in
a pseudo-optimal a chance to jump out. The new individuals obtained after each crossover
need to go through competition, and only the individuals better than the parent generation
will be retained for the next iteration.
3.3.1. Horizontal Crossover Operator
A horizontal crossover operation is similar to crossover operations in genetic al-
gorithms, a kind of arithmetic crossover between the same dimension of two different
individual particles in a population. Assuming a horizontal crossover in the d-th dimension
for the i-th and j-th parent individual particles, the formula for generating offspring is
shown in Equations (7) and (8).
MShc (i, d) = r1 × X (i, d) + (1 − r1 ) × X ( j, d) + c1 × ( X (i, d) − X ( j, d)) (7)
MShc ( j, d) = r1 × X ( j, d) + (1 − r1 ) × X (i, d) + c1 × ( X ( j, d) − X (i, d)) (8)
where r1 and r2 are random numbers between [0, 1], and, c1 and c2 are random numbers be-
tween [−1, 1]. X (i, d) and X ( j, d) represent the d-th dimension of the i-th and j-th individ-
uals in the population, respectively. MShc (i, d) and MShc ( j, d) are the d-th dimension of the
offspring generated by X (i, d) and X ( j, d) via horizontal crossover, respectively. From a so-
212
Electronics 2022, 11, 4224
ciological point of view, r1 × X (i, d) is the memory term of particle X (i ). (1 − r1 ) × X ( j, d)
is the group cognitive term of particles X (i ) and X ( j), representing the interaction between
different particles. c1 is the learning factor, c1 × ( X (i, d) − X ( j, d)) can effectively enlarge
the search interval and search for optimization at the edge. The schematic diagram of the
horizontal crossover operation is shown in Figure 1.
Figure 1. Schematic of horizontal crossover.
3.3.2. Vertical Crossover Operator
A vertical crossover is an arithmetic crossover between two different dimensions of
a particle in a population. Since different dimensional elements have different ranges
of values, the two dimensions need to be normalized before crossover. Furthermore, in
order to allow the dimension that has stalled in the local optimum to jump out of the
local optimum without destroying the information of the other dimension, only one child
particle is generated for each vertical crossover operation, and only one of the dimensions
is updated. The vertical crossover operation is defined by Equation (9).
MSvc (i, d1 ) = r × X (i, d1 ) + (1 − r ) × X (i, d2 ), i ∈ N (1, M), d1 d2 ∈ N (1, D ) (9)
where r is a random number between [0, 1]. MSvc (i, d1 ) is the d1 -th dimension of the off-
spring produced by the d1 -th and d2 -th dimensions of individual X (i ) by vertical crossover.
The new individual contains not only the information of the d1 -th dimension of the parent
particle, but also the information of the d2 -th dimension with a certain probability, and the
information of the d2 -th dimension will not be destroyed during the crossover. A schematic
diagram of the vertical crossover is shown in Figure 2.
Figure 2. Schematic of vertical crossover.
3.4. Framework of Proposed DECCWOA
The whale algorithm, the crossover and mutation operations in the DE and the criss-
cross operators together form the overall framework of the DECCWOA. We consider a
positive population renewal to be complete when a location closer to a food source is found
in one iteration. When the entire whale population has completed S positive updates, we
consider the population to have been concentrated and to be losing population diversity.
In one iteration, after the whales have completed one location update, it is determined
whether the population has completed S positive updates, and, if so, the crossover and
mutation operations of the DE algorithm are performed, resulting in a perturbation of the
whale population, further ensuring population quality. Moreover, vertical crossover is
213
Electronics 2022, 11, 4224
performed in dimensions to improve dimensional stagnation as iterations progress, and,
when the entire population has completed one location update, horizontal crossover is
performed between individuals to fully facilitate the exchange of information between
individuals, allowing the problem space to be fully searched, effectively improving the
search capability of the algorithm. The pseudo-code of the DECCWOA can be seen in
Algorithm 1, and a flow chart of the overall DECCWOA framework is shown in Figure 3.
Algorithm 1: The pseudo-code of the DECCWOA
Input: Number of populations N, maximum number of iterations T, , objective function f obj;
Output: Optimum whale position Xbest ;
Initialize the whale population positions X;
Calculate fitness values for all individuals in the whale population and sort them;
Set the position of the individual with the smallest fitness value f best to Xbest ;
Set s = 0;
while (t < T)
for each agent
Update a, A, C l, S and p;
if p < 0.5
if | A| < 1 && s < S
Update the position of agent using Equation (1), and set Xq as Xbest ;
elseif | A| ≥ 1 && s < S
Select a random search agent as Xrand ;
Update the position of agent using Equation (1), and set Xq as Xrand ;
elseif s ≥ S
Performing crossover and mutation operations in DE;
end if
else
Update the position of agent using Equation (2);
end if
Perform vertical crossover operator using Equation (9);
end for
Perform horizontal crossover operation using Equations (7) and (8);
Calculate fitness values for all individuals in the whale population and sort them;
Set the position of the individual with the smallest fitness value gbest to Xgbest ;
if gbest < f best
Updates Xbest and f best ;
s = s + 1;
end if
t = t + 1;
end while
Return Xbest
In the basic whale algorithm, only each individual in the population is updated accord-
ing to the corresponding situation in each iteration, excluding other complex operations.
Therefore, the time complexity of the algorithm is only related to the maximum number of
iterations T and the population size N; that is, the time complexity of the whale algorithm
is O( T ∗ N ). When executing the vertical crossover algorithm, the time complexity of the
vertical crossover is O(D); a vertical crossover is performed at the end of each individual
update as the vertical crossover occurs in dimension D. When the horizontal crossover is
executed after the whole population has been updated, the time complexity of the horizon-
tal crossover is O( N ∗ D ) depending on the size of the individuals and the dimension of the
problem, as the horizontal crossover is performed by communicating between individuals
and updating the dimensional information in turn. In DE, a crossover is performed, and the
mutation and selection operations are only related to dimensions, so the time complexity
of an iteration is O( D ). In this work, only when the position of the population is updated
every time and a certain period is met, we carry out an operation of crossover, mutation
214
Electronics 2022, 11, 4224
and selection for the population. Therefore, the operation of theoretically introducing the
DE does not add a high time cost to the algorithm. In summary, the time complexity of the
proposed algorithm DECCWOA is O( T ∗ (O( N ∗ D ) + O( N ))).
Figure 3. Flow chart of the DECCWOA framework.
4. Experimental Results
This section presents a quantitative analysis of the introduced DE and CSO mecha-
nisms and presents the experimental results comparing the proposed algorithm, DECC-
WOA, with other improved WOA algorithms and improved swarm intelligence algorithms
that have better performance on 35 benchmark functions. Furthermore, to show that the
proposed algorithm is still valid for practical applications, the DECCWOA is applied to
the intelligent prediction of talent stability in universities. All experiments were carried
215
Electronics 2022, 11, 4224
out on a Windows Server 2012 R2 operating system with Intel(R) Xeon(R) Silver 4110 CPU
(2.10 GHz) and 32.GB RAM. All algorithms were coded and run on MATLAB 2014b.
To ensure fairness of the experiment, all algorithms were executed in the same en-
vironment. For all algorithms, the population size was set to 30, the maximum number
of function evaluations was set to 300,000 and, to avoid the effect of randomness on the
results, each algorithm was individually executed 30 times on each benchmark function.
avg and std reflect the average ability and stability of each algorithm after 30 independent
experiments. To allow a more visual presentation of the average performance of all the
algorithms, the Freidman test is used to evaluate the experimental results of all algorithms
on the benchmark function and the final ranking is recorded.
4.1. Experimental Results of the DECCWOA on Benchmark Functions
The DECCWOA and its related comparison algorithm conducted comparison experi-
ments on 35 benchmark functions selected from 23 benchmark functions and CEC2014. In
detail, Table A1 of the Appendix A shows a summary of the 35 test functions, which can
be divided into three categories, including unimodal functions, multimodal functions and
hybrid functions.
4.1.1. Parameter Sensitivity Analysis
Not every dimension of an individual is selected for crossover in a vertical crossover
operation. In the vertical crossover operation, there is a key parameter p2 . When the
random probability is less than p2 , the crossover operation is performed in the correspond-
ing dimension of the individual, as shown in Equation (9). Otherwise, the operation is
considered not to be performed in that dimension. The possible values of p2 are 0.1, 0.2,
0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 and 1.0. In order to visually present the impact of p2 on the
optimization capabilities of the DECCWOA, we conducted comparative experiments using
different versions. The names corresponding to the different algorithm versions are shown
in Table 2.
Table 2. Names of different algorithm versions when p2 is different.
DEC DEC DEC DEC DEC DEC DEC DEC DEC DEC
Algorithm
CWOA1 CWOA2 CWOA3 CWOA4 CWOA5 CWOA6 CWOA7 CWOA8 CWOA9 CWOA10
p2 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0
Different values of p2 have a direct impact on the optimization of the DECCWOA.
Table 3 shows the results of the DECCWOA2 and Table A2 in Appendix A shows the
detailed results when p2 is taken to different values. The rankings generated by the
Friedman test show that when the value of p2 is too large, the less effective the average
optimization is. The significance of introducing a longitudinal crossover operator is to
help the population change dimensional stagnation. That is because when p2 takes a larger
value, it means that each dimension of the individual changes with a high probability.
This not only changes the dimension of stagnation, but also the dimension of having good
performance along with it. Notably, when p2 is taken as 0.1 versus 0.2, the performance is
similar for 28 of the 35 benchmark functions, but, for overall performance, the DECCWOA2
is slightly better. This is because, when the value of p2 is too small, only a few dimensions
are adjusted after the individual enters the vertical crossover operator, which does not have
the problem of falling into local optima due to dimensional stagnation being significantly
improved, especially in solving multimodal functions and hybrid functions. Therefore, in
the course of the next experiments, p2 was set to 0.2.
216
Electronics 2022, 11, 4224
Table 3. Experimental results for analysis of different versions.
Overall
Algorithms
+/−/= Rank
DECCWOA1 ~ 2
DECCWOA2 4/3/28 1
DECCWOA3 14/3/18 6
DECCWOA4 12/2/21 5
DECCWOA5 14/4/17 3
DECCWOA6 14/5/16 4
DECCWOA7 14/4/17 7
DECCWOA8 15/4/16 8
DECCWOA9 17/2/16 9
DECCWOA10 16/2/17 10
4.1.2. Comparison of Mechanisms
In order to verify the effectiveness of the introduced mechanism in improving the
optimization capabilities of the WOA, ablation studies on the integrated DE and CSO
were conducted. Table 4 presents the comparison results for the introduced mechanisms.
The detailed results can be found in Table A3 of Appendix A. Notably, on most of the
benchmark functions, the DECCWOA has the best optimization capability by performing
the Friedman test on 30 times randomized trials. Furthermore, the CCWOA with the
introduction of CSO outperforms the WOA on more than 90% of the benchmark functions.
However, for the DEWOA, which introduces the DE into the WOA, although the overall
results are not significantly improved, a comparison of the optimization performance of
CCWOA and DECCWOA shows that the combination of CSO with the DE makes the WOA
more optimizable.
Table 4. Comparison results for the introduced mechanisms.
Overall
Algorithms
+/−/= Rank
DECCWOA ~ 1
DEWOA 31/1/3 4
CCWOA 18/4/13 2
WOA 25/1/9 3
Convergence curves of the comparison results for the introduced mechanisms are
shown in Figure 4. Among them, the CCWOA excels in both optimization accuracy and
convergence speed on F4, F6 (from 23 benchmark functions) and unimodal functions of F14
(from CEC2014), F12, F13 (from 23 benchmark functions), multimodal functions of F18, F19,
F23, F24, F29 (from CEC2014) and hybrid functions of F30 and F32. In particular, CCWOA
also has stronger search ability in multimodal functions and hybrid functions. This shows
that CSO effectively improves the problem that the basic WOA is prone to falling into the
local optimum. It is also worth noting that the introduction of the DE did not give the
desired results on most of the benchmark functions. However, when acting together with a
CSO on the WOA, the convergence speed and optimization accuracy of the DECCWOA
are significantly improved. Especially in F4, F6 and F13, it is obvious that the DECCWOA
has better performance than the CCWOA. This is because we perform the DE crossover
and mutation operations over a period of time in order to take advantage of differences
between individuals to disturb the population, but do not perform the rounding up of prey
in the basic WOA at this time, thus slowing the efficiency of the whale population towards
the food source. However, when CSO is applied to the whole population, not only is the
information between individuals utilized, but also the information in the spatial dimension
217
Electronics 2022, 11, 4224
is considered. Combined with the periodic perturbation of the DE, the whale population
can search the whole problem space more efficiently.
Figure 4. Convergence curves of the comparison results for the introduced mechanisms.
4.1.3. Comparison with Improved WOA Versions
In order to provide a clearer picture of the results of the experiments comparing
the DECCWOA with other improved WOA algorithms for 35 benchmark functions, avg
and std of all functions obtained after 30 independent experiments on the corresponding
benchmark functions and the average ranking results of the Friedman test on the average
results are recorded in Table 5. The detailed results are shown in Table A4 of Appendix A.
The composite average ranking of the DECCWOA is the highest, followed by the RDWOA
and the CCMWOA with the lowest. Among them, +/−/= respectively records the number
of benchmark functions that the DECCWOA is superior to, inferior to and similar to in
terms of performance to other competing algorithms among the 35 test functions. For the
worst performing CCMWOA, the DECCWOA outperforms it for twenty-eight benchmark
functions, has the same performance on five functions, and performs slightly worse on only
two functions. Moreover, compared to the RDWOA, which ranks second overall, the DEC-
CWOA has better performance for sixteen benchmark functions, has the same optimization
ability for thirteen functions and only has poor performance for six functions. This proves
218
Electronics 2022, 11, 4224
that the DECCWOA has better performance than other improved WOA algorithms for
most of the optimization problems, further demonstrating that the introduced CSO and
DE have a positive steering effect on improving the basic WOA, such as slow convergence
speed and poor accuracy guiding role.
Table 5. Comparison results for DECCWOAs with improved WOA versions.
Overall
Algorithms
+/−/= Rank
DECCWOA ~ 1
RDWOA 16/6/13 2
ACWOA 26/3/6 6
CCMWOA 28/2/5 9
CWOA 29/0/6 8
BMWOA 32/1/2 7
BWOA 23/3/9 4
LWOA 26/4/5 5
IWOA 24/1/10 3
In this section, the performance of the DECCWOA is compared with other improved
versions of the WOA, including the RDWOA, the ACWOA, the CCMWOA [77], the
CWOA [78], the BMWOA, the BWOA, the LWOA [79] and the IWOA [80]. Figure 5 shows
the convergence curves of the average results obtained after 30 operations for all algorithms.
On unimodal functions such as F6, it can be intuitively observed that the DECCWOA has
the strongest search capability, with the RDWOA in second place, but the DECCWOA has
a better performance than the RDWOA in terms of both accuracy and convergence speed.
For both F12 and F13, the optimal values found by the other improved WOA algorithms
are similar and more concentrated; however, the accuracy of the optimization obtained
by the DECCWOA calculation is substantially improved. On F18, F19, F21, F23, F25 and
F29, the DECCOWA can still search for more satisfactory optimal values compared to
the other improved WOA algorithms. This demonstrates that the improvements to the
WOA in this experiment are relatively more effective, and that, even when solving for
multimodal functions, the DECCWOA can still jump out of the local optimum in time to
obtain a high-quality optimal solution.
4.1.4. Comparison with Advanced Algorithms
Table 6 presents the comparison results for the DECCWOA with advanced algorithms.
The detailed results can be found in Table A5 of Appendix A. avg reflects the average opti-
mization ability of the algorithm after independently running on the benchmark function
for 30 times, and std represents the influence of randomness on the optimization ability of
the algorithm, which further reflects the stability of the algorithm to solve problems. From
Table 6, the DECCWOA is superior to the IGWO on twenty functions and is inferior to the
IGWO on eight functions (F3, F5, F22, F28, F30, F33, F34, F35). The DECCWOA beats the
OBLGWOA on nineteen functions and loses to the OBLGWO on five functions (F3, F7, F28,
F30, F33). For the CGPSO, ALCPSO and RCBA, the DECCWOA is inferior to them on nine
functions, and outperforms most of the others. In detail, the DECCWOA is worse than the
CGPSO at F5, F7, F8, F16, F17, F26, F30, F33 and F34, worse than the ALCPSO at F15, F16,
F20, F21, F22, F28, F30, F33 and F34 and is worse than the RCBA at F14, F15, F16, F17, F20,
F26, F30, F33 and F34. The DECCWOA beats the CBA on twenty-four functions, and loses
to the CBA in six functions (F15, F16, F20, F30, F33, F34). The DECCWOA outperforms
the OBSCA on 32 functions and only performs worse than the OBSCA on one function
of F3. The DECCWOA is worse than the SCADE on F3 and F6. Based on the analysis
above, the DECCWOA did not perform as well as the ALPSO, RCBA and CBA on the
three unimodal functions (F14~F16) selected in CEC2014, but demonstrated competitive
performance on the seven unimodal functions (F1~F7) selected from the twenty-three
219
Electronics 2022, 11, 4224
benchmark functions. The DECCWOA does not perform more competitively than the other
comparison algorithms in terms of hybrid functions, but the DECCWOA performs well on
most of the multimodal functions.
Figure 5. Convergence curves of comparison with improved WOA versions.
Table 6. Comparison results for the DECCWOA and advanced algorithms.
Overall
Algorithms
+/−/= Rank
DECCWOA ~ 1
IGWO 20/8/7 2
OBLGWO 19/5/11 5
CGPSO 23/9/3 4
ALPSO 19/9/7 3
RCBA 23/9/3 6
CBA 24/6/5 7
OBSCA 32/1/2 9
SCADE 28/2/5 7
In order to verify the effectiveness of the proposed DECCWOA compared to other ad-
vanced algorithms, comparison experiments were carried out. Among them, an enhanced
GWO with a new hierarchical structure (IGWO) [81], boosted GWO (OBLGWO) [82],
cluster guide PSO (CGPSO) [83], hybridizing sine cosine algorithm with differential evo-
lution (SCADE) [84], particle swarm optimization with an aging leader and challengers
(ALPSO) [85], hybrid bat algorithm (RCBA) [86], chaotic BA (CBA) [87] and opposition-
based SCA (OBSCA) [88] were selected as the comparison algorithms. Convergence curves
220
Electronics 2022, 11, 4224
for comparison with the advanced algorithms are displayed in Figure 6. In particular,
for unimodal functions, the DECCWOA has the same search capability as the IGWO,
OBLGWO, CGPSO and SCADE in F1. For F6, the DECCWOA has the strongest optimiza-
tion capability and, as can be seen in Figure 6, the DECCWOA maintains a satisfactory
convergence rate for F6. On the multimodal functions, such as F12, F13, F21, F23, F24
and F29, the DECCWOA also shows strong optimization ability. Compared with the clas-
sic ALPSO, the optimization performance of the DECCWOA is not inferior, and it can
even converge to a better solution at a faster convergence rate. When solving a hybrid
optimization problem, such as F31, although the IGWO can still obtain better solutions in
the late iteration, its convergence speed is slow and the search ability is poor in the early
iteration. The OBLGWOA, CGPAO, SCADE and OBSCA are unsatisfactory in terms of
their optimization ability and convergence speeds during the entire iterative process, while
the ALPSO, RCBA and CBA are relatively better; however, the DECCWOA showed better
optimization than them.
Figure 6. Convergence curves of the DECCWOA and advanced algorithms.
4.2. Experiments on Application of the DECCWOA in Predicting Talent Stability in Higher Education
4.2.1. Description of the Selected Data
The subjects studied in this paper were 69 talented individuals who left several col-
leges and universities in Wenzhou from 1 January 2015, accounting for 11.5% of the official
staff. The following characteristics were examined: subject gender, political status, profes-
sional attributes, age, type of place of origin, category of talents above the municipal level,
nature of the previous unit, type of location of college and university, year of employment
at college and university, type of position at college and university, professional relevance
of employment at college and university, annual salary level at college and university,
221
Electronics 2022, 11, 4224
current employment unit, time of introduction of current employment unit, nature of
current employment unit and type of location of current employment unit. The indicators,
as presented in Table A6 of the Appendix A, were mined and analyzed to explore the
importance and interconnectedness of each indicator, and to build an intelligent predic-
tion model based on these indicators. Moreover, the following indicators are bolded as
important indicators.
4.2.2. Experimental Results
The proposed DECCWOA was combined with the KELM and the feature selection
(DECCWOA-KELM-FS) method to solve the classification problem of employment inten-
tion of talent. The experimental results are shown in Tables 7 and 8. The DECCWOA-KELM-
FS’s results on the ACC, Sensitivity, Specificity and MCC indicators are 95.87%, 94.96%,
96.59% and 91.64%, respectively. The classification results are all superior to other com-
parison algorithms, including the DECCWOA-KELM, DECCWOA-KELM, WOA-KELM,
ANN, RF and SVM. Furthermore, the stability results of the ten experimental results of the
proposed model are also superior. The std metrics results of the ACC, Sensitivity, Specificity
and MCC indicators are 3.19 × 10−2 , 6.85 × 10−2 , 4.25 × 10−2 and 6.66 × 10−2 . Obviously,
the stability of the proposed algorithm is better than that of most comparison algorithms.
Therefore, by combining the DECCWOA with the KELM and FS, the talent stability predic-
tion of Wenzhou Vocational College is effectively realized. To further visualize the results,
Figure 7 shows a comparison of results between the proposed algorithm and the other
five methods, including the average results and standard deviations of the five indicators.
Similarly, the average performance and stability of the DECCWOA-KELM-FS in each index
are better than most reported algorithms.
Table 7. Four avg metrics results of the proposed model and other models.
Models ACC Sensitivity Specificity MCC
DECCWOA-KELM-FS 95.87% 94.64% 96.59% 91.64%
DECCWOA-KELM 92.57% 94.05% 92.50% 86.27%
WOA-KELM 90.32% 89.39% 91.05% 81.10%
ANN 88.96% 87.58% 90.51% 77.16%
RF 92.67% 92.85% 91.01% 85.33%
SVM 89.30% 91.92% 86.96% 79.75%
Table 8. Four std metrics results of the proposed model and other models.
Models ACC Sensitivity Specificity MCC
DECCWOA-KELM-FS 3.19 × 10−2 6.85 × 10−2 4.25 × 10−2 6.66 × 10−2
DECCWOA-KELM 5.60 × 10−2 8.31 × 10−2 8.93 × 10−2 1.01 × 10−1
WOA-KELM 4.33 × 10−2 9.06 × 10−2 1.02 × 10−1 8.80 × 10−2
ANN 4.16 × 10−2 5.61 × 10−2 5.91 × 10−2 9.50 × 10−2
RF 4.17 × 10−2 1.08 × 10−1 6.74 × 10−2 8.59 × 10−2
SVM 6.72 × 10−2 1.12 × 10−1 1.07 × 10−1 1.18 × 10−1
Figure 8 shows the feature selection results of the proposed model. As can be seen, F7
(city-level and above talent categories) and F22 (professional and technical position at the
time of leaving) are both screened the most, eight times. It shows that the two key factors
affecting the stability of university talents are F7 and F22, which provides some guiding
significance of the flow of highly educated talents. Based on the fact that the proposed
method has such excellent performance, it can also be applied in many other fields in the
future, such as information retrieval services [89,90], named entity recognition [91], road
network planning [92], colorectal polyp region extraction [93], image denoising [94], image
segmentation [95–97] and power flow optimization [98].
222
Electronics 2022, 11, 4224
Figure 7. Mean value and standard deviation of four metrics for the DECCWOA and others methods.
Figure 8. Feature selection results of the proposed model.
5. Conclusions
This paper studied the stability of higher education talent for the first time, and
proposed a DECCWOA-KELM-FS model to intelligently predict the stability of higher
education talent. By introducing a crossover algorithm, the information exchange between
individuals was promoted and the problem of dimension stagnation was improved. The
DE operation was carried out in a certain time, and the difference between individuals was
used to disturb the population and ensure the diversity of the population. In order to verify
the optimization performance of the DECCWOA, 35 benchmark functions were selected
from 32 benchmark functions and CEC214 for comparative experiments. Experimental
results showed that the DECCWOA algorithm had higher accuracy and faster convergence
rates when solving unimodal and multimodal functions; although the mixture function
223
Electronics 2022, 11, 4224
also had very good performance. By combining the DECCWOA with the KELM and
feature selection, the stable intelligence of talent in Wenzhou colleges and universities was
efficiently predicted. This method can be used as a reliable and high precision method to
predict the flow of talent in colleges and universities.
Subsequent studies will further improve the generality of the proposed GLLCSA-
KELM-FS and solve more complex classification problems, such as disease diagnosis and
financial risk prediction.
Author Contributions: Conceptualization, G.L. and H.C.; methodology, F.K. and H.C.; software, G.L.
and F.K.; validation, H.L., S.K., X.R., C.L., G.L., H.C., F.K. and L.L.; formal analysis, F.K., G.L. and
L.L.; investigation, H.L., S.K., D.C. and C.L.; resources, F.K., G.L. and L.L.; data curation, F.K., G.L.
and C.L.; writing—original draft preparation, H.L., S.K., X.R. and C.L.; writing—review and editing,
G.L. and H.C.; visualization, G.L. and H.C.; supervision, F.K., G.L. and L.L.; project administration,
F.K., G.L. and L.L.; funding acquisition, F.K., G.L. and H.C. All authors have read and agreed to the
published version of the manuscript.
Funding: Zhejiang Provincial universities Major Humanities and social Science project: Innovation
and Practice of Cultivating Paths for Leaders in Rural Industry Revitalization under the Background
of Common Prosperity (Moderator: Li Hong), Humanities and Social Science Research Planning Fund
Project of the Ministry of Education (research on risk measurement and early warning mechanism
of science and technology finance based on big data analysis, 20YJA790090), Zhejiang Provincial
Philosophy and Social Sciences Planning Project (Research on rumor recognition and dissemination
intervention based on automated essay scoring, 23NDJC393YBM).
Data Availability Statement: The data involved in this study are all public data, which can be
downloaded through public channels.
Conflicts of Interest: The authors declare no conflict of interest.
Appendix A
Table A1. Details of the selected 35 benchmark functions.
Types No. Functions Rang fmin
F1 f 1 ( x ) = ∑in=1 xi2 [−100, 100] 0
F2 f 2 ( x ) = ∑in=1 | xi | + ∏in=1 | xi | [−10, 10] 0
2
F3 f 3 ( x ) = ∑in=1 ∑ij−1 x j [−100, 100] 0
Unimodal
F4 f 4 ( x ) = maxi {| xi |, 1 ≤ i ≤ n} [−100, 100] 0
Functions
f 5 ( x ) = ∑in=−11 100 xi+1 − xi2 + ( xi − 1)2 [−30, 30]
2
F5 0
F6 f 6 ( x ) = ∑in=1 ([ xi + 0.5])2 [−100, 100] 0
F7 f7 (x) = + random[0, 1]
∑in=1 ixi4 [−1.28, 1.28] 0
%
F8 f 8 ( x ) = ∑in=1 − xi sin | xi | [−500, 500] −418.9829 × 5
# 2 $
F9 f 9 ( x ) = ∑i=1 xi − 10 cos(2πxi ) + 10
n
[−5.12, 5.12] 0
! & "
F10 f 10 ( x ) = −20 exp −0.2 n1 ∑in=1 xi2 − exp n1 ∑in=1 cos(2πxi ) + 20 + e [−32, 32] 0
Multimodal
F11 f 11 ( x ) = 1
∑in=1 xi2 − ∏in=1 cos
xi
√ +1 [−600, 600] 0
Functions 4000 i
' (
f 12 ( x ) = π n −1 yi − 1 2 1 + 10 sin2 πyi +1 + (yn − 1)2 + ∑in=1 u xi , 10, 100, 4
n 10 sin πy1 + ∑i =
F12 ⎧1
⎨k xi − a m xi > a [−50, 50] 0
x +1
yi = 1 + i , u xi , a, k, m = 0 − a < xi < a
4 ⎩
k − xi − a m xi < − a
' (
F13 f 13 ( x ) = 0.1 sin2 3πx1 + ∑n x − 1 2 1 + sin2 3πxi + 1 + ( xn − 1)2 1 + sin2 (2πxn ) + ∑n u xi , 5, 100, 4
i =1 i i =1
[−50, 50] 0
F14 Rotated High Conditioned Elliptic Function [−100, 100] 100
Unimodal F15 Rotated Bent Cigar Function [−100, 100] 200
Functions
F16 Rotated Discus Function [−100, 100] 300
224
Electronics 2022, 11, 4224
Table A1. Cont.
Types No. Functions Rang fmin
F17 Shifted and Rotated Rosenbrock’s Function [−100, 100] 400
F18 Shifted and Rotated Ackley’s Function [−100, 100] 500
F19 Shifted and Rotated Weierstrass Function [−100, 100] 600
F20 Shifted and Rotated Griewank’s Function [−100, 100] 700
F21 Shifted Rastrigin’s Function [−100, 100] 800
F22 Shifted and Rotated Rastrigin’s Function [−100, 100] 900
Simple
Multimodal F23 Shifted Schwefel’s Function [−100, 100] 1000
Functions F24 Shifted and Rotated Schwefel’s Function [−100, 100] 1100
F25 Shifted and Rotated Katsuura Function [−100, 100] 1200
F26 Shifted and Rotated HappyCat Function [−100, 100] 1300
F27 Shifted and Rotated HGBat Function [−100, 100] 1400
F28 Shifted and Rotated Expanded Griewank’s plus Rosenbrock’s Function [−100, 100] 1500
F29 Shifted and Rotated Expanded Scaffer’s F6 Function [−100, 100] 1600
F30 Hybrid Function 1 (N = 3) [−100, 100] 1700
F31 Hybrid Function 2 (N = 3) [−100, 100] 1800
Hybrid F32 Hybrid Function 3 (N = 4) [−100, 100] 1900
Function1 F33 Hybrid Function 4 (N = 4) [−100, 100] 2000
F34 Hybrid Function 5 (N = 5) [−100, 100] 2100
F35 Hybrid Function 6 (N = 5) [−100, 100] 2200
Table A2. Experimental results for analysis of key parameter p2 .
F1 F2 F3
avg std avg std avg std
DECCWOA1 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 6.0453 × 10−8 3.3108 × 10−7
DECCWOA2 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 4.2361 × 10−17 2.3074 × 10−16
DECCWOA3 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 6.1871 × 10−28 1.4243 × 10−27
DECCWOA4 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.8338 × 10−27 2.4802 × 10−27
DECCWOA5 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 5.5498 × 10−28 1.4428 × 10−27
DECCWOA6 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 5.9383 × 10−28 1.6120 × 10−27
DECCWOA7 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 9.3229 × 10−28 1.9913 × 10−27
DECCWOA8 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 3.4963 × 10−28 1.1052 × 10−27
DECCWOA9 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 5.3287 × 10−28 1.2818 × 10−27
DECCWOA10 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 4.2382 × 10−28 1.3085 × 10−27
F4 F5 F6
avg std avg std avg std
DECCWOA1 0.0000 × 100 0.0000 × 100 2.4439 × 101 6.6504 × 100 0.0000 × 100 0.0000 × 100
DECCWOA2 0.0000 × 100 0.0000 × 100 2.4123 × 101 6.5641 × 100 0.0000 × 100 0.0000 × 100
DECCWOA3 0.0000 × 100 0.0000 × 100 2.6257 × 101 2.8910 × 10−1 0.0000 × 100 0.0000 × 100
DECCWOA4 0.0000 × 100 0.0000 × 100 2.5987 × 101 4.1389 × 10−1 0.0000 × 100 0.0000 × 100
DECCWOA5 0.0000 × 100 0.0000 × 100 2.6107 × 101 3.0119 × 10−1 0.0000 × 100 0.0000 × 100
DECCWOA6 0.0000 × 100 0.0000 × 100 2.5412 × 101 4.8062 × 100 0.0000 × 100 0.0000 × 100
DECCWOA7 0.0000 × 100 0.0000 × 100 2.5432 × 101 4.8097 × 100 0.0000 × 100 0.0000 × 100
DECCWOA8 0.0000 × 100 0.0000 × 100 2.4619 × 101 6.6972 × 100 0.0000 × 100 0.0000 × 100
DECCWOA9 0.0000 × 100 0.0000 × 100 2.5539 × 101 4.8318 × 100 0.0000 × 100 0.0000 × 100
DECCWOA10 0.0000 × 100 0.0000 × 100 2.6489 × 101 3.4054 × 10−1 0.0000 × 100 0.0000 × 100
225
Electronics 2022, 11, 4224
Table A2. Cont.
F7 F8 F9
avg std avg std avg std
DECCWOA1 1.6842 × 10−4 2.7932 × 10−4 −1.3963 × 104 5.1858 × 103 0.0000 × 100 0.0000 × 100
DECCWOA2 1.5645 × 10−4 1.7877 × 10−4 −1.2595 × 104 1.3910 × 102 0.0000 × 100 0.0000 × 100
DECCWOA3 6.6910 × 10−5 9.9764 × 10−5 −1.2619 × 104 2.7031 × 102 0.0000 × 100 0.0000 × 100
DECCWOA4 1.0031 × 10−4 1.4658 × 10−4 −1.2530 × 104 5.3042 × 102 0.0000 × 100 0.0000 × 100
DECCWOA5 8.9743 × 10−5 1.0676 × 10−4 −1.3512 × 104 5.1597 × 103 0.0000 × 100 0.0000 × 100
DECCWOA6 5.2519 × 10−5 5.3764 × 10−5 −1.2569 × 104 1.9404 × 10−12 0.0000 × 100 0.0000 × 100
DECCWOA7 6.4531 × 10−5 6.4938 × 10−5 −1.3485 × 104 2.8423 × 103 0.0000 × 100 0.0000 × 100
DECCWOA8 4.0419 × 10−5 5.3492 × 10−5 −1.2805 × 104 9.0308 × 102 0.0000 × 100 0.0000 × 100
DECCWOA9 6.3101 × 10−5 7.7305 × 10−5 −1.2569 × 104 2.0267 × 10−12 0.0000 × 100 0.0000 × 100
DECCWOA10 3.8169 × 10−5 6.1534 × 10−5 −1.2673 × 104 2.7066 × 102 0.0000 × 100 0.0000 × 100
F10 F11 F12
avg std avg std avg std
DECCWOA1 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.5705 × 10−32 5.5674 × 10−48
DECCWOA2 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.5705 × 10−32 5.5674 × 10−48
DECCWOA3 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.5705 × 10−32 5.5674 × 10−48
DECCWOA4 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.5705 × 10−32 5.5674 × 10−48
DECCWOA5 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.5705 × 10−32 5.5674 × 10−48
DECCWOA6 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.5705 × 10−32 5.5674 × 10−48
DECCWOA7 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.5705 × 10−32 5.5674 × 10−48
DECCWOA8 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.5705 × 10−32 5.5674 × 10−48
DECCWOA9 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.5705 × 10−32 5.5674 × 10−48
DECCWOA10 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.5705 × 10−32 5.5674 × 10−48
F13 F14 F15
avg std avg std avg std
DECCWOA1 1.3498 × 10−32 5.5674 × 10−48 3.6810 × 106 2.7334 × 106 1.3342 × 105 1.9982 × 105
DECCWOA2 1.3498 × 10−32 5.5674 × 10−48 5.1469 × 106 3.7469 × 106 2.2654 × 105 3.0564 × 105
DECCWOA3 1.3498 × 10−32 5.5674 × 10−48 1.6507 × 107 1.0130 × 107 9.4042 × 107 8.6776 × 107
DECCWOA4 1.3498 × 10−32 5.5674 × 10−48 7.2801 × 106 5.0765 × 106 8.7941 × 106 7.2596 × 106
DECCWOA5 1.3498 × 10−32 5.5674 × 10−48 1.1619 × 107 7.8606 × 106 3.3924 × 107 2.5699 × 107
DECCWOA6 1.3498 × 10−32 5.5674 × 10−48 1.2238 × 107 8.2473 × 106 7.4207 × 107 5.2159 × 107
DECCWOA7 1.3498 × 10−32 5.5674 × 10−48 2.5408 × 107 1.2932 × 107 1.5504 × 108 1.0836 × 108
DECCWOA8 1.3498 × 10−32 5.5674 × 10−48 2.9064 × 107 1.2592 × 107 3.1493 × 108 3.1857 × 108
DECCWOA9 1.3498 × 10−32 5.5674 × 10−48 2.7983 × 107 1.7994 × 107 4.3963 × 108 5.9410 × 108
DECCWOA10 1.3498 × 10−32 5.5674 × 10−48 4.0140 × 107 2.8456 × 107 6.8723 × 108 7.6542 × 108
F16 F17 F18
avg std avg std avg std
DECCWOA1 7.4819 × 103 4.6257 × 103 4.9577 × 102 4.4816 × 101 5.2004 × 102 4.4169 × 10−2
DECCWOA2 5.3970 × 103 5.6834 × 103 5.2284 × 102 4.4110 × 101 5.2009 × 102 4.7541 × 10−2
DECCWOA3 5.5074 × 103 3.3963 × 103 5.9759 × 102 5.0184 × 101 5.2036 × 102 1.4114 × 10−1
DECCWOA4 4.7987 × 103 4.0122 × 103 5.5522 × 102 5.6453 × 101 5.2019 × 102 9.2319 × 10−2
DECCWOA5 3.9879 × 103 2.8027 × 103 5.6621 × 102 4.6593 × 101 5.2029 × 102 1.0546 × 10−1
DECCWOA6 4.7947 × 103 3.8454 × 103 6.0512 × 102 3.7665 × 101 5.2031 × 102 1.4175 × 10−1
DECCWOA7 4.7025 × 103 3.4303 × 103 6.4612 × 102 5.0034 × 101 5.2039 × 102 1.4396 × 10−1
DECCWOA8 5.7773 × 103 3.8347 × 103 6.9438 × 102 9.0009 × 101 5.2033 × 102 1.7149 × 10−1
DECCWOA9 6.8194 × 103 3.9312 × 103 6.7202 × 102 7.1887 × 101 5.2035 × 102 1.6351 × 10−1
DECCWOA10 7.6046 × 103 2.9400 × 103 6.9534 × 102 7.7239 × 101 5.2038 × 102 1.7225 × 10−1
226
Electronics 2022, 11, 4224
Table A2. Cont.
F19 F20 F21
avg std avg std avg std
DECCWOA1 6.2052 × 102 3.2852 × 100 7.0040 × 102 2.2886 × 10−1 8.0287 × 102 1.0273 × 101
DECCWOA2 6.1946 × 102 2.9290 × 100 7.0052 × 102 2.0981 × 10−1 8.1110 × 102 2.0103 × 101
DECCWOA3 6.2495 × 102 2.9171 × 100 7.0250 × 102 8.3283 × 10−1 8.7716 × 102 1.8311 × 101
DECCWOA4 6.2184 × 102 2.6694 × 100 7.0111 × 102 7.1368 × 10−2 8.2441 × 102 7.7346 × 100
DECCWOA5 6.2371 × 102 2.6632 × 100 7.0164 × 102 4.2137 × 10−1 8.4642 × 102 1.7780 × 101
DECCWOA6 6.2456 × 102 3.2157 × 100 7.0230 × 102 8.4958 × 10−1 8.7407 × 102 2.4081 × 101
DECCWOA7 6.2621 × 102 3.2713 × 100 7.0300 × 102 8.7250 × 10−1 8.9713 × 102 1.9802 × 101
DECCWOA8 6.2840 × 102 3.4007 × 100 7.0506 × 102 2.9144 × 100 9.1581 × 102 1.9967 × 101
DECCWOA9 6.2897 × 102 3.4733 × 100 7.0619 × 102 2.5650 × 100 9.2703 × 102 2.5100 × 101
DECCWOA10 6.2933 × 102 3.7025 × 100 7.0753 × 102 3.4438 × 100 9.4279 × 102 2.4986 × 101
F22 F23 F24
avg std avg std avg std
DECCWOA1 1.0312 × 103 2.7380 × 101 1.0420 × 103 1.1886 × 102 3.9026 × 103 6.5371 × 102
DECCWOA2 1.0377 × 103 3.4427 × 101 1.0510 × 103 7.9342 × 101 4.1202 × 103 7.1968 × 102
DECCWOA3 1.0545 × 103 3.3397 × 101 1.7059 × 103 3.0416 × 102 5.3301 × 103 4.9187 × 102
DECCWOA4 1.0420 × 103 3.5382 × 101 1.1956 × 103 2.0676 × 102 4.2088 × 103 6.4091 × 102
DECCWOA5 1.0502 × 103 2.9746 × 101 1.4485 × 103 4.7609 × 102 4.9060 × 103 7.5372 × 102
DECCWOA6 1.0708 × 103 2.3208 × 101 1.6654 × 103 3.5966 × 102 5.0839 × 103 7.4254 × 102
DECCWOA7 1.0725 × 103 2.9966 × 101 2.4340 × 103 3.6991 × 102 5.5460 × 103 6.9622 × 102
DECCWOA8 1.0867 × 103 3.0093 × 101 2.8661 × 103 5.7401 × 102 5.6002 × 103 5.3783 × 102
DECCWOA9 1.0862 × 103 2.9502 × 101 3.4724 × 103 6.7538 × 102 5.6526 × 103 7.8496 × 102
DECCWOA10 1.0860 × 103 3.5118 × 101 3.7201 × 103 5.3438 × 102 5.6708 × 103 5.7142 × 102
F25 F26 F27
avg std avg std avg std
DECCWOA1 1.2002 × 103 6.7099 × 10−2 1.3005 × 103 1.5439 × 10−1 1.4003 × 103 4.8887 × 10−2
DECCWOA2 1.2002 × 103 6.0385 × 10−2 1.3005 × 103 1.1841 × 10−1 1.4003 × 103 5.5441 × 10−2
DECCWOA3 1.2008 × 103 2.9906 × 10−1 1.3005 × 103 1.1364 × 10−1 1.4003 × 103 4.0852 × 10−2
DECCWOA4 1.2004 × 103 1.2088 × 10−1 1.3005 × 103 1.3836 × 10−1 1.4003 × 103 1.9112 × 10−1
DECCWOA5 1.2005 × 103 1.9004 × 10−1 1.3005 × 103 1.0714 × 10−1 1.4003 × 103 5.7154 × 10−2
DECCWOA6 1.2008 × 103 2.5696 × 10−1 1.3005 × 103 9.5896 × 10−2 1.4003 × 103 1.0255 × 10−1
DECCWOA7 1.2010 × 103 3.2942 × 10−1 1.3005 × 103 1.1984 × 10−1 1.4003 × 103 1.7872 × 10−1
DECCWOA8 1.2011 × 103 3.7909 × 10−1 1.3005 × 103 1.3301 × 10−1 1.4004 × 103 6.0314 × 10−1
DECCWOA9 1.2012 × 103 3.9281 × 10−1 1.3006 × 103 1.4510 × 10−1 1.4003 × 103 5.1310 × 10−2
DECCWOA10 1.2014 × 103 4.0093 × 10−1 1.3005 × 103 1.1885 × 10−1 1.4004 × 103 1.7136 × 10−1
F28 F29 F30
avg std avg std avg std
DECCWOA1 1.5176 × 103 6.4897 × 100 1.6104 × 103 6.8683 × 10−1 1.9247 × 106 1.1101 × 106
DECCWOA2 1.5189 × 103 7.4912 × 100 1.6104 × 103 7.6782 × 10−1 1.5103 × 106 1.1011 × 106
DECCWOA3 1.5422 × 103 1.3549 × 101 1.6115 × 103 6.7294 × 10−1 1.9418 × 106 1.2814 × 106
DECCWOA4 1.5266 × 103 6.5567 × 100 1.6110 × 103 6.9374 × 10−1 1.7005 × 106 9.1883 × 105
DECCWOA5 1.5304 × 103 9.0407 × 100 1.6113 × 103 6.2976 × 10−1 1.8482 × 106 1.1135 × 106
DECCWOA6 1.5424 × 103 1.2171 × 101 1.6116 × 103 5.9848 × 10−1 1.9396 × 106 1.2724 × 106
DECCWOA7 1.6047 × 103 2.9073 × 102 1.6119 × 103 6.5689 × 10−1 2.0687 × 106 1.2220 × 106
DECCWOA8 1.5684 × 103 3.2783 × 101 1.6120 × 103 4.3100 × 10−1 2.2597 × 106 1.5545 × 106
DECCWOA9 1.5970 × 103 4.5170 × 101 1.6121 × 103 6.1504 × 10−1 2.2349 × 106 1.2776 × 106
DECCWOA10 1.6376 × 103 9.5739 × 101 1.6119 × 103 7.4369 × 10−1 2.4610 × 106 1.6436 × 106
227
Electronics 2022, 11, 4224
Table A2. Cont.
F31 F32 F33
avg std avg std avg std
DECCWOA1 5.8087 × 103 6.2358 × 103 1.9179 × 103 2.6069 × 101 1.4137 × 104 7.6746 × 103
DECCWOA2 4.8867 × 103 3.6023 × 103 1.9189 × 103 2.3237 × 101 8.3832 × 103 5.6464 × 103
DECCWOA3 4.0166 × 103 2.5970 × 103 1.9215 × 103 2.4809 × 101 5.5742 × 103 2.6752 × 103
DECCWOA4 5.2173 × 103 3.9350 × 103 1.9267 × 103 3.4926 × 101 4.9997 × 103 2.4000 × 103
DECCWOA5 4.9446 × 103 4.1973 × 103 1.9262 × 103 2.9792 × 101 4.5639 × 103 2.0732 × 103
DECCWOA6 4.5409 × 103 2.8935 × 103 1.9239 × 103 2.2044 × 101 5.0427 × 103 2.4608 × 103
DECCWOA7 4.7751 × 103 2.8190 × 103 1.9279 × 103 2.2825 × 101 4.5396 × 103 1.8457 × 103
DECCWOA8 4.6894 × 104 2.3224 × 105 1.9358 × 103 3.7797 × 101 4.8777 × 103 1.6024 × 103
DECCWOA9 7.0415 × 103 9.3191 × 103 1.9284 × 103 2.5490 × 101 4.5525 × 103 2.1545 × 103
DECCWOA10 6.2462 × 103 9.1482 × 103 1.9295 × 103 2.4829 × 101 3.7338 × 103 1.6768 × 103
Overall rank F34 F35 overall
avg std avg std +/−/= rank
DECCWOA1 8.6335 × 105 6.2796 × 105 2.8860 × 103 2.2542 × 102 ~ 2
DECCWOA2 7.0965 × 105 6.4048 × 105 2.7590 × 103 1.9713 × 102 4/3/28 1
DECCWOA3 8.1850 × 105 6.4237 × 105 2.6856 × 103 1.9951 × 102 14/3/18 6
DECCWOA4 8.3727 × 105 6.0484 × 105 2.8021 × 103 1.8728 × 102 12/2/21 5
DECCWOA5 7.2517 × 105 6.6623 × 105 2.7406 × 103 2.2485 × 102 14/4/17 3
DECCWOA6 5.9730 × 105 4.4486 × 105 2.7219 × 103 1.8356 × 102 14/5/16 4
DECCWOA7 6.4163 × 105 4.3900 × 105 2.6995 × 103 2.0571 × 102 14/4/17 7
DECCWOA8 7.0675 × 105 6.1652 × 105 2.7178 × 103 1.9634 × 102 15/4/16 8
DECCWOA9 6.4914 × 105 5.4887 × 105 2.7793 × 103 1.9480 × 102 17/2/16 9
DECCWOA10 5.9732 × 105 4.7600 × 105 2.7603 × 103 2.1609 × 102 16/2/17 10
Table A3. Comparison results for the introduced mechanisms.
F1 F2 F3
avg std avg std avg std
DECCWOA 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 4.1255 × 10−18 2.1806 × 10−17
DEWOA 1.2420 × 10−10 3.9129 × 10−10 8.5083 × 10−6 1.4067 × 10−5 7.8264 × 103 1.2145 × 104
CCWOA 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100
WOA 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 3.2071 × 101 6.1783 × 101
F4 F5 F6
avg std avg std avg std
DECCWOA 0.0000 × 100 0.0000 × 100 2.5968 × 101 3.5258 × 10−1 0.0000 × 100 0.0000 × 100
DEWOA 6.3178 × 10−3 1.5936 × 10−2 4.4319 × 10−3 4.7769 × 10−3 9.6180 × 10−5 1.2811 × 10−4
CCWOA 0.0000 × 100 0.0000 × 100 2.2483 × 101 6.1153 × 100 1.1597 × 10−11 1.3565 × 10−11
WOA 7.5414 × 100 1.7526 × 101 2.3562 × 101 4.4675 × 100 4.7799 × 10−6 1.8846 × 10−6
F7 F8 F9
avg std avg std avg std
DECCWOA 1.0328 × 10−4 1.7676 × 10−4 −1.2783 × 104 8.3042 × 102 0.0000 × 100 0.0000 × 100
DEWOA 3.4741 × 10−3 5.8983 × 10−3 −1.4406 × 104 4.9552 × 103 6.2111 × 10−10 8.6723 × 10−10
CCWOA 1.7804 × 10−5 3.0937 × 10−5 −1.2569 × 104 5.6938 × 10−7 0.0000 × 100 0.0000 × 100
WOA 1.5818 × 10−4 1.8724 × 10−4 −1.2236 × 104 8.6401 × 102 0.0000 × 100 0.0000 × 100
228
Electronics 2022, 11, 4224
Table A3. Cont.
F10 F11 F12
avg std avg std avg std
DECCWOA 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.5705 × 10−32 5.5674 × 10−48
DEWOA 4.8353 × 10−6 1.1226 × 10−5 6.9380 × 10−7 3.7853 × 10−6 7.0591 × 10−6 9.9086 × 10−6
CCWOA 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.6821 × 10−12 2.1310 × 10−12
WOA 3.6119 × 10−15 1.7906 × 10−15 2.7668 × 10−4 1.5155 × 10−3 2.1111 × 10−4 1.1507 × 10−3
F13 F14 F15
avg std avg std avg std
DECCWOA 1.3498 × 10−32 5.5674 × 10−48 4.6009 × 106 3.5694 × 106 1.5068 × 105 1.7046 × 105
DEWOA 1.3742 × 10−4 2.1617 × 10−4 4.5118 × 107 3.3352 × 107 2.6842 × 109 2.2525 × 109
CCWOA 2.2806 × 10−11 2.1476 × 10−11 1.0815 × 107 7.8011 × 106 6.3006 × 106 3.9908 × 106
WOA 1.1255 × 10−3 3.3493 × 10−3 3.3488 × 107 1.7699 × 107 3.8002 × 106 7.5915 × 106
F16 F17 F18
avg std avg std avg std
DECCWOA 6.2884 × 103 4.0514 × 103 4.9673 × 102 3.4575 × 101 5.2008 × 102 5.6636 × 10−2
DEWOA 3.6134 × 104 3.3572 × 104 8.0754 × 102 1.5372 × 102 5.2033 × 102 2.2602 × 10−1
CCWOA 5.8371 × 103 3.4122 × 103 5.3911 × 102 5.8876 × 101 5.2032 × 102 8.7776 × 10−2
WOA 3.6143 × 104 2.3682 × 104 5.8016 × 102 5.5983 × 101 5.2032 × 102 1.6884 × 10−1
F19 F20 F21
avg std avg std avg std
DECCWOA 6.1813 × 102 3.3345 × 100 7.0050 × 102 1.8285 × 10−1 8.0336 × 102 5.5434 × 100
DEWOA 6.4146 × 102 2.3442 × 100 7.1656 × 102 1.1726 × 101 9.7436 × 102 2.7480 × 101
CCWOA 6.2191 × 102 3.1893 × 100 7.0106 × 102 1.1101 × 10−1 8.2734 × 102 1.6890 × 101
WOA 6.3521 × 102 3.8342 × 100 7.0102 × 102 7.0807 × 10−2 9.8601 × 102 3.9020 × 101
F22 F23 F24
avg std avg std avg std
DECCWOA 1.0398 × 103 4.1688 × 101 1.0459 × 103 8.8217 × 101 3.7945 × 103 5.1310 × 102
DEWOA 1.1215 × 103 3.4240 × 101 5.3843 × 103 9.7624 × 102 7.0285 × 103 1.3163 × 103
CCWOA 1.0486 × 103 3.6153 × 101 1.3579 × 103 7.6567 × 102 4.2859 × 103 5.9815 × 102
WOA 1.1285 × 103 5.7638 × 101 4.9219 × 103 6.8542 × 102 5.7481 × 103 9.5752 × 102
DECCWOA 1.0398 × 103 4.1688 × 101 1.0459 × 103 8.8217 × 101 3.7945 × 103 5.1310 × 102
F25 F26 F27
avg std avg std avg std
DECCWOA 1.2002 × 103 7.7530 × 10−2 1.3005 × 103 1.0640 × 10−1 1.4003 × 103 5.7690 × 10−2
DEWOA 1.2026 × 103 6.7176 × 10−1 1.3011 × 103 8.8278 × 10−1 1.4032 × 103 6.9794 × 100
CCWOA 1.2007 × 103 1.9439 × 10−1 1.3005 × 103 1.0762 × 10−1 1.4003 × 103 5.6885 × 10−2
WOA 1.2017 × 103 5.8032 × 10−1 1.3005 × 103 1.4025 × 10−1 1.4003 × 103 4.6882 × 10−2
F28 F29 F30
avg std avg std avg std
DECCWOA 1.5215 × 103 7.2851 × 100 1.6105 × 103 5.6166 × 10−1 1.6567 × 106 1.2704 × 106
DEWOA 3.9455 × 103 1.8290 × 103 1.6129 × 103 5.3817 × 10−1 5.2403 × 106 3.8043 × 106
CCWOA 1.5263 × 103 7.8018 × 100 1.6111 × 103 5.3599 × 10−1 2.3769 × 106 1.7422 × 106
WOA 1.5710 × 103 2.7076 × 101 1.6124 × 103 6.2114 × 10−1 3.8096 × 106 3.0597 × 106
229
Electronics 2022, 11, 4224
Table A3. Cont.
F31 F32 F33
avg std avg std avg std
DECCWOA 6.8401 × 103 6.1595 × 103 1.9156 × 103 1.7561 × 101 8.1086 × 103 4.1891 × 103
DEWOA 1.1805 × 104 1.9283 × 104 2.0808 × 103 7.9264 × 101 2.3551 × 104 1.9203 × 104
CCWOA 1.5061 × 104 2.0280 × 104 1.9305 × 103 3.7604 × 101 5.3268 × 103 3.0310 × 103
WOA 6.2265 × 103 4.2908 × 103 1.9415 × 103 3.6716 × 101 2.3634 × 104 1.4518 × 104
Overall rank F34 F35 overall
avg std avg std +/−/= rank
DECCWOA 7.8180 × 105 6.8802 × 105 2.8140 × 103 2.4485 × 102 ~ 1
DEWOA 1.1914 × 106 1.0362 × 106 3.3508 × 103 3.5303 × 102 31/1/3 4
CCWOA 5.8255 × 105 4.9559 × 105 2.7967 × 103 1.7716 × 102 18/4/13 2
WOA 1.3452 × 106 1.6988 × 106 3.0734 × 103 2.6034 × 102 25/1/9 3
Table A4. Comparison results for the DECCWOA with improved WOA versions.
F1 F2 F3
avg std avg std avg std
DECCWOA 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 2.7777 × 10−18 1.2942 × 10−17
RDWOA 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100
ACWOA 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100
CCMWOA 0.0000 × 100 0.0000 × 100 4.7501 × 10−286 0.0000 × 100 0.0000 × 100 0.0000 × 100
CWOA 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 6.9438 × 100 1.0312 × 101
BMWOA 9.0723 × 10−4 1.2467 × 10−3 7.9729 × 10−3 7.3643 × 10−3 2.4579 × 10−1 7.2733 × 10−1
BWOA 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100
LWOA 4.9293 × 10−2 1.1696 × 10−2 1.0756 × 100 1.8737 × 10−1 1.8394 × 101 4.5449 × 100
IWOA 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 8.8944 × 101 1.3312 × 102
F4 F5 F6
avg std avg std avg std
DECCWOA 0.0000 × 100 0.0000 × 100 2.4313 × 101 6.6194 × 100 0.0000 × 100 0.0000 × 100
RDWOA 0.0000 × 100 0.0000 × 100 1.8882 × 101 5.1359 × 100 5.1469 × 10−15 3.2926 × 10−15
ACWOA 0.0000 × 100 0.0000 × 100 2.4274 × 101 4.5690 × 100 6.3093 × 10−4 2.1127 × 10−4
CCMWOA 4.3891 × 10−289 0.0000 × 100 2.7607 × 100 7.6225 × 100 2.0854 × 10−2 8.2250 × 10−3
CWOA 8.4827 × 100 1.6542 × 101 2.5501 × 101 1.5480 × 100 1.0737 × 10−1 1.6796 × 10−1
BMWOA 4.4563 × 10−3 6.7037 × 10−3 1.2474 × 10−2 3.0382 × 10−2 1.2974 × 10−3 1.8541 × 10−3
BWOA 0.0000 × 100 0.0000 × 100 2.3788 × 101 6.4677 × 100 1.3716 × 10−4 5.6219 × 10−5
LWOA 3.5964 × 10−1 9.6483 × 10−2 4.8931 × 101 4.4527 × 101 5.8005 × 10−2 1.4408 × 10−2
IWOA 3.0373 × 10−4 1.4320 × 10−3 2.3521 × 101 7.0061 × 10−1 3.5922 × 10−6 1.7322 × 10−6
F7 F8 F9
avg std avg std avg std
DECCWOA 1.7008 × 10−4 2.2308 × 10−4 −1.2569 × 104 2.8058 × 10−12 0.0000 × 100 0.0000 × 100
RDWOA 2.8442 × 10−5 3.6777 × 10−5 −1.2521 × 104 1.6733 × 102 0.0000 × 100 0.0000 × 100
ACWOA 5.6623 × 10−6 5.7698 × 10−6 −1.2569 × 104 2.1881 × 10−3 0.0000 × 100 0.0000 × 100
CCMWOA 1.9668 × 10−4 1.6220 × 10−4 −1.0928 × 104 9.5870 × 102 0.0000 × 100 0.0000 × 100
CWOA 3.1139 × 10−4 3.9744 × 10−4 −1.1583 × 104 1.6942 × 103 0.0000 × 100 0.0000 × 100
BMWOA 1.0619 × 10−3 8.6629 × 10−4 −1.2569 × 104 2.9396 × 10−3 6.3549 × 10−4 1.1849 × 10−3
BWOA 2.5018 × 10−5 3.0399 × 10−5 −1.2357 × 104 4.2512 × 102 0.0000 × 100 0.0000 × 100
LWOA 1.2178 × 10−1 4.6795 × 10−2 −1.2382 × 104 4.4862 × 102 1.0110 × 102 2.6929 × 101
IWOA 2.6929 × 10−4 3.2479 × 10−4 −1.2298 × 104 7.5775 × 102 0.0000 × 100 0.0000 × 100
230
Electronics 2022, 11, 4224
Table A4. Cont.
F10 F11 F12
avg std avg std avg std
DECCWOA 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.5705 × 10−32 5.5674 × 10−48
RDWOA 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 2.1668 × 10−7 1.1868 × 10−6
ACWOA 1.0066 × 10−15 6.4863 × 10−16 0.0000 × 100 0.0000 × 100 6.7416 × 10−5 1.9647 × 10−5
CCMWOA 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 7.8157 × 10−4 3.6365 × 10−4
CWOA 3.0198 × 10−15 2.0010 × 10−15 0.0000 × 100 0.0000 × 100 4.4206 × 10−3 6.6548 × 10−3
BMWOA 5.1495 × 10−3 4.7013 × 10−3 2.1417 × 10−3 4.0514 × 10−3 1.5181 × 10−5 2.4654 × 10−5
BWOA 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.8415 × 10−5 6.4484 × 10−6
LWOA 6.6177 × 10−1 6.9724 × 10−1 1.4973 × 10−2 1.3048 × 10−2 5.5931 × 10−1 1.1387 × 100
IWOA 2.5461 × 10−15 2.0298 × 10−15 1.8892 × 10−3 1.0348 × 10−2 5.1354 × 10−7 1.4075 × 10−7
F13 F14 F15
avg std avg std avg std
DECCWOA 1.3498 × 10−32 5.5674 × 10−48 5.3971 × 106 4.3864 × 106 1.1568 × 105 1.0038 × 105
RDWOA 3.6625 × 10−4 2.0060 × 10−3 1.0435 × 107 6.2580 × 106 2.2927 × 107 2.8097 × 107
ACWOA 2.5808 × 10−3 4.6664 × 10−3 1.4456 × 108 5.9824 × 107 7.4176 × 109 4.5829 × 109
CCMWOA 6.6551 × 10−4 7.9798 × 10−4 3.1814 × 108 1.2548 × 108 3.0720 × 1010 7.7697 × 109
CWOA 5.3049 × 10−1 4.3677 × 10−1 6.6829 × 107 4.6037 × 107 2.0499 × 109 2.4020 × 109
BMWOA 1.2733 × 10−4 2.2038 × 10−4 1.0438 × 108 3.7729 × 107 2.8151 × 108 1.3106 × 108
BWOA 3.3556 × 10−3 5.0182 × 10−3 6.4289 × 107 2.9224 × 107 2.4303 × 108 1.3580 × 108
LWOA 2.1065 × 10−2 7.2157 × 10−3 3.7558 × 106 1.3953 × 106 5.2308 × 105 1.5679 × 105
IWOA 9.8357 × 10−6 9.6866 × 10−6 2.4173 × 107 1.2055 × 107 2.1211 × 106 3.5049 × 106
F16 F17 F18
avg std avg std avg std
DECCWOA 4.0353 × 103 2.8694 × 103 4.9768 × 102 4.3913 × 101 5.2008 × 102 6.1713 × 10−2
RDWOA 6.3763 × 103 3.2741 × 103 5.3428 × 102 3.9426 × 101 5.2012 × 102 1.1564 × 10−1
ACWOA 5.0442 × 104 6.7503 × 103 1.2586 × 103 2.9833 × 102 5.2085 × 102 1.1588 × 10−1
CCMWOA 5.9083 × 104 9.2658 × 103 2.7400 × 103 1.0666 × 103 5.2088 × 102 1.7053 × 10−1
CWOA 5.7234 × 104 3.7392 × 104 8.0857 × 102 2.2460 × 102 5.2029 × 102 1.3417 × 10−1
BMWOA 5.7008 × 104 9.2535 × 103 6.7153 × 102 6.3683 × 101 5.2097 × 102 9.6222 × 10−2
BWOA 3.2197 × 104 1.0637 × 104 6.9451 × 102 7.2749 × 101 5.2067 × 102 1.7262 × 10−1
LWOA 1.0354 × 103 4.9837 × 102 5.0374 × 102 4.8236 × 101 5.2048 × 102 9.4869 × 10−2
IWOA 1.6513 × 104 9.7529 × 103 5.7401 × 102 6.2791 × 101 5.2023 × 102 1.3567 × 10−1
F19 F20 F21
avg std avg std avg std
DECCWOA 6.1886 × 102 2.8176 × 100 7.0051 × 102 2.4043 × 10−1 8.0268 × 102 2.9674 × 100
RDWOA 6.2296 × 102 3.2376 × 100 7.0097 × 102 2.3043 × 10−1 8.4662 × 102 1.2443 × 101
ACWOA 6.3380 × 102 2.8192 × 100 7.4705 × 102 2.6949 × 101 9.9173 × 102 2.8423 × 101
CCMWOA 6.3421 × 102 3.1895 × 100 9.1058 × 102 6.8146 × 101 1.0329 × 103 2.5834 × 101
CWOA 6.3619 × 102 2.3328 × 100 7.1987 × 102 1.9833 × 101 9.8919 × 102 3.5017 × 101
BMWOA 6.3209 × 102 3.4550 × 100 7.0298 × 102 7.9463 × 10−1 9.6429 × 102 2.2995 × 101
BWOA 6.3659 × 102 2.7733 × 100 7.0210 × 102 4.7824 × 10−1 9.6653 × 102 2.0133 × 101
LWOA 6.2990 × 102 3.7057 × 100 7.0071 × 102 1.0660 × 10−1 8.7689 × 102 1.4956 × 101
IWOA 6.2837 × 102 3.5182 × 100 7.0086 × 102 1.8091 × 10−1 9.1853 × 102 2.3903 × 101
231
Electronics 2022, 11, 4224
Table A4. Cont.
F22 F23 F24
avg std avg std avg std
DECCWOA 1.0349 × 103 3.5053 × 101 1.0502 × 103 7.2638 × 101 3.9773 × 103 5.2239 × 102
RDWOA 1.0862 × 103 3.9406 × 101 1.6401 × 103 2.1508 × 102 4.8765 × 103 4.8011 × 102
ACWOA 1.1353 × 103 2.7084 × 101 4.6113 × 103 7.8646 × 102 6.0951 × 103 8.4619 × 102
CCMWOA 1.1585 × 103 2.0571 × 101 5.7676 × 103 4.6957 × 102 7.0634 × 103 8.3597 × 102
CWOA 1.1502 × 103 5.9550 × 101 5.0935 × 103 8.0866 × 102 6.4607 × 103 8.0167 × 102
BMWOA 1.1247 × 103 3.0558 × 101 4.7543 × 103 7.0975 × 102 7.1260 × 103 9.0188 × 102
BWOA 1.1033 × 103 2.3404 × 101 4.8599 × 103 7.9435 × 102 6.5557 × 103 1.0588 × 103
LWOA 1.1231 × 103 4.1332 × 101 2.1055 × 103 5.0404 × 102 5.3203 × 103 5.2375 × 102
IWOA 1.1290 × 103 5.0219 × 101 2.6021 × 103 4.6117 × 102 5.5791 × 103 7.2655 × 102
F25 F26 F27
avg std avg std avg std
DECCWOA 1.2002 × 103 5.1670 × 10−2 1.3005 × 103 1.1585 × 10−1 1.4003 × 103 4.7444 × 10−2
RDWOA 1.2005 × 103 1.8157 × 10−1 1.3005 × 103 1.0242 × 10−1 1.4002 × 103 3.7231 × 10−2
ACWOA 1.2017 × 103 5.3455 × 10−1 1.3011 × 103 8.3617 × 10−1 1.4239 × 103 1.2976 × 101
CCMWOA 1.2018 × 103 4.5129 × 10−1 1.3041 × 103 8.3728 × 10−1 1.4661 × 103 1.6380 × 101
CWOA 1.2018 × 103 5.2022 × 10−1 1.3006 × 103 1.2049 × 10−1 1.4102 × 103 1.2849 × 101
BMWOA 1.2023 × 103 4.1490 × 10−1 1.3005 × 103 1.1904 × 10−1 1.4003 × 103 1.0699 × 10−1
BWOA 1.2019 × 103 4.8775 × 10−1 1.3005 × 103 1.3303 × 10−1 1.4003 × 103 4.2027 × 10−2
LWOA 1.2008 × 103 3.0020 × 10−1 1.3005 × 103 1.1102 × 10−1 1.4003 × 103 9.9959 × 10−2
IWOA 1.2010 × 103 2.9781 × 10−1 1.3005 × 103 9.8276 × 10−2 1.4003 × 103 5.2298 × 10−2
F28 F29 F30
avg std avg std avg std
DECCWOA 1.5195 × 103 5.8976 × 100 1.6103 × 103 7.8355 × 10−1 1.4951 × 106 1.0794 × 106
RDWOA 1.5215 × 103 7.2912 × 100 1.6116 × 103 5.9134 × 10−1 1.1935 × 106 1.0797 × 106
ACWOA 1.8396 × 103 4.0931 × 102 1.6121 × 103 4.8464 × 10−1 1.3124 × 107 8.0308 × 106
CCMWOA 7.0062 × 103 4.0693 × 103 1.6130 × 103 3.2081 × 10−1 2.6816 × 107 1.9260 × 107
CWOA 1.9731 × 103 8.2350 × 102 1.6127 × 103 5.6484 × 10−1 9.8463 × 106 8.8774 × 106
BMWOA 1.5828 × 103 3.6612 × 101 1.6126 × 103 2.1626 × 10−1 6.9174 × 106 4.9113 × 106
BWOA 1.6258 × 103 4.8685 × 101 1.6124 × 103 4.8342 × 10−1 7.5640 × 106 5.4938 × 106
LWOA 1.5213 × 103 4.9669 × 100 1.6125 × 103 5.6375 × 10−1 4.9220 × 105 2.9566 × 105
IWOA 1.5506 × 103 1.6210 × 101 1.6125 × 103 5.1867 × 10−1 2.7873 × 106 2.0454 × 106
F31 F32 F33
avg std avg std avg std
DECCWOA 9.2541 × 103 2.1036 × 104 1.9198 × 103 2.4744 × 101 8.8237 × 103 5.3819 × 103
RDWOA 4.8557 × 103 3.4855 × 103 1.9194 × 103 2.6942 × 101 6.7743 × 103 3.5180 × 103
ACWOA 4.4984 × 107 4.3109 × 107 2.0047 × 103 3.3162 × 101 3.7129 × 104 1.9130 × 104
CCMWOA 9.8440 × 107 1.2615 × 108 2.0824 × 103 5.0281 × 101 5.7205 × 104 2.2855 × 104
CWOA 3.9424 × 106 1.2057 × 107 2.0018 × 103 6.3131 × 101 5.7907 × 104 5.9437 × 104
BMWOA 1.1037 × 105 1.2099 × 105 1.9467 × 103 4.0178 × 101 3.3436 × 104 1.7890 × 104
BWOA 1.1889 × 105 3.5142 × 105 1.9593 × 103 3.8145 × 101 3.2143 × 104 1.6907 × 104
LWOA 1.0695 × 104 5.9845 × 103 1.9230 × 103 2.4187 × 101 3.0576 × 103 7.5160 × 102
IWOA 5.4855 × 103 4.2910 × 103 1.9348 × 103 3.5960 × 101 1.6411 × 104 1.0072 × 104
232
Electronics 2022, 11, 4224
Table A4. Cont.
Overall rank F34 F35 overall
avg std avg std +/−/= rank
DECCWOA 1.0426 × 106 8.4796 × 105 2.8721 × 103 2.1610 × 102 ~ 1
RDWOA 4.2175 × 105 3.3446 × 105 2.7874 × 103 2.1665 × 102 16/6/13 2
ACWOA 4.2559 × 106 3.6243 × 106 3.0278 × 103 2.2024 × 102 26/3/6 6
CCMWOA 8.7004 × 106 5.9791 × 106 3.2984 × 103 4.4928 × 102 28/2/5 9
CWOA 3.1633 × 106 2.9730 × 106 3.1092 × 103 2.3259 × 102 29/0/6 8
BMWOA 1.0736 × 106 9.0915 × 105 3.0014 × 103 2.7107 × 102 32/1/2 7
BWOA 1.9551 × 106 1.5899 × 106 2.9774 × 103 2.8735 × 102 23/3/9 4
LWOA 2.0517 × 105 1.6837 × 105 2.9007 × 103 2.4887 × 102 26/4/5 5
IWOA 9.3081 × 105 7.7249 × 105 2.9329 × 103 1.7696 × 102 24/1/10 3
Table A5. Comparison results for the DECCWOA with advanced algorithms.
F1 F2 F3
avg std avg std avg std
DECCWOA 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.0221 × 10−18 4.2975 × 10−18
IGWO 0.0000 × 100 0.0000 × 100 3.6328 × 10−261 0.0000 × 100 1.3124 × 10−86 7.1881 × 10−86
OBLGWO 0.0000 × 100 0.0000 × 100 3.6589 × 10−142 2.004 × 10−141 6.2014 × 10−293 0.0000 × 100
CGPSO 2.3583 × 10−8 7.7088 × 10−8 3.9726 × 10−5 2.8781 × 10−5 6.3491 × 10−2 5.1833 × 10−2
ALPSO 1.1539 × 10−184 0.0000 × 100 2.5959 × 10−8 7.1555 × 10−8 2.2102 × 10−11 2.9723 × 10−11
RCBA 8.9446 × 10−3 2.9769 × 10−3 5.8765 × 10−1 8.4909 × 10−2 2.1948 × 100 5.2552 × 10−1
CBA 7.2954 × 10−8 3.8213 × 10−7 4.1161 × 101 1.3912 × 102 1.3118 × 101 6.5496 × 100
OBSCA 1.0911 × 10−103 5.5402 × 10−103 4.3833 × 10−91 1.1161 × 10−90 3.1617 × 10−24 1.1702 × 10−23
SCADE 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100 0.0000 × 100
F4 F5 F6
avg std avg std avg std
DECCWOA 1.0221 × 10−18 4.2975 × 10−18 2.6083 × 101 3.1418 × 10−1 0.0000 × 100 0.0000 × 100
IGWO 1.3124 × 10−86 7.1881 × 10−86 2.3216 × 101 1.8144 × 10−1 1.2448 × 10−5 3.5159 × 10−6
OBLGWO 6.2014 × 10−293 0.0000 × 100 2.6052 × 101 3.8656 × 10−1 3.9085 × 10−5 1.4498 × 10−5
CGPSO 6.3491 × 10−2 5.1833 × 10−2 1.0747 × 10−7 1.4040 × 10−7 1.5149 × 10−8 2.7356 × 10−8
ALPSO 2.2102 × 10−11 2.9723 × 10−11 3.5496 × 101 3.2473 × 101 5.9288 × 10−31 2.2626 × 10−30
RCBA 2.1948 × 100 5.2552 × 10−1 3.6041 × 101 4.0444 × 101 8.7533 × 10−3 2.4284 × 10−3
CBA 1.3118 × 101 6.5496 × 100 7.3423 × 101 1.2319 × 102 4.4526 × 10−7 2.4194 × 10−6
OBSCA 3.1617 × 10−24 1.1702 × 10−23 2.7647 × 101 3.8007 × 10−1 3.8321 × 100 2.7513 × 10−1
SCADE 0.0000 × 100 0.0000 × 100 1.5398 × 101 1.3017 × 101 1.7996 × 10−7 1.6508 × 10−7
F7 F8 F9
avg std avg std avg std
DECCWOA 1.1896 × 10−4 1.4262 × 10−4 −1.3066 × 104 2.6313 × 103 0.0000 × 100 0.0000 × 100
IGWO 2.9290 × 10−4 2.6976 × 10−4 −7.4319 × 103 6.6317 × 102 0.0000 × 100 0.0000 × 100
OBLGWO 2.4381 × 10−5 2.9727 × 10−5 −1.2561 × 104 4.4545 × 101 0.0000 × 100 0.0000 × 100
CGPSO 1.4906 × 10−5 1.4183 × 10−5 −3.7698 × 104 6.6756 × 103 3.0143 × 10−9 6.2053 × 10−9
ALPSO 7.8389 × 10−2 3.1754 × 10−2 −1.1531 × 104 2.8700 × 102 1.9471 × 101 7.9710 × 100
RCBA 1.1712 × 10−1 5.5739 × 10−2 −7.3244 × 103 5.4651 × 102 2.0111 × 101 4.6024 × 100
CBA 1.5885 × 10−1 3.4560 × 10−1 −7.3445 × 103 6.5505 × 102 1.2498 × 102 4.7753 × 101
OBSCA 8.1175 × 10−4 5.3137 × 10−4 −4.1274 × 103 2.4305 × 102 0.0000 × 100 0.0000 × 100
SCADE 2.9509 × 10−4 2.0997 × 10−4 −1.2569 × 104 1.1550 × 10−2 0.0000 × 100 0.0000 × 100
233
Electronics 2022, 11, 4224
Table A5. Cont.
F10 F11 F12
avg std avg std avg std
DECCWOA 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 1.5705 × 10−32 5.5674 × 10−48
IGWO 4.9146 × 10−15 1.2283 × 10−15 0.0000 × 100 0.0000 × 100 1.1169 × 10−6 3.8305 × 10−7
OBLGWO 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 3.8858 × 10−4 1.1452 × 10−3
CGPSO 1.8069 × 10−5 1.2953 × 10−5 4.3701 × 10−8 7.1267 × 10−8 6.2743 × 10−11 1.4249 × 10−10
ALPSO 8.0156 × 10−1 8.3429 × 10−1 1.6465 × 10−2 1.5344 × 10−2 3.0222 × 10−2 8.1300 × 10−2
RCBA 1.0853 × 10−1 2.7602 × 10−2 1.0473 × 10−2 1.0208 × 10−2 9.1885 × 100 2.8806 × 100
CBA 1.5880 × 101 2.1141 × 100 1.3514 × 10−2 1.8331 × 10−2 1.4396 × 101 4.7131 × 100
OBSCA 4.3225 × 10−15 6.4863 × 10−16 0.0000 × 100 0.0000 × 100 3.8964 × 10−1 4.5185 × 10−2
SCADE 8.8818 × 10−16 0.0000 × 100 0.0000 × 100 0.0000 × 100 5.6904 × 10−9 4.8080 × 10−9
F13 F14 F15
avg std avg std avg std
DECCWOA 1.3498 × 10−32 5.5674 × 10−48 4.2212 × 106 3.5710 × 106 1.6057 × 105 1.7381 × 105
IGWO 1.4838 × 10−2 2.6985 × 10−2 1.7924 × 107 6.8885 × 106 2.3989 × 106 1.4218 × 106
OBLGWO 5.7997 × 10−2 7.7859 × 10−2 1.7531 × 107 1.0402 × 107 1.3307 × 107 1.0251 × 107
CGPSO 3.1353 × 10−9 9.6561 × 10−9 9.8321 × 106 2.5274 × 106 1.5880 × 108 1.6828 × 107
ALPSO 2.8346 × 10−2 9.8785 × 10−2 5.7145 × 106 5.4783 × 106 2.9466 × 103 3.6264 × 103
RCBA 5.1201 × 10−3 4.6593 × 10−3 1.0422 × 106 3.8825 × 105 2.5206 × 104 1.0389 × 104
CBA 3.1616 × 101 2.6961 × 101 4.7886 × 106 1.8780 × 106 1.2467 × 104 1.0840 × 104
OBSCA 2.1646 × 100 1.1588 × 10−1 3.9908 × 108 1.1211 × 108 2.4969 × 1010 3.6691 × 109
SCADE 8.3767 × 10−8 6.6478 × 10−8 4.7479 × 108 9.8759 × 107 2.9269 × 1010 4.2012 × 109
F16 F17 F18
avg std avg std avg std
DECCWOA 7.8122 × 103 5.4762 × 103 5.1647 × 102 4.8965 × 101 5.2007 × 102 5.1181 × 10−2
IGWO 7.2399 × 103 2.0340 × 103 5.2142 × 102 3.0682 × 101 5.2050 × 102 1.4090 × 10−1
OBLGWO 1.0074 × 104 3.8144 × 103 5.4284 × 102 3.5930 × 101 5.2095 × 102 5.4001 × 10−2
CGPSO 2.3365 × 103 5.0383 × 102 4.6884 × 102 3.1903 × 101 5.2098 × 102 4.2868 × 10−2
ALPSO 3.7450 × 102 1.3166 × 102 5.4221 × 102 5.6842 × 101 5.2080 × 102 5.8119 × 10−2
RCBA 3.2947 × 102 1.2959 × 101 4.7036 × 102 3.7390 × 101 5.2010 × 102 9.5615 × 10−2
CBA 4.7703 × 103 9.2720 × 103 4.9781 × 102 4.4714 × 101 5.2009 × 102 1.3697 × 10−1
OBSCA 5.3939 × 104 6.9272 × 103 2.2087 × 103 5.3362 × 102 5.2096 × 102 5.8056 × 10−2
SCADE 5.4785 × 104 6.7546 × 103 2.2800 × 103 4.7955 × 102 5.2094 × 102 5.3187 × 10−2
F19 F20 F21
avg std avg std avg std
DECCWOA 6.1885 × 102 2.4155 × 100 7.0061 × 102 3.1716 × 10−1 8.0279 × 102 8.0509 × 100
IGWO 6.1887 × 102 2.6487 × 100 7.0099 × 102 5.1420 × 10−2 8.8181 × 102 1.6752 × 101
OBLGWO 6.1968 × 102 4.3347 × 100 7.0117 × 102 9.6122 × 10−2 9.2963 × 102 3.9241 × 101
CGPSO 6.2402 × 102 2.9481 × 100 7.0241 × 102 2.0187 × 10−1 9.8743 × 102 2.5413 × 101
ALPSO 6.1705 × 102 2.4439 × 100 7.0001 × 102 8.9890 × 10−3 8.2142 × 102 9.5753 × 100
RCBA 6.3882 × 102 3.5284 × 100 7.0007 × 102 1.8671 × 10−2 1.0209 × 103 3.9995 × 101
CBA 6.4033 × 102 2.8154 × 100 7.0003 × 102 3.4856 × 10−2 1.0228 × 103 6.1207 × 101
OBSCA 6.3161 × 102 1.3106 × 100 9.0597 × 102 3.6858 × 101 1.0643 × 103 1.7737 × 101
SCADE 6.3355 × 102 2.2424 × 100 8.9018 × 102 3.3322 × 101 1.0695 × 103 1.2949 × 101
234
Electronics 2022, 11, 4224
Table A5. Cont.
F22 F23 F24
avg std avg std avg std
DECCWOA 1.0366 × 103 3.6638 × 101 1.0472 × 103 5.2652 × 101 3.6010 × 103 4.5441 × 102
IGWO 1.0087 × 103 1.9673 × 101 3.3271 × 103 4.7812 × 102 4.6073 × 103 7.5057 × 102
OBLGWO 1.0661 × 103 4.0353 × 101 4.0667 × 103 1.0107 × 103 5.5480 × 103 1.0343 × 103
CGPSO 1.1225 × 103 2.5722 × 101 5.5982 × 103 5.0945 × 102 6.0825 × 103 5.5185 × 102
ALPSO 1.0021 × 103 2.9422 × 101 1.6121 × 103 3.2630 × 102 4.0735 × 103 5.3691 × 102
RCBA 1.1638 × 103 6.3597 × 101 5.6153 × 103 6.4055 × 102 5.8506 × 103 8.1461 × 102
CBA 1.1526 × 103 7.2911 × 101 5.7931 × 103 7.2017 × 102 5.9590 × 103 7.1736 × 102
OBSCA 1.1929 × 103 1.5671 × 101 6.1341 × 103 3.2876 × 102 7.2777 × 103 4.0271 × 102
SCADE 1.2049 × 103 1.8580 × 101 7.4883 × 103 2.3162 × 102 8.2006 × 103 2.9486 × 102
F25 F26 F27
avg std avg std avg std
DECCWOA 1.2002 × 103 7.1972 × 10−2 1.3005 × 103 1.4836 × 10−1 1.4003 × 103 4.2207 × 10−2
IGWO 1.2008 × 103 3.5285 × 10−1 1.3006 × 103 1.2395 × 10−1 1.4004 × 103 2.5832 × 10−1
OBLGWO 1.2023 × 103 6.8209 × 10−1 1.3005 × 103 1.1878 × 10−1 1.4005 × 103 2.3451 × 10−1
CGPSO 1.2025 × 103 2.0362 × 10−1 1.3004 × 103 1.0032 × 10−1 1.4003 × 103 1.2353 × 10−1
ALPSO 1.2013 × 103 5.4330 × 10−1 1.3005 × 103 7.9368 × 10−2 1.4006 × 103 2.8021 × 10−1
RCBA 1.2006 × 103 3.7833 × 10−1 1.3005 × 103 1.3700 × 10−1 1.4003 × 103 9.7996 × 10−2
CBA 1.2011 × 103 7.3537 × 10−1 1.3005 × 103 1.4823 × 10−1 1.4003 × 103 1.5708 × 10−1
OBSCA 1.2023 × 103 4.4892 × 10−1 1.3036 × 103 2.6704 × 10−1 1.4695 × 103 1.1814 × 101
SCADE 1.2026 × 103 2.4794 × 10−1 1.3039 × 103 2.9836 × 10−1 1.4881 × 103 1.3091 × 101
F28 F29 F30
avg std avg std avg std
DECCWOA 1.5202 × 103 6.6341 × 100 1.6102 × 103 7.9146 × 10−1 1.8690 × 106 1.1246 × 106
IGWO 1.5176 × 103 3.7863 × 100 1.6116 × 103 5.8466 × 10−1 9.2251 × 105 5.5675 × 105
OBLGWO 1.5150 × 103 5.7646 × 100 1.6120 × 103 6.3233 × 10−1 1.3955 × 106 1.0330 × 106
CGPSO 1.5176 × 103 1.3084 × 100 1.6117 × 103 3.2922 × 10−1 3.3985 × 105 1.7015 × 105
ALPSO 1.5115 × 103 4.1448 × 100 1.6118 × 103 3.2864 × 10−1 5.5179 × 105 4.6710 × 105
RCBA 1.5371 × 103 9.0984 × 100 1.6135 × 103 3.4738 × 10−1 1.2165 × 105 7.5279 × 104
CBA 1.5589 × 103 1.7899 × 101 1.6133 × 103 5.2338 × 10−1 1.8619 × 105 1.2340 × 105
OBSCA 1.4085 × 104 8.8848 × 103 1.6129 × 103 2.5975 × 10−1 1.1278 × 107 5.7586 × 106
SCADE 1.8666 × 104 6.8024 × 103 1.6127 × 103 1.7040 × 10−1 1.5787 × 107 8.3755 × 106
F31 F32 F33
avg std avg std avg std
DECCWOA 4.3650 × 103 3.0442 × 103 1.9120 × 103 1.2480 × 101 7.8097 × 103 4.1959 × 103
IGWO 1.7080 × 104 2.1685 × 104 1.9180 × 103 1.4497 × 101 3.0438 × 103 6.5561 × 102
OBLGWO 8.3234 × 104 1.7925 × 105 1.9215 × 103 2.3356 × 101 5.5656 × 103 2.6114 × 103
CGPSO 2.4871 × 106 7.6618 × 105 1.9170 × 103 2.9535 × 100 2.4762 × 103 1.6062 × 102
ALPSO 7.8595 × 103 7.3812 × 103 1.9170 × 103 2.0884 × 101 3.0087 × 103 4.2177 × 102
RCBA 6.9919 × 103 7.0401 × 103 1.9292 × 103 2.9262 × 101 2.4379 × 103 1.3813 × 102
CBA 9.7529 × 103 9.7686 × 103 1.9246 × 103 2.6288 × 101 2.9663 × 103 1.2059 × 103
OBSCA 1.5585 × 108 1.0228 × 108 2.0091 × 103 1.5224 × 101 3.1925 × 104 1.3827 × 104
SCADE 1.9277 × 108 9.7379 × 107 2.0133 × 103 1.3639 × 101 2.7694 × 104 1.1641 × 104
235
Electronics 2022, 11, 4224
Table A5. Cont.
Overall rank F34 F35 overall
avg std avg std +/−/= rank
DECCWOA 5.6266 × 105 5.3759 × 105 2.8005 × 103 2.0373 × 102 ~ 1
IGWO 2.5893 × 105 2.2750 × 105 2.5846 × 103 1.4319 × 102 20/8/7 2
OBLGWO 5.1886 × 105 3.8300 × 105 2.6930 × 103 1.9962 × 102 19/5/11 5
CGPSO 1.2464 × 105 6.8764 × 104 2.9020 × 103 2.0995 × 102 23/9/3 4
ALPSO 1.1929 × 105 2.9474 × 105 2.7316 × 103 2.0662 × 102 19/9/7 3
RCBA 8.3440 × 104 3.8322 × 104 3.3862 × 103 3.5129 × 102 23/9/3 6
CBA 1.2013 × 105 7.8959 × 104 3.4067 × 103 2.6854 × 102 24/6/5 7
OBSCA 1.9523 × 106 9.0846 × 105 3.1622 × 103 1.4760 × 102 32/1/2 9
SCADE 2.4532 × 106 1.2033 × 106 3.1167 × 103 1.2839 × 102 28/2/5 7
Table A6. Description of each attribute for the talent stability data.
Attributes Name Description
F1 Sex 1 for male and 2 for female.
There are five categories: Communist Party members, reserve party members,
F2 Political affiliation democratic party members, Communist Youth League members and the masses,
denoted by 1, 2, 3, 4 and 13, respectively.
1 indicates arts, 2 indicates science and 3 indicates less than junior college (junior
F3 Professional attributes
college not divided into arts and science subjects)
Ages 25–30, 31–35, 36–40, 41–45, 46–50, 51–55 and 56–60 are indicated by 1, 2, 3,
4, 5, 6 and 7, respectively. Young and middle-aged people have a strong level of
F4 Age
competence and a strong tendency to move because of upward mobility, life
pressures, etc.
There are three categories: in-city, in-province and out-of-province, indicated by
F5 Household Registration
0, 1 and 2, respectively.
There are three categories: urban, township and rural, denoted by 1, 2 and 3,
F6 Type of place of origin
respectively.
City-level and above talent There are categories A, B, C, D and E, denoted by 1, 2, 3, 4 and 5, respectively. 6
F7
categories is for talent category F and no talent category is denoted by 10.
0 indicating pending employment, 10 indicating state institutions, 20 indicating
scientific research institutions, 21 indicating higher education institutions, 22
indicating secondary and junior education institutions, 23 indicating health and
F8 Nature of previous unit medical institutions, 29 indicating other institutions, 31 indicating state-owned
enterprises, 32 indicating foreign-funded enterprises, 39 indicating private
enterprises, 40 indicating the army, 55 indicating rural organizations, and 99
indicating self-employment. No previous unit is denoted by 100.
Wenzhou colleges and
F9 Prefectural level cities, denoted by 2.
university’s location type
This is a measure of stability in the unit of employment. 1 is used for entry
before 2000 (merger), 2 for entry from 2001–2006 (preparation), 3 for entry from
Year of employment at
2007–2008 (de-preparation), 4 for entry from 2009–2014 (school introduction
F10 Wenzhou colleges and
policy), 5 for entry from 2015–2017 (city introduction policy) and 6 for entry from
universities
2018. To date (increased introduction by the school) entry is indicated by 6. (It
can also be described in terms of stable years 3, 4–6, 7–10, 11+ years).
Teaching staff are represented by 24, PhD students and research staff by 11,
Types of positions at Wenzhou
F11 professional and technical staff by 29, administrative staff by 101 and counsellors
colleges and universities
by 102.
236
Electronics 2022, 11, 4224
Table A6. Cont.
Attributes Name Description
Professional relevance of
It is used to measure the relevance of the major studied to the job, with higher
F12 employment at Wenzhou
percentages indicating higher relevance.
colleges and universities
Monthly salary level for
It is used to measure the average monthly salary received, with higher values
F13 employment at Wenzhou
indicating higher salary levels.
colleges and universities: RMB
Current employment is indicated by 1 for Wenzhou undergraduate institutions;
2 for civil servants or institutions; 3 for undergraduate institutions (including
F14 Current employment doctoral studies); 4 for vocational institutions in other cities; 5 for vocational
institutions in the city, 6 for enterprises, 7 for going abroad and 8 for
pending employment.
Indicated by 1 for entry before 2000 (merger), 2 for entry from 2001–2006
(preparation), 3 for entry from 2007–2008 (de-preparation), 4 for entry from
Time of introduction at current
F15 2009–2014 (school introduction policy), 5 for entry from 2015–2017 (city
employment
introduction policy) and 6 for entry from 2018-present (increased
school introduction).
0 indicating pending employment, 10 indicating state institutions, 20 indicating
scientific research institutions, 21 indicating higher education institutions, 22
indicating secondary and junior education institutions, 23 indicating health and
F16 Nature of current employment medical institutions, 29 indicating other institutions, 31 indicating state-owned
enterprises, 32 indicating foreign-funded enterprises, 39 indicating private
enterprises, 40 indicating the army, 55 indicating rural organizations and 99
indicating self-employment.
Type of location of current Pending employment is represented by 0, sub-provincial and large cities by 1,
F17
employment unit prefecture-level cities by 2 and counties and villages by 3.
The type of position currently employed is expressed in the same way as the
type of position in the previous employment unit indicated in F11. Pending
employment is indicated by 0, civil servants by 10, doctoral students and
F18 Type of current employment
researchers by 11, engineers and technicians by 13, teaching staff by 24,
professional and technical staff by 29, commercial service staff and clerks by 30,
military personnel by 80, administrative staff by 101 and counsellors by 102.
Relevance of current The professional relevance of current employment is expressed in the same way
F19
employment profession as the type of position in the previous employment unit indicated by F11.
Monthly salary level in current The current employment monthly salary level is expressed in the same way as
F20
employment unit: RMB the previous employment monthly salary level in F13.
It is used to measure the change in the monthly salary of the current
employment unit from that of the previous employment unit, that is, the
difference between the monthly salary level of the current employment unit
F21 Salary differential
expressed in F21 and the monthly salary level of the previous employment unit
expressed in F13, with a larger value indicating a larger increase in
monthly salary.
Professional and technical Positive senior, deputy senior, intermediate, primary and none are represented
F22
position at the time of leaving by 1, 2, 3, 4, and 5, respectively.
F23 Double first-rate 1 means double first-rate, 2 means not.
College, university and postgraduate are denoted by 0, 1 and 2, respectively.
F24 Highest Education
Below junior college, it is denoted by 5.
Tertiary, bachelor, master and doctoral degrees are denoted by 0, 1, 2 and 3,
F25 Highest degrees
respectively. Below the tertiary level, they are denoted by 5.
F26 Change in place of employment A variation is indicated by 1 and no variation is indicated by 0.
237
Electronics 2022, 11, 4224
References
1. Yang, J. The Theory of Planned Behavior and Prediction of Entrepreneurial Intention Among Chinese Undergraduates. Soc. Behav.
Pers. Int. J. 2013, 41, 367–376. [CrossRef]
2. González-Serrano, M.H.; Moreno, F.C.; Hervás, J.C. Prediction model of the entrepreneurial intentions in pre-graduated and
post-graduated Sport Sciences students. Cult. Cienc. Y Deporte 2018, 13, 219–230. [CrossRef]
3. Gorgievski, M.J.; Stephan, U.; Laguna, M.; Moriano, J.A. Predicting Entrepreneurial Career Intentions: Values and the theory of
planned behavior. J. Career Assess. 2018, 26, 457–475. [CrossRef] [PubMed]
4. Nawaz, T.; Khattak, B.K.; Rehman, K. New look of predicting entrepreneurial intention: A serial mediation analysis. Dilemas
Contemp. Educ. Polit. Y Valor. 2019, 6, 126.
5. Yang, F. Decision Tree Algorithm Based University Graduate Employment Trend Prediction. Informatica 2019, 43. [CrossRef]
6. Djordjevic, D.; Cockalo, D.; Bogetic, S.; Bakator, M. Predicting Entrepreneurial Intentions among the Youth in Serbia with a
Classification Decision Tree Model with the QUEST Algorithm. Mathematics 2021, 9, 1487. [CrossRef]
7. Wei, Y.; Lv, H.; Chen, M.; Wang, M.; Heidari, A.A.; Chen, H.; Li, C. Predicting Entrepreneurial Intention of Students: An Extreme
Learning Machine with Gaussian Barebone Harris Hawks Optimizer. IEEE Access 2020, 8, 76841–76855. [CrossRef]
8. Bhagavan, K.S.; Thangakumar, J.; Subramanian, D.V. RETRACTED ARTICLE: Predictive analysis of student academic perfor-
mance and employability chances using HLVQ algorithm. J. Ambient. Intell. Humaniz. Comput. 2020, 12, 3789–3797. [CrossRef]
9. Huang, Z.; Liu, G. Prediction model of college students entrepreneurship ability based on artificial intelligence and fuzzy logic
model. J. Intell. Fuzzy Syst. 2021, 40, 2541–2552. [CrossRef]
10. Li, X.; Yang, T. Forecast of the Employment Situation of College Graduates Based on the LSTM Neural Network. Comput. Intell.
Neurosci. 2021, 2021, 5787355. [CrossRef]
11. Mirjalili, S.; Lewis, A. The Whale Optimization Algorithm. Adv. Eng. Softw. 2016, 95, 51–67. [CrossRef]
12. Li, J.; Guo, L.; Li, Y.; Liu, C.; Wang, L.; Hu, H. Enhancing Whale Optimization Algorithm with Chaotic Theory for Permutation
Flow Shop Scheduling Problem. Int. J. Comput. Intell. Syst. 2021, 14, 651–675. [CrossRef]
13. Luan, F.; Cai, Z.; Wu, S.; Jiang, T.; Li, F.; Yang, J. Improved Whale Algorithm for Solving the Flexible Job Shop Scheduling Problem.
Mathematics 2019, 7, 384. [CrossRef]
14. Navarro, M.A.; Oliva, D.; Ramos-Michel, A.; Zaldívar, D.; Morales-Castañeda, B.; Pérez-Cisneros, M.; Valdivia, A.; Chen, H. An
improved multi-population whale optimization algorithm. Int. J. Mach. Learn. Cybern. 2022, 13, 2447–2478. [CrossRef]
15. Abbas, S.; Jalil, Z.; Javed, A.R.; Batool, I.; Khan, M.Z.; Noorwali, A.; Gadekallu, T.R.; Akbar, A. BCD-WERT: A novel approach for
breast cancer detection using whale optimization based efficient features and extremely randomized tree algorithm. PeerJ Comput.
Sci. 2021, 7, e390. [CrossRef]
16. Elaziz, M.A.; Nabil, N.; Moghdani, R.; Ewees, A.A.; Cuevas, E.; Lu, S. Multilevel thresholding image segmentation based on
improved volleyball premier league algorithm using whale optimization algorithm. Multimed. Tools Appl. 2021, 80, 12435–12468.
[CrossRef]
17. Abdel-Basset, M.; El-Shahat, D.; El-Henawy, I. A modified hybrid whale optimization algorithm for the scheduling problem in
multimedia data objects. Concurr. Comput. Pr. Exp. 2020, 32, e5137. [CrossRef]
18. Qiao, S.; Yu, H.; Heidari, A.A.; El-Saleh, A.A.; Cai, Z.; Xu, X.; Mafarja, M.; Chen, H. Individual disturbance and neighborhood
mutation search enhanced whale optimization: Performance design for engineering problems. J. Comput. Des. Eng. 2022, 9,
1817–1851. [CrossRef]
19. Peng, L.; He, C.; Heidari, A.A.; Zhang, Q.; Chen, H.; Liang, G.; Aljehane, N.O.; Mansour, R.F. Information sharing search boosted
whale optimizer with Nelder-Mead simplex for parameter estimation of photovoltaic models. Energy Convers. Manag. 2022, 270,
116246. [CrossRef]
20. Abderazek, H.; Hamza, F.; Yildiz, A.R.; Sait, S.M. Comparative investigation of the moth-flame algorithm and whale optimization
algorithm for optimal spur gear design. Mater. Test. 2021, 63, 266–271. [CrossRef]
21. Ahmadianfar, I.; Asghar Heidari, A.; Gandomi, A.H.; Chu, X.; Chen, H. RUN Beyond the Metaphor: An Efficient Optimization
Algorithm Based on Runge Kutta Method. Expert Syst. Appl. 2021, 181, 115079. [CrossRef]
22. Zhang, H.; Li, R.; Cai, Z.; Gu, Z.; Heidari, A.A.; Wang, M.; Chen, H.; Chen, M. Advanced orthogonal moth flame optimization
with Broyden–Fletcher–Goldfarb–Shanno algorithm: Framework and real-world problems. Expert Syst. Appl. 2020, 159, 113617.
[CrossRef]
23. Heidari, A.A.; Mirjalili, S.; Faris, H.; Aljarah, I.; Mafarja, M.; Chen, H. Harris hawks optimization: Algorithm and applications.
Futur. Gener. Comput. Syst. 2019, 97, 849–872. [CrossRef]
24. Yang, Y.; Chen, H.; Heidari, A.A.; Gandomi, A.H. Hunger games search: Visions, conception, implementation, deep analysis,
perspectives, and towards performance shifts. Expert Syst. Appl. 2021, 177, 114864. [CrossRef]
25. Ahmadianfar, I.; Asghar Heidari, A.; Noshadian, S.; Chen, H.; Gandomi, A.H. INFO: An Efficient Optimization Algorithm based
on Weighted Mean of Vectors. Expert Syst. Appl. 2022, 195, 116516. [CrossRef]
26. Tu, J.; Chen, H.; Wang, M.; Gandomi, A.H. The Colony Predation Algorithm. J. Bionic Eng. 2021, 18, 674–710. [CrossRef]
27. Hu, J.; Gui, W.; Heidari, A.A.; Cai, Z.; Liang, G.; Chen, H.; Pan, Z. Dispersed foraging slime mould algorithm: Continuous and
binary variants for global optimization and wrapper-based feature selection. Knowl. Based Syst. 2022, 237, 107761. [CrossRef]
238
Electronics 2022, 11, 4224
28. Liu, Y.; Heidari, A.A.; Cai, Z.; Liang, G.; Chen, H.; Pan, Z.; Alsufyani, A.; Bourouis, S. Simulated annealing-based dynamic
step shuffled frog leaping algorithm: Optimal performance design and feature selection. Neurocomputing 2022, 503, 325–362.
[CrossRef]
29. Hussien, A.G.; Heidari, A.A.; Ye, X.; Liang, G.; Chen, H.; Pan, Z. Boosting whale optimization with evolution strategy and
Gaussian random walks: An image segmentation method. Eng. Comput. 2022, 1–45. [CrossRef]
30. Yu, H.; Song, J.; Chen, C.; Heidari, A.A.; Liu, J.; Chen, H.; Zaguia, A.; Mafarja, M. Image segmentation of Leaf Spot Diseases on
Maize using multi-stage Cauchy-Enabled grey wolf algorithm. Eng. Appl. Artif. Intell. 2022, 109, 104653. [CrossRef]
31. Xu, Y.; Chen, H.; Heidari, A.A.; Luo, J.; Zhang, Q.; Zhao, X.; Li, C. An efficient chaotic mutative moth-flame-inspired optimizer
for global optimization tasks. Expert Syst. Appl. 2019, 129, 135–155. [CrossRef]
32. Zhang, Y.; Liu, R.; Heidari, A.A.; Wang, X.; Chen, Y.; Wang, M.; Chen, H. Towards augmented kernel extreme learning models for
bankruptcy prediction: Algorithmic behavior and comprehensive analysis. Neurocomputing 2021, 430, 185–212. [CrossRef]
33. Yu, H.; Cheng, X.; Chen, C.; Heidari, A.A.; Liu, J.; Cai, Z.; Chen, H. Apple leaf disease recognition method with improved residual
network. Multimed. Tools Appl. 2022, 81, 7759–7782. [CrossRef]
34. Wang, M.; Chen, H.; Yang, B.; Zhao, X.; Hu, L.; Cai, Z.; Huang, H.; Tong, C. Toward an optimal kernel extreme learning machine
using a chaotic moth-flame optimization strategy with applications in medical diagnoses. Neurocomputing 2017, 267, 69–84.
[CrossRef]
35. Chen, H.L.; Wang, G.; Ma, C.; Cai, Z.N.; Liu, W.B.; Wang, S.J. An efficient hybrid kernel extreme learning machine approach for
early diagnosis of Parkinson’s disease. Neurocomputing 2016, 184, 131–144. [CrossRef]
36. Dong, R.; Chen, H.; Heidari, A.A.; Turabieh, H.; Mafarja, M.; Wang, S. Boosted kernel search: Framework, analysis and case
studies on the economic emission dispatch problem. Knowl. Based Syst. 2021, 233, 107529. [CrossRef]
37. He, Z.; Yen, G.G.; Ding, J. Knee-Based Decision Making and Visualization in Many-Objective Optimization. IEEE Trans. Evol.
Comput. 2020, 25, 292–306. [CrossRef]
38. He, Z.; Yen, G.G.; Lv, J. Evolutionary Multiobjective Optimization with Robustness Enhancement. IEEE Trans. Evol. Comput. 2019,
24, 494–507. [CrossRef]
39. Wu, S.-H.; Zhan, Z.-H.; Zhang, J. SAFE: Scale-Adaptive Fitness Evaluation Method for Expensive Optimization Problems. IEEE
Trans. Evol. Comput. 2021, 25, 478–491. [CrossRef]
40. Li, J.Y.; Zhan, Z.H.; Wang, C.; Jin, H.; Zhang, J. Boosting data-driven evolutionary algorithm with localized data generation. IEEE
Trans. Evol. Comput. 2020, 24, 923–937. [CrossRef]
41. Deng, W.; Zhang, X.; Zhou, Y.; Liu, Y.; Zhou, X.; Chen, H.; Zhao, H. An enhanced fast non-dominated solution sorting genetic
algorithm for multi-objective problems. Inf. Sci. 2022, 585, 441–453. [CrossRef]
42. Hua, Y.; Liu, Q.; Hao, K.; Jin, Y. A Survey of Evolutionary Algorithms for Multi-Objective Optimization Problems with Irregular
Pareto Fronts. IEEE/CAA J. Autom. Sin. 2021, 8, 303–318. [CrossRef]
43. Han, X.; Han, Y.; Chen, Q.; Li, J.; Sang, H.; Liu, Y.; Pan, Q.; Nojima, Y. Distributed Flow Shop Scheduling with Se-quence-
Dependent Setup Times Using an Improved Iterated Greedy Algorithm. Complex Syst. Model. Simul. 2021, 1, 198–217. [CrossRef]
44. Gao, D.; Wang, G.-G.; Pedrycz, W. Solving Fuzzy Job-Shop Scheduling Problem Using DE Algorithm Improved by a Selection
Mechanism. IEEE Trans. Fuzzy Syst. 2020, 28, 3265–3275. [CrossRef]
45. Wang, G.-G.; Gao, D.; Pedrycz, W. Solving Multiobjective Fuzzy Job-Shop Scheduling Problem by a Hybrid Adaptive Differential
Evolution Algorithm. IEEE Trans. Ind. Informatics 2022, 18, 8519–8528. [CrossRef]
46. Chen, H.L.; Yang, B.; Wang, S.J.; Wang, G.; Liu, D.Y.; Li, H.Z.; Liu, W. Towards an optimal support vector machine classifier using
a parallel particle swarm optimization strategy. Appl. Math. Comput. 2014, 239, 180–197. [CrossRef]
47. Deng, W.; Xu, J.; Zhao, H.; Song, Y. A Novel Gate Resource Allocation Method Using Improved PSO-Based QEA. IEEE Trans.
Intell. Transp. Syst. 2020, 23, 1737–1745. [CrossRef]
48. Deng, W.; Xu, J.; Song, Y.; Zhao, H. An effective improved co-evolution ant colony optimisation algorithm with multi-strategies
and its application. Int. J. Bio Inspir. Comput. 2020, 16, 158–170. [CrossRef]
49. Ye, X.; Liu, W.; Li, H.; Wang, M.; Chi, C.; Liang, G.; Chen, H.; Huang, H. Modified Whale Optimization Algorithm for Solar Cell
and PV Module Parameter Identification. Complexity 2021, 2021, 8878686. [CrossRef]
50. Yu, H.; Yuan, K.; Li, W.; Zhao, N.; Chen, W.; Huang, C.; Chen, H.; Wang, M. Improved Butterfly Optimizer-Configured Extreme
Learning Machine for Fault Diagnosis. Complexity 2021, 2021, 6315010. [CrossRef]
51. Agrawal, R.; Kaur, B.; Sharma, S. Quantum based Whale Optimization Algorithm for wrapper feature selection. Appl. Soft Comput.
2020, 89, 106092. [CrossRef]
52. Bai, L.; Han, Z.; Ren, J.; Qin, X. Research on feature selection for rotating machinery based on Supervision Kernel Entropy
Component Analysis with Whale Optimization Algorithm. Appl. Soft Comput. 2020, 92, 106245. [CrossRef]
53. Bahiraei, M.; Foong, L.K.; Hosseini, S.; Mazaheri, N. Predicting heat transfer rate of a ribbed triple-tube heat exchanger working
with nanofluid using neural network enhanced by advanced optimization algorithms. Powder Technol. 2021, 381, 459–476.
[CrossRef]
54. Qi, A.; Zhao, D.; Yu, F.; Heidari, A.A.; Chen, H.; Xiao, L. Directional mutation and crossover for immature performance of whale
algorithm with application to engineering optimization. J. Comput. Des. Eng. 2022, 9, 519–563. [CrossRef]
55. Bui, D.T.; Abdullahi, M.M.; Ghareh, S.; Moayedi, H.; Nguyen, H. Fine-tuning of neural computing using whale optimization
algorithm for predicting compressive strength of concrete. Eng. Comput. 2021, 37, 701–712. [CrossRef]
239
Electronics 2022, 11, 4224
56. Butti, D.; Mangipudi, S.K.; Rayapudi, S. Model Order Reduction Based Power System Stabilizer Design Using Improved Whale
Optimization Algorithm. IETE J. Res. 2021, 1–20. [CrossRef]
57. Cao, Y.; Li, Y.; Zhang, G.; Jermsittiparsert, K.; Nasseri, M. An efficient terminal voltage control for PEMFC based on an improved
version of whale optimization algorithm. Energy Rep. 2020, 6, 530–542. [CrossRef]
58. Çerçevik, A.E.; Avşar, Ö.; Hasançebi, O. Optimum design of seismic isolation systems using metaheuristic search methods. Soil
Dyn. Earthq. Eng. 2019, 131, 106012. [CrossRef]
59. Zhao, S.; Song, J.; Du, X.; Liu, T.; Chen, H.; Chen, H. Intervention-Aware Epidemic Prediction by Enhanced Whale Optimization.
In International Conference on Knowledge Science, Engineering and Management; Memmi, G., Yang, B., Kong, L., Zhang, T., Qiu, M.,
Eds.; Springer: Berlin/Heidelberg, Germany, 2022; pp. 457–468.
60. Fan, Y.; Wang, P.; Heidari, A.A.; Wang, M.; Zhao, X.; Chen, H.; Li, C. Boosted hunting-based fruit fly optimization and advances
in real-world problems. Expert Syst. Appl. 2020, 159, 113502. [CrossRef]
61. Raj, S.; Bhattacharyya, B. Optimal placement of TCSC and SVC for reactive power planning using Whale optimization algorithm.
Swarm Evol. Comput. 2018, 40, 131–143. [CrossRef]
62. Guo, Y.; Shen, H.; Chen, L.; Liu, Y.; Kang, Z. Improved whale optimization algorithm based on random hopping update and
random control parameter. J. Intell. Fuzzy Syst. 2021, 40, 363–379. [CrossRef]
63. Jiang, R.; Yang, M.; Wang, S.; Chao, T. An improved whale optimization algorithm with armed force program and strategic
adjustment. Appl. Math. Model. 2020, 81, 603–623. [CrossRef]
64. Tu, J.; Chen, H.; Liu, J.; Heidari, A.A.; Zhang, X.; Wang, M.; Ruby, R.; Pham, Q.V. Evolutionary biogeography-based whale
optimization methods with communication structure: Towards measuring the balance. Knowl. Based Syst. 2021, 212, 106642.
[CrossRef]
65. Wang, G.; Gui, W.; Liang, G.; Zhao, X.; Wang, M.; Mafarja, M.; Turabieh, H.; Xin, J.; Chen, H.; Ma, X. Spiral Motion Enhanced Elite
Whale Optimizer for Global Tasks. Complexity 2021, 2021, 1–33. [CrossRef]
66. Abd Elazim, S.M.; Ali, E.S. Optimal network restructure via improved whale optimization approach. Int. J. Commun. Syst. 2021,
34, e4617. [CrossRef]
67. Abdel-Basset, M.; Chang, V.; Mohamed, R. HSMA_WOA: A hybrid novel Slime mould algorithm with whale optimization
algorithm for tackling the image segmentation problem of chest X-ray images. Appl. Soft Comput. 2020, 95, 106642. [CrossRef]
68. Chai, Q.-W.; Chu, S.-C.; Pan, J.-S.; Hu, P.; Zheng, W.-M. A parallel WOA with two communication strategies applied in DV-Hop
localization method. EURASIP J. Wirel. Commun. Netw. 2020, 2020, 1–10. [CrossRef]
69. Heidari, A.A.; Aljarah, I.; Faris, H.; Chen, H.; Luo, J.; Mirjalili, S. An enhanced associative learning-based exploratory whale
optimizer for global optimization. Neural Comput. Appl. 2020, 32, 5185–5211. [CrossRef]
70. Jin, Q.; Xu, Z.; Cai, W. An Improved Whale Optimization Algorithm with Random Evolution and Special Reinforcement
Dual-Operation Strategy Collaboration. Symmetry 2021, 13, 238. [CrossRef]
71. Qin, A.K.; Huang, V.L.; Suganthan, P.N. Differential Evolution Algorithm with Strategy Adaptation for Global Numerical
Optimization. IEEE Trans. Evol. Comput. 2008, 13, 398–417. [CrossRef]
72. Wan, X.; Zuo, X.; Zhao, X. A differential evolution algorithm combined with linear programming for solving a closed loop facility
layout problem. Appl. Soft Comput. 2022, 108725. [CrossRef]
73. Yuan, Y.; Cao, J.; Wang, X.; Zhang, Z.; Liu, Y. Economic-effectiveness analysis of micro-fins helically coiled tube heat exchanger
and optimization based on multi-objective differential evolution algorithm. Appl. Therm. Eng. 2022, 201, 117764. [CrossRef]
74. Liu, D.; Hu, Z.; Su, Q.; Liu, M. A niching differential evolution algorithm for the large-scale combined heat and power economic
dispatch problem. Appl. Soft Comput. 2021, 113, 108017. [CrossRef]
75. He, Z.; Ning, D.; Gou, Y.; Zhou, Z. Wave energy converter optimization based on differential evolution algorithm. Energy 2022,
246, 123433. [CrossRef]
76. Meng, A.-B.; Chen, Y.-C.; Yin, H.; Chen, S.-Z. Crisscross optimization algorithm and its application. Knowl. Based Syst. 2014, 67,
218–229. [CrossRef]
77. Luo, J.; Chen, H.; Heidari, A.A.; Xu, Y.; Zhang, Q.; Li, C. Multi-strategy boosted mutative whale-inspired optimization approaches.
Appl. Math. Model. 2019, 73, 109–123. [CrossRef]
78. Yousri, D.; Allam, D.; Eteiba, M. Chaotic whale optimizer variants for parameters estimation of the chaotic behavior in Permanent
Magnet Synchronous Motor. Appl. Soft Comput. 2019, 74, 479–503. [CrossRef]
79. Ling, Y.; Zhou, Y.; Luo, Q. Lévy Flight Trajectory-Based Whale Optimization Algorithm for Global Optimization. IEEE Access
2017, 5, 6168–6186. [CrossRef]
80. Tubishat, M.; Abushariah, M.A.M.; Idris, N.; Aljarah, I. Improved whale optimization algorithm for feature selection in Arabic
sentiment analysis. Appl. Intell. 2018, 49, 1688–1707. [CrossRef]
81. Cai, Z.; Gu, J.; Luo, J.; Zhang, Q.; Chen, H.; Pan, Z.; Li, Y.; Li, C. Evolving an optimal kernel extreme learning machine by using an
enhanced grey wolf optimization strategy. Expert Syst. Appl. 2019, 138, 112814. [CrossRef]
82. Heidari, A.A.; Ali Abbaspour, R.; Chen, H. Efficient boosted grey wolf optimizers for global search and kernel extreme learning
machine training. Appl. Soft Comput. 2019, 81, 105521. [CrossRef]
83. Sun, T.-Y.; Liu, C.-C.; Tsai, S.-J.; Hsieh, S.-T.; Li, K.-Y. Cluster Guide Particle Swarm Optimization (CGPSO) for Underdetermined
Blind Source Separation with Advanced Conditions. IEEE Trans. Evol. Comput. 2010, 15, 798–811. [CrossRef]
240
Electronics 2022, 11, 4224
84. Nenavath, H.; Jatoth, R.K. Hybridizing sine cosine algorithm with differential evolution for global optimization and object
tracking. Appl. Soft Comput. 2018, 62, 1019–1043. [CrossRef]
85. Singh, R.P.; Mukherjee, V.; Ghoshal, S.P. Optimal power flow by particle swarm optimization with an aging leader and challengers.
Int. J. Eng. 2015, 7, 123–132. [CrossRef]
86. Liang, H.; Liu, Y.; Shen, Y.; Li, F.; Man, Y. A Hybrid Bat Algorithm for Economic Dispatch with Random Wind Power. IEEE Trans.
Power Syst. 2018, 33, 5052–5061. [CrossRef]
87. Adarsh, B.R.; Raghunathan, T.; Jayabarathi, T.; Yang, X.-S. Economic dispatch using chaotic bat algorithm. Energy 2016, 96,
666–675. [CrossRef]
88. Abd Elaziz, M.; Oliva, D.; Xiong, S. An improved Opposition-Based Sine Cosine Algorithm for global optimization. Expert Syst.
Appl. 2017, 90, 484–500. [CrossRef]
89. Wu, Z.; Li, R.; Xie, J.; Zhou, Z.; Guo, J.; Jiang, J.; Su, X. A user sensitive subject protection approach for book search service.
J. Assoc. Inf. Sci. Technol. 2020, 71, 183–195. [CrossRef]
90. Wu, Z.; Shen, S.; Zhou, H.; Li, H.; Lu, C.; Zou, D. An effective approach for the protection of user commodity viewing privacy in
e-commerce website. Knowl. Based Syst. 2021, 220, 106952. [CrossRef]
91. Yang, Z.; Chen, H.; Zhang, J.; Chang, Y. Context-aware Attentive Multilevel Feature Fusion for Named Entity Recognition. IEEE
Trans. Neural Netw. Learn. Syst. 2022. [CrossRef]
92. Huang, L.; Yang, Y.; Chen, H.; Zhang, Y.; Wang, Z.; He, L. Context-aware road travel time estimation by coupled tensor
decomposition based on trajectory data. Knowl. Based Syst. 2022, 245. [CrossRef]
93. Hu, K.; Zhao, L.; Feng, S.; Zhang, S.; Zhou, Q.; Gao, X.; Guo, Y. Colorectal polyp region extraction using saliency detection
network with neutrosophic enhancement. Comput. Biol. Med. 2022, 147, 105760. [CrossRef] [PubMed]
94. Zhang, X.; Zheng, J.; Wang, D.; Zhao, L. Exemplar-Based Denoising: A Unified Low-Rank Recovery Framework. IEEE Trans.
Circuits Syst. Video Technol. 2020, 30, 2538–2549. [CrossRef]
95. Qi, A.; Zhao, D.; Yu, F.; Heidari, A.A.; Wu, Z.; Cai, Z.; Alenezi, F.; Mansour, R.F.; Chen, H.; Chen, M. Directional mutation and
crossover boosted ant colony optimization with application to COVID-19 X-ray image segmentation. Comput. Biol. Med. 2022,
148, 105810. [CrossRef]
96. Ren, L.; Zhao, D.; Zhao, X.; Chen, W.; Li, L.; Wu, T.; Liang, G.; Cai, Z.; Xu, S. Multi-level thresholding segmentation for pathological
images: Optimal performance design of a new modified differential evolution. Comput. Bio. Med. 2022, 148, 105910. [CrossRef]
97. Su, H.; Zhao, D.; Elmannai, H.; Heidari, A.A.; Bourouis, S.; Wu, Z.; Cai, Z.; Gui, W.; Chen, M. Multilevel threshold image
segmentation for COVID-19 chest radiography: A framework using horizontal and vertical multiverse optimization. Comput.
Biol. Med. 2022, 146, 105618. [CrossRef]
98. Cao, X.; Wang, J.; Zeng, B. A Study on the Strong Duality of Second-Order Conic Relaxation of AC Optimal Power Flow in Radial
Networks. IEEE Trans. Power Syst. 2021, 37, 443–455. [CrossRef]
241
electronics
Article
A Novel Multistrategy-Based Differential Evolution Algorithm
and Its Application
Jinyin Wang 1 , Shifan Shang 2,3 , Huanyu Jing 2 , Jiahui Zhu 2 , Yingjie Song 4 , Yuangang Li 5, * and Wu Deng 2,6, *
1 UNI-FI Credit Solutions Co., Ltd., Beijing 100083, China
2 School of Electronic Information and Automation, Civil Aviation University of China, Tianjin 300300, China
3 HAI ROBOTICS Co., Ltd., Shenzhen 518000, China
4 College of Computer Science and Technology, Shandong Technology and Business University,
Yantai 264005, China
5 Faculty of Business Information, Shanghai Business School, Shanghai 200235, China
6 Traction Power State Key Laboratory, Southwest Jiaotong University, Chengdu 610031, China
* Correspondence: [email protected] (Y.L.); [email protected] (W.D.)
Abstract: To address the poor searchability, population diversity, and slow convergence speed of the
differential evolution (DE) algorithm in solving capacitated vehicle routing problems (CVRP), a new
multistrategy-based differential evolution algorithm with the saving mileage algorithm, sequential
encoding, and gravitational search algorithm, namely SEGDE, is proposed to solve CVRP in this
paper. Firstly, an optimization model of CVRP with the shortest total vehicle routing is established.
Then, the saving mileage algorithm is employed to initialize the population of the DE to improve the
initial solution quality and the search efficiency. The sequential encoding approach is used to adjust
the differential mutation strategy to legalize the current solution and ensure its effectiveness. Finally,
the gravitational search algorithm is applied to calculate the gravitational relationship between points
to effectively adjust the evolutionary search direction and further improve the search efficiency. Four
CVRPs are selected to verify the effectiveness of the proposed SEGDE algorithm. The experimental
Citation: Wang, J.; Shang, S.; Jing, H.;
results show that the proposed SEGDE algorithm can effectively solve the CVRPs and obtain the
Zhu, J.; Song, Y.; Li, Y.; Deng, W. A ideal vehicle routing. It adopts better search speed, global optimization ability, routing length, and
Novel Multistrategy-Based stability.
Differential Evolution Algorithm and
Its Application. Electronics 2022, 11, Keywords: differential evolution; capacitated vehicle routing planning; saving mileage;
3476. https://doi.org/10.3390/ gravity search
electronics11213476
Academic Editor: João Soares
Received: 5 October 2022 1. Introduction
Accepted: 25 October 2022
The vehicle routing problem (VRP) was formally presented in 1959 by Dantzig [1].
Published: 26 October 2022
The problem is defined as finding the optimal route of a vehicle under certain constraint
Publisher’s Note: MDPI stays neutral conditions (such as vehicle capacity, customer demand, transportation process, etc.), so as
with regard to jurisdictional claims in to minimize the transportation cost or find the shortest transportation distance [2–4]. VRP
published maps and institutional affil- is a NP-hard problem and is one of the hotspots in operations research and combinatorial
iations. optimization. In recent years, heuristic algorithms have been widely explored in solving
large-scale VRPs [5–8]. Therefore, a new algorithm for VRP has a certain theoretical
significance and practical value.
The algorithms for solving VRP can be broadly divided into exact algorithms and
Copyright: © 2022 by the authors.
heuristic algorithms (including metaheuristics). The exact algorithm can obtain the optimal
Licensee MDPI, Basel, Switzerland.
solution, but its high computational complexity makes it unsuitable for solving large-
This article is an open access article
scale VRPs [9–11]. Heuristic algorithms can be further divided into neighborhood-based
distributed under the terms and
conditions of the Creative Commons
algorithms and population-based algorithms [12–14]. The neighborhood-based algorithms
Attribution (CC BY) license (https://
maintain a single solution during the search process and seek a more optimal solution by
creativecommons.org/licenses/by/
iterating between neighborhood solutions according to the strategy. The algorithms include
4.0/). iterative local search, Tabu search, and so on.
Electronics 2022, 11, 3476. https://doi.org/10.3390/electronics11213476 https://www.mdpi.com/journal/electronics
243
Electronics 2022, 11, 3476
The differential evolution (DE) algorithm is a heuristic search algorithm based on
population, and each individual in the population corresponds to a solution vector [15].
The evolution process of DE favors that of GA, which includes mutation, crossover, and
selection, but its specific definition is different from that of GA. Since the DE has a simple
structure, fast convergence, and so on, it is applied in data mining, pattern recognition,
electromagnetics, and so on. However, the DE algorithm also has some defects in solving
large-scale VRPs, such as poor searchability and population diversity, slow convergence
speed, and so on. Therefore, some variants of DE algorithms are proposed from the different
aspects of algorithm, such as parameter adaption, new mutation strategies, crossover
strategy strategies, population initialization, hybrid DE with the other algorithms, and
so on.
To some extent, these improved DE algorithms have improved the searchability, accel-
erated the convergence, strengthened avoidance of falling into local optimum, and so on,
which can help better obtain optimization results in solving the complex optimization prob-
lems and the different VRPs. However, there still exists some defects in solving the complex
optimization problems, such as poor population diversity, low search accuracy, easily
falling into local optimum, and so on. To solve these problems, a new multistrategy-based
differential evolution algorithm with the saving mileage algorithm, sequential encoding,
and gravitational search algorithm, namely SEGDE, is proposed to solve the CVRP. A
planning method of the CVRP based on SEGDE is implemented to solve the actual CVRP
for obtaining the ideal results of the vehicle routing problems.
The main contributions of this study are described as follows:
(1) A new multistrategy DE algorithm, namely SEGDE, is developed to improve the
solution quality and the search efficiency in solving the CVRPs.
(2) The saving mileage algorithm is used to initialize the population of the DE to ensure
the initial solution quality and improve the search efficiency.
(3) The sorting and coding strategy is used to adjust the differential mutation strategy,
and the vectors are added and subtracted.
The structure of this paper is as follows: In Section 3, the related works are reviewed,
and the basic DE is introduced. In Section 4, the capacitated vehicle routing model is
constructed. Section 5 develops a new multistrategy DE algorithm, and the idea, model,
and steps are described in detail. The experimental calculation and analysis are executed in
the Section 6. Finally, the conclusions are summarized in Section 7.
2. Related Works
Since the VRP was proposed, many researchers have made in-depth explorations and
solved VRPs. When the traditional methods, the exact algorithm, heuristic algorithms,
and so on are used to solve the VRPs, a slow solving speed and excessive calculation
will occur. In recent years, the focus for solving VRPs has been on combining heuristic
algorithms with artificial intelligence technology, such as simulated annealing (SA), tabu
search (TS), genetic algorithm (GA), ant colony optimization (ACO), different improve-
ments, and so on. Yusuf et al. [16] studied the GA to solve a combinatorial problem of
VRP. Akpinar [17] presented a hybrid algorithm with a large neighborhood search and
ACO for CVRP. Zhang et al. [18] presented a hybrid approach with Tabu search and ABC
to solve VRP. Dechampai et al. [19] presented a MESOMDE_G-Q-DVRP-FD for solving
GQDVRP. Gutierrez et al. [20] presented a new memetic algorithm with multipopulation
to solve VRP. Fallah et al. [21] presented a robust algorithm to solve the competitive VRP.
Altabeeb et al. [22] presented a new CVRP-firefly algorithm. Altabeeb et al. [23] presented
a cooperative hybrid FA with multipopulation to solve VRP. Xiao et al. [24] presented a
heuristic EMRG-HA to solve CVRP with a large scale. Jia et al. [25] presented a novel
bilevel ACO to solve the CEVRP. Jiang et al. [26] presented a fast evolutionary algorithm
called RMEA to accelerate convergence for CVRP. Deng et al. [27] presented an ACDE/F for
the gate allocation problem. Zhang et al. [28] presented a branch-and-cut algorithm to solve
the two-dimensional loading constraint VRP. Song et al. [29] presented a dynamic hybrid
244
Electronics 2022, 11, 3476
mechanism CDE to solve the complex optimization problem. Niu et al. [30] presented a
multiobjective EA to tackle the MO-VRPSD. Deng et al. [31] presented a new MPSACO
with CWBPSO and ACO for solving the taxiway planning problem. Gu et al. [32] presented
a hierarchical solution evaluation approach for a general VRPD. Azad et al. [33] presented a
QAOA to solve VRP. Lai et al. [34] presented a data-driven flexible transit method with the
origin-destination insertion and mixed-integer linear programming for scheduling vehicles.
Voigt et al. [35] presented a hybrid adaptive large neighborhood search method to solve
three variants of VRP. Seyfi et al. [36] presented a matheuristic method with a variable neigh-
borhood search with mathematical programming to solve multimode HEVRP. Cai et al. [37]
presented a hybrid evolutionary multitask algorithm to solve multiobjective VRPTWs.
Wen et al. [38] presented an improved adaptive large neighborhood search algorithm to
efficiently solve large-scale instances of the multidepot green VRP with time windows.
Ma et al. [39] presented an adaptive large neighborhood search algorithm to find near-
optimal solutions for larger-size time-dependent VRPs. In addition, some other algorithms
are also presented for solving VRPs and the other optimization problems [40–51].
The DE algorithm is widely applied in solving different VRPs. For solving large-scale
VRPs, there exist poor searchability, worsened population diversity, a slow convergence
speed, and so on. Many researchers have deeply studied and proposed some improve-
ments to the DE algorithm. Zhang et al. [52] presented a new constrained DE to obtain
an optimal feasible routing. Teoh et al. [53] presented a local search-based DE to solve
CVRP. Pitakaso et al. [54] presented five modified DEs for solving three subproblems.
Xing et al. [55] presented a hybrid discrete DE for solving the split delivery VRP in the lo-
gistic distribution. Sethanan et al. [56] presented a novel hybrid DE with a genetic operator
to solve the multitrip VRP with backhauls. Hameed et al. [57] presented a hybrid algorithm
based on discrete DE and TS for solving many instances of QAP. Liu et al. [58] presented
a mixed-variable DE for solving the hierarchical mixed-variable optimization problem.
Moonsri et al. [59] presented a hybrid and self-adaptive DE for solving an EGG distribu-
tion problem. Chai et al. [60] presented a multi-strategy fusion DE with multipopulation,
self-adaption and interactive mutation to solve the path planning of UAV. Wu et al. [61]
presented a fast and effective improved DE to solve the integer linear programming model.
Hou et al. [62] presented a multistate-constrained MODE with a variable neighborhood
to solve the real-world-constrained multiobjective problem. Chen et al. [63] presented a
fast-neighborhood algorithm based on crowding DE. In addition, some other DE algorithms
are also improved for solving the complex optimization problems [64–66]. A summary of
the main works is shown Table 1.
Table 1. A summary of the main works.
Name Key Points Advantages Disadvantages
Improve optimization
Zhang et al. [52] Constrained DE Lack of population diversity
performance
Teoh et al. [53] Local search-based DE Explore new search areas Lack of global searchability
Pitakaso et al. [54] Five modified DE Improve population diversity Fall into local optimal value
Avoid the prematurity and Slow convergence to
Xing et al. [55] Hybrid discrete DE
ensure the solution quality some extent
Hybrid DE with a
Sethanan et al. [56] Balance the exploration ability Fall into local optimal value
genetic operator
Enhance solutions, to reduce
Hameed et al. [57] Hybrid algorithm the distances between Increase the time complexity
the locations
Hierarchical mixed-variable
Liu et al. [58] Mixed-variable DE Lack of population diversity
mutation operator
245
Electronics 2022, 11, 3476
Table 1. Cont.
Name Key Points Advantages Disadvantages
Self-adaptive
Moonsri et al. [59] Hybrid and self-adaptive DE Fall into local optimal value
mutation strategy
Slow convergence to
Chai et al. [60] Multistrategy fusion DE Enhance population diversity
some extent
Enhance the
Hou et al. [62] Multistate-constrained MODE Increase the time complexity
optimization effectiveness
Chen et al. [63] Fast-neighborhood DE Faster convergence Lack of population diversity
Through these variants of DE, algorithms from various aspects have improved its
performance by parameter adaption, designing new mutation/crossover strategy, and
hybridity with the other algorithms, and so on. However, some defects, such as poor
population diversity and low search accuracy, still exist in solving the complex optimization.
Therefore, the DE algorithm needs to be further and more deeply studied in order to solve
the large-scale complex optimization problem.
3. Differential Evolution Algorithm
DE is an efficient evolutionary algorithm with a simple and clear structure and idea.
It combines parent individuals with other individuals in a population to produce new
offspring, which will continue to evolve in place of the parent if they possess better fitness
values. In brief, DE consists of the following parts:
3.1. Initialization
The parameters of DE are initialized and generally include: population (Np), dimen-
sion (D), mutation factor (F), crossover factor (CR), and the maximum number of iteration
(Gm). In addition, the individuals are initialized randomly within the specified range:
' (
(G) (G) (G)
xi,1 , xi,2 , . . . , xi,D , xi,D ∈ R D , i = 1, 2, . . . , NP.
3.2. Mutation
In each iteration of evolution, the parent generation generates Np mutation vectors
through certain mutation strategies. The mutation strategy is usually expressed as DE/x/y,
where x represents the vector to be mutated and Y represents the number of vectors to be
mutated during the mutation process. There are five variation strategies that are commonly
used in DE:
(1) DE/rand/1
(2) DE/Rand/1
g g g g
Vi = Xr1 + F × ( Xr2 − Xr3 ) (1)
(3) DE/best/1
(4) DE/Best/1
g g g g
Vi = Xbest + F × ( Xr1 − Xr2 ) (2)
(5) DE/rand-to-best/1
(6) DE/Rand-to-best/1
g g g g g g
Vi = Xi + F × ( Xbest − Xi ) + F × ( Xr1 − Xr2 ) (3)
(7) DE/current-to-rand/1
(8) DE/Current-to-rand/1
g g g g g g
Vi = Xi + K × ( Xr1 − Xi ) + F × ( Xr2 − Xr3 ) (4)
246
Electronics 2022, 11, 3476
(9) DE/current-to-best/1
(10) DE/Current-to-best/1
g g g g g g
Vi = Xi + F1 × ( Xbest − Xi ) + F2 × ( Xr1 − Xr2 ) (5)
where r1 , r2 and r3 are individuals selected randomly from 1 to Np individuals, and X is the
individual with the best adaptation in the gth iteration.
3.3. Crossover
After the mutation is executed, a crossover operation is performed to generate the
final experimental vector U by crossing the parent vector X with the mutation vector V
with a certain probability:
g
g Vi,j , i f rand(0, 1) ≤ CR or j = jrand
Ui,j = g (6)
Xi,j , otherwise
where j ∈ [1, D ].
3.4. Selection
If the experimental vector U performs better in fitness than the parent individual X,
then the parent individual is replaced with it:
g g g
g +1 Ui , i f f Ui ≤ f ( Xi )
Xi = g (7)
Xi , otherwise
where X will be the parent individual of the next generation evolution, and f (U) and f (X)
represent the adaptation values of the current generation experiment vector and the parent
individual, respectively.
4. Modeling Capacitated Vehicle Routing
VRP generally refers to organizing and calling a certain number of vehicles to a series
of shipping and receiving points, arranging appropriate travel routes so that the vehicles
pass through them in an orderly manner [67]. Under specified constraints (e.g., demand
and delivery of goods, delivery time, vehicle capacity limits, mileage limits, travel time
limits, etc.), we strive to achieve certain goals (e.g., shortest total vehicle miles driven,
lowest total transportation costs, vehicles arriving at a certain time, minimum number of
vehicles used, and so on.) [68–71].
4.1. Model Assumptions
The following assumptions are made for the model based on the actual problem:
(1) The distribution center is assigned to complete a series of demand point distribution
services.
(2) The relative geographical location and the corresponding demand quantity of the
distribution center and each demand point are given clearly.
(3) Vehicle distribution is completed and returned to the designated distribution center.
(4) The vehicles have the same specifications, and there are no errors.
(5) There is no consideration of urban traffic congestion.
(6) The distribution vehicles always travel at a constant speed, and the distribution cost is
equal within the unit distance, so the travel distance can represent the distribution cost.
(7) Each demand point shall be served by only one delivery vehicle, and the sum of the
requirements of all the demand points of the vehicle service shall be less than or equal
to the rated load limit of the vehicle.
247
Electronics 2022, 11, 3476
4.2. Symbolic Description
The relevant symbols are described in Table 2.
Table 2. List of symbols involved in the CVRP model.
Symbols Meaning
m Number of vehicles in distribution center
n Number of customer points
Q Vehicle capacity
The requirement for customer points I, di > 0
di
(i > 0), and D0 = 0
cij The distance from point i to point j
The degree of delivery requirements from the k
Xijk
vehicle distribution Point i to point j
A collection of distribution centers and
V
customer points
4.3. Objective Optimization Function
The CVRP model can be constructed based on the mentioned distribution objectives
and distribution requirements as follows:
Distribution objective:
n n m
Min Z = ∑ ∑ ∑ cij xijk (8)
i =0 j =0 k =1
Constraints:
n m
∑ ∑ xijk = 1 , i, j = 0, 1, 2, . . . , n (9)
i ( j)=0 k =1
n n
∑ xipk − ∑ xijk = 0 , k = 1, 2, . . . , m , p = 0, 1, . . . , n (10)
i =0 j =0
n n
∑ ∑ di xijk ≤ Q, k = 1, 2, . . . , m (11)
i =0 j =0
n n
∑ ∑ xijk ≤ |V | − 1 , k = 1, 2, . . . , m (12)
i =1 j =1
xijk ∈ {0, 1} , i, j = 0, 1, 2, . . . , n , k = 1, 2, . . . , m (13)
The optimization goal is represented by an Equation (8) to minimize the total distance
traveled. The constraint (9) represents the availability of one and only one vehicle per
customer point to provide service. The constraint (10) ensures that a customer point is
visited the same number of times as it is left. The constraint (11) ensures that the vehicle
works within its maximum load. The constraint (12) means that the subtour is eliminated.
The constraint (13) provides a mutable limit.
5. A Multistrategy-Based Differential Evolution Algorithm
The DE is a population-based adaptive global optimization algorithm with a simple
structure and high robustness. However, there are some problems in solving optimization
problems, such as poor searchability, slow convergence, and a tendency to fall into local
optimality. Therefore, a multistrategy DE algorithm, namely SEGDE, is proposed by
introducing the population initialization strategy, the differential mutation strategy, and the
gravity search algorithm. The mileage saving method is used to initialize the population
of the DE to improve the initial solution quality and the search efficiency. The differential
mutation strategy is adjusted by using a sequential encoding approach to perform a
legalization operation on the current solution to ensure that the solution is valid. Finally,
248
Electronics 2022, 11, 3476
the gravity search algorithm (GSA) is introduced to calculate the gravitational relationship
between points, which can be used to legitimize the solution, reinsert the points, effectively
adjust the search direction of evolution, optimize the search efficiency, and prevent the
algorithm from falling into local optimum, to obtain better optimization ability of complex
optimization problems.
These strategies in the SEGDE are described in detail as follows.
5.1. Population Initialization Strategy
Traditional DE algorithms usually use population random initialization to randomly
distribute the initial population in the feasible domain. In this way, the algorithm does
not depend on the initial population solution, but the quality of the initial population
often affects the efficiency and accuracy of the global search algorithm. The saving mileage
method is a heuristic algorithm for solving transportation problems [72]. The key idea of
the heuristic method is to combine the two circuits of the transportation problem according
to the distance table, which can reduce the total transportation distance and make the
distribution more efficient. Therefore, the initial population is a combination of the solution
of the mileage-saving method and the random individuals, which ensures the initial
population solution quality and allows the algorithm to carry out the follow-up search
around the individuals with better quality, to improve search efficiency.
5.2. Differential Mutation Strategy
Since the CVRP is discrete, a ranking encoding approach is used to adjust the operation
of the differential variation strategy DE/neighbor-to-neighbor/1 by using ranking numbers
instead of vectors for addition and subtraction. In addition, the solution after mutation
operation is not necessarily the legal solution to meet the requirements; after the mutation
operation, the current solution should be legal operation to ensure the effectiveness of the
solution. The solutions are searched from right to left, the repeated points are set to zero,
and the zero positions are re-inserted by using contemporary evolutionary individuals.
The individual variation was calculated using Equation (14), and the adjusted variation
process is shown in Table 3.
g g g g g
g mod Xr ,j + Xbest,j − Xr ,j + Xr ,j − Xr ,j + j − 1, j , i f rand < F
Vi,j = 3 3
g
1 2 (14)
Xbest,j , i f rand ≥ F
Table 3. Examples of variant operations (F = 0.5).
g g
Xr 1 − Xr 2
g
Xr 1 7 4 3 5 2 1 6
g
Xr 2 5 2 1 3 7 4 6
g g −5 −3
Xr 1 − Xr 2 2 2 2 2 0
−5 −3
g g
Xbest − Xr 3
g
Xbest 5 1 3 4 2 7 6
g
Xr 3 2 3 5 1 7 6 4
g g −2 −2 −5
Xbest − Xr 3 3 3 1 2
−2 −2 −5
g
Vi
rand
0.18 0.22 0.53 0.78 0.61 0.39 0.42
Rand
g
Ui 1 1 3 1 1 5 1
g
Vi 5 1 3 1 1 7 6
249
Electronics 2022, 11, 3476
5.3. Variable Correlation Using GSA
VRP is an optimization problem with point-line network topology. The key to solving
this problem is discovering the correlation between the points and connecting them. The
gravitational search algorithm (GSA) is used to calculate the gravitational relationship
between points, and the point-point relationship table is used for the legitimization of the
solution and the reinsertion link of points, which can effectively adjust the evolutionary
search direction and optimize the search efficiency. GSA is a bionic algorithm based on
the laws of Newton’s law of gravity and the laws of kinematics [73]. The core idea of the
algorithm is to calculate the value of the gravitational force between points according to
Newton’s universal gravity formula, update the gravitational table, adjust the mass of the
points according to the gravitational table, and use the mass table updated in the current
generation to guide the next generation solution.
Define the attraction between individual i and individual j as follows:
Mpi (t) × Maj (t) d
Fijd (t)= G(t) x j (t) − xid (t) (15)
Rij (t)+ε
where Maj is the related active gravitational mass of individual j, and Mpj is the related
passive gravitational mass of individual i. ε is a variable to prevent variables with denomi-
nators. Rij (t) is the Euclidean distance between individuals i and j.
Rij (t) =Xi (t) · Xj (t)2 (16)
In the d-dimension space, the exerted force on any particle is the exerted resultant
force on it by other particles, and the random weighted sum of the gravitational forces of
each particle is expressed as follows:
N
Fdi (t) = ∑ randj Fdij (t) (17)
j=1,j=i
where rand j is a random value in [0,1].
Therefore, the acceleration of an individual i in the d-dimension is described as follows:
Fdi (t)
adi (t) = (18)
Mii (t)
where Mii is the inertial gravity of individual i at iteration t.
Based on the above model, the position update of individuals can be obtained as fol-
lows:
vdi (t + 1) = randi × vdi (t) + adi (t) (19)
xid (t + 1) = xid (t)+vdi (t + 1) (20)
where randi is a random value in [0,1].
The GSA algorithm framework is shown in Figure 1.
250
Electronics 2022, 11, 3476
Figure 1. The framework of the GSA.
5.4. Model of the SEGDE
The flow of the SEGDE algorithm is shown in Figure 2.
Figure 2. The flow of the SEGDE algorithm.
251
Electronics 2022, 11, 3476
The implementation steps of the SEGDE are described as follows:
Step 1. The initial population is randomly generated by sequence coding, and the
size of the initial population is NP, the dimension D, the maximum evolutionary iteration
number Max, and the iteration number G = 1.
Step 2. The initial population is composed of the solution of the mileage saving method
and the random solution of the mileage saving method.
Step 3. Calculate the initial fitness values of the individuals.
Step 4. If the number of iterations G is less than the maximum number of evolutionary
iterations Max, enter Step 5; otherwise, proceed to Step 10.
Step 5. The strategy of neighborhood mutation is implemented to legalize the solution
of the mutated population.
Step 6. The neighborhood search is carried out for the individual population, and the
optimal solution in the local search is preserved.
Step 7. The gravity search algorithm is used to explore the relationship between
variables and update the table of point-point relations, preserving the optimal solution.
Step 8. A population selection operation is performed.
Step 9. If the number of iterations G = G + 1, return to Step 4.
Step 10. The output evolutionary optimal solution is obtained.
6. Experimental Calculation and Analysis
6.1. Experimental Data
In order to verify the effectiveness of the SEGDE algorithm in solving the CVRP,
data sets were selected from the operational research database OR-LIBRARY and the VRP
database | NEO Research Group (uma.es). A total of 41 data instances with fewer than 50
dimensions were selected from among four test data sets.
6.2. Experimental Environment and Parameter Settings
The experimental environment included CPU-intel Core I5-4200H, Windows-Win8,
RAM-4GB, and MATLAB R2018B. In the experiment, many alternative values are tested,
and some classical values were selected from the literature; these parameter values were
experimentally modified until the most reasonable parameter values were determined.
These selected parameter values obtained the optimal solution, so that they could accurately
and efficiently verify the effectiveness of the proposed SEGDE algorithm. Each experiment
was carried out 25 times independently, and the optimal solution of 25 experiments was
selected to compare with the other five algorithms. The five comparison algorithms were
standard DE, GA, SA, the mileage-saving method (MS), and the improved MS(IMS) method.
The settings of the parameters are shown in Table 4.
Table 4. The initial parameters of all algorithms.
Algorithms Parameter Settings
SA delta = 0.85, T = 150, Np = 100
GA CR = 0.7, F = 0.5, Np = 100
DE CR = 0.9, F = 0.5, Np = 100
SEGDE Fmin = 0.5, Fmax = 0.9, CR = 0.9, Np = 100
6.3. Experimental Results and Analysis
The obtained experimental results are shown in Tables 5–8.
252
Electronics 2022, 11, 3476
Table 5. The experimental results of six algorithms in solving set A.
Test Data Opt. SA GA MS IMS DE SEGDE
A32_5 784 739 850 842 827 1426 813
A33_5 661 740 700 713 700 1194 680
A33_6 742 924 798 775 743 1233 746
A34_5 778 895 856 810 793 1347 789
A36_5 799 814 897 826 806 1367 805
A37_5 669 806 752 705 708 1366 685
A37_6 949 949 1047 975 974 1595 954
A38_5 730 908 789 765 751 1497 734
A39_5 822 1009 954 898 894 1575 871
A39_6 831 1011 940 861 848 1618 852
A44_6 937 1021 974 985 1785 1534 943
A45_6 944 1231 1111 1005 955 2093 963
A45_7 1146 1431 1282 1200 1178 1968 1203
A46_7 914 1431 1068 940 934 1862 935
A48_7 1073 1343 1280 1110 1102 2180 1129
Table 6. The experimental results of six algorithms in solving set E.
Test Data Opt. SA GA MS IMS DE SEGDE
E22_K4 375 394 375 388 375 441 375
E23_K3 569 575 575 621 574 888 569
E30_K3 508 564 557 532 - 976 508
E33_K4 835 929 904 841 841 1180 841
E51_K5 521 697 685 582 - 1315 575
Table 7. The experimental results of six algorithms in solving set P.
Test Data Opt. SA GA MS IMS DE SEGDE
P16_K8 450 889 451 478 472 452 451
P19_K2 212 213 213 237 219 276 213
P20_K2 216 217 218 234 247 452 217
P21_K2 211 213 213 236 233 318 213
P22_K2 216 222 219 240 234 317 218
P22_K8 589 589 589 591 590 624 589
P23_K8 529 541 532 537 537 633 531
P40_K5 458 561 526 516 484 629 508
P45_K5 510 616 614 569 519 1142 563
Table 8. The experimental results of six algorithms in solving set B.
Test Data Opt. SA GA DE SEGDE
B31_K5 672 697 706 886 679
B34_K5 788 839 799 1186 790
B35_K5 955 1021 991 1665 970
B38_K6 805 887 845 1343 825
B39_K5 549 649 577 1314 563
B41_K6 829 989 880 1565 838
B43_K6 742 907 833 1387 775
B44_K7 909 1139 1058 1725 931
B45_K5 751 918 880 1631 755
B45_K6 678 888 791 1317 698
B50_K7 741 1006 879 1875 766
B50_K8 1312 1462 1401 2132 1352
B31_K5 672 697 706 886 679
B34_K5 788 839 799 1186 790
B35_K5 955 1021 991 1665 970
253
Electronics 2022, 11, 3476
As can be observed from Tables 5–8, for set A, the proposed SEGDE algorithm has
the best solutions of A33_5, A34_5, A36_5, A37_5, A38_5, and A39_5, and the IMS has
the best solutions of A33_6, A39_6, A45_6, A45_7, A46_7, and A48_7. SA has the best
solutions of A32_5 and A37_6. The IMS and SEGDE algorithm have obtained the best
solutions of six cases. The obtained best solutions of A33_6, A34_5, A37_6, A38_5, and
A44_6 are close to the optimal values by using the proposed SEGDE algorithm. For set E,
the proposed SEGDE algorithm has obtained the best solutions of all cases. In particular, the
optimal solutions of E22_K4, E23_K3, and E30_K3 are obtained using the proposed SEGDE
algorithm. The best solutions of the other cases are also close to the optimal values using
the proposed SEGDE algorithm. For set P, the proposed SEGDE algorithm has obtained
the best solutions, except those of P40_K5 and P45_K5. The optimal solution of P22_K8 is
obtained, and the obtained other solutions are also infinitely close to the optimal values
using the proposed SEGDE algorithm. The IMS has obtained the best solutions of P40_K5
and P45_K5. For set B, the proposed SEGDE algorithm has obtained all best solutions of all
cases. The obtained best solutions of B31_K5, B34_K5, B45_K5, and B34_K5 are infinitely
close to the optimal values using the proposed SEGDE algorithm. The experimental results
demonstrate that the proposed SEGDE algorithm can better solve these CVRPs from the
operational research database OR-LIBRARY and the VRP database, and the optimized
solutions are the optimal values, or are (infinitely) close to the optimal values. Therefore,
the proposed SEGDE algorithm takes on a better global optimization ability in solving
these different CVRPs. The reason for this is that the proposed SEGDE algorithm optimizes
the abilities of the saving mileage algorithm, the sequential encoding approach, and the
differential mutation strategy.
The routing comparison curves for generations 1 and 200 in the A33-K6 and B34-K5
optimization iterations are shown in Figures 3 and 4.
As can be observed from the optimization curves of the A33-K6 and B34-K5 cases in
Figures 3 and 4, the obtained optimization paths by using the proposed SEGDE algorithm
overlap to lessen, eliminate the path knot phenomenon, and effectively connect the adjacent
points. In addition, the paths gradually become localized, which achieves the total path
reduction. Through the experimental results of the test data, it can be observed that the
proposed SEGDE algorithm possesses an advantage in addressing the vehicle path planning
problem, and can approach the optimal solution to a great extent when the problem of
fewer than 30 dimensions are processed. It also performs well on most of the problems
with fewer than 50 dimensions, which proves the effectiveness of the proposed SEGDE
algorithm in solving the different CVRPs. Therefore, the proposed SEGDE algorithm can
effectively solve the CVRPs and obtain the optimized vehicle routing, as well as eliminate
the path knotting, thus avoiding overlap. It is an effective algorithm for solving the CVRPs
and the complex optimization problems.
254
Electronics 2022, 11, 3476
(a)
(b)
Figure 3. The optimization effect of A33-K6. (a) Optimization curve at Generation 1(1336.2577).
(b) Optimization curve at Generation 200(745.6772).
255
Electronics 2022, 11, 3476
(a)
(b)
Figure 4. The optimization effect of B34-K5. (a) Optimization curve at Generation 1(1492.6296).
(b) Optimization curve at Generation 200(790.3643).
256
Electronics 2022, 11, 3476
6.4. Discussion
As can be observed from Tables 5–8 and Figures 3 and 4, the proposed SEGDE algo-
rithm is used to solve CVRPs of set A, set B, set E, and set P; the obtained best solutions
of E22_K4, E23_K3, E30_K3, and P22_K8 are the optimal values, and the obtained best
solutions of A36_5, A38_5, E33_K4, P16_K8, P19_K2, P20_K2, P21_K2, P22_K2, and P23_K8
are (infinitely) close to the optimal values. Compared with the SA, GA, MS, IMS, and DE,
the proposed SEGDE algorithm can effectively solve these various CVRPs and obtain the
ideal vehicle routing, as well as eliminate the path knotting, avoiding overlap. Therefore,
the proposed SEGDE algorithm adopts a better global optimization ability. The reason is
that the proposed SEGDE algorithm is based on the saving mileage algorithm, the sequen-
tial encoding approach, and the differential mutation strategy. It optimizes the abilities
of the saving mileage algorithm, the sequential encoding approach, and the differential
mutation strategy. The saving mileage algorithm can improve the initial solution quality
and the search efficiency by initializing the population of the DE. The sequential encoding
approach can legalize the current solution and ensure its effectiveness by adjusting the
differential mutation strategy. The gravitational search algorithm can effectively adjust the
evolutionary search direction and further improve the search efficiency by calculating the
gravitational relationship between points.
7. Conclusions
In this paper, a new multistrategy DE, namely SEGDE, is proposed to solve various
CVRPs. In order to improve the search efficiency, the saving mileage algorithm is employed
to initialize the population of DE. The sequential encoding method is used to adjust the
differential mutation strategy to legalize the current solution and ensure its effectiveness.
The GSA is applied to calculate the gravitational relationship between points for solution
legalization and point reinsertion, which can effectively adjust the evolutionary search
direction and optimize the search efficiency. Finally, the CVRP example from the operational
research database is selected to verify the effectiveness of the proposed SEGDE algorithm.
The obtained best solutions of E22_K4, E23_K3, E30_K3, and P22_K8 are the optimal
values, and the obtained best solutions of A36_5, A38_5, E33_K4, P16_K8, P19_K2, P20_K2,
P21_K2, P22_K2, and P23_K8 are (infinitely) close to the optimal values. Compared with
the SA, GA, MS, IMS, and DE, the proposed SEGDE algorithm can effectively solve these
different CVRPs and obtain the ideal vehicle routing, as well as eliminate the path knotting,
avoiding overlap. Therefore, the experimental results demonstrate that the proposed
SEGDE algorithm has a good optimization ability, search speed, and routing length. In
addition, the stability of the SEGDE also possesses a good advantage.
Author Contributions: Conceptualization, J.W. and S.S.; methodology, S.S.; software, H.J.; validation,
J.Z., H.J. and Y.S.; formal analysis, H.J.; resources, Y.L.; data curation, Y.L.; writing—original draft
preparation, J.W. and S.S.; writing—review and editing, Y.L. and W.D.; visualization, J.Z.; supervision,
H.J.; project administration, J.W.; funding acquisition, W.D. All authors have read and agreed to the
published version of the manuscript.
Funding: This research was funded by the National Natural Science Foundation of China under grant
numbers U2133205 and 61771087, the Innovation and Entrepreneurship Training Program of Civil
Aviation University of China under grant number IECAUC2022126, the Traction Power State Key
Laboratory of Southwest Jiaotong University under Grant TPL2203, and the Research Foundation for
Civil Aviation University of China under grant numbers 3122022PT02 and 2020KYQD123.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: Not applicable.
Conflicts of Interest: The authors declare no conflict of interest.
257
Electronics 2022, 11, 3476
References
1. Hulagu, S.; Celikoglu, H.B. An electric vehicle routing problem with intermediate nodes for shuttle fleets. IEEE Trans. Intell.
Transp. Syst. 2022, 23, 1223–1235. [CrossRef]
2. Yang, Y.; Chen, H.; Heidari, A.A.; Gandomi, A.H. Hunger games search: Visions, conception, implementation, deep analysis,
perspectives, and towards performance shifts. Expert Syst. Appl. 2021, 177, 114864. [CrossRef]
3. Felipe, A.; Ortuno, M.T.; Righini, G.; Tirado, G. A heuristic approach for the green vehicle routing problem with multiple
technologies and partial recharges. Transp. Res. Part E-Logist. Transp. Rev. 2014, 71, 111–128. [CrossRef]
4. Ahmadianfar, I.; Heidari, A.A.; Noshadian, S.; Chen, H.; Gandomi, A.H. INFO: An efficient optimization algorithm based on
weighted mean of vectors. Expert Syst. Appl. 2022, 195, 116516. [CrossRef]
5. Wang, Z.; Sheu, J.B. Vehicle routing problem with drones. Transp. Res. Part B-Methodol. 2019, 122, 350–364. [CrossRef]
6. Dorling, K.; Heinrichs, J.; Messier, G.G.; Magierowski, S. Vehicle routing problems for drone delivery. IEEE Trans. Syst. Man
Cybern.-Syst. 2017, 47, 70–85. [CrossRef]
7. Wang, X.Y.; Shao, S.; Tang, J.F. Iterative local-search heuristic for weighted vehicle routing problem. IEEE Trans. Intell. Transp.
Syst. 2021, 22, 3444–3454. [CrossRef]
8. Wang, H.; Li, M.H.; Wang, Z.Y.; Li, W.; Hou, T.J.; Yang, X.Y.; Zhao, Z.Z.; Wang, Z.F.; Sun, T. Heterogeneous fleets for green vehicle
routing problem with traffic restrictions. In IEEE Transactions on Intelligent Transportation Systems; IEEE: Piscataway, NJ, USA,
2022. [CrossRef]
9. Khaitan, A.; Mehlawat, M.K.; Gupta, P.; Pedrycz, W. Socially aware fuzzy vehicle routing problem: A topic modeling based
approach for driver well-being. Expert Syst. Appl. 2022, 205, 117655. [CrossRef]
10. Ahmadianfar, I.; Heidari, A.A.; Gandomi, A.H.; Chu, X.; Chen, H. Run beyond the metaphor: An efficient optimization algorithm
based on Runge Kutta method. Expert Syst. Appl. 2021, 181, 115079. [CrossRef]
11. Oztas, T.; Tus, A. A hybrid metaheuristic algorithm based on iterated local search for vehicle routing problem with simultaneous
pickup and delivery. Expert Syst. Appl. 2022, 202, 117401. [CrossRef]
12. Feng, B.; Wei, L.X. An improved multi-directional local search algorithm for vehicle routing problem with time windows and
route balance. Appl. Intell. 2022, 1–13. [CrossRef]
13. Thiebaut, K.; Pessoa, A. Approximating the chance-constrained capacitated vehicle routing problem with robust optimization.
4OR-A Q. J. Oper. Res. 2022, 1–19. [CrossRef]
14. Li, S.; Chen, H.; Wang, M.; Heidari, A.A.; Mirjalili, S. Slime mould algorithm: A new method for stochastic optimization. Futur.
Gener. Comput. Syst. 2020, 111, 300–323. [CrossRef]
15. Storn, R.; Price, K. Differential Evolution: A Simple and Efficient Adaptive Scheme for Global Optimization over Continuous Spaces;
Technical Report; TR-95-012; International Computer Science Institute: California, CA, USA, 1995.
16. Yusuf, I.; Baba, M.S.; Iksan, N. Applied genetic algorithm for solving rich VRP. Appl. Artif. Intell. 2014, 28, 957–991. [CrossRef]
17. Akpinar, S. Hybrid large neighbourhood search algorithm for capacitated vehicle routing problem. Expert Syst. Appl. 2016, 61,
28–38. [CrossRef]
18. Zhang, D.F.; Cai, S.F.; Ye, F.R.; Si, Y.W.; Nguyen, T.T. A hybrid algorithm for a vehicle routing problem with realistic constraints.
Inf. Sci. 2017, 394, 167–182. [CrossRef]
19. Dechampai, D.; Tanwanichkul, L.; Sethanan, K.; Pitakaso, R. A differential evolution algorithm for the capacitated VRP with
flexibility of mixing pickup and delivery services and the maximum duration of a route in poultry industry. J. Intell. Manuf. 2017,
28, 1357–1376. [CrossRef]
20. Gutierrez, A.; Dieulle, L.; Labadie, N.; Velasco, N. A multi-population algorithm to solve the VRP with stochastic service and
travel times. Comput. Ind. Eng. 2018, 125, 144–156. [CrossRef]
21. Fallah, M.; Tavakkoli-Moghaddam, R.; Alinaghian, M.; Salamatbakhsh-Varjovi, A. A robust approach for a green periodic
competitive VRP under uncertainty: DE and PSO algorithms. J. Intell. Fuzzy Syst. 2019, 36, 5213–5225. [CrossRef]
22. Altabeeb, A.M.; Mohsen, A.M.; Ghallab, A. An improved hybrid firefly algorithm for capacitated vehicle routing problem. Appl.
Soft Comput. 2019, 84, 105728. [CrossRef]
23. Altabeeb, A.M.; Mohsen, A.M.; Abualigah, L.; Ghallab, A. Solving capacitated vehicle routing problem using cooperative firefly
algorithm. Appl. Soft Comput. 2021, 108, 107403. [CrossRef]
24. Xiao, J.H.; Zhang, T.; Du, J.G.; Zhang, X.Y. An evolutionary multiobjective route grouping-based heuristic algorithm for large-scale
capacitated vehicle routing problems. IEEE Trans. Cybern. 2021, 51, 4173–4186. [CrossRef] [PubMed]
25. Jia, Y.H.; Mei, Y.; Zhang, M.J. A bilevel ant colony optimization algorithm for capacitated electric vehicle routing problem. IEEE
Trans. Cybern. 2022, 52, 10855–10868. [CrossRef] [PubMed]
26. Jiang, H.; Lu, M.X.; Tian, Y.; Qiu, J.F.; Zhang, X.Y. An evolutionary algorithm for solving Capacitated Vehicle Routing Problems by
using local information. Appl. Soft Comput. 2022, 117, 108431. [CrossRef]
27. Deng, W.; Ni, H.C.; Liu, Y.; Chen, H.L.; Zhao, H.M. An adaptive differential evolution algorithm based on belief space and
generalized opposition-based learning for resource allocation. Appl. Soft Comput. 2022, 127, 109419. [CrossRef]
28. Zhang, X.Y.; Chen, L.; Gendreau, M.; Langevin, A. A branch-and-cut algorithm for the vehicle routing problem with two-
dimensional loading constraints. Eur. J. Oper. Res. 2022, 302, 259–269. [CrossRef]
29. Song, Y.J.; Cai, X.; Zhou, X.; Zhang, B.; Chen, H.; Li, Y.G.; Deng, W.; Deng, W. Dynamic hybrid mechanism-based differential
evolution algorithm and its application. Expert Syst. Appl. 2023, 213, 118834. [CrossRef]
258
Electronics 2022, 11, 3476
30. Niu, Y.Y.; Shao, J.; Xiao, J.H.; Song, W.; Cao, Z.G. Multi-objective evolutionary algorithm based on RBF network for solving the
stochastic vehicle routing problem. Inf. Sci. 2022, 609, 387–410. [CrossRef]
31. Deng, W.; Zhang, L.R.; Zhou, X.B.; Zhou, Y.Q.; Sun, Y.Z.; Zhu, W.H.; Chen, H.Y.; Deng, W.Q.; Chen, H.L.; Zhao, H.M. Multi-
strategy particle swarm and ant colony hybrid optimization for airport taxiway planning problem. Inf. Sci. 2022, 612, 576–593.
[CrossRef]
32. Gu, R.X.; Poon, M.; Luo, Z.H.; Liu, Y.; Liu, Z. A hierarchical solution evaluation method and a hybrid algorithm for the vehicle
routing problem with drones and multiple visits. Transp. Res. Part C Emerg. Technol. 2022, 141, 103733. [CrossRef]
33. Azad, U.; Behera, B.K.; Ahmed, E.A.; Panigrahi, P.K.; Farouk, A. Solving vehicle routing problem using quantum approximate
optimization algorithm. In IEEE Transactions on Intelligent Transportation Systems; IEEE: Piscataway, NJ, USA, 2022. [CrossRef]
34. Lai, Y.X.; Yang, F.; Meng, G.; Lu, W. Data-driven flexible vehicle scheduling and route optimization. In IEEE Transactions on
Intelligent Transportation Systems; IEEE: Piscataway, NJ, USA, 2022. [CrossRef]
35. Voigt, S.; Frank, M.; Fontaine, P.; Kuhn, H. Hybrid adaptive large neighborhood search for vehicle routing problems with depot
location decisions. Comput. Oper. Res. 2022, 146, 105856. [CrossRef]
36. Seyfi, M.; Alinaghian, M.; Ghorbani, E.; Catay, B.; Sabbagh, M.S. Multi-mode hybrid electric vehicle routing problem. Transp. Res.
Part E-Logist. Transp. Rev. 2022, 166, 102882. [CrossRef]
37. Cai, Y.Q.; Cheng, M.Q.; Zhou, Y.; Liu, P.Z.; Guo, J.M. A hybrid evolutionary multitask algorithm for the multiobjective vehicle
routing problem with time windows. Inf. Sci. 2022, 612, 168–187. [CrossRef]
38. Wen, M.Y.; Sun, W.; Yu, Y.; Tang, J.F.; Ikou, K. An adaptive large neighborhood search for the larger-scale multi depot green
vehicle routing problem with time windows. J. Clean. Prod. 2022, 374, 133916. [CrossRef]
39. Ma, B.S.; Hu, D.W.; Wang, Y.; Sun, Q.; He, L.W.; Chen, X.Q. Time-dependent vehicle routing problem with departure time and
speed optimization for shared autonomous electric vehicle service. Appl. Math. Model. 2023, 113, 333–357. [CrossRef]
40. Zhou, X.B.; Ma, H.J.; Gu, J.G.; Chen, H.L.; Deng, W. Parameter adaptation-based ant colony optimization with dynamic hybrid
mechanism. Eng. Appl. Artif. Intell. 2022, 114, 105139. [CrossRef]
41. Ren, Z.; Han, X.; Yu, X.; Skjetne, R.; Leira, B.J.; Sævik, S.; Zhu, M. Data-driven simultaneous identification of the 6DOF dynamic
model and wave load for a ship in waves. Mech. Syst. Signal Process. 2023, 184, 109422. [CrossRef]
42. Chen, H.Y.; Miao, F.; Chen, Y.J.; Xiong, Y.J.; Chen, T. A hyperspectral image classification method using multifeature vectors and
optimized KELM. IEEE J. Sel. Top. Appl. Earth Obs. Remote Sens. 2021, 14, 2781–2795. [CrossRef]
43. Xu, G.; Dong, W.; Xing, J.; Lei, W.; Liu, J. Delay-CJ: A novel cryptojacking covert attack method based on delayed strategy and its
detection. Digit. Commun. Netw. 2022, in press. [CrossRef]
44. Yao, R.; Guo, C.; Deng, W.; Zhao, H.M. A novel mathematical morphology spectrum entropy based on scale-adaptive techniques.
ISA Trans. 2022, 126, 691–702. [CrossRef]
45. Li, T.Y.; Shi, J.Y.; Deng, W.; Hu, Z.D. Pyramid particle swarm optimization with novel strategies of competition and cooperation.
Appl. Soft Comput. 2022, 121, 108731. [CrossRef]
46. Zhao, H.M.; Liu, J.; Chen, H.Y.; Chen, J.; Li, Y.; Xu, J.J.; Deng, W. Intelligent diagnosis using continuous wavelet transform and
gauss convolutional deep belief network. In IEEE Transactions on Reliability; IEEE: Piscataway, NJ, USA, 2022. [CrossRef]
47. Wu, D.; Wu, C. Research on the time-dependent split delivery green vehicle routing problem for fresh agricultural products with
multiple time windows. Agriculture 2022, 12, 793. [CrossRef]
48. Xu, G.; Bai, H.; Xing, J.; Luo, T.; Xiong, N.N. SG-PBFT: A secure and highly efficient distributed blockchain PBFT consensus
algorithm for intelligent Internet of vehicles. J. Parallel Distrib. Comput. 2022, 164, 1–11. [CrossRef]
49. Wei, Y.Y.; Zhou, Y.Q.; Luo, Q.F.; Deng, W. Optimal reactive power dispatch using an improved slime Mould algorithm. Energy
Rep. 2021, 7, 8742–8759. [CrossRef]
50. Zhang, Z.; Huang, W.G.; Liao, Y.; Song, Z.; Shi, J.; Jiang, X.; Shen, C.; Zhu, Z. Bearing fault diagnosis via generalized logarithm
sparse regularization. Mech. Syst. Signal Process. 2022, 167, 108576. [CrossRef]
51. Chen, H.Y.; Fang, M.; Xu, S. Hyperspectral remote sensing image classification with CNN based on quantum genetic-optimized
sparse representation. IEEE Access 2020, 8, 99900–99909. [CrossRef]
52. Zhang, X.Y.; Duan, H.B. An improved constrained differential evolution algorithm for unmanned aerial vehicle global route
planning. Appl. Soft Comput. 2014, 26, 270–284. [CrossRef]
53. Teoh, B.E.; Ponnambalam, S.G.; Kanagaraj, G. Differential evolution algorithm with local search for capacitated vehicle routing
problem. Int. J. Bio-Inspired Comput. 2015, 7, 321–342. [CrossRef]
54. Pitakaso, R.; Sethanan, K.; Srijaroon, N. Modified differential evolution algorithms for multi-vehicle allocation and route
optimization for employee transportation. Eng. Optim. 2019, 52, 1225–1243. [CrossRef]
55. Xing, L.N.; Liu, Y.Y.; Li, H.Y.; Wu, C.C.; Lin, W.C.; Song, W. A hybrid discrete differential evolution algorithm to solve the split
delivery vehicle routing problem. IEEE Access 2020, 8, 207962–207972. [CrossRef]
56. Sethanan, K.; Jamrus, T. Hybrid differential evolution algorithm and genetic operator for multi-trip vehicle routing problem with
backhauls and heterogeneous fleet in the beverage logistics industry. Comput. Ind. Eng. 2020, 146, 106571. [CrossRef]
57. Hameed, A.S.; Aboobaider, B.M.; Mutar, M.L.; Choon, N.H. A new hybrid approach based on discrete differential evolution
algorithm to enhancement solutions of quadratic assignment problem. Int. J. Ind. Eng. Comput. 2020, 11, 51–72. [CrossRef]
58. Liu, W.L.; Gong, Y.J.; Chen, W.N.; Liu, Z.Q.; Wang, H.; Zhang, J. Coordinated charging scheduling of electric vehicles: A
mixed-variable differential evolution approach. IEEE Trans. Intell. Transp. Syst. 2020, 21, 5094–5109. [CrossRef]
259
Electronics 2022, 11, 3476
59. Moonsri, K.; Sethanan, K.; Worasan, K.; Nitisiri, K. A hybrid and self-adaptive differential evolution algorithm for the multi-depot
vehicle routing problem in EGG distribution. Appl. Sci. 2022, 12, 35. [CrossRef]
60. Chai, X.Z.; Zheng, Z.S.; Xiao, J.M.; Yan, L.; Qu, B.Y.; Wen, P.W.; Wang, H.Y.; Zhou, Y.; Sun, H. Multi-strategy fusion differential
evolution algorithm for UAV path planning in complex environment. Aerosp. Sci. Technol. 2022, 121, 107287. [CrossRef]
61. Wu, P.; Xu, L.; D’Ariano, A.; Zhao, Y.X.; Chu, C.B. Novel formulations and improved differential evolution algorithm for optimal
lane reservation with task merging. In IEEE Transactions on Intelligent Transportation Systems; IEEE: Piscataway, NJ, USA, 2022.
[CrossRef]
62. Hou, Y.; Wu, Y.L.; Han, H.G. Multistate-constrained multiobjective differential evolution algorithm with variable neighborhood
strategy. In IEEE Transactions on Cybernetics; IEEE: Piscataway, NJ, USA, 2022. [CrossRef]
63. Chen, M.C.; Yerasani, S.; Tiwari, M.K. Solving a 3-dimensional vehicle routing problem with delivery options in city logistics
using fast-neighborhood based crowding differential evolution algorithm. J. Ambient. Intell. Humaniz. Comput. 2022, 1–14.
[CrossRef]
64. Deng, W.; Xu, J.; Song, Y.; Zhao, H.M. Differential evolution algorithm with wavelet basis function and optimal mutation strategy
for complex optimization problem. Appl. Soft Comput. 2021, 100, 106724. [CrossRef]
65. Li, X.; Zhao, H.; Yu, L.; Chen, H.; Deng, W.Q.; Deng, W. Feature extraction using parameterized multisynchrosqueezing transform.
IEEE Sens. J. 2022, 22, 14263–14272. [CrossRef]
66. Wu, X.; Wang, Z.C.; Wu, T.H.; Bao, X.G. Solving the family traveling salesperson problem in the adleman–lipton model based on
DNA computing. IEEE Trans. NanoBioscience 2021, 21, 75–85. [CrossRef]
67. Abu-Monshar, A.; Al-Bazi, A. A multi-objective centralised agent-based optimisation approach for vehicle routing problem with
unique vehicles. Appl. Soft Comput. 2022, 125, 109187. [CrossRef]
68. Torres, F.; Gendreau, M.; Rei, W. Vehicle routing with stochastic supply of crowd vehicles and time windows. Transp. Sci. 2021, 56,
631–653. [CrossRef]
69. Kuo, R.J.; Lu, S.H.; Mara, S.T.W. Vehicle routing problem with drones considering time windows. Expert Syst. Appl. 2022,
191, 116264. [CrossRef]
70. Ochelska-Mierzejewska, J.; Poniszewska-Maranda, A.; Maranda, W. Selected genetic algorithms for vehicle routing problem
solving. Electronics 2022, 10, 3147. [CrossRef]
71. Lei, D.M.; Cui, Z.Z.; Li, M. A dynamical artificial bee colony for vehicle routing problem with drones. Eng. Appl. Artif. Intell.
2022, 107, 104510. [CrossRef]
72. Sheng, Y.K.; Lan, W.L. Application of Clarke-Wright Saving Mileage Heuristic Algorithm in Logistics Distribution Route Optimization;
Trans Tech Publications Ltd.: Baech, Switzerland, 2011.
73. Hosseinabadi, A.A.R.; Vahidi, J.; Balas, V.E.; Mirkamali, S.S. OVRP_GELS: Solving open vehicle routing problem using the
gravitational emulation local search algorithm. Neural Comput. Appl. 2017, 29, 955–968. [CrossRef]
260
electronics
Article
Fine-Grained Classification of Announcement News Events in
the Chinese Stock Market
Feng Miu 1, *, Ping Wang 2 , Yuning Xiong 3 , Huading Jia 2 and Wei Liu 1
1 School of Artificial Intelligence and Law, Southwest University of Political Science & Law,
Chongqing 401120, China; [email protected]
2 School of Economic Information Engineering, Southwestern University of Finance and Economics,
Chengdu 611130, China; [email protected] (P.W.); [email protected] (H.J.)
3 School of Economics, Xihua University, Chengdu 610039, China; [email protected]
* Correspondence: [email protected]; Tel.: +86-189-8371-5062
Abstract: Determining the event type is one of the main tasks of event extraction (EE). The announce-
ment news released by listed companies contains a wide range of information, and it is a challenge to
determine the event types. Some fine-grained event type frameworks have been built from financial
news or stock announcement news by domain experts manually or by clustering, ontology or other
methods. However, we think there are still some improvements to be made based on the existing
results. For example, a legal category has been created in previous studies, which considers violations
of company rules and violations of the law the same thing. However, the penalties they face and the
expectations they bring to investors are different, so it is more reasonable to consider them different
types. In order to more finely classify the event type of stock announcement news, this paper proposes
a two-step method. First, the candidate event trigger words and co-occurrence words satisfying the
support value are extracted, and they are arranged in the order of common expressions through the
algorithm. Then, the final event types are determined using three proposed criteria. Based on the
real data of the Chinese stock market, this paper constructs 54 event types (p = 0.927, f = 0.946), and
Citation: Miu, F.; Wang, P.; Xiong, Y.; some reasonable and valuable types have not been discussed in previous studies. Finally, based on
Jia, H.; Liu, W. Fine-Grained the unilateral trading policy of the Chinese stock market, we screened out some event types that may
Classification of Announcement not be valuable to investors.
News Events in the Chinese Stock
Market. Electronics 2022, 11, 2058. Keywords: event extraction; event type; event trigger words; stock announcement news; stock return
https://doi.org/10.3390/
electronics11132058
Academic Editor: Arkaitz Zubiaga
1. Introduction
Received: 4 June 2022
Much empirical research has shown that news events have important impacts on
Accepted: 28 June 2022
the stock market. According to Yin’s classification standard [1], news can be divided into
Published: 30 June 2022
specific news and general news. Specific news refers to news stories where the affected stock
Publisher’s Note: MDPI stays neutral entities are clearly specified in the news text, while general news refers to stories where
with regard to jurisdictional claims in they are not. Specific news usually involves announcements about stocks. General news
published maps and institutional affil- includes industry news, policy news, microeconomic news and so on. When analyzing the
iations.
impact of general news on the stock market, we first need to determine the stock entities
that may be affected by such news. Due to the different processing methods for the two
kinds of news, this paper only focuses on stock announcement news, which can reflect
the recent development of a listed company. It can assist investors in making decisions
Copyright: © 2022 by the authors.
Licensee MDPI, Basel, Switzerland.
and can be used in stock return predictions. Determining the event type is one of the main
This article is an open access article
tasks of event extraction. The announcement news covers all aspects of information about
distributed under the terms and listed companies, so it is a challenge to build a maturity event type framework from stock
conditions of the Creative Commons announcement news.
Attribution (CC BY) license (https:// To date, there is no unified classification framework or standard for the news announce-
creativecommons.org/licenses/by/ ments regarding the Chinese stock market. Therefore, the existing research has constructed
4.0/).
Electronics 2022, 11, 2058. https://doi.org/10.3390/electronics11132058 https://www.mdpi.com/journal/electronics
261
Electronics 2022, 11, 2058
various event type frameworks using expert domain knowledge and experience [2], cluster-
ing [3], ontology [4], and other methods [5]. Some studies have implemented a fine-grained
event type framework. Following an analysis of the existing studies, we believe that there
is still room for improvement. The existing methods usually focus on the event types that
occur more frequently or are generally considered important. Some low-frequency event
types are usually neglected, and some event types can be further subdivided. For example,
an event type called legal has been constructed in many studies, which regards violations
of company policy and violations of the law as being the same. However, the two will
receive different penalties, resulting in different expected impacts on investors. Therefore,
we think it is more reasonable to regard the two as different event types.
Inspired by the “IDA-CLUSTERING + HUMAN-IDENTIFICATION” strategy [6], we
propose a two-step method to divide stock announcement news into more detailed types.
Event trigger words play an important role in the event type, which are usually verbs.
By combining these with the conventional expressions of a certain kind of announcement
news, we can extract expressions from an announcement news set containing event trigger
words. In order to take into account the industry characteristics and event emotional
tendency, we propose three event type judgment criteria to determine the final event type.
The experimental results of real data on the Chinese stock market show that the event type
framework constructed in this paper is reasonable and consistent with people’s cognition.
Compared with the existing related research results, our method finds some reasonable
and valuable event types that have not been discussed yet. Our work enriches the existing
research, and the results will help investors.
After extracting all kinds of announcement news events, we did not choose to conduct
the stock prediction work in the traditional way. This is due to the fact that we think it is
inappropriate to rely solely on announcement news for prediction without considering
other types of news such as industry news, financial news and so on. Instead, considering
the unilateral trading policy in the Chinese stock market, we screened out some event types
that are not valuable to investors.
2. Related Research
Event extraction is a typical task in the field of NLP that has been widely studied in
the past. Due to the subject of this paper, we focus on event extraction methods in the
economic domain. The ACE event typology “business”, which has four subtypes (Start-org,
Merge-org, Declare-bankruptcy, and End-org), is relevant to the economic domain. The
ACE event type definition does not meet our requirements. Therefore, researchers have pro-
posed various methods to categorize types of financial events according to actual situations.
Fung et al. [7] classified financial news into two simple types of events: stimulating
stock rise and stimulating stock fall. Wong et al. [8] carried out similar work, which used a
method based on feature words and template rules to identify three types of stock opinion
events (rising, stable and falling). Du et al. [9] proposed a PULS business intelligence system,
which detected 15 event types pre-categorized as “positive” or “negative”. Chen et al. [10]
proposed a fine-grained event extraction method and applied it to the stock price prediction
model. Firstly, a professional financial event dictionary (TFED) was constructed manually
by experts. The event type, event trigger word and event role were determined by the
dictionary, and the event was extracted using the template rules. The abovementioned
research did not separate stock announcement news from financial news, opting instead
to combine the two. Events are classified and used as inputs for the prediction model, so
the classification is usually rough. Liu [11] proposed a method for discovering financial
events that affect stock movements. Firstly, 13 types of financial events were manually
determined according to the industry characters; then, the keywords in the constructed
financial ontology were used to annotate the text. Liu’s work classified financial news
according to industry characteristics, and the types of construction are biased towards
industry news.
262
Electronics 2022, 11, 2058
The Stock Sonar project expert-created event typology identified eight event types:
“Legal”, “Analyst Recommendation”, “Financial”, “Stock Price Change”, “Deals”, “Mergers
and Acquisitions”, “Partnerships”, “Product”, and “Employment” [12]. The author focused
on the event types in stock announcement news, but the number of designed event types
are small and the coverage is not wide. He [13] constructed a stock market theme event case
base through ontology. The theme event types included financial policy events, monetary
policy events and market rule adjustment with multiple subtypes. The subject event was
defined in triple (event description, market description, event result). It can be seen from
the construction types that the author focuses on three types of macroeconomic events
and did not focus on the stock announcement news. Wang [14] constructed a corpus of
2500 news texts that were manually divided into two categories and six sub-categories.
Then, based on semantic, grammatical and syntactic features, the SVM method was used to
identify event types. Chen [15] implemented an event extraction system in the financial
field. Firstly, the system manually determined eight event types and selected seed event
sentences for each event type. Then, the seed event trigger words were extracted using
verb object relationship and subject predicate relationship and were extended by word2vec
to obtain the event trigger word dictionary. Han et al. [16] proposed a method for event
extraction in the business field by combining machine learning and template rules. Firstly,
a business event type framework was defined manually, in which business events were
divided into 8 categories and 16 sub-categories, and a small number of event triggers
were constructed. Then, the trigger word dictionary was extended via word embedding
to identify event types through multiple classification models combined with the trigger
word dictionary. References [14–16] manually classified the event type from the financial
news while paying close attention to the design of the event recognition model. Boudoukh
et al. [17] identified 18 event categories based on Capital-IQ types and a cross-section
of academics.
Arenarenarenko et al. [18] proposed an event extraction system named BEECON
(Business Events Extractor Component based on the ONtology) for business intelligence.
The system can identify 11 types and 41 sub-types of business events from news texts using
template rules. The experimental results verified that the system had high accuracy (95%).
Although the author built a rich and fine-grained event type framework, which includes
some news on the stock market, he focused on the events in the business domain, and
the coverage of stock announcement news event types was not comprehensive enough.
Zhang [19] proposed an event-driven stock recommendation model. The financial events
are manually classified into 12 categories and 30 sub-categories. The fine-grained event
type framework constructed by the author was all centered around stock announcement
news. It covered most of the events in the announcement news, but also ignored some
low-frequency event types, such as winning bid events. In addition, as we mentioned
earlier, some event types can be further subdivided. In terms of event recognition, the
author’s accuracy on the domain data set (67.3%) was much lower than the method that
used template rules in [18] (95%). The template rules method can usually achieve high
precision but requires much energy and expert experience. Some researchers consider
automatic template rule generation and use a small amount of training corpus and seed
templates through weak supervision, bootstrapping or other methods to automatically
generate more templates [20].
Zhou [21] implemented a financial event extraction system based on deep learning. In
the system, experts manually divided types of financial events (4 categories and 34 sub-
categories) and built two kinds of relationships tables between financial entities (personnel
to enterprise, enterprise to enterprise). The author constructed a detailed event type
framework around stock announcement news. From the classification of the first layer
types, the coverage was not wide (far less so than that of [19]). However, the author
divided the sub-types in a very detailed way, which is better than the divisions used in [19].
Wang et al. [22] proposed a bond event element extraction method based on CRF. The
event element framework was manually predefined and included bond event type and
263
Electronics 2022, 11, 2058
an event element list. Ding et al. [23] proposed a method to extract events from financial
reports. Due to the standard writing of the financial report text, it takes the titles at all
levels as the event category and the paragraphs under the title as the extraction unit. The
author constructs event types according to the characteristics of financial reports, and the
method is not suitable for stock announcement news. Wu [20] used the improved TFIDF
algorithm to calculate the weight of text eigenvalues, then clustered the text using the
K-means method. Finally, the most appropriate K = 13 value was selected by listing. The
13 event types included: issuance, dividend, event prompt, pledge, performance notice,
suspension and resumption of trading, fund-raising, increase or decrease of holdings,
financial report, investment in subsidiaries, abnormal fluctuation, asset reorganization and
change registration. The author used the clustering method to construct event types from
stock news. Although some event types could be found, some event types, especially those
with low frequency, are easily ignored.
The event study method is also widely used by researchers to analyze the impact of
news events on the Chinese stock market, which was initiated by Ball and Brown (1968)
and Fama et al. (1969). It is essentially a statistical analysis method. The basic idea of the
event study method is to select a certain type of specific event according to the research
purpose, calculate the abnormal return index in the event window period, and then explain
the impact of specific events on the change in sample stock price and return. There have
been many achievements in the research on the Chinese stock market involving many types
of stock announcement news events, such as monetary policy, industry related policies,
epidemic situations, explosion accidents, earthquakes, avian influenza, the Shenzhou
spacecraft launch, negative reputations, food safety accidents, environmental pollution,
performance forecast events, corporate mergers and acquisitions, the lifting of stock bans
and so on [24–26]. Besides stock markets, news event study also plays an important role in
commodity markets [27,28].
3. Proposed Method
3.1. Extracting Event Trigger Words
Event trigger words are key words that help us to identify event types, which are
usually verbs. Firstly, this paper proposes an algorithm and a support calculation formula,
which takes all stock announcement news texts as the input, extracts all verbs from the
text, marks the emotional polarity according to the emotional dictionary, takes the verb
as a candidate event trigger word and takes the announcement news containing the verb
as a class. Then it calculates the support between the other words and the verb, takes the
other words that meet the threshold as collocations and judges the word order between
collocations. Finally, it extracts candidate event trigger words and co-occurrence words
and arranges them in the order of common expressions. It can be described as Algorithm 1:
The function of Formula (1) involves calculating the support between words and the
verb, where CountB() represents the number of times the word appears before the verb, and
CountA() stands for the opposite. If the absolute value of Formula (1) exceeds the threshold,
this means that it is a conventional expression with a verb in the announcement news. If
the result is positive, it means the word is usually in front of the verb. If the probability of a
word appearing before and after the verb is close, it means that the word has no value in
the representation of the event type.
CountB(wi , wt ) CountA(wi , wt )
Support(wi , wt ) = − (1)
Count(wt ) Count(wt )
264
Electronics 2022, 11, 2058
Algorithm 1: Extract Candidate Trigger Words and Collocations from Announcement News
1. Input: Announcement news text set C
2. Output: event trigger words and collocation sequence set E
3. #Text preprocessing, put all verbs into set V, and judge the emotional polarity of verbs
4. For text in C
5. wlist1 = Segment(text)
6. wlist2 = NotStopWord(word1)
7. Postagger(wlist2)
8. if Postagger[word in wlist2] = Verb
9. add word in V
10. SentimentTag(V)
11. #From the announcement news set Ci containing verb Vi, judge the best position of other words,
trigger words and the best order between other words according to word co-occurrence, and calculate
the support
12. For word in Ci
13. beforeValueocc = Count(word, vi)/Count(Ci)
14. afterValueocc = Count(vi, word)/Count(Ci)
15. if beforeValueocc > afterValueocc and beforeValueocc > thred1
16. add word in listbfi
17. else if afterValueocc > thred1
18. add word in listafi
19. Add first word from listbfi, listafi in Ebefore and Eafter
20. For every word as w1 in listbfi
21. For every word as w2 in Ebefore
22. if Count(w1, w2) > Count(w2,w1)
23. add w1 in Ebefore and put w1 before w2
24. else
25. for next w2
26. if w1 not in Ebefore
27. // If a word is not placed before the sorted word, it is placed in the last position
28. add w1 in Ebefore and put in the last location.
29. Judge the position of words in listafi as shown above
30. Connect the words in ebefore and eafter in order to form vlist
31. if exist (beforeValueocc or afterValueocc)>thred2
32. put vList in E
33. else if Sentiment(vi) > 0
34. put vList in E
35. END
3.2. Three Classification Criteria
Based on the results of the above Algorithm 1, this paper puts forward three criteria
to judge whether it constitutes the final event type from the perspective of data mining.
The purpose of the three criteria is to select regular announcement news from the stock
announcement news set containing verbs and construct it into a type. When constructing
the event type of stock announcement news, the event extraction template is determined
according to the criteria. The three criteria are as follows:
(1) For verbs without emotional polarity, if there is a collocation with more than
0.95 support around the verb, combine the collocation with the verb as the event trigger
words. For example, there is a collocation of “扩股/capital increase (0.99)” to the left of
the verb “增资/share expansion”, so “增资扩股/capital increase and share expansion” is
used as the event trigger words. If the event trigger word itself contains independent type
information, it is determined as a type of event, and the event trigger word is directly used
as the extraction template. If the event trigger word does not constitute independent type
information, the collocation words whose support exceeds the threshold and the event
trigger words are constructed as a type of event. The form of word combination is used as
the event extraction template.
265
Electronics 2022, 11, 2058
We take the “垃圾焚烧/garbage burn” event as an example to illustrate the advantages
of the classification method. Firstly, through the algorithm, the output results about the
verb “焚烧/burn” are as follows:
[中标/winning the bid (0.38)-环保/environmental protection (0.54)-生活/domestic
(0.61)-垃圾/garbage (0.93)-焚烧 焚烧
焚烧/burn-发电/power generation (0.90)-项目/project (0.93)-投
资/investment (0.45)-建设/construction (0.24)-处理/treatment (0.32)]
Since there is no combinatorial collocation around the word “焚烧/burn”, the word
“burn” itself is used as an event trigger word, and the word itself does not constitute
independent type information. Therefore, the type is constructed together with the collo-
cation whose support exceeds the threshold, which forms the “garbage burn” event. The
extraction template is:
[ . . . ]垃圾/garbage [ . . . ]焚烧/burn [ . . . ]发电/power generation [ . . . ]项目/project
[ ... ]
Through the event extraction template, the announcement news events related to
environmental protection can be screened out from the meaningless stock announcement
news containing “burn”. For example, announcement news 3 (shown below) can be
excluded.
公告新闻3：辉丰股份(002496)公告, 子公司华通化学收到环保局出具行政处罚决定
书，要求对吡氟酰草胺项目责令限期改正，对RTO废气焚烧装置责令立即停止建设。
NEWS 3: (SZ002496) announced that Huatong Chemical, a subsidiary company,
received the decision of administrative punishment issued by the Environmental Protection
Bureau, demanding it to order the correction within a time limit for the pyruvic oxalamide
project and order the construction of RTO waste gas burn unit to stop immediately.
At the same time, the advantages of the event extraction template compared with the
word similarity calculation method and clustering method can be seen in announcements 4
and 5.
公告新闻4：绿色动力(601330)11月28日晚间公告，公司成为葫芦岛东部垃圾焚烧发电
综合处理厂生活垃圾焚烧发电项目的社会资本合作方，项目估算总投资不超过6.3亿元。
NEWS 4: (SH601330) announced on the evening of November 28 that the company
has become a social capital partner of the domestic garbage burn power generation project
of the waste incineration power generation comprehensive treatment plant in the east of
Huludao, with an estimated total investment of no more than 630 million yuan.
公告新闻5：城发环境(000885)9月26日晚间公告，公司为宜阳县生活垃圾焚烧发电项
目的中标人，项目总投资3.60亿元，项目合作期30年，含2年建设期。
News 5: (SZ000885) announced on the evening of September 26 that the company is
the bid winner of Yiyang domestic garbage burn power generation project, with a total
investment of 360 million yuan and a cooperation period of 30 years, including a two-year
construction period.
(2) If the verb or the collocation around the verb is combined to form an industry
characteristic word, the verb or the combined words are used as the event trigger words,
and the event trigger words are used as the event extraction template. Taking the “评
价/evaluate” verb as an example, the output of the algorithm is:
仿制/Imitation (0.50)-药/medical (0.76)-药品/drug (0.41)-制药/Pharmaceutical (0.57)-
通过/pass (0.67)-收到/receive (0.33)-一致性/consistency (0.78)-评价/Evaluate
The word “evaluate” itself does not constitute event type information, but it becomes
a word with the characteristics of the pharmaceutical industry after being combined with
the collocation word “consistency”. The introduction of “consistency evaluate” in Baidu
Encyclopedia is as follows:
“Drug consistency evaluation” is a drug quality requirement in the 12th Five
Year Plan for national drug safety, that is, the state requires that the imitated
drugs should be consistent with the quality and efficacy of the original drugs.
Specifically, it is required that the impurity spectrum is consistent, the stability is
consistent, and the dissolution law in vivo and in vitro is consistent.
266
Electronics 2022, 11, 2058
(3) The verbs with emotional polarity are screened, the words with clear semantics are
retained as event trigger words and the event recognition template is constructed according
to the trigger words. For example, emotional words such as “支持/support, 通过/pass
and 指导/guide” are filtered out, and words such as “犯罪/crime” and “违纪/violation of
discipline” are retained.
3.3. Event Types of Chinese Stock Announcement News
We used data on Chinese stock announcements collected from the EASTMONEY
website (https://www.eastmoney.com/ (accessed on 21 April 2020)) from March 2015 to
December 2019. A total of 59 types of events were constructed using the proposed method.
After sorting and merging, 54 types of events were finally obtained. The types of events
can also be optimized by evolutionary algorithms [29,30]. Table 1 shows the “put into
production” event type as an example.
Table 1. “投产/Put into production” event.
Event Type: 投产
投产/Put into Production”
ᣅӗ“投产
Event trigger word: 投产/Put into production
Words matching list extracted by the 期/Phase (0.33)-项目/Project (0.75)-建成/completed
algorithm (0.23)-投产/put into operation
Event identification template: [ . . . ]投产/Put into production [ . . . ]
(SZ000952): The VB2 production line of the industrial
Event example: park will be officially put into production, and the
performance is expected to achieve restorative growth.
The processing flow of our model is shown in Figure 1.
Figure 1. Processing flow of the proposed method.
4. Experimental Verification
4.1. Data Description
The main problem faced by experiments on event extraction methods in a specific
domain is a lack of a unified corpus and type division standards. Existing studies generally
label the experimental data manually and then verify the event extraction method on the
267
Electronics 2022, 11, 2058
labeled data set. The purpose of this section is to verify whether the classification of event
types in the stock announcement news proposed by this paper is reasonable. Therefore,
we first build the evaluation dataset and randomly select 60 stock announcements for
each type of event, of which 30 meet the event identification template (the actual number
shall prevail if less than 30). If the event identification template is in the form of a word
combination, then the remaining announcement news is extracted from the announcement
news that contains event trigger words but does not meet the identification template. For
example, the announcement news that contains the word “焚烧/burn” is selected from the
garbage burn event. If the recognition template is in the form of non-compound words,
it will be randomly selected from other announcements. Finally, each evaluation sample
contains 54 × 60 = 3240 announcements.
We select five teachers from Southwest University of Political Science and Law who
hold doctoral degrees or a vice senior academic title and have more than three years of
practical experience in the stock market as the evaluators. A random evaluation sample
is generated for each evaluator. In the evaluation sample, an example announcement is
provided for each type of event. The evaluator marks the announcement news similar to
the example as 1 and those not similar as 0.
4.2. Evaluation Results
In this paper, the precision p, recall R and F values are used to calculate the results
of five evaluation samples, and then the average value is taken as the final experimental
result. The formal definitions of p, R, and F are as follows:
The number o f announcements that the evaluators consider
consistent with the method in this paper
p= (2)
The number o f announcements o f this event type
identi f ied in this paper
The number o f announcements that the evaluators consider
consistent with the method in this paper
R= (3)
The number o f announcements o f this event type
maked as 1 by the evalutor
2PR
F= (4)
( P + R)
The final experimental results are shown in Table 2.
From the overall results, all event types identified have an average p value of 0.927, R
value of 0.969 and F value of 0.946, which shows that the type of announcements constructed
in this paper is reasonable. From the individual point of view, the p value of some event
types is poor, far lower than the average value. Through discussions with the evaluators,
we found that the reasons are as follows:
1. The average p value of “signing” is 0.796, which is far lower than the average since one
of the legal professional evaluators believes that there is a semantic difference between
the word “签署” and the word “签订”, although the two meanings are very similar.
2. The average p value of the “profit” event is 0.743, which is much lower than the
average since the specific information about the “profit” event is described in detail
in the sample text. Announcements that do not describe the specific information of
profit in detail shifted the focus of the evaluators.
3. The average p value of “impairment” is 0.752, which is much lower than the average
value. The reason is that the sample text describes the event of “asset impairment”.
The evaluators exclude the remaining “goodwill impairment” and “accrued (exclud-
ing asset) impairment” from the type, so the p value is low.
4. The average p value of “planning” is 0.759, which is much lower than the average
since the example text contains the word “major event” in addition to the planning
268
Electronics 2022, 11, 2058
trigger word. The evaluators believe that “major events” play an important role in
representing the planned events, so they marked the evaluation text without “major
events” as different.
Table 2. Experimental results of event types.
ID Event Type p R F
1 “垃圾焚烧”事件/garbage burn 0.977 0.95 0.963
2 “增资扩股”事件/Capital increase and share expansion 0.903 0.920 0.912
3 “业绩预告”事件/Performance forecast 0.910 0.947 0.928
4 “责令改正”事件/Order to correct 0.936 1.000 0.967
5 “权益分派”事件/Equity distribution 1.000 0.952 0.975
6 “股票解禁”事件/lifting the ban on stocks 0.901 1.000 0.948
7 “到期失效”事件/Expiration 1.000 0.988 0.994
8 “不确定性”事件/Uncertain 0.957 0.989 0.972
9 “届满”事件/Expiration 0.879 0.944 0.911
10 “可转换债券”事件/Convertible bond 0.925 0.966 0.945
11 “补助”事件/Subsidy 0.935 0.974 0.955
12 “犯罪”事件/Crime 0.917 0.927 0.922
13 “辞职”事件/Resignation 0.962 0.989 0.975
14 “一致性评价”事件/Consistency evaluation 0.871 1.000 0.931
15 “侦查”事件/Investigation incident 1.000 0.933 0.966
16 “违纪”事件/Violation of discipline 0.897 0.977 0.935
17 “行政处罚”事件/Administrative punishment 0.946 0.891 0.918
18 “拨付款”事件/Payment allocation 0.879 1.000 0.935
19 “投产”事件/Put into production 0.871 0.989 0.926
20 “拘留”事件/Detention 1.000 1.000 1.000
21 “盈利”事件/Profit 0.743 0.909 0.818
22 “预增”事件/Pre increase 0.978 0.940 0.959
23 “改制”事件/Restructuring 1.000 1.000 1.000
24 “减值”事件/Devaluation 0.752 0.989 0.854
25 “减持”事件/Reduction 0.968 0.968 0.968
26 “建成”事件/Completion 0.853 1.000 0.921
27 “清仓”事件/Clearance 0.849 0.939 0.892
28 “吞吐量”事件/Throughput 1.000 1.000 1.000
29 “预中标”事件/Pre bid winning 1.000 1.000 1.000
30 “转增股”事件/Conversion to share capital 0.827 0.990 0.901
31 “中标”事件/Winning the bid 1.000 1.000 1.000
32 “吸收合并”事件/Absorb merge 0.957 0.937 0.947
33 “扩建”事件/Expansion 0.882 0.978 0.927
269
Electronics 2022, 11, 2058
Table 2. Cont.
ID Event Type p R F
34 “诉讼”事件/Litigation 0.957 1.000 0.978
35 “发起设立”事件/Initiate establishment 0.875 0.893 0.884
36 “投建”事件/Investment and construction 0.978 0.989 0.984
37 “罢免”事件/Recall 0.967 1.000 0.983
38 “药品临床”事件/Drug clinical 0.817 1.000 0.899
39 “筹划”事件/Planning 0.759 0.908 0.827
40 “并购”事件/Merger and acquisition 0.925 0.976 0.950
41 “转让”事件/Transfer 0.829 0.823 0.826
42 “净利”事件/Net profit 1.000 0.979 0.989
43 “补贴”事件/Subsidy 0.913 1.000 0.955
44 “收购”事件/Acquisition 0.968 0.958 0.963
45 “增持”事件/Overweight 0.989 0.924 0.956
46 “质押”事件/Pledge 0.989 0.969 0.979
47 “罚款”事件/Fine 0.975 1.000 0.988
48 “违法”事件/Illegal 0.914 1.000 0.955
49 “冻结”事件/Freeze 1.000 1.000 1.000
50 “签署签订”事件/Signing 0.796 1.000 0.886
51 “回购”事件/Repurchase 0.978 0.989 0.984
52 “出售”事件/Sale 1.000 0.990 0.995
53 “设立公司”事件/Establishment of company 0.925 0.943 0.934
54 “股票激励”事件/Stock incentive 0.968 0.949 0.959
Total 0.927 0.969 0.946
4.3. Comparison to Existing Results
At present, there have been few studies focusing on event extraction from stock an-
nouncements [12,19,21], and more studies are focusing on event extraction from financial
news. We select some representative related studies and list them in Table 3 for comparison.
We roughly divide the methods of generating the event type framework into two categories:
full-manual and semi-manual. Full-manual means that the event type framework is com-
pletely determined by domain experts; semi-manual means a combination of some model
or algorithm and manual identification.
Due to a lack of a unified event type standard and framework for stock announcements,
we cannot compare our work with the existing related studies with numerical indicators.
Based on the fact that we have built a fine-grained event type framework, we mainly
compare our work with [18,19,21].
The model proposed in [18] identifies 11 types and 41 sub-types of events from the
business domain. The p value is 0.95, and the F value is 0.79. References [19,21] both use full-
manual methods to determine the event types, and both focus on the stock announcement
news. The event type framework in [19] includes 12 types and 30 sub-types of events.
Reference [21] includes 4 types and 34 sub-types of events. The p value in [19] is 0.673, and
the F1 value is 0.60. The p value in [21] is 0.967, and the F value is missing in the paper.
The p value of our work is 0.927, which is lower than those of [18,21] but higher than that
of [19]. The F value of our work is 0.946, higher than [18,19].
270
Electronics 2022, 11, 2058
Table 3. The results of related studies.
Source Method Event Type Framework
1 type: Business
ACE event
full-manual 4 subtypes: Start-org, Merge-org, Declare bankruptcy
typology
and End-org
8 types: Legal, Analyst Recommendation, Financial,
The Stock Sonar project [12] semi-manual Stock Price Change, Deals, Mergers and Acquisitions,
Partnerships, Product and Employment
11 types: Analyst Event, Bankruptcy, Company Basic
Information Change, Company Collaboration,
Company Growth, Product Event, etc.
BEECON [18] semi-manual
41 subtypes: reorganizations and changes in
employment, company changing its stock listing,
name or accounting procedures, debt financing, etc.
3 types: Financial Policy Events, Monetary Policy
Events and Market Rule Adjustment
He [13] semi-manual multiple subtypes: tax rate adjustment, deposit and
loan interest rate adjustment, national debt
adjustment, etc.
2 types: Macro-Events, Individual Stock Event
6 subtypes: policy events, social emergencies, mergers
Wang [14] semi-manual
and acquisitions, profitability, personnel changes
and refinancing
8 types: Major contracts, Raw Materials, Major
Conferences, Company Financial Statements, Major
Chen [15] full-manual
Policies, Mergers and Acquisitions, Personnel Changes
and Additional Allotments
8 types: Product Transformation, Equity Change,
Share Price Movement, Personnel Changes, Financial
Han et al. [16] full-manual Status, etc.
16 subtypes: win bidding, shareholding increase, stock
suspension, profit, debt, etc.
12 types: Major Events, Major Risks, Shareholding
Changes, Capital Changes, Emergencies, Special
Treatment, etc.
Zhang [19] full-manual
30 subtypes: enterprise cooperation, product release,
senior management change, reorganization and
merger, government support, etc.
18 types: Business Trend, Deal, Employment,
Boudoukh et al. [17] full-manual Financial, Mergers and Acquisitions, Earnings Factors,
Ratings, Legal, Product, Investment, etc.
13 types: Issuance, Dividend, Event Prompt, Pledge,
Wu [20] semi-manual Performance Notice, Suspension and Resumption of
Trading, Fund-Raising, etc.
4 types: Share Change, Debt, Market Transaction,
Enterprise Change
Zhou [21] full-manual 34 subtypes: senior management change, performance
change, product release, related party transactions,
equity auction, debt overdue, etc.
From the classification results, the fine-grained event type framework built in this
paper finds some reasonable and valuable event types that have not been discussed yet.
An example is the violation of company policies and violation of the law discussed in the
previous section. Another interesting example is that we built an event called throughput,
which is usually issued by listed companies in the airline or port sector. According to our
271
Electronics 2022, 11, 2058
knowledge, this event type has not been discussed in existing studies, which only list a
related type called “performance change”. Technically, the throughput event is actually
a sub-type of the performance change. Performance change news is usually announced
on a quarterly, semi-annual and annual basis, and thus cannot reflect short-term changes.
Unlike listed companies in other sectors, throughput events usually involve the company’s
main business. For example, Air China’s (SH601111) passenger transport business achieved
a revenue of 58.317 billion yuan in 2021, accounting for 78.24% of the operation revenue;
CMB Shekou’s (SZ001872) port business accounted for 95.76% of its revenue in 2021.
Due to various limitations, the event type framework constructed in this paper cannot
be directly compared with those of other studies. However, through the analysis of the
results we did find some event types that have not been discussed in the existing literature,
and these types are effective and reasonable. Therefore, we can say that the event type
framework constructed by the method proposed in this paper enriches the existing research,
and thus it has certain value and significance.
5. Filtering of Event Types
In this section, we did not choose to conduct stock return prediction in the traditional
way since we think it is inappropriate to rely solely on stock announcement news. Instead,
based on the unilateral trading policy of the Chinese stock market, we filtered out some
event types that are not valuable to investors. Our approach is that after the announcement
news is released, we enter the market and sell at the highest price in the short term.
Although in real life, the possibility of selling at the highest price is very low, here we
are describing the best-case scenario. We believe that if in the ideal situation the return
obtained based on a certain event type is small or the probability is low, combined with the
unilateral trading policy, we think such an event type is not valuable to investors.
5.1. Return Calculation Method
If the official announcement time of the event is between the opening in the morning of
the day and the closing in the afternoon of the day, mark the day as t = 1. Otherwise, mark
the first trading day after the event as t = 1. We consider the best return and probability of
entering the market at t = 1 and selling stocks at t = 2 or t = 3. This paper selects three kinds
of entry prices: opening price, closing price and the highest price in the worst case, and
sells the stock at the highest price of the day at t = 2 or t = 3 to obtain the return. Although
the probability of selling at the highest price is small in reality, the purpose of this paper is
to provide a reference for investors according to historical data based on the probability of
obtaining the best return value. If the return value or proportion is low under the best-case
scenario, this indicates that making decisions based on this kind of news is risky and has
no investment value. The calculation of the best return obtained at three entry prices is
as follows:
DRETOH2 = ( Hipr T =2 − Oppr T =1 )/Oppr T =1 (5)
DRETHH2 = ( Hipr T =2 − Hipr T =1 )/Hipr T =1 (6)
DRETCH2 = ( Hipr T =2 − Cl pr T =1 )/Cl pr T =1 (7)
DRETOH2 refers to the return from selling stocks at the highest price at t = 2 after
entering the market at t = 1; similarly, DRETOH3 is expressed as the return of entering the
market at t = 1 and selling stocks at the highest price at t = 3. DRETHH2 and DRETCH2
represent the best return when entering the market at the highest price and closing price of
the day at t = 1 and when selling stocks at the highest price at t = 2, respectively.
5.2. Investment Results
According to the 54 types of announcement events constructed in this paper, the
transaction data within the time span from March 2015 to December 2019 are selected. In
this period, by using the above return calculation method, the results of some types of
investment return are shown in Table 4.
272
Table 4. Investment return for some event types.
Purchase Price: Opening Price Purchase Price: Highest Price Purchase Price: Closing Price
Event Type Selling Time t Sample
Probability of Average Probability of Average Probability of Average
Variance Variance Variance Sizes
Positive Return Return Positive Return Return Positive Return Return
2 69.4% 3.3% 0.4% 42.2% 0.3% 0.3% 78.2% 2.6% 0.2% 147
Capital
increase and 3 61.2% 3.2% 1.1% 42.2% 0.2% 0.9% 63.3% 2.5% 0.7% 147
Electronics 2022, 11, 2058
share
The experimental results show that the best investment scheme for such events is to buy at the closing price and sell on the second day. It has a probability of 78.2% and can
expansion
obtain a positive return with an average of 2.6%.
2 77.1% 3.1% 0.1% 62.9% 0.7% 0.1% 91.4% 2.5% 0.1% 35
3 91.4% 3.4% 0.1% 77.1% 1.0% 0.1% 91.4% 2.8% 0.1% 35
Expiration
The experimental results show that the best investment scheme for such events is to buy at the opening price and sell on the third day, with a probability of 91.4% and a positive
return with an average of 3.4%; the second best investment scheme is to buy at the closing price and sell on the third day, with a probability of 91.4% and a positive return with
an average of 2.8% or to sell on the second day with a probability of 91.4% and a positive return with an average of 2.5%.
2 71.6% 1.0% 0.3% 33.8% −1.4% 0.2% 79.7% 0.8% 0.1% 74
3 58.1% −0.1% 0.6% 35.1% −2.5% 0.4% 51.4% −0.4% 0.3% 74
Restructuring
It can be seen from the experimental results that the positive average return of this kind of event sample is low. Therefore, such events have no investment value.
2 68.8% 1.5% 0.1% 42.5% 0.1% 0.1% 83.8% 1.4% 0.0% 80
3 60.0% 1.5% 0.2% 42.5% 0.2% 0.2% 70.0% 1.4% 0.1% 80
Throughput
The experimental results show that the best investment scheme for such events is to buy at the closing price and sell on the second day, with a probability of 83.8% and a positive
return with an average of 1.4%.
273
2 64.4% 2.3% 0.5% 42.5% 0.1% 0.4% 78.3% 2.9% 0.3% 811
Conversion to 3 59.4% 2.5% 1.0% 45.4% 0.3% 1.0% 67.2% 3.0% 0.8% 811
share capital
The experimental results show that the best investment scheme for such events is to buy at the closing price and sell on the second day. It has a probability of 78.3% and can
obtain a positive return with an average of 2.9%.
2 66.7% 1.5% 0.2% 36.3% −0.5% 0.1% 79.6% 1.5% 0.1% 1990
Winning the 3 59.6% 1.3% 0.4% 37.3% −0.7% 0.3% 64.2% 1.3% 0.3% 1990
bid The experimental results show that the best investment scheme for such events is to buy at the closing price and sell on the second day. It has a probability of 79.6% and can
obtain a positive return with an average of 1.5%.
2 73.8% 2.3% 0.2% 42.1% 0.2% 0.1% 82.2% 1.9% 0.1% 107
3 67.3% 2.3% 0.3% 40.2% 0.2% 0.2% 70.1% 2.0% 0.2% 107
Subsidy
The experimental results show that the best investment scheme for such events is to buy at the closing price and sell on the second day, with a probability of 82.2% and a positive
return with an average of 1.9%.
Table 4. Cont.
Purchase Price: Opening Price Purchase Price: Highest Price Purchase Price: Closing Price
Sample
Event Type Selling Time t Probability of Average Probability of Average Probability of Average
Variance Variance Variance Sizes
Positive Return Return Positive Return Return Positive Return Return
2 64.5% 2.3% 0.5% 42.0% 0.0% 0.4% 73.8% 2.3% 0.3% 3555
3 58.6% 2.3% 1.1% 42.0% 0.0% 1.0% 60.0% 2.3% 0.9% 3555
Electronics 2022, 11, 2058
Acquisition
The experimental results show that the best investment scheme for such events is to buy at the closing price and sell on the second day, with a probability of 73.8% and a positive
return with an average of 2.3%.
2 72.8% 3.2% 0.4% 43.1% 0.2% 0.2% 81.7% 2.6% 0.2% 3268
3 66.7% 3.3% 0.7% 43.5% 0.3% 0.5% 67.1% 2.7% 0.5% 3268
Overweight
The experimental results show that the best investment scheme for such events is to buy at the closing price and sell on the second day, with a probability of 81.7% and a positive
return with an average of 2.6%.
2 65.2% 1.5% 0.4% 35.0% −1.2% 0.2% 70.5% 0.8% 0.2% 397
3 60.5% 1.5% 0.8% 39.3% −1.2% 0.5% 63.2% 0.8% 0.5% 397
Illegal
It can be seen from the experimental results that although the probability of obtaining a positive return is 70.5%, the average positive return is small. Therefore, on the whole,
such events are not good for investment.
2 65.7% 2.1% 0.3% 39.2% −0.2% 0.2% 77.4% 2.1% 0.1% 1809
3 58.5% 1.9% 0.6% 40.3% −0.5% 0.6% 64.0% 1.8% 0.5% 1809
Signing
The experimental results show that the best investment scheme for such events is to buy at the closing price and sell on the second day, with a probability of 77.4% and a positive
return with an average of 2.1%.
274
2 72.1% 2.9% 0.3% 40.4% 0.0% 0.2% 81.9% 2.3% 0.1% 408
3 66.4% 2.8% 0.7% 42.9% −0.2% 0.5% 67.4% 2.1% 0.5% 408
Stock incentive
The experimental results show that the best investment scheme for such events is to buy at the closing price and sell on the second day, with a probability of 81.9% and a positive
return with an average of 2.3% or buy at the opening price and sell on the second day, with a probability of 72.1% and a positive return with an average of 2.9%.
Electronics 2022, 11, 2058
Due to space limitations, we only list the results of several event types in Table 4. Eight
event types have low returns or probabilities, even under the best conditions. Among
these eight types of events, the event types with the smallest benefit value are “Illegal” and
“Restructuring” which only come with an average positive return of 0.8%. The remaining
events in the order of return from small to large are: “Expiration” (0.9%), “order to correct”
(1.0%), “Resignation” (1.1%), “Recall” (1.1%), “Freeze” (1.3%) and “Planning” (2.7%).
The event type with the smallest probability value is “Freeze” (68.8%). The remaining
events in the order of probability from small to large are: “Planning” (69%), “Illegal” (70.5%),
“Recall” (75%), “Resignation” (75.9%), “Expiration” (78%), “order to correct” (78.9%), and
“Restructuring” (79.7%).
6. Conclusions
Stock announcements contains much information about all aspects of a company,
which are important for investors and stock forecasting. It is difficult to determine the
event types from stock announcements. As there is no unified classification standard,
existing studies have constructed various event type frameworks based on domain experts’
experience, Clustering, ontology and other methods. Some studies have resulted in a
fine-grained classification framework. However, we believe that there is still room for
improvement on the basis of the existing research (e.g., the abovementioned violations
of laws and violations of company policy events). Based on different punishments and
expectations for investors, we think that it is more reasonable to classify events into different
types rather than into one type in the manner of the extant literature.
In order to obtain more detailed event types of stock announcement news, we proposed
a two-step method. First, all verbs extracted from the announcement news are used as
candidate event triggers. Due to the common expressions in Chinese announcement news,
if there is an event type, it usually has a conventional expression form. On the contrary, if a
candidate event trigger word (verb) does not suggest an event type, the expression of the
news containing the verb is chaotic. Therefore, we combine co-occurrence words with the
candidate event trigger words and express them in an ordered sequence of words. Then,
we use three proposed criteria to determine the final event types.
Based on real data on the Chinese stock market, we finally constructed 54 event types
from the announcement news. The verification results of the constructed event types
(p = 0.927, f = 0.946) show that it is reasonable and consistent with people’s cognition.
Further, we compare our work with other similar studies (summarized in Table 3). First
of all, most of the existing studies focus on the event types in the financial news, and
only regard the stock announcement news as part of this greater whole. Therefore, the
event type frameworks built are usually rough. Then, we compared our results with those
of [18,19,21], which also constructed fine-grained event types from stock announcement
news. The p value of our work is lower than those of [18] (0.95) and [21] (0.967) but
higher than that of [19] (0.673). The F value of our work is higher than those of [18] (0.79)
and [19] (0.6). From the results of the constructed event types, our method has found some
reasonable and valuable event types that have not been discussed yet. For example, an
event type named “throughput” is constructed in this paper. To the best of our knowledge,
this is the first of its kind, and only one similar event type called “performance change”
can be found in the existing research. In the Chinese stock market, companies usually
release quarterly, semi-annual or annual performance change news, so this method cannot
reflect short-term changes. “Throughput” events are released by airline or port sector
stocks. Unlike in other stock sectors, a “throughput” event is usually the main business.
For example, CMB Shekou’s (SZ001872) port business accounted for 95.76% of its revenue
in 2021. “Throughput” events can reflect the short-term performance changes of these
companies and are valuable for investors.
In conclusion, our research on event extraction from stock announcements has enriched
the existing literature, so it is of value and significance.
275
Electronics 2022, 11, 2058
After constructing a fine-grained announcement news event type framework, we did
not choose to conduct stock prediction work in a traditional way since we believe that it is
inappropriate to consider announcements without other types of news, such as industry
news and macroeconomic news (as has been proven in the literature). Instead, based on the
unilateral trading policy of the Chinese stock market, we screen out some event types that
are not valuable to investors according to their performance under the best-case scenario.
We did not carry out a precise calculation here but consider the event performance under
special circumstances.
Author Contributions: Formal analysis, F.M.; investigation, P.W.; methodology, F.M., Y.X. and W.L.;
software, F.M. and H.J.; supervision, F.M.; writing—original draft, F.M., P.W., Y.X., H.J. and W.L.;
writing—review and editing, F.M., Y.X., P.W., H.J. and W.L. All authors have read and agreed to the
published version of the manuscript.
Funding: This research received no external funding.
Data Availability Statement: The data presented in this study are available on request from the
corresponding author.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Yi, Z. Research on Deep Learning Based Event-Driven Stock Prediction. Ph.D. Thesis, Harbin Institute of Technology, Harbin,
China, 2019.
2. Yang, H.; Chen, Y.; Liu, K.; Xiao, Y.; Zhao, J. DCFEE: A document-level Chinese financial event extraction system based on
automatically labeled training data. In Proceedings of the ACL 2018, System Demonstrations, Melbourne, Australia, 15–20 July
2018; pp. 50–55.
3. Linghao, W.U. Empirical Analysis of the Impact of Stock Events on Abnormal Volatility of Stock Prices. Master’s Thesis,
Huazhong University of Science and Technology, Wuhan, China, 2019.
4. Balali, A.; Asadpour, M.; Jafari, S.H. COfEE: A Comprehensive Ontology for Event Extraction from text. arXiv 2021,
arXiv:2107.10326. [CrossRef]
5. Guda, V.; Sanampudi, S.K. Rules based event extraction from natural language text. In Proceedings of the 2016 IEEE International
Conference on Recent Trends in Electronics, Information & Communication Technology (RTEICT), Bangalore, India, 20–21 May
2016; pp. 9–13.
6. Ritter, A.; Etzioni, O.; Clark, S. Open domain event extraction from twitter. In Proceedings of the 18th ACM SIGKDD International
Conference on Knowledge Discovery and Data Mining, Beijing, China, 12–16 August 2012; pp. 1104–1112.
7. Fung GP, C.; Yu, J.X.; Lam, W. Stock prediction: Integrating text mining approach using real-time news. In Proceedings of the
2003 IEEE International Conference on Computational Intelligence for Financial Engineering, Hong Kong, China, 20–23 March
2003; pp. 395–402.
8. Wong, K.F.; Xia, Y.; Xu, R.; Wu, M.; Li, W. Pattern-based opinion mining for stock market trend prediction. Int. J. Comput.
Processing Lang. 2008, 21, 347–361. [CrossRef]
9. Du, M.; Pivovarova, L.; Yangarber, R. PULS: Natural language processing for business intelligence. In Proceedings of the 2016
Workshop on Human Language Technology, New York, NY, USA, 9–15 July 2016; pp. 1–8.
10. Chen, C.; Ng, V. Joint modeling for Chinese event extraction with rich linguistic features. In Proceedings of the COLING 2012,
Mumbai, India, 8–15 December 2012; pp. 529–544.
11. Liu, L. Heterogeneous Information Based Financial Event Detection. Ph.D. Thesis, Harbin Institute of Technology, Harbin,
China, 2010.
12. Feldman, R.; Rosenfeld, B.; Bar-Haim, R.; Fresko, M. The stock sonar—sentiment analysis of stocks based on a hybrid approach.
In Proceedings of the AAAI Conference on Artificial Intelligence, San Francisco, CA, USA, 7–11 August 2011; pp. 1642–1647.
13. He, Y. Research on Ontology-Based Case Base Building and Reasoning for Theme Events in the Stock Markets. Master’s Thesis,
Hefei University of Technology, Hefei, China, 2017.
14. Wang, Y. Research on Financial Events Detection by Incorporating Text and Time-Series Data. Master’s Thesis, Harbin Institute of
Technology, Harbin, China, 2015.
15. Chen, H. Research and Application of Event Extraction Technology in Financial Field. Ph.D. Thesis, Beijing Institute of Technology,
Beijing, China, 2017.
16. Han, S.; Hao, X.; Huang, H. An event-extraction approach for business analysis from online Chinese news. Electron. Commer. Res.
Appl. 2018, 28, 244–260. [CrossRef]
17. Boudoukh, J.; Feldman, R.; Kogan, S.; Richardson, M. Information, trading, and volatility: Evidence from firm-specific news. Rev.
Financ. Stud. 2019, 32, 992–1033. [CrossRef]
276
Electronics 2022, 11, 2058
18. Arendarenko, E.; Kakkonen, T. Ontology-based information and event extraction for business intelligence. In Proceedings of
the 2012 International Conference on Artificial Intelligence: Methodology, Systems, and Applications, Varna, Bulgaria, 13–15
September 2012; pp. 89–102.
19. Zhang, W. Research on key technologies of event-driven stock market prediction. Ph.D. Thesis, Harbin Institute of Technology,
Harbin, China, 2018.
20. Turchi, M.; Zavarella, V.; Tanev, H. Pattern learning for event extraction using monolingual statistical machine translation. In
Proceedings of the International Conference Recent Advances in Natural Language Processing 2011, Hissar, Bulgaria, 10–16
September 2011; pp. 371–377.
21. Zhou, X. Research on Financial Event Extraction Technology Based on Deep Learning. Ph.D. Thesis, University of Electronic
Science and Technology of China, Chengdu, China, 2020.
22. Wang, Y.; Luo, S.; Hu, Z.; Han, M. A Study of event elements extraction on Chinese bond news texts. In Proceedings of the
2018 IEEE International Conference on Progress in Informatics and Computing (PIC), Suzhou, China, 14–16 December 2018;
pp. 420–424.
23. Ding, P.; Zhuoqian, L.; Yuan, D. Textual information extraction model of financial reports. In Proceedings of the 2019 7th
International Conference on Information Technology: IoT and Smart City, Shanghai, China, 20–23 December 2019; pp. 404–408.
24. Wang, A. Study on the Impact of Change on Interest Rate on Real Estate Listed Companies Stock Price. Master’s thesis,
Southwestern University of Finance and Economics, Chengdu, China, 2012.
25. Jinmei Zhao Yu Shen Fengyun, W.U. Natural disasters, man-made disasters and stock prices: A study based on earthquakes and
mass riots. J. Manag. Sci. China 2014, 17, 19–33.
26. Yi, Z.; Lu, H.; Pan, B. The impact of Sino US trade war on China’s stock market—An analysis based on event study method. J.
Manag. 2020, 33, 18–28.
27. Li, T.; Qian, Z.; Deng, W.; Zhang, D.; Lu, H.; Wang, S. Forecasting crude oil prices based on variational mode decomposition and
random sparse Bayesian learning. Appl. Soft Comput. 2021, 113, 108032. [CrossRef]
28. Brandt, M.; Gao, L. Macro fundamentals or geopolitical events? A textual analysis of news events for crude oil. J. Empir. Financ.
2019, 51, 64–94. [CrossRef]
29. Li, T.; Shi, J.; Deng, W.; Hu, Z. Pyramid particle swarm optimization with novel strategies of competition and cooperation. Appl.
Soft Comput. 2022, 121, 108731. [CrossRef]
30. Deng, W.; Shang, S.; Cai, X.; Zhao, H.; Zhou, Y.; Chen, H.; Deng, W. Quantum differential evolution with cooperative coevolution
framework and hybrid mutation strategy for large scale optimization. Knowl.-Based Syst. 2021, 224, 107080. [CrossRef]
277
electronics
Article
Hybrid Graph Neural Network Recommendation Based on
Multi-Behavior Interaction and Time Sequence Awareness
Mingyu Jia, Fang’ai Liu *, Xinmeng Li and Xuqiang Zhuang
School of Information Science and Engineering, Shandong Normal University, Jinan 250358, China
* Correspondence: [email protected]
Abstract: In recent years, mining user multi-behavior information for prediction has become a hot
topic in recommendation systems. Usually, researchers only use graph networks to capture the
relationship between multiple types of user-interaction information and target items, while ignoring
the order of interactions. This makes multi-behavior information underutilized. In response to the
above problem, we propose a new hybrid graph network recommendation model called the User
Multi-Behavior Graph Network (UMBGN). The model uses a joint learning mechanism to integrate
user–item multi-behavior interaction sequences. We designed a user multi-behavior information-
aware layer to focus on the long-term multi-behavior features of users and learn temporally ordered
user–item interaction information through BiGRU units and AUGRU units. Furthermore, we also
defined the propagation weights between the user–item interaction graph and the item–item relation-
ship graph according to user behavior preferences to capture more valuable dependencies. Extensive
experiments on three public datasets, namely MovieLens, Yelp2018, and Online Mall, show that our
model outperforms the best baselines by 2.04%, 3.82%, and 3.23%.
Keywords: multi-behavior recommendation; sequential recommendation; graph neural network;
embedding propagation
Citation: Jia, M.; Liu, F.; Li, X.; 1. Introduction
Zhuang, X. Hybrid Graph Neural Recommendation systems have been widely used in various Internet business services
Network Recommendation Based on in the era of big data. The recommendation model can recommend products that match
Multi-Behavior Interaction and Time its users for various businesses and find suitable user groups for enterprises [1]. In order
Sequence Awareness. Electronics 2023,
to better personalize recommendations for each user, it is crucial to fully understand the
12, 1223. https://doi.org/10.3390/
interests and behavioral preferences of users. For sales platforms, understanding users’
electronics12051223
purchasing interests and behavioral preferences can increase sales and profit margins. For
Academic Editor: Alberto Fernandez the user him/herself, identifying the user’s shopping interests and behavioral preferences
Hilario on the client side can improve the user’s experience and save unnecessary browsing time.
The early popular collaborative filtering algorithm (CF) decomposes a single user–item
Received: 25 December 2022
interaction into latent representations for finding similar users and related items and then
Revised: 27 February 2023
Accepted: 2 March 2023
predicting the next user behavior [2,3]. However, since traditional CF cannot model user
Published: 3 March 2023
attributes and item auxiliary information, there are data-sparsity and cold-start problems
in practical application scenarios [4]. To address these issues, supervised learning (SL)
models such as Factorization Machine (FM) [5] and NFM (Neural FM) [6] have emerged one
after another. With the development of neural network techniques, collaborative filtering
Copyright: © 2023 by the authors. architectures for enhancing nonlinear feature interactions utilize multilayer perceptrons to
Licensee MDPI, Basel, Switzerland. handle advanced nonlinear relationships, such as NCF [7] and DMF [8].
This article is an open access article In recent years, deep neural networks based on graph data have received extensive
distributed under the terms and attention, showing good results in processing high-dimensional sparse user interaction
conditions of the Creative Commons
data. These neural network structures, called graph neural networks [9,10], are used to
Attribution (CC BY) license (https://
learn meaningful representations in graph data structures. Since user–item interactions
creativecommons.org/licenses/by/
are often sparse non-Euclidean data, graph data structures can be used to store their
4.0/).
Electronics 2023, 12, 1223. https://doi.org/10.3390/electronics12051223 https://www.mdpi.com/journal/electronics
279
Electronics 2023, 12, 1223
interactions. In addition, the introduction of external Knowledge Graph (KG) data can
expand the additional information about users and items [11]. This provides a feasible
solution for improving the accuracy and interpretability of recommendation systems. Given
the strong performance of graph neural networks in aggregating and propagating graph-
structured data, it provides an unprecedented opportunity to improve the performance of
recommendation systems.
However, recommendation systems based on graph neural networks also face many
problems: (1) Different graph data provide user and item information from different
perspectives. How to aggregate and learn more accurate node representations from different
types of graphs is crucial for recommendation models [12]. (2) The connections between
nodes are diverse rather than single [13]. The assignment of weights to different connection
methods requires more consideration. (3) Graph neural networks show good performance
in learning the relationships between nodes. However, it is difficult for them to process
sequence information [14]. Therefore, it is worth considering how to incorporate temporal
information into the model. In this paper, our research question is how to utilize multi-
behavior interaction time-series information for an accurate recommendation.
Because of the limitations of existing graph network methods, it is crucial to develop
a hybrid graph neural network model that focuses on user behavioral characteristics and
user–item interaction habits. Therefore, we designed a user multi-behavior awareness
module and an item-information-relation module based on the graph neural network.
Specifically, we propose a new method called the User Multi-Behavior Graph Neural
Network (UMBGN) Hybrid Model, which has four sections. (1) User–item connection
weight calculation: It provides unique weight information for each edge to describe the
connection relationship between nodes according to the multi-behavior interaction infor-
mation between users and items. (2) User–item graph network information transfer: It
aggregates the feature information of the node’s neighbors according to the edge weights to
obtain the final feature representation. (3) Information perception based on user behavior
sequence: It uses a behavior-aware network module with bidirectional GRU and AUGRU
to enrich the user’s behavioral information representation, fully considering the user’s
behavioral characteristics. (4) Information aggregation between items. It aggregates user–
item interaction information by using an attention mechanism and considers the order of
interactions between items. Compared with traditional graph network models, our model
computes weight information between nodes according to different behavioral interac-
tions. This allows for a more accurate dissemination of information between neighboring
nodes. Furthermore, compared with the existing state-of-the-art graph neural network
recommendation models, our proposed method introduces user multi-behavior sequential
information perception, achieving more accurate recommendation performance. This ben-
efits from the fact that our model considers not only the global nature of multi-behavior
interactions but also each user’s personality. Therefore, the contributions of the paper can
be summarized as follows:
(1) We constructed a user multi-behavior awareness module with bidirectional GRU
and AUGRU to enrich user-behavior-information representation. We input the user’s inter-
action with items into the network in chronological order to obtain the user’s interaction
behavior feature vector, which helps us understand the user’s behavioral preferences. Then
we integrate the interaction behavior feature vector with the user’s feature vector to more
accurately locate the user’s interest.
(2) We propose the connection weights between user–item nodes by focusing on
user–item multi-behavior interaction information to make information aggregation and
dissemination more accurate. In addition, we design an item-information relation module
based on the user’s dependencies on items. Then we use the attention mechanism to aggre-
gate the item–item connections information to further enrich the embedding representation
of items.
(3) The experiments performed on three real datasets indicate that our UMBGN
model achieves significant improvements over existing models. In addition, we also
280
Electronics 2023, 12, 1223
extensively studied the overall impact of different modules on the experiments to prove
the effectiveness of our method.
2. Methods
In this section, we elaborate on our method; the basic architecture is shown in Figure 1.
Our model consists of four modules: (1) a user–item interaction information module,
which mines user–item multi-behavior interaction information; (2) a user multi-behavior
awareness module, which further learns the strength of each user interaction behavior
and extracts long-term user behavior preference; (3) an item-information-relation module,
which, according to the user–item interaction information, calculates the information of
other items related to an item; and (4) a joint prediction module, which combines the
information of each module to obtain the final output result.
Figure 1. The framework of the UMBGN model. It contains four modules: module (a) is used to
extract user multi-behavior interaction information, module (b) is used to extract user long-term
multi-behavior preferences, module (c) is used to extract association information between items, and
module (d) is used to output the result.
2.1. Symbol Description
We use the set U = {u1 , u2 , . . . , um } to represent user information, where m is the total
number of users. Similarly, we use set I = {i1 , i2 , . . . , in } to represent item information,
where n is the total number of items. The set K = {k1 , k2 , . . . , k L } is used to represent user
interactions with items (e.g., favorites, purchases, and clicks).
User–item interaction sequence: In the recommendation scenario, we usually obtain
the historical sequence of' user–item interactions
( and the time information of their inter-
actions, defined as S = s1 , s2 , . . . , s|S| . Moreover, si = (u, i, k, t) indicates that user u
interacts with item i through behavior k at time t.
281
Electronics 2023, 12, 1223
' (
Input: User–item multi-behavior interaction sequence S = s1 , s2 , . . . , s|S| .
Output: The probability, ŷ( p,q) , that user u p interacts with item iq , with which he/she
has no interaction.
2.2. Preliminary Preparation
2.2.1. Generation of the Bipartite Graph of User–Item Interactions
Our task is to use various interaction information to make recommendations for
target users. According to Zhang et al. [15,16], the interaction information between users
and items is sparse with non-Euclidean data, and building a knowledge graph can better
represent the relationship between them. Therefore, we generate an extended' user–item
(
interaction graph G0 = (V0 , E0 ), using the user–item interaction data S = s1 , s2 , . . . , s|S| ,
where node V0 consists of user node u ∈ U and item node i ∈ I. Similar to existing graph
models in [17], the d-dimensional vectors pu and pi are used to represent the user and
item embeddings. The edge, set E0 , is a two-tuple composed of interaction type, k ∈ K,
and timestamp information, t, denoted as E0 = (k, t). Different edges represent different
behaviors. This can help extract behavior-based information between users and items.
2.2.2. User’s Behavior Interaction Information Extraction
Traditional graph network recommendation often only focuses on the users’ single-
behavior interaction information, ignoring the influence of edge sets on information dis-
semination in the graph network. In this paper, we add a certain weight to the edge set
of the graph network according to the user–item interaction behavior. This optimizes the
process of information transfer in the graph network. We consider two factors that affect
user–item interaction preferences: the relative importance of interactions and the temporal
order of interactions. On the one hand, users have their own unique interactive behavior
habits. For example, user u1 likes to favorite items, but user u2 prefers to put the favorite
items in the shopping cart. Then their unique behaviors have different relative importance.
On the other hand, items also have unique interactions with users. For example, item i1
is usually favorited by users, but item i2 is usually added to the shopping cart by users.
Therefore, we design different interactive behavior weights, αuk and αik , between users and
items:
wku ·nuk wik ·nik
αuk = ; αik = , (1)
∑m∈ N (u) wm ·num
u
∑m∈ N (i) wim ·num
where wku and wik are learnable parameters, representing the degree of influence of users
and items on behavior, k; nuk represents the number of items that user u interacts with
through type k; nik represents the number of users that user i interacts with through type k;
N (u) represents all items interacting with user u; and N (i ) represents all users interacting
with the item i.
2.3. User–Item Multi-Behavior Interaction Information Transfer and Aggregation
2.3.1. Construction of User–Item Relationship Graph
We not only pay attention to local relations but also global interaction relations to learn
user–item interaction multi-behavior information. According to the user–item interaction
graph, G0 , we calculate the weight of the edge set through normalization and obtain the
connection strength information, eui and eiu , between every two points:
⎛ ⎞ ⎛ ⎞
eui = σ⎝ ∑ αuk + b⎠; eiu = σ⎝ ∑ αik + b⎠, (2)
k ∈ N (u,i ) k ∈ N (i,u)
where σ is the sigmoid function, b is the bias, and N (i, u) is the sum of the interaction
types between i and u. Then eui , eiu ∈ E1 , and point set V0 are combined to obtain the
user–item bidirectional relationship graph, G1 = (V0 , E1 ). Compared with the traditional
282
Electronics 2023, 12, 1223
undirected graph network, the bidirectional graph network with weight information has
better performance in information transmission.
2.3.2. Information Dissemination of User–Item Relationship Graph
It is an effective method to use graph neural networks to analyze graph data struc-
tures [9,10]. These networks used an iterative message aggregation method to mine struc-
tural information within node neighborhoods. According to the method of Xiang et al. [18],
our graph network has a total of L layers and follows their aggregation and propagation
method. Firstly, the nodes in the graph network aggregate the information of their neighbor
nodes in the previous layer. Then they update themselves by combining the aggregated
information with their original information. Different from Xiang et al., we designed a
propagation weight according to the connection strength of nodes in order to achieve a
better information transmission effect. Specifically,
⎛ ⎞
(l ) ( l −1) ( l −1) ⎠
hu = ϕ⎝W1 hu + ∑ λiu W2 hi , (3)
i∈ N (u)
(l ) (l )
where hu ∈ Rd is the user’s embedding in the l-th layer, hi ∈ Rd is the item’s embedding
(0) (0)
in the l-th layer; hu= = pi ; ϕ represents the LeakyReLU function for information
p u , hi
transformation; and W1 and W2 ∈ Rd×d are learnable weight matrices. Moreover, λiu is the
attention coefficient of user u to item i, and its calculation formula is as follows:
exp(eui )
λiu = . (4)
exp ∑ j∈ N (u) euj
(l )
Similarly, we can obtain the l-th embedding information, hi , of item node i. After
embedding propagation, neighborhood information is fused into each node’s embedding
information. To obtain a better representation of the nodes’ information, we use a standard
multilayer perceptron (MLP) to combine the L layers embedding representations of nodes
into the final embedding representation. Among them, all the embedding information of
the L layers is concatenated together before being input into the MLP. The specific form is
as follows:
(∗) (0) (1) ( L) (∗) (0) (1) ( L)
hu = MLP hu hu . . . hu ; hi = MLP hi hi . . . hi , (5)
where MLP is a multilayer perceptron; represents the concatenation operation of vectors;
(∗) (∗)
and hu and hi ∈ Rd are the final embedding representations of user u and item i,
respectively.
2.4. Perceptron Module Based on User–Item Multi-Behavior Interaction Sequence
2.4.1. User Multi-Behavior Feature Extraction
The purpose of this module is to aggregate heterogeneous information generated
by multi-behavior patterns between users and their interacting items. Different from
the extraction of neighbor information, we also mine user multi-behavior embedding
features based on user historical interaction behavior sequences. To obtain the preference
information of users interacting with items, we designed a user multi-behavior awareness
module. This module extracts the target user, u,' and the neighbor ( nodes, i ∈ N (u),
|S |
interacting with it, and it arranges them into Su = s1u , s2u , . . . , su u according to the time
sequence.
283
Electronics 2023, 12, 1223
According to the embedding information of item nodes and edge nodes, we can obtain
the behavior characteristics of user u:
j
bu,i,k = σ(αuk hi + bθ ), (6)
where hv ∈ Rd is the embedding representation information of item v, σ is the sigmoid
function, and bθ is the bias.
By using Formula (6), we can obtain an embedding interaction
sequence b1 , b2 , . . . , b| N (u)| of user u.
2.4.2. Bi-GRU-Based Behavior Feature Extraction
To mine the overall features of user-embedded behavioral feature sequences, we use
an RNN model to explore their temporal information and generate a single representation
to encode their overall semantics. Different from basic RNN units, GRU units can memorize
long-term dependencies sequentially [19]. Therefore, in this module, we use GRU to capture
the user’s multi-behavior preferences. Guo et al. [20] demonstrate that Bi-LSTM and Bi-
GRU can achieve better results in sequential problems than LSTM
and GRU. Therefore, we
input the embedding interaction sequence b1 , b2 , . . . , b| N (u)| into a Bi-GRU network:
| N (u)|
h1b , h2b , . . . , hb = Bi − GRU b1 , b2 , . . . , b| N (u)| . (7)
where hib ∈ Rd .
We obtain the user’s multi-behavior preference sequence based on the user’s behavior
information and interactive item information. As we all know, users’ way of thinking and
external market conditions change over time. If the model does not pay attention to changes
in the user’s core behavior, it will cause errors in subsequent recommendations. Inspired
by Chang et al. [21], we input the user multi-behavior preference sequence into a GRU
network with an attention update gate (AUGRU) to obtain the user’s final multi-behavior
preference representation:
| N (u)|
hub = AUGRU h1b , h2b , . . . , hb (8)
The AUGRU model uses an attention mechanism to process differentiated multi-
behavior information. It scales the individual multi-behavior features of the update gates
by using attention scores. Therefore, behavior features with less correlation have less
influence on the hidden state. This makes the acquired multi-behavior information changes
more accurate.
2.5. Item–Item Multi-Behavior Interaction Information Aggregation
2.5.1. Construction of Item–Item Relationship Graph
Even for the same item, different users may show different meanings when interacting
with the item. We can mine the connection between items from the perspective of users,
and then obtain the potential representation of items. Therefore, we extract the item set
with the same interaction type as the target item, i j , in the user–item interaction graph,
G0 (Figure 2). Then we construct the item–item multi-behavior interaction graph, Gi , for
further learning the latent factors of items. The weight of each interactive edge is expressed
as follows:
exp e∗jj
e∗jj = ∑ e jm e j m , e jj = , (9)
m∈ NG1 ( j,j ) exp ∑r∈ NG ( j) e∗jr
1
where α jm and α j m are the weight information calculated by Formula (1). NG1 ( j, j ) rep-
resents the users adjacent to j and j in graph G1 . NG1 ( j) represents the items that are
second-order adjacent to G1 and j in the graph. The final attention weight e jj is obtained by
normalizing e∗jj using the Softmax function.
284
Electronics 2023, 12, 1223
Figure 2. The principal figure of item–item relation information aggregation.
2.5.2. Information Propagation of Item–Item Relationship Graph
Through the weight information, we can define the information propagation method
of neighbor item j to item i. Based on the weight information of the item-relation graph and
the feature information of neighbor items, we obtain the extended representation of item i:
(∗)
his = f ( ∑ eij hi + h i ), (10)
j ∈ N i (i )
where N i (i ) represents the neighborhood of i in the item–item interaction graph Gi , and
his is the aggregated information of i. Moreover, f ( ) is an activation function similar to
LeakyReLU.
2.6. Joint Prediction Module
After the above three modules, we obtain the user’s preference behavior, hub ; the
(∗) (∗)
user interest feature, hu ; the clustering feature, his ; and the feature, hi , of the item. We
combine the above feature information to obtain the final embeddings of users and items
for the final prediction:
(∗) (∗)
h u = h u ⊕ h ub , hi = hi ⊕ hus , (11)
where ⊕ represents addition between vector elements. Finally, we inner-product the final
representations of users and items to predict their match scores:
ŷ(u,i) = hu T · hi , (12)
2.7. Model Learning
' (
Given a user–item interaction sequence, S = s1 , s2 , . . . , s|S| , we extract its top |S| − x
items to predict the x items of its last interaction. To optimize our UMBGN model, we
choose BPRloss [22], which is widely used in recommendation systems [9,17]. Specifically,
the final loss function is denoted as follows:
L= ∑ −lnσ ŷ(u,i+ ) − ŷ(u,i− ) + λΘ22 , (13)
(u,i+ ,i− )∈O
where O = {(u, i+ , i− )|(u, i+ ) ∈ R+ , (u, i− ) ∈ R− } represents the paired target behavior
training dataset; R+ and R− refer to target behaviors that have occurred and target behav-
iors that have not occurred, respectively; σ refers to the sigmoid function; Θ is a parameter
that can be trained in the network; and λ is the L2 normalization coefficient.
3. Experiment
In this section, we recount the experiments we conducted on three real datasets, namely
MovieLens, Yelp2018, and Online Mall, to evaluate our UMBGN model. We explore the
following four questions:
285
Electronics 2023, 12, 1223
RQ1: In this paper, we consider user multi-behavior information. Does this improve
recommendation performance? How does UMBGN perform compared to existing models?
RQ2: We also set the propagation weight among network nodes according to the
behavior information. Does this improve the performance of the model? If the weight
information is not considered, what will be the effect on the experimental results?
RQ3: How does each module of the model contribute to the improvement of the
accuracy of the prediction results?
RQ4: What are the effects of various parameters of the model on the final performance
of our proposed method?
3.1. Experimental Environment
3.1.1. Datasets
To evaluate the performance of UMBGN, we conduct experiments on MovieLens,
Yelp2018, and the real e-commerce dataset Online Mall, respectively.
MovieLens is a widely used benchmark dataset in recommendation systems containing
20 million movie ratings (accessed at https://grouplens.org/datasets/movielens/20m/,
accessed on 15 April 2022). In the experiment, we divided user ratings into multiple
behavior types: (1) dislike behavior, (2) neutral behavior, and (3) like behavior.
Yelp2018 is a famous merchant-review website in the US (accessed at https://www.
yelp.com/dataset/download, accessed on 16 April 2022). Users can rate merchants, submit
reviews, and give tips on the Yelp website. We divided the Yelp dataset into four behaviors
(like, dislike, neutral, and tip), using the same criteria as we did for MovieLens.
Online Mall is provided by JD.com, a commerce company with a huge number of
users and a full range of goods (accessed at https://jdata.jd.com/html/detail.html?id=8,
accessed on 16 April 2022). User-behavior types include click, favorite, add to cart, and
purchase.
To ensure the accuracy of the experiments, we performed basic preprocessing on the
dataset. We removed users and items with fewer than 10 interactions. Then we divide the
dataset into the training set, validation set, and test set according to 80%, 10%, and 10%.
The dataset information after data preprocessing is shown in Table 1.
Table 1. Experimental dataset statistics.
Dataset User Item Interaction Behavior Type
Yelp2018 31,668 38,048 1,561,406 {Tip, Dislike, Neutral, Like}
ML-20 M 138,493 26,744 19,989,593 {Dislike, Neutral, Like}
Online Mall 102,703 24,677 37,059,872 {Buy, Cart, Fav, PV}
3.1.2. Comparison Methods
To evaluate our method, we adopted two evaluation metrics that were widely used in
previous work: recall@K and NDCG@K [18]. They are defined as follows:
Recall@K: It is used to measure the probability that the actual interaction item appears
in the top-K leaderboard recommendation task. Recall@K does not pay attention to the
order in which the user actually clicks an item in the recommended task list; it only
considers whether the item appears in the top N positions of the recommended task list.
NDCG@K: In the top-K ranking list, NDCG@K evaluates the quality of the recom-
mendation list according to the rank order of correct items. It assigns higher scores to
higher-ranked positions, which means that test items should be ranked as high as possible.
For each user in the test set, we adopt the next-item-recommendation task [23]. For
each user, we pair the ground-truth items in the test set with other negative items that are
interactions, obtain the user’s preference score for all items, and then rank them. In this
paper, we set K=10. It is known that higher HR and NDCG scores indicate a better model
performance.
286
Electronics 2023, 12, 1223
3.1.3. Parameter Setting
In this paper, we use TensorFlow to implement the UMBGN model and use the Adam
optimizer to infer the model parameters. We performed experiments on two NVIDIA
GeForce GTX2080 Ti GPUs. Firstly, we initialized the user–item embedding matrix and the
weights of each item in the mixture model. The embedding dimension of users and items
is set to 32. The initial learning rate and the batch size are set to 0.01 and 64, respectively.
Secondly, a regularization strategy with weight decay selected from the set of {0.1, 0.05,
0.01, 0.005, 0.001} was used to alleviate the overfitting problem during the training phase.
In our evaluation, we employed early stopping to terminate training when the performance
on the validation data degraded for 5 consecutive epochs.
3.1.4. Baseline
To verify the effectiveness of the UMBGN model, we compare it with six baseline
models: two traditional recommendation methods, two RNN-based methods, and two
graph network recommendation methods. We briefly describe the six baseline models as
follows:
BPR-MF [24]: It optimizes the latent factor of implicit feedback, using pairwise ranking
loss in Bayesian methods to maximize the gap between positive and negative terms.
FPMC [25]: This is a classic mixed model that captures sequential effects and the
general interest of users. FPMC fuses sequence and personalized information for recom-
mendation by constructing a Markov transition matrix.
GRURec [19]: It is a GRU model trained based on a parallel mini-batch top1 loss
function. GRURec uses parallel computation, as well as mini-batch computation, to learn
model parameters.
GRU4Rec+ [26]: This is an improved version of GRURec, which concatenates the hot
term vector and the feature vector as the input GRU network and has a new loss function
and sampling strategy.
GraphRec [27]: It is a deep graph neural network model that enriches the information
representation of nodes through embedding propagation and aggregation. GraphRec also
aggregates social relations among users through a graph neural network structure.
NGCF [18]: It is an advanced graph neural network model. NGCF has some special
designs that can combine traditional collaborative filtering with graph neural networks for
application in recommendation systems.
Among all of these methods, BPR-MF and FPMC are traditional recommendation
methods, GRURec and GRU4Rec+ are RNN-based methods, and GrahRec and NGCF are
graph-network-based methods.
3.2. Performance Comparison
We demonstrate the performance of the above methods in predicting target types
for user–item interactions on three real datasets. As shown in Table 2, UMBGN achieves
significant performance improvement on different types of datasets. This improvement
benefits from our consideration of the user’s multi-behavior interaction sequence and the
relationship between items.
Table 2. Performance comparison of all methods in terms of Recall@10 and NDCG@10 on all datasets.
Dataset Metric BPR-MF FPMC GRURec GRU4Rec+ NGCF GraphRec UMBGN
Recall 0.2136 0.3811 0.6689 0.7051 0.7813 0.7594 0.7938
Yelp2018
NDCG 0.1208 0.2439 0.3607 0.4518 0.5232 0.4943 0.5362
Recall 0.2608 0.3404 0.3748 0.4976 0.6020 0.5891 0.6351
ML-20 M
NDCG 0.1365 0.3163 0.2942 0.4129 0.5029 0.4982 0.5137
Online Recall 0.2679 0.3637 0.4474 0.6786 0.7801 0.7546 0.8293
Mall NDCG 0.1347 0.2692 0.3815 0.4641 0.5832 0.5317 0.5841
287
Electronics 2023, 12, 1223
The experimental result shows that BPR-MF performed poorly overall. This may
be because it cannot consider the user’s long-term preference information. It proves
that some traditional matrix factorization methods are not suitable for multi-behavior
recommendation tasks. Although FPMC has an improved performance compared with BPR-
MF, it still has not achieved satisfactory results. RNN-based models (GRURec, GRU4Rec+)
have been greatly improved compared to traditional methods because RNN-based models
can capture users’ long-term preferences more effectively. In addition, GRU4Rec+ performs
better than GRURec. This may be attributed to GRU4Rec+ considering personalized
information.
Graph-network-based models (GraphRec, NGCF, and UMBGN) significantly outper-
form traditional methods and RNN-based methods. This shows that using the graph
network method can better mine user–item connections and have a better ability to recom-
mend the next item. Furthermore, we observe that UMBGN outperforms other datasets in
the Online Mall dataset. One possible explanation is that Online Mall has a large amount of
data and rich types of user–item interactions. In addition, the number of users in the Online
Mall dataset is relatively large, thus enabling the model to better model user preference
information. Therefore, UMBGN is more practical in the real world with massive user data,
such as online shopping platforms and social platforms. This shows that considering the
multi-behavior information of users improves the recommendation performance.
3.3. Ablation Experiments
3.3.1. The Influence of Different Behavioral Weights on the Experimental Results
To evaluate the impact of different behavioral information on user purchase intention,
we compared the performance of our method on the Online Mall dataset. We designed
the following controlled experiments: (1) setting the behavior weight of each user to the
same weight, αuk ; and (2) setting each interaction behavior to the same weight, wku . We
present the results of the ablation experiments in Table 3. It shows that our UMBGN model
with learnable behavior weight information is 68.45% higher than the model with the same
αuk and 34.10% higher than the model with the same wku on recall@10. It is 50.27% higher
than the model with the same αuk and 25.21% higher than the model with the same wku on
NDCG@10. This indicates that focusing on multi-behavior weights is necessary and should
be learned by the model itself. Therefore, setting the propagation weights between graph
network nodes according to multi-behavior information improves the performance of the
model.
Table 3. Results of ablation experiments with multi-behavior weights on Online Mall.
Model UMBGN Same αuk Same wuk
Recall@10 0.8293 0.4923 0.6182
NDCG@10 0.5841 0.3887 0.4665
3.3.2. The Influence of Each Module in UMBGN on the Experimental Results
The user multi-behavior awareness module aims to obtain the user’s behavior prefer-
ence information, and the item-information-relation module aims to obtain the relevant
information between items. They are both complementary to the user–item interaction
information module. We conducted an ablation study to test the effectiveness of the
user multi-behavior awareness module and the item information relation module in our
UMBGN. The results are shown in Table 4.
288
Electronics 2023, 12, 1223
Table 4. Performance of user multi-behavior awareness module and item information relation
module.
Yelp2018 ML-20 M Online Mall
Dataset
Recall NDCG Recall NDCG Recall NDCG
UMBGN 0.7938 0.5362 0.6351 0.5137 0.8293 0.5841
w/o UBAM 0.6905 0.4803 0.5960 0.4821 0.7294 0.5267
w/o IIRM 0.7513 0.5189 0.6127 0.5088 0.7687 0.5502
The results of the ablation experiments (Figure 3) show that the UMBGN model has a
higher recall rate and NDCG than the model without the user multi-behavior awareness
model and the item-information-relation model. Especially on the Online Mall dataset,
it improves the recall rate by 13.70% and 7.88%, respectively. Moreover, it improves the
NDCG by 9.83% and 5.80%, respectively. This shows that taking into account the user’s
multi-behavior interaction sequence and the relationship between items can make more
accurate recommendations to users. This shows that each module is necessary to improve
the accuracy of the prediction results.
Figure 3. Results of ablation experiments of sub-modules in UMBGN.
3.4. Parametric Analysis
3.4.1. The Effect of Sequence Length on Prediction Results
We also explored the effect of the maximum length, N, of user–item interaction se-
quences on the model recommendation performance. Figure 4 shows the impact of the
maximum length, N, on the recommendation performance on the ML-20 m dataset and
the Online Mall dataset, respectively. We observe that the recommendation performance
improves as the N increases until the N is less than 40. This indicates that the length of the
user’s behavior sequence has an impact on the recommendation performance. However,
when N exceeds 40, the recommendation performance on the ML-20 m dataset no longer
increases significantly. Moreover, the recommendation performance of the Online Mall
dataset has also declined. This suggests that the model does not always benefit from larger
N, as larger N tends to introduce more noise. However, our model remains stable when
the length N becomes larger. This also proves that our model can handle noisy behavioral
sequence information well.
289
Electronics 2023, 12, 1223
Figure 4. Performance comparison of methods with different behavior sequence lengths, N, on three
datasets.
3.4.2. The Influence of the Number of Layers of the Graph Neural Network on the
Prediction Results
We wish to test the effect of the number of layers of the GNN on the UMBGN model.
In the user–item interaction information module, UMBGN, with two recursive message
propagation layers, achieves the best results. This shows that it is essential to model higher-
order relationships between items and features via GNNs. However, as shown in Figure 5,
the performance starts to degrade as the depth of the graph model increases. This is
because multiple embedded propagation layers may contain some noisy signals, resulting
in over-smoothing [28]. This shows that determining the optimal parameters of the model
through a large number of experiments is conducive to improving the performance of the
model.
Figure 5. Performance comparison of methods with different numbers of GNN layers on three
datasets.
4. Related Work
4.1. Recommendation Based on Graph Neural Network
In recent years, graph networks that can naturally aggregate node information and
topology have attracted extensive attention. Especially in recommendation systems, the
use of graph networks to mine user–item interaction data has achieved remarkable re-
sults [29–31]. Yang et al. [32] constructed a Hierarchical Attention Convolutional Network
(HAGERec) combined with a knowledge graph. They exploited the high-order connec-
tivity relationship of heterogeneous knowledge graphs to mine users’ latent preferences.
In addition, information aggregation was performed on user and item entities through
local proximity and attention mechanisms. Gwadabe et al. [33] proposed a GNN-based
recommendation model, GRASER, for the session-based recommendation. It used GNN to
learn the sequential and non-sequential complex transformation relationship between items
in each session, which improved the performance of the recommendation. Zhang et al. [34]
290
Electronics 2023, 12, 1223
proposed a dynamic graph neural network (DGSR) for the sequential recommendation. It
explicitly modeled the dynamic collaboration information between different user sequences
in sequential recommendations. Therefore, it could transform the task of the next prediction
in sequential recommendation into a link prediction between user nodes and item nodes
in a dynamic graph. Fan et al. [27] designed a graph network framework (GraphRec) for
the social recommendation. The method jointly captured users’ purchase preferences from
the user’s social graph and the user–item interaction graph. The SURGE graph neural
network frame proposed by Chang et al. [21] combined the sequential recommendation
model and the graph neural network model. This method first integrated the different
preferences in the user’s long-term behavior sequence into the graph structure, and then it
performed operations such as perception, propagation, and pooling of the graph network.
It could dynamically extract the core interests of the current user from noisy user behavior
sequences. Different from their work, our work defines new multi-behavior information
weights for information propagation in graph neural networks.
4.2. Multi-Behavior Recommendation
Traditional recommendation systems usually rely only on a single type of user–item
interaction, which limits the performance of the methods. Recommendation methods
utilizing multiple behaviors can more accurately capture user preference information. Guo
et al. [20] designed a Deep Intent Prediction Network (DIPN) to predict users’ purchase
intentions from multiple perspectives. They combined touch interaction behavior with
traditional browsing behavior and introduced multi-task learning to differentiate user
behavior. Experiments on large-scale datasets showed that the network significantly out-
performs traditional methods that used only browsing interaction behavior. Rosaci [35,36]
proposed a CILIOS method to determine inter-ontology similarities between agents. It
monitored user behavior and interests to extend the recommendation dataset generated
by traditional methods. In addition, this method extracted logical knowledge in recom-
mendation scenarios to support web recommendations. Wu et al. [37] constructed a new
multi-behavior multi-view contrastive learning recommendation model (MMCLR) to solve
the data sparsity and cold-start problems in traditional recommender models. They consid-
ered the similarities and differences between different user behaviors and views through
three tasks. Experiments on real datasets indicate that MMCLR significantly improved the
performance of recommendations. Pan et al. [38] designed a Spatiotemporal Interaction
Augmented Graph Neural Network (SIGMA). It encoded a mobile graph to represent
individual mobile behavior and used a stacked scoring approach to generate recommen-
dation scores. This showed that the mobile behavior of individuals and groups played an
important role in location recommender systems. Xia et al. [39] developed a Multi-Behavior
Graph Meta Network (MB-GMN) to extract the interaction information of multiple behavior
types between users and items. The proposed method jointly models behavioral hetero-
geneity and interaction behavioral diversity, combined with the meta-learning paradigm. A
large number of comparative experiments on three datasets demonstrated the effectiveness
of their method. Inspired by the above research work, we propose a new multi-behavior
awareness module to further mine time-series based user multi-behavior information.
5. Conclusions
In this paper, we explored the problem of graph network recommendation, focusing
on user multi-behavior interaction sequences, and proposed a UMBGN model. Compared
with the traditional GNN model, our model updates the node connection weights of the
user–item interaction graph according to the multi-behavior interaction information, so that
it can capture the user’s interest in specific items under different behavioral information. In
this study, we designed two modules to further mine the user’s multi-behavior preference
information. Firstly, we put the multi-behavior sequence information of the target user into
an improved Bi-GRU model, the AUGRU model, to enrich the user’s embedding represen-
tation. Secondly, we built an item–item graph based on the user’s dependencies on items to
291
Electronics 2023, 12, 1223
further enrich the embedding representation of items. The comparative experiments that
we performed on three real datasets demonstrate the effectiveness of the UMBGN model.
Further ablation experiments prove the necessity of the user multi-behavior awareness
module and item information awareness module in our UMBGN model. In addition, we
also evaluated the impact of different parameters on recommendation performance, con-
firming the applicability of UMBGN in practical applications. However, our approach does
not consider potential connections among users. In the future, we plan to introduce users’
social relations into our method to improve the accuracy of the next-item recommendation.
Author Contributions: Conceptualization, M.J. and F.L.; methodology, M.J. and X.Z.; software, M.J.
and X.L.; validation, X.Z.; investigation, M.J.; resources, F.L.; data curation, M.J.; writing—original
draft preparation, M.J. and X.L.; writing—review and editing, F.L. and X.Z.; visualization, M.J.;
supervision, F.L.; funding acquisition, F.L.; All authors have read and agreed to the published version
of the manuscript.
Funding: This work was funded by the National Natural Science Foundation of Shandong (ZR202011
020044) and the National Natural Science Foundation of China (61772321).
Data Availability Statement: Publicly available datasets were analyzed in this study. The data of
MovieLens can be found here: https://grouplens.org/datasets/movielens/20m/ (accessed on 15
April 2022). The data of Yelp2018 can be found here: https://www.yelp.com/dataset/download
(accessed on 16 April 2022). The data of Online Mall can be found here: https://jdata.jd.com/html/
detail.html?id=8 (accessed on 16 April 2022).
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Gu, Y.; Ding, Z.; Wang, S.; Yin, D. Hierarchical user profiling for e-commerce recommender systems. In Proceedings of the 13th
International Conference on Web Search and Data Mining, Houston, TX, USA, 3–7 February 2020; pp. 223–231.
2. Schafer, J.B.; Frankowski, D.; Herlocker, J.; Sen, S. Collaborative filtering recommender systems. In The Adaptive Web: Methods and
Strategies of Web Personalization; Springer: Berlin/Heidelberg, Germany, 2007; pp. 291–324.
3. Koren, Y. Factorization meets the neighborhood: A multifaceted collaborative filtering model. In Proceedings of the 14th
ACM SIGKDD International Conference on Knowledge Discovery and Data Mining, Las Vegas, NV, USA, 24–27 August 2008;
pp. 426–434.
4. Ning, X.; Karypis, G. Slim: Sparse linear methods for top-n recommender systems. In Proceedings of the 2011 IEEE 11th
international conference on data mining, Vancouver, BC, Canada, 11–14 December 2011; IEEE: Piscataway, NJ, USA, 2011;
pp. 497–506.
5. Rendle, S.; Gantner, Z.; Freudenthaler, C.; Schmidt-Thieme, L. Fast context-aware recommendations with factorization machines.
In Proceedings of the 34th international ACM SIGIR conference on Research and development in Information Retrieval, Beijing,
China, 25–29 July 2011; pp. 635–644.
6. He, X.; Chua, T.S. Neural factorization machines for sparse predictive analytics. In Proceedings of the 40th International ACM
SIGIR conference on Research and Development in Information Retrieval, Tokyo, Japan, 7–11 August 2017; pp. 355–364.
7. He, X.; Liao, L.; Zhang, H.; Nie, L.; Hu, X.; Chua, T.S. Neural collaborative filtering. In Proceedings of the 26th International
Conference on World Wide Web, Perth, Australia, 3–7 April 2017; pp. 173–182.
8. Xue, H.J.; Dai, X.; Zhang, J.; Huang, S.; Chen, J. Deep matrix factorization models for recommender systems. In Proceedings of
the IJCAI International Joint Conference on Artificial Intelligence, Melbourne, Australia, 19–25 August 2017; pp. 3203–3209.
9. Fan, S.; Zhu, J.; Han, X.; Shi, C.; Hu, L.; Ma, B.; Li, Y. Metapath-guided heterogeneous graph neural network for intent
recommendation. In Proceedings of the 25th ACM SIGKDD International Conference on Knowledge Discovery & Data Mining,
Anchorage, AK, USA, 4–8 August 2019; pp. 2478–2486.
10. Wu, S.; Tang, Y.; Zhu, Y.; Wang, L.; Xie, X.; Tan, T. Session-based recommendation with graph neural networks. In Proceedings of
the AAAI Conference on Artificial Intelligence, Honolulu, HI, USA, 27 January–1 February 2019; Volume 33, pp. 346–353.
11. Wang, X.; He, X.; Cao, Y.; Liu, M.; Chua, T.S. Kgat: Knowledge graph attention network for recommendation. In Proceedings of
the 25th ACM SIGKDD International Conference on Knowledge Discovery & Data Mining, Anchorage, AK, USA, 4–8 August
2019; pp. 950–958.
12. Yang, L.; Liu, Z.; Dou, Y.; Ma, J.; Yu, P.S. Consisrec: Enhancing gnn for social recommendation via consistent neighbor aggregation.
In Proceedings of the 44th International ACM SIGIR Conference on Research and Development in Information Retrieval, Montreal,
QC, Canada, 11–15 July 2021; pp. 2141–2145.
292
Electronics 2023, 12, 1223
13. Gao, C.; Zheng, Y.; Li, N.; Li, Y.; Qin, Y.; Piao, J.; Quan, Y.; Chang, J.; Jin, D.; He, X.; et al. Graph neural networks for recommender
systems: Challenges, methods, and directions. arXiv 2021, arXiv:2109.12843, 2021. [CrossRef]
14. Fan, Z.; Liu, Z.; Zhang, J.; Xiong, Y.; Zheng, L.; Yu, P.S. Continuous-time sequential recommendation with temporal graph
collaborative transformer. In Proceedings of the 30th ACM International Conference on Information & Knowledge Management,
Gold Coast, Australia, 1–5 November 2021; pp. 433–442.
15. Zhao, Y.; Ou, M.; Zhang, R.; Li, M. Attributed Graph Neural Networks for Recommendation Systems on Large-Scale and Sparse
Graph. arXiv 2021, arXiv:2112.13389.
16. Tan, Q.; Zhang, J.; Yao, J.; Liu, N.; Zhou, J.; Yang, H.; Hu, X. Sparse-interest network for sequential recommendation. In
Proceedings of the 14th ACM International Conference on Web Search and Data Mining, Jerusalem, Israel, 8–12 March 2021;
pp. 598–606.
17. Zheng, Y.; Gao, C.; He, X.; Li, Y.; Jin, D. Price-aware recommendation with graph convolutional networks. In Proceedings of the
2020 IEEE 36th International Conference on Data Engineering (ICDE), Dallas, TX, USA, 20–24 April 2020; IEEE: Piscataway, NJ,
USA, 2020; pp. 133–144.
18. Wang, X.; He, X.; Wang, M.; Feng, F.; Chua, T.-S. Neural graph collaborative filtering. In Proceedings of the SIGIR, Paris, France,
21–25 July 2019; pp. 165–174.
19. Hidasi, B.; Karatzoglou, A.; Baltrunas, L.; Tikk, D. Session-based recommendations with recurrent neural networks. arXiv 2015,
arXiv:1511.06939.
20. Guo, L.; Hua, L.; Jia, R.; Zhao, B.; Wang, X.; Cui, B. Buying or browsing? Predicting real-time purchasing intent using attention-
based deep network with multiple behavior. In Proceedings of the 25th ACM SIGKDD International Conference on Knowledge
Discovery & Data Mining, Anchorage, AK, USA, 4–8 August 2019; pp. 1984–1992.
21. Chang, J.; Gao, C.; Zheng, Y.; Hui, Y.; Niu, Y.; Song, Y.; Jin, D.; Li, Y. Sequential recommendation with graph neural networks. In
Proceedings of the 44th International ACM SIGIR Conference on Research and Development in Information Retrieval, Montreal,
QC, Canada, 11–15 July 2021; pp. 378–387.
22. Rendle, S.; Freudenthaler, C.; Gantner, Z.; Schmidt-Thieme, L. BPR: Bayesian personalized ranking from implicit feedback. arXiv
2012, arXiv:1205.2618.
23. Sun, F.; Liu, J.; Wu, J.; Pei, C.; Lin, X.; Ou, W.; Jiang, P. BERT4Rec: Sequential recommendation with bidirectional encoder
representations from transformer. In Proceedings of the 28th ACM International Conference on Information and Knowledge
Management, Beijing, China, 3–7 November 2019; pp. 1441–1450.
24. Guo, H.; Tang, R.; Ye, Y.; Li, Z.; He, X. DeepFM: A factorization-machine based neural network for CTR prediction. arXiv 2017,
arXiv:1703.04247.
25. Rendle, S.; Freudenthaler, C.; Schmidt-Tieme, L. Fac-torizing personalized Markov chains for next-basket recommendation. In
Proceedings of the 19th International Conference on World Wide Web-WWW’10, Raleigh, NC, USA, 26–30 April 2010.
26. Hidasi, B.; Karatzoglou, A. Recurrent neural networks with top-k gains for session-based recommendations. In Proceedings of the
27th ACM International Conference on Information and Knowledge Management, Torino, Italy, 22–26 October 2018; pp. 843–852.
27. Fan, W.; Ma, Y.; Li, Q.; He, Y.; Zhao, E.; Tang, J.; Yin, D. Graph neural networks for social recommendation. In Proceedings of the
World Wide Web Conference, San Francisco, CA, USA, 13–17 May 2019; ACM: New York, NY, USA, 2019; pp. 417–426.
28. Chen, D.; Lin, Y.; Li, W.; Li, P.; Zhou, J.; Sun, X. Measuring and relieving the over-smoothing problem for graph neural networks
from the topological view. In Proceedings of the AAAI Conference on Artificial Intelligence, New York, NY, USA, 7–12 February
2020; Volume 34, pp. 3438–3445.
29. Kipf, T.N.; Welling, M. Semi-supervised classification with graph convolutional networks. arXiv 2016, arXiv:1609.02907.
30. Wu, Z.; Pan, S.; Chen, F.; Long, G.; Zhang, C.; Philip, S.Y. A comprehensive survey on graph neural networks. IEEE Trans. Neural
Netw. Learn. Syst. 2020, 32, 4–24. [CrossRef] [PubMed]
31. Yin, R.; Li, K.; Zhang, G.; Lu, J. A deeper graph neural network for recommender systems. Knowl. Based Syst. 2019, 185, 105020.
[CrossRef]
32. Yang, Z.; Dong, S. HAGERec: Hierarchical attention graph convolutional network incorporating knowledge graph for explainable
recommendation. Knowl. Based Syst. 2020, 204, 106194. [CrossRef]
33. Gwadabe, T.R.; Liu, Y. Improving graph neural network for session-based recommendation system via non-sequential interactions.
Neurocomputing 2022, 468, 111–122. [CrossRef]
34. Zhang, M.; Wu, S.; Yu, X.; Liu, Q.; Wang, L. Dynamic graph neural networks for sequential recommendation. IEEE Trans. Knowl.
Data Eng. 2022. [CrossRef]
35. Rosaci, D. Web Recommender Agents with Inductive Learning Capabilities. In Emergent Web Intelligence: Advanced Information
Retrieval; Springer: London, UK, 2010; pp. 233–267. [CrossRef]
36. Rosaci, D. CILIOS: Connectionist inductive learning and inter-ontology similarities for recommending information agents. Inf.
Syst. 2007, 32, 793–825. [CrossRef]
37. Wu, Y.; Xie, R.; Zhu, Y.; Ao, X.; Chen, X.; Zhang, X.; Zhuang, F.; Lin, L.; He, Q. Multi-view Multi-behavior Contrastive Learning
in Recommendation. In Proceedings of the International Conference on Database Systems for Advanced Applications, Virtual
Event, 11–14 April 2022; Springer: Cham, Switzerland, 2022; pp. 166–182.
293
Electronics 2023, 12, 1223
38. Pan, X.; Cai, X.; Song, K.; Baker, T.; Gadekallu, T.R.; Yuan, X. Location recommendation based on mobility graph with individual
and group influences. IEEE Trans. Intell. Transp. Syst. 2022. [CrossRef]
39. Xia, L.; Xu, Y.; Huang, C.; Dai, P.; Bo, L. Graph meta network for multi-behavior recommendation. In Proceedings of the 44th
International ACM SIGIR Conference on Research and Development in Information Retrieval, Montreal, QC, Canada, 11–15 July
2021; pp. 757–766.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
294
electronics
Article
Towards Adversarial Attacks for Clinical
Document Classification
Nina Fatehi 1 , Qutaiba Alasad 2 and Mohammed Alawad 1, *
1 Electrical and Computer Engineering Department, Wayne State University, Detroit, MI 48202, USA
2 Department of Petroleum Processing Engineering, Tikrit University, Al Qadisiyah P.O. Box 42, Iraq
* Correspondence: [email protected]
Abstract: Regardless of revolutionizing improvements in various domains thanks to recent advance-
ments in the field of Deep Learning (DL), recent studies have demonstrated that DL networks are
susceptible to adversarial attacks. Such attacks are crucial in sensitive environments to make criti-
cal and life-changing decisions, such as health decision-making. Research efforts on using textual
adversaries to attack DL for natural language processing (NLP) have received increasing attention
in recent years. Among the available textual adversarial studies, Electronic Health Records (EHR)
have gained the least attention. This paper investigates the effectiveness of adversarial attacks on
clinical document classification and proposes a defense mechanism to develop a robust convolutional
neural network (CNN) model and counteract these attacks. Specifically, we apply various black-box
attacks based on concatenation and editing adversaries on unstructured clinical text. Then, we
propose a defense technique based on feature selection and filtering to improve the robustness of
the models. Experimental results show that a small perturbation to the unstructured text in clinical
documents causes a significant drop in performance. Performing the proposed defense mechanism
under the same adversarial attacks, on the other hand, avoids such a drop in performance. Therefore,
it enhances the robustness of the CNN model for clinical document classification.
Keywords: adversarial attacks; document classification; CNN; NLP
Citation: Fatehi, N.; Alasad, Q.;
Alawad, M. Towards Adversarial 1. Introduction
Attacks for Clinical Document Although DL models for NLP have achieved remarkable success in various do-
Classification. Electronics 2023, 12, mains, such as text classification [1], sentiment analysis [2] and Named Entity Recognition
129. https://doi.org/10.3390/ (NER) [3], recent studies have demonstrated that DL models are susceptible to adversarial
electronics12010129
attacks, small perturbations and named adversarial examples (AEs), crafted to fool the
Academic Editors: Taiyong Li, Wu DL model to make false predictions [4]. Such attacks are crucial in sensitive environments
Deng and Jiang Wu like healthcare where such vulnerabilities can directly threaten human life. Similar to
other domains, DL in healthcare has obtained diagnostic parity with human physicians
Received: 15 November 2022
on various health information tasks such as pathology [5] and radiology [6]. The issue
Revised: 21 December 2022
of AEs has emerged as a pervasive challenge in even state-of-the-art learning systems for
Accepted: 22 December 2022
health and has raised concerns about the practical deployment of DL models in such a do-
Published: 28 December 2022
main. However, in comparison to non-clinical NLP tasks, adversarial attacks on Electronic
Health Records (EHR) and tasks such as clinical document classification have gained the
least attention.
Copyright: © 2022 by the authors. Various approaches based on concatenation [7] or editing [8] perturbations have been
Licensee MDPI, Basel, Switzerland. proposed to attack NLP models. Attacking these models by manipulating characters in a
This article is an open access article word to generate AEs seems unnatural for some applications due to grammatical disfluency.
distributed under the terms and Also, generating AEs is challenging in the text compared to images, due to the discrete
conditions of the Creative Commons space of input data as well as the fact that generating perturbations which can fool the DL
Attribution (CC BY) license (https:// model and at the same time be unperceivable for humans is not easy in text [4]. However,
creativecommons.org/licenses/by/ these approaches apply very well to the target application of this paper, i.e., pathology
4.0/).
Electronics 2023, 12, 129. https://doi.org/10.3390/electronics12010129 https://www.mdpi.com/journal/electronics
295
Electronics 2023, 12, 129
report classification based on the cancer type. The unstructured text in pathology reports is
ungrammatical, fragmented, and marred with typos and abbreviations. Also, the document
text is usually long and results from the concatenation of several fields, such as microscopic
description, diagnosis, and summary. Whenever they are combined, the human cannot
easily differentiate between the beginning and end of each field. Moreover, the text in
pathology reports exhibits linguistic variability across pathologists even when describing
the same cancer characteristics [9,10].
Perturbations can occur at all stages of the DL pipeline from data collection to model
training to the post-processing stage. In this paper, we will focus on two aspects of it.
The first part will be the robustness during the training time. The case when the training
set is unvetted, e.g., when the training set has arbitrarily chosen an outlier that the model is
biased towards. The second aspect is the robustness during the test time. The case when
the adversary is trying to fool the model.
The AEs that we will use in this paper are the class label names. These words are
known to the attacker without accessing the target DL model. Also, due to the unbalanced
nature of this dataset, the model is biased to majority classes or to specific keywords,
which are mostly the class label names, that appear in their corresponding samples. Then,
we propose a novel defense method against adversarial attacks. Specifically, we select
and filter specific features during the training phase. Two criteria are followed when
determining these features: (1) the DL model has to be biased to them, and (2) filtering
them does not impact the overall model accuracy. We focus on the CNN model to carry out
the adversarial evaluation on the clinical document classification, i.e., classifying cancer
pathology reports based on their associated cancer type. This model performs equally or
better than state-of-the-art natural language models, i.e., BERT [11]. This is mainly because
in clinical text classification tasks on documents in which only very few words contribute
toward a specific label, most of these subtle word relationships may not be necessary or
even relevant to the task at hand [12].
The main contributions of the paper include:
• We compare the effectiveness of different black-box adversarial attacks on the robust-
ness of the CNN model for document classification on long clinical texts.
• We evaluate the effectiveness of using class label names as AEs by either concatenating
these examples to the unstructured text or editing them whenever they appear in
the text.
• We propose a novel defense technique based on feature selection and filtering to
enhance the robustness of the CNN model.
• We evaluate the robustness of the proposed approach on clinical document classification.
The rest of the paper is organized as follows: related works are briefly outlined
in Section 2. Sections 3 and 4 present the method and experimental setup, respectively.
In Section 5, the results are discussed. Finally, we conclude our paper in Section 6.
2. Related Works
Numerous methods have been proposed in the area of computer vision and NLP
for adversarial attacks [4,13,14]. Since our case study focuses on adversarial attacks and
defense for clinical document classification, we mainly review state-of-the-art approaches
in the NLP domain. Zhang et al. present a comprehensive survey of the latest progress
and existing adversarial attacks in various NLP tasks and textual DL models [4]. They
categorize adversarial attacks on textual DL as follows:
• Model knowledge determines if the adversary has access to the model information
(white-box attack) or if the model is unknown and inaccessible to the adversary
(black-box attack).
• Target type determines the aim of the adversary. If the attack can alter the output
prediction to a specific class, it is called a targeted attack, whereas an untargeted attack
tries to fool the DL model into making any incorrect prediction.
296
Electronics 2023, 12, 129
• Semantic granularity refers to the level to which the perturbations are applied. In other
words, AEs are generated by perturbing sentences (sentence-level), words (word-level)
or characters (character-level).
The work investigated in this paper relates to the adversarial attack on document
classification tasks in the healthcare domain and focuses on the targeted/untargeted black-
box attack using word/character-level perturbations. We choose black-box attacks as they
are more natural than white-box attacks.
In the following subsections, we first present the popular attack strategies with respect
to the three above-mentioned categories. Then, we discuss the adversarial defense tech-
niques.
2.1. Adversarial Attack Strategies
Adversarial attacks have been widely investigated for various NLP tasks, including
NER [15,16], semantic textual similarity [16], and text classification [17]. These attacks
generate perturbations by modifying characters within a word [18], adding or removing
words [16], replacing words with semantically similar and grammatically correct synonyms
using a word embedding optimized for synonyms replacement [17], or by synonym substi-
tution using WordNet where the replaced word has the same Part of Speech (POS) as the
original one [19]. The drawback of character-level methods is that generated AEs can easily
be perceived by human and impact the readability of the text [20], and the drawback of
AEs generated in word-level is their dependency on the original sentences [20].
Clinical text comes with its unique challenges, where the findings in the non-clinical
text might not be applied to clinical text. For instance, in non-clinical text, character-level
or word-level perturbations that change the syntax can be easily detected and defended
against by the spelling or syntax check. However, this does not apply to clinical text, which
often contains incomplete sentences, typographical errors, and inconsistent formatting.
Thus, domain-specific strategies for adversarial attacks and defense are required [21].
There are relatively few works that have examined the area of clinical NLP. Mon-
dal et al. propose BBAEG, which is a black-box attack on biomedical text classification tasks
using both character-level and word-level perturbations [22]. BBAEG is benchmarked on a
simple binary classification and the text is relatively short and clean when compared to
real-world clinical text. There are also some works that investigate adversarial attack on
EHR including [23,24]. However, they are different from this paper’s work as they use the
temporal property of EHR to generate AEs and none of them investigates the adversarial
attack on unstructured clinical text.
2.2. Adversarial Defense Strategies
As explained in the previous section, detection-based approaches, such as spelling
check, have been used as a defense strategy. Gao et al. use python’s spelling check to detect
the adversarial perturbations in character level; however, this detection method can be
performed only on character-level AEs [18]. Another approach in detection to evaluate
the model’s robustness under adversarial attacks is discriminator training. Xu et al. train
another discriminator using a portion of original samples plus AEs to discriminate AEs from
original examples [25]. Adversarial training has also been used to enhance the robustness
of DL model [4,26]. In adversarial training, adversarial perturbations are involved in the
training process [27]. The authors of [15–17] utilize an augmentation strategy to evaluate
or enhance the robustness of DL models. In this approach, the model is trained on the
augmented dataset that includes original samples plus AEs. The drawback of adversarial
training, which makes it an ineffective defense strategy against some adversarial attacks, is
overfitting [27]. If the model is biased to the AEs, as in the case of our paper, augmentation
will make the bias issue worse.
297
Electronics 2023, 12, 129
3. Method
In this section, we first formalize the adversarial attack in a textual CNN context and
then describe two methods, namely concatenation adversaries and edit adversaries to
generate AEs.
3.1. Problem Formulation
Let us assume that a dataset consists of N documents X = { X1 , X2 , ..., X N } and a
corresponding set of N labels y = {Y1 , Y2 , ..., YN }. On such a dataset, F : X → y is the CNN
model which maps input space X to the output space y. Adversarial attack and adversarial
example can be formalized as follows:
Xadv = X + Δ
F ( Xadv ) = y (Untargeted attack)
F ( Xadv ) = y, y = y ( Targeted attack)
3.2. Concatenation Adversaries
Given an input document X1 of n words X1 = {w1 , w2 , ..., wn }, in concatenation
adversaries, there is a list of selected perturbation words that are supposed to be added
(one at a time) to different locations of documents. In this paper, we consider three locations:
“random”, “end”, and “beginning”.
• Adding perturbation words at random locations: In this attack, we attempt to add
a various number of a specific perturbation word in random locations of input
documents. If wadv denotes the added word, the adversarial input would be as
X = {w1 , w2 , wadv , . . . , wadv , wn−4 , wadv , wn }. The location of each wadv is deter-
mined randomly.
• Adding perturbation words in the beginning: In this attack, the aim is to append a various
number of a specific perturbation word in the beginning of each input document. In this
way, the adversarial input would be as X = {wadv , wadv , wadv , . . . , w1 , w2 , . . . , wn }.
• Adding perturbation words at the end: This attack is carried out to add a various
number of a specific perturbation word at the end of each document. The adversarial
inputs would be as X = {w1 , w2 , . . . , wn , wadv , wadv , wadv }.
3.3. Edit Adversaries
Instead of adding perturbation words to the input document text, edit adversaries
manipulate specific words in the input document text. In this paper, we apply two edit
adversaries forms: synthetic perturbation, which is an untargeted attack; and replacing
strategy, which in contrast is a targeted attack [28].
• Synthetic perturbation: In this attack, AEs are generated by perturbing characters
including swapping all two neighboring characters (breast → rbaets), randomly
deleting one character (breast → breat), randomly changing orders of all characters
(breast → reastb) and randomly changing orders of characters except the first and
last ones (breast → beasrt) of a specific list words. Each of these perturbations are
performed on all selected words at the same time.
• Replacing strategy: This attack is a targeted attack in which the selected words in
all input documents are replaced with a specific word that leads to the targeted
prediction (for instance F ( Xtadv ) = Yd and wadv is the perturbation word that makes
the prediction Yd instead of Yt ).
3.4. Defense Strategy
For the defense mechanism, we propose a novel method called feature selection and
filtering, in which features are selected and filtered from input documents during the model
training. These features are selected based on two criteria: (1) the CNN model has to be
298
Electronics 2023, 12, 129
biased to them, and (2) filtering them does not impact the overall model accuracy. In this
paper, we select the class label names as the target features. Other techniques can also be
used to determine which features should be selected, such as model interpretability tools,
attention weights, scoring functions, etc.
3.5. Evaluation Metrics
The focus of this study is to evaluate the performance of the CNN model for document
classification against adversarial examples. The following common performance metrics
for classification tasks are used for model evaluation:
F1 Score: The overall accuracy is calculated using the standard micro- and macro- F1
scores as follows:
Precision ∗ Recall
Micro F1 = 2( )
Precision + Recall
1 c
Macro F1 = Σ Micro F1(ci )
| c | ci
where |C | is the total number of classes and ci represents the number of samples belonging
to class i.
Accuracy per class: To evaluate the vulnerability of the model per class, we use the
accuracy per class metric, which is the percentage of correctly predicted classes after an
attack to the number of all samples of the class.
TPi
Accuracy =
ci
Number of Perturbed Words: For the attack itself, we include a metric to measure the
amount of required perturbations to fool the CNN model. We call this metric “number of
perturbed words”. In this way, we can determine the minimum number of perturbation
words, in concatenation adversaries, that leads to a significant degradation in accuracy.
4. Experimental Setup
4.1. Data
In this paper, we benchmark the proposed adversarial attack and defense on a clinical
dataset, specifically The Cancer Genome Atlas Program pathology reports dataset (TCGA)
(https://www.cancer.gov/tcga, accessed on 1 October 2021).
The original TCGA dataset consists of 6365 cancer pathology reports; five of which
are excluded because they are unlabeled. Therefore, the final dataset consists of 6360
documents. Each document is assigned a ground truth label for the site of the cancer,
the body organ where the cancer is detected. In the TCGA dataset, there is a total of 25
classes for the site label. Figure A1 in Appendix A shows the histograms of the number
of occurrences per class. Standard text cleaning, such as lowercasing and tokenization, is
applied to the unstructured text in the documents. Then, a word vector of size 300 is chosen.
The maximum length of 1500 is chosen to limit the length of documents in pathology
reports. In this way, reports containing more than 1500 tokens are truncated and those with
less than 1500 tokens are zero-padded. Also, we choose 80%/20% data splitting strategy.
4.2. Target Model
In this paper, we use a CNN network as the DL model. ADAM adaptive optimization is
used to train the network weights. For all the experiments, the embedding layer is followed
by three parallel 1-D convolutional layers. The number of filters in each convolution layer
is 100, and the kernel sizes are 3, 4, and 5. ReLU is employed as the activation function and
a dropout of 50% is applied to the global max pooling at the output layer. Finally, a fully
connected softmax layer is used for the classification task. These parameters are optimized
following previous studies [29,30]. We use NVIDIA V100 GPU for all the experiments.
299
Electronics 2023, 12, 129
4.3. Adversarial Attack
In this subsection we go through the details of each adversarial attack. For these
attacks, we use the dataset class label names, which are the cancer types, as the selected
perturbation words to perform concatenation and edit adversaries. The reasons for selecting
the label names as the AEs are as follows:
1. Using these names is considered a black-box attack as the adversary does not need to
know the CNN model details.
2. The presence of a specific class label name frequently in the unstructured text of
pathology reports biases the CNN model to a specific prediction [29,30].
3. As we will see later, filtering these names during the model training does not impact
the overall model accuracy.
Therefore, we note that the practical dataset is the one whose class label names exist in
the document text.
Since there are 25 different labels’ class names in the dataset, we select three of them
as AEs to report the result in this paper. Specifically, we select one of the majority classes
(breast), one of the minority classes (leukemia/lymphoma- in short lymphoma) and one
of the moderate classes (sarcoma). From that selection, we can see how the classes with
different distributions can impact the performance of the CNN model under adversarial
attacks. In this way, the impact of class distribution on the CNN model’s performance can
be evaluated as well.
4.3.1. Concatenation Adversaries
In this attack, we investigate the impact of adding selected class names (breast,
leukemia/lymphoma, and sarcoma) to the input documents as perturbation words. Three
different concatenation adversaries are used:
• Concat-Random: For each selected perturbation word, 1, 2, 3, 5, 10, 20 or 40 words
are randomly added to all input documents. For instance, Concat-Random-Breast-1
means randomly adding one “breast” perturbation word to the documents.
• Concat-Begin: For each selected perturbation word, 1, 2, 3, 5, 10, 20 or 40 words are
added at the beginning of all input documents. For instance, Concat-Begin-Breast-1
denotes appending one “breast” perturbation word at the beginning of all documents.
• Concat-End: For each selected perturbation word, 1, 2, 3, 5, 10, 20 or 40 words are
appended at the end of all input documents. For instance, Concat-End-Breast-1 means
adding one “breast” perturbation word at the end of the documents.
4.3.2. Edit Adversaries
We apply the following edit adversaries to the text dataset:
• Edit-Synthetic: In this attack, we perturb the letters of all the selected words (breast,
leukemia/lymphoma, and sarcoma) whenever they appear in the document text.
Different approaches are applied to edit the targeted tokens, such as swapping all two
neighboring characters (Swap), randomly deleting one character (Delete), randomly
changing orders of all character (Fully Random), or randomly changing orders of
characters except the first and last ones (Middle Random).
• Edit-Replacing: In this attack, all class label names (the 25 different labels) are replaced
with one of the target words (breast, leukemia/lymphoma, or sarcoma) whenever
they appear in the unstructured text. For instance, Edit-Replacing-Breast means all
class label names that appear in the input document text are replaced with the word
“breast” as the perturbed word.
4.4. Defense
In defense, all class label names are filtered from the input documents during the new
model training. Then, we attack the model using the same AEs as before to investigate
300
Electronics 2023, 12, 129
the word-level and character-level adversarial training impacts on enhancing the CNN
model’s robustness.
5. Results
In this section, we present the results related to each experiment.
5.1. Concatenation Adversaries
Figure 1 illustrates the impact of increasing the number of perturbed words on the
overall accuracy. We can see, as expected, that the drop in accuracy increases when adding
more perturbation words to the document text.
0.9 Concat-End-Breast 0.95 Concat-End-Sarcoma 0.95 Concat-End-Lymphoma
Concat-Begin-Breast Concat-Begin-Sarcoma Concat-Begin-Lymphoma
0.8 Concat-Random-Breast 0.90 Concat-Random-Sarcoma Concat-Random-Lymphoma
0.90
0.7
0.85
0.6 0.85
Accuracy
Accuracy
Accuracy
0.80
0.5 0.80
0.75
0.4
0.70 0.75
0.3
0.2 0.65 0.70
0 5 10 15 20 25 30 35 40 0 5 10 15 20 25 30 35 40 0 5 10 15 20 25 30 35 40
a. Number of Perturbed words (Breast) b. Number of Perturbed words (Sarcoma) c. Number of Perturbed words (Lymphoma)
Figure 1. Impact of increasing number of words in Concatenation adversaries; for (a). breast,
(b). sarcoma and (c). lymphoma.
The figure also shows that Concat-Random’s accuracy degrades slowly with an in-
creasing number of perturbation words; however, in Concat-Begin and Concat-End, there is
a sharp drop in accuracy by adding only 3 perturbation words and this decrease continues
until adding 5 words. Adding more than 5 words does not change the accuracy. This
indicates that if the perturbation words are adjacent in the input text, they have higher
impact on the model predictions.
Another observation is the different impact of the selected perturbed words (breast,
sarcoma and lymphoma) on the overall model accuracy. From the accuracy values for
each class, we see that accuracy drop in breast as a majority class is significant, as adding
3 words causes accuracy to become less than 30%. However, in lymphoma and sarcoma as
minority and moderate classes, accuracy drops to 79% and 74%, respectively.
In Table 1, a comparison between different concatenation adversaries is provided.
In this table, we consider 3 perturbed words. Compared with the baseline model, we can
see that adding only 3 words can reduce the accuracy significantly, which is an indication
of the effectiveness of the attack. From the results of Table 1, we came to conclude that in an
imbalanced dataset and under an adversarial attack, majority classes contribute at least 3
times more than the minority classes. This conclusion is drawn from the fact that the CNN
model is biased towards the majority classes in an imbalanced dataset; therefore, minority
classes contribute less to the overall accuracy than majority classes.
Table 1. Comparison between different concatenation adversaries attack strategies.
Micro F1 Macro F1
Model
Beginning End Random Beginning End Random
Baseline 0.9623 0.9400
Concat-Breast-3 0.2461 0.2335 0.7193 0.2337 0.2029 0.7501
Concat-Sarcoma-3 0.7429 0.7594 0.9261 0.6666 0.6818 0.8794
Concat-lymphoma-3 0.7862 0.7932 0.9465 0.7262 0.7367 0.9028
To gain more insight on the impact of concatenation adversaries, we investigate the
accuracy per class. Figure 2 illustrates the accuracy of each class when the perturbed word
is “breast” for Concat-End attack. The figures for the other two perturbation words and the
301
Electronics 2023, 12, 129
other concatenation strategies are included in Appendix B. The interesting observation is
that adding the perturbed word contributes in an accuracy drop of all classes except the
“breast” class. In other words, the adversarial attack was able to fool the CNN model to a
target attack and give 100% accuracy for the perturbed class word.
1.0 Baseline
Concat-End-Breast-3
0.8
0.6
$ F F X U D F \
0.4
0.2
0.0
ma
nd
us
a
e
ast
ey
ck
der
ach
oma
t
g
rus
oid
in
es
us
ra
skin
ix
ry
duc
live
crea
nom
stat
lun
colo
cerv
bra
ova
pleu
& ne
test
hag
thym
kidn
gla
thyr
bre
ute
pho
blad
stom
sarc
bile
pro
pan
mela
p
nal
/lym
oeso
d
Hea
Adre
mia
e
leuk
6 L W H 7 \ S H / D E H O
Figure 2. Accuracy per class in Concat-End for breast.
With further analysis, we also realize that adding the perturbed word causes an
increase in number of false predictions such that the CNN model is most likely to classify
the documents of other classes as the class equal to the perturbed word. Table 2 shows the
number of documents classified as the perturbed word after an adversarial attack.
While analysing the two-term word class names, such as “leukemia/lymphoma”, “bile
duct” and “head and neck”, we noticed that such classes seem to have one term neutral
which does not cause any changes in the accuracy; however, the other term follows almost
the same pattern as the other single-term word class names in the dataset. To find the
reason, we looked into the input dataset to see the occurrence of each word in the whole
dataset (Table A1 in Appendix B). We found that the term that occurred more often is likely
to impact the performance more under adversarial attacks.
Table 2. Number of documents classified as the perturbed word before and after adversarial attack.
Number of Documents
Baseline-breast 134 out of 1272
Concat-Random-Breast-1 359
Concat-Random-Breast-10 671
Concat-Random-Breast-20 878
Baseline-sarcoma 31 out of 1272
Concat-Random-sarcoma-1 61
Concat-Random-sarcoma-10 196
Concat-Random-sarcoma-20 312
Baseline-lymphoma 6 out of 1272
Concat-Random-lymphoma-1 22
Concat-Random-sarcoma-10 90
Concat-Random-lymphoma-20 179
5.2. Edit Adversaries
Table 3 depicts the comparison of accuracy on different edit adversaries attacks. As we
can see from the results, compared to the baseline model, all edit adversaries attack strate-
gies degrade the accuracy. We also see that all character-level perturbations cause the same
302
Electronics 2023, 12, 129
amount of drop in accuracy (4% in micro F1 and 6% in macro F1). The reason is that, only
class names have been targeted in this set of experiments and no matter how they are
edited, the CNN model interprets them all as unknown words; therefore, they all contribute
in the same amount of accuracy drop. This also confirms that there are keywords other
than the class names that are critical to the class prediction. On the contrary, Edit-Replacing
strategies result in a significant decrease in accuracy (12% in micro F1 and 17% in macro F1)
and (58% in micro F1 and 44% in macro F1) when all 25 class names in the text are replaced
with “lymphoma” and “breast” perturbation words, respectively. It shows that although
the CNN model is biased towards all class names, majority classes seem to have a more
significant impact than the minority. Figure 3 shows accuracy per class under Edit-Synthetic
adversarial attack. From the figure, we see that minority classes are impacted more than
majority classes. Figures of accuracy per class in Edit-Replacing attacks for breast, sarcoma
and lymphoma are included in Appendix B.
Table 3. Comparison between different edit adversaries attack strategy.
Micro F1 Macro F1
Baseline 0.9623 0.9400
Swap 0.9230 0.8815
Delete 0.9230 0.8815
Fully Random 0.9230 0.8815
Middle Random 0.9230 0.8815
Edit-Replacing-Breast 0.3774 0.4209
Edit-Replacing-Sarcoma 0.7987 0.7366
Edit-Replacing-Lymphoma 0.8373 0.7648
1.0 Baseline
Edit-Synthetic
0.8
0.6
$ F F X U D F \
0.4
0.2
0.0
ma
land
t
ast
ey
eck
der
ach
a
oma
g
in
rus
roid
skin
ix
ry
es
us
ra
duc
live
agu
crea
nom
stat
lun
colo
cerv
bra
ova
pleu
test
thym
kidn
bre
ute
p ho
blad
nd n
stom
thy
al g
sarc
oph
bile
pro
pa n
mela
/lym
da
en
oes
Adr
Hea
mia
e
leuk
6 L W H 7 \ S H / D E H O
Figure 3. Accuracy per class in Edit-Synthetic.
5.3. Defense
Tables 4 and 5 demonstrate the performance results of the CNN model after filtering
the class names from the text during the training, as well as the model performance under
adversarial attacks using the concatenation and edit adversaries. From the result, we can
easily see that the defense strategy was able to successfully defend against adversarial at-
tacks with little to no degradation of the performance of the baseline CNN model under the
same adversarial attack. From the macro-F1 score, we see that after performing the defense
strategy, the accuracy of minority classes increases while the accuracy of majority classes
remains unchanged; so, we came to conclude that the defense strategy is able to enhance
the CNN model’s robustness not only by immunizing the model against adversarial attack
but also by tackling the class imbalance problem as well.
303
Electronics 2023, 12, 129
Table 4. Comparison between different concatenation adversaries attack strategies while defense
strategy is imposed.
Micro F1 Macro F1
Model
Beginning End Random Beginning End Random
Baseline 0.9544 0.9240
Concat-Breast-3 0.9544 0.9544 0.9544 0.9240 0.9240 0.9243
Concat-Sarcoma-3 0.9544 0.9544 0.9544 0.9240 0.9243 0.9243
Concat-lymphoma-3 0.9544 0.9544 0.9544 0.9240 0.9240 0.9243
Table 5. Overall micro/macro F1 by performing defense.
Micro F1 Macro F1
Baseline 0.9544 0.9240
Swap 0.9583 0.9369
Delete 0.9583 0.9369
Fully Random 0.9583 0.9369
Middle Random 0.9583 0.9369
Edit-Replacing-Breast 0.9583 0.9369
Edit-Replacing-Sarcoma 0.9583 0.9369
Edit-Replacing-Lymphoma 0.9583 0.9369
6. Conclusions
In this paper, we investigate the problem of adversarial attacks on unstructured clinical
datasets. Our work demonstrates the vulnerability of the CNN model in clinical document
classification tasks, specifically cancer pathology reports. We apply various black-box
attacks based on concatenation and edit adversaries; then, using the proposed defense
technique, we are able to enhance the robustness of the CNN model under adversarial
attacks. Experimental results show that adding a few perturbation words as AEs to the
input data will drastically decrease the model accuracy. We also indicate that by filtering
the class names in the input data, the CNN model will be robust to such adversarial attacks.
Furthermore, this defense technique is able to mitigate the bias of the CNN model towards
the majority classes in the imbalanced clinical dataset.
Author Contributions: Conceptualization, M.A. and Q.A.; methodology, M.A. and N.F.; software,
M.A. and N.F.; validation, M.A., N.F. and Q.A.; formal analysis, M.A.; investigation, M.A. and
N.F.; resources, M.A.; writing, review, and editing, M.A., N.F., Q.A.; visualization, M.A. and N.F.;
supervision, M.A.; project administration, M.A. All authors have read and agreed to the published
version of the manuscript.
Funding: This research received no external funding.
Acknowledgments: The results published here are in whole or part based upon data generated by
the TCGA Research Network: https://www.cancer.gov/tcga, accessed on 1 October 2021.
Conflicts of Interest: The authors declare no conflict of interest.
304
Electronics 2023, 12, 129
Appendix A. TCGA Dataset
Figure A1 shows the histograms of the number of occurrences per class for the can-
cer site.
Site
700
600
Document Distribution
500
400
300
200
100
ma
nd
a
e
ck
ast
ey
der
ach
oma
us
t
g
rus
roid
in
es
ra
skin
ix
ry
duc
live
a gu
crea
nom
stat
colo
lun
cerv
bra
ova
pleu
e
test
thym
kidn
l gla
bre
pho
ute
blad
nd n
stom
thy
sarc
oph
bile
pro
pan
mela
ena
/lym
da
oes
Adr
Hea
emia
leuk
Site Type classes
Figure A1. Classes Distribution in TCGA Dataset for Site.
Appendix B. Adversarial Attack
Table A1 shows the frequency of each term of two-term Label’s classes word in the
whole dataset.
Table A1. Two-term word Labels’ occurrence in whole dataset.
Occurrence
duct 1542
bile 1012
gland 2589
adrenal 1786
lymphoma 90
leukemia 3
neck 2817
head 356
Appendix B.1. Concatenation Adversaries
The overall micro- and macro- F1 scores for various number of perturbed words in
Concat-End-Breast, Concat-End-sarcoma and Concat-End-lymphoma adversarial attacks
are depicted in Tables A2–A4.
Table A2. Overall micro/macro F1 in Concat-End-Breast adversarial attack for various number of
perturbed word.
Micro F1 Macro F1
Baseline 0.9623 0.9400
Concat-End-Breast-1 0.8003 0.8156
Concat-End-Breast-3 0.2335 0.2029
Concat-End-Breast-5 0.1486 0.0915
Concat-End-Breast-20 0.1486 0.0915
305
Electronics 2023, 12, 129
Table A3. Overall micro/macro F1 in Concat-End-sarcoma adversarial attack for various number of
perturbed word.
Micro F1 Macro F1
Baseline 0.9623 0.9400
Concat-End-sarcoma-1 0.9520 0.9172
Concat-End-sarcoma-3 0.7594 0.6818
Concat-End-sarcoma-5 0.6156 0.5506
Concat-End-sarcoma-20 0.6156 0.5506
Table A4. Overall micro/macro F1 in Concat-End-lymphoma adversarial attack for various number
of perturbed word.
Micro F1 Macro F1
Baseline 0.9623 0.9400
Concat-End-lymphoma-1 0.9520 0.9091
Concat-End-lymphoma-3 0.7932 0.7367
Concat-End-lymphoma-5 0.6824 0.6203
Concat-End-lymphoma-20 0.6824 0.6203
The overall micro- and macro- F1 scores for various number of perturbed words
in Concat-Begin-Breast, Concat-Begin-sarcoma and Concat-Begin-lymphoma adversarial
attacks are depicted in Tables A5–A7.
Table A5. Overall micro/macro F1 in Concat-Begin-Breast adversarial attack for various number of
perturbed word.
Micro F1 Macro F1
Baseline 0.9623 0.9400
Concat-Begin-Breast-1 0.9198 0.9157
Concat-Begin-Breast-3 0.2461 0.2337
Concat-Begin-Breast-5 0.1682 0.1332
Concat-Begin-Breast-20 0.1682 0.1332
Table A6. Overall micro/macro F1 in Concat-Begin-sarcoma adversarial attack for various number
of perturbed word.
Micro F1 Macro F1
Baseline 0.9623 0.9400
Concat-Begin-sarcoma-1 0.9615 0.9157
Concat-Begin-sarcoma-3 0.7429 0.6666
Concat-Begin-sarcoma-5 0.6211 0.5684
Concat-Begin-sarcoma-20 0.6211 0.5684
Table A7. Overall micro/macro F1 in Concat-Begin-lymphoma adversarial attack for various number
of perturbed word.
Micro F1 Macro F1
Baseline 0.9623 0.9400
Concat-Begin-lymphoma-1 0.9638 0.9289
Concat-Begin-lymphoma-3 0.7862 0.7262
Concat-Begin-lymphoma-5 0.6863 0.6209
Concat-Begin-lymphoma-20 0.6863 0.6209
306
Electronics 2023, 12, 129
The overall micro- and macro- F1 scores for various number of perturbed words in
Concat-Random-Breast, Concat-Random-lymphoma and Concat-Random-sarcoma adver-
sarial attacks are depicted in Tables A8–A10.
Table A8. Overall micro/macro F1 in Concat-Random-Breast adversarial atttack for various number
of perturbed word.
Micro F1 Macro F1
Baseline 0.9623 0.9400
Concat-Random-Breast-1 0.8066 0.8240
Concat-Random-Breast-10 0.5660 0.6006
Concat-Random-Breast-20 0.4049 0.3992
Table A9. Overal micro/macro F1 in Concat-Random-lymphoma adversarial atttack for various
number of perturbed word.
Micro F1 Macro F1
Baseline 0.9623 0.9400
Concat-Random-lymphoma-1 0. 9520 0.9105
Concat-Random-lymphoma-10 0.9033 0.8567
Concat-Random-lymphoma-20 0.8381 0.7924
Table A10. Overall micro/macro F1 in Concat-Random-sarcoma adversarial attack for various
number of perturbed word.
Micro F1 Macro F1
Baseline 0.9623 0.9400
Concat-Random-sarcoma-1 0. 4049 0.3992
Concat-Random-sarcoma-10 0.8585 0.8051
Concat-Random-sarcoma-20 0.7720 0.7148
Figures A2–A9 illustrates the accuracy per class for each perturbed word (breast,
sarcoma and lymphoma) in concatenation adversaries.
1.0 Baseline
Concat-Begin-Breast-3
0.8
0.6
$ F F X U D F \
0.4
0.2
0.0
ma
d
gus
a
tate
oma
t
st
ey
neck
der
ac h
lung
brain
oid
ix
es
us
ra
skin
liver
duc
crea
u
ovar
nom
glan
colo
cerv
brea
pleu
test
uter
thym
kidn
thyr
pho
blad
p ha
stom
pros
sarc
bile
pa n
d&
mela
nal
/lym
oeso
Hea
Adre
emia
leuk
6 L W H 7 \ S H / D E H O
Figure A2. Accuracy per class in Concat-Begin for breast.
307
Electronics 2023, 12, 129
$ F F X U D F \ $ F F X U D F \ $ F F X U D F \
0.0
0.2
0.4
0.6
0.8
1.0
0.0
0.2
0.4
0.6
0.8
1.0
0.0
0.2
0.4
0.6
0.8
1.0
brea brea brea
st st st
lung lung lung
kidn kidn kidn
ey ey ey
brain brain brain
colo colo colo
n n n
uter uter uter
us us us
thyr thyr thyr
o id oid oid
pros pros pros
tate tate tate
Hea Hea Hea
d& d& d&
308
neck neck neck
skin skin skin
blad blad blad
der der der
liver liver liver
stom stom stom
ach ach ach
cerv cerv cerv
ix ix ix
6 L W H 7 \ S H / D E H O
6 L W H 7 \ S H / D E H O
6 L W H 7 \ S H / D E H O
ovar ovar ovar
y y y
Figure A4. Accuracy per class in Concat-Begin for sarcoma.
Figure A3. Accuracy per class in Concat-Random for breast.
sarc sarc sarc
oma oma o ma
Figure A5. Accuracy per class in Concat-Random for sarcoma.
Adre Adre Adre
nal g n al gla nal g
land nd land
pan pan pan
crea crea crea
s s s
oeso oeso oeso
pha pha pha
gus gus gus
test test test
e s es es
thym thym thym
us us us
pleu pleu pleu
ra ra ra
mela mela mela
nom nom no m
leuk a leuk a leuk a
Baseline
emia emia em
Baseline
Baseline
ia/ly
/lym
pho
/lym
pho m pho
ma ma ma
bile bile bile
duc
t
duct duct
Concat-Begin-Sarcoma-3
Concat-Random-Breast-3
Concat-Random-Sarcoma-3
Electronics 2023, 12, 129
$ F F X U D F \ $ F F X U D F \ $ F F X U D F \
0.0
0.2
0.4
0.6
0.8
1.0
0.0
0.2
0.4
0.6
0.8
1.0
0.0
0.2
0.4
0.6
0.8
1.0
brea brea brea
st st st
lung lung lung
kidn kidn kidn
ey ey ey
brain brain brain
colo colo colo
n n n
uter uter uter
us us us
thyr thyr thyr
o id oid oid
pros pros pros
ta te tate tate
Hea Hea Hea
d& d& d&
309
neck neck neck
skin skin skin
blad blad blad
der der der
liver liver liver
stom stom stom
Baseline
ach ach ach
cerv cerv cerv
ix ix ix
6 L W H 7 \ S H / D E H O
6 L W H 7 \ S H / D E H O
6 L W H 7 \ S H / D E H O
Concat-End-Lymphoma-3
Figure A6. Accuracy per class in Concat-End for sarcoma.
ovar ovar ovar
y y y
Figure A8. Accuracy per class in Concat-End for lymphoma.
sarc sarc sarc
oma oma oma
Figure A7. Accuracy per class in Concat-Begin for lymphoma.
Adre Adre Adre
n al gla nal g n
al gla
nd la nd nd
pan panc pan
crea crea
s reas s
oeso oeso oeso
pha phag pha
gus us gus
test teste test
es s es
thym thym thym
us us us
pleu pleu pleu
ra ra ra
mela mela mela
nom nom nom
leuk a a leuk a
Baseline
emia emia
/lym /lym
Baseline
pho leuk pho
ma emia ma
bile bile bile
duct duct duct
Concat-End-Sarcoma-3
Concat-Begin-Lymphoma-3
Electronics 2023, 12, 129
1.0 Baseline
Concat-Random-Lymphoma-3
0.8
0.6
$ F F X U D F \
0.4
0.2
0.0
ma
nd
gus
oma
st
ey
oid
tate
neck
der
ach
oma
duct
ix
lung
brain
us
us
ra
skin
liver
crea
e
ovar
colo
cerv
brea
pleu
test
uter
thym
kidn
la
thyr
pho
blad
pha
stom
pros
nal g
n
sarc
bile
pan
d&
mela
/lym
oeso
Hea
Adre
emia
leuk
6 L W H 7 \ S H / D E H O
Figure A9. Accuracy per class in Concat-Random for lymphoma.
Appendix B.2. Edit Adversaries
Figures A10–A12 show accuracy per class in Edit-Replacing-Breast, Edit-Replacing-
Sarcoma and Edit-Replacing-Lymphoma attacks, respectively.
1.0 Baseline
Edit-Replcing-Breast
0.8
0.6
$ F F X U D F \
0.4
0.2
0.0
ma
nd
gus
a
oma
uct
ast
ey
oid
ck
der
ach
lung
in
rus
skin
ix
ry
es
us
ra
live
crea
nom
stat
colo
cerv
bra
ova
pleu
d ne
test
thym
kidn
gla
thyr
bre
ute
pho
d
blad
pha
stom
sarc
bile
pro
pan
mela
nal
d an
/lym
oeso
Adre
Hea
emia
leuk
6 L W H 7 \ S H / D E H O
Figure A10. Accuracy per class in Edit-Replacing-breast.
1.0 Baseline
Edit-Replcing-Sarcoma
0.8
0.6
$ F F X U D F \
0.4
0.2
0.0
ma
land
gus
a
ach
oma
t
ast
oid
ck
der
ra
lung
in
rus
ix
skin
ry
es
us
duc
live
crea
e
nom
stat
colo
cerv
bra
ova
pleu
d ne
test
thym
kidn
thyr
bre
ute
pho
blad
pha
stom
al g
sarc
bile
pro
pan
mela
d an
/lym
oeso
n
Adre
Hea
emia
leuk
6 L W H 7 \ S H / D E H O
Figure A11. Accuracy per class in Edit-Replacing-Sarcoma.
310
Electronics 2023, 12, 129
1.0 Baseline
Edit-Replcing-Lymphoma
0.8
0.6
$ F F X U D F \
0.4
0.2
0.0
ma
d
gus
a
e
k
ast
ey
der
ach
oma
t
lung
in
rus
oid
ix
es
us
ra
skin
ry
duc
live
crea
nec
nom
stat
glan
colo
cerv
bra
ova
pleu
test
thym
kidn
thyr
bre
ute
pho
blad
pha
stom
sarc
bile
pro
pan
and
mela
nal
/lym
oeso
Adre
d
Hea
emia
leuk
6 L W H 7 \ S H / D E H O
Figure A12. Accuracy per class in Edit-Replacing-lymphoma.
Appendix C. Defense
In this section, we provide figures and tables that are related to the defense under
different adversarial attacks. Figures A13–A15 illustrate accuracy per class under concate-
nation and edit adversaries attacks when defense strategy is applied.
1.0 Baseline
Defense-Concat
0.8
0.6
$ F F X U D F \
0.4
0.2
0.0
m
land
gus
tate
ach
t
ast
ey
lung
in
rus
oid
der
es
us
ra
skin
liver
ix
ry
duc
crea
nec
nom
om
colo
cerv
bra
pho
ova
pleu
test
thym
kidn
thyr
bre
ute
blad
pha
stom
pros
al g
sarc
bile
pa n
d&
mela
/lym
oeso
n
Hea
Adre
emia
leuk
6 L W H 7 \ S H / D E H O
Figure A13. Accuracy per class in Defense-Concat.
1.0 Baseline
Defense-Edit-Synthetic
0.8
0.6
$ F F X U D F \
0.4
0.2
0.0
m
d
gus
oma
oma
s
st
ey
oid
tate
der
ach
ix
t
ra
lung
in
ry
es
skin
liver
du c
crea
ru
u
nec
glan
colo
cerv
brea
bra
pho
ova
pleu
test
thym
kidn
thyr
ute
blad
pha
stom
pros
n
sarc
bile
pan
d&
mela
/lym
nal
oeso
Hea
Adre
emia
leuk
6 L W H 7 \ S H / D E H O
Figure A14. Accuracy per class in Defense-Edit-Synthetic.
311
Electronics 2023, 12, 129
1.0 Baseline
Defense-Edit-Replace
0.8
0.6
$ F F X U D F \
0.4
0.2
0.0
m
nd
gus
a
tate
oma
reas
t
t
ey
der
h
lung
in
oid
skin
liver
ix
ry
us
ra
duc
s
ru
e
nec
nom
ac
colo
cerv
brea
bra
pho
ova
pleu
test
thym
kidn
l gla
thyr
ute
blad
pha
stom
pros
c
sarc
bile
pan
d&
mela
/lym
na
oeso
Hea
Adre
emia
leuk
6 L W H 7 \ S H / D E H O
Figure A15. Accuracy per class in Defense-Edit-Replace.
Table A11 lists the results of overall micro/macro F1 by performing defense on Edit-
Replacing for all classes names. From the result, we can easily see that defense strategy
enhance the robustness of the CNN model.
Table A11. Overall micro/macro F1 by performing defense.
Micro F1 Macro F1
Baseline 0.9544 0.9240
Edit-Replacing-Breast 0.9583 0.9369
Edit-Replacing-Lung 0.9583 0.9369
Edit-Replacing-Kidney 0.9583 0.9369
Edit-Replacing-Brain 0.9583 0.9369
Edit-Replacing-colon 0.9583 0.9369
Edit-Replacing-uterus 0.9583 0.9369
Edit-Replacing-thyroid 0.9583 0.9369
Edit-Replacing-prostate 0.9583 0.9369
Edit-Replacing-head and neck 0.9583 0.9369
Edit-Replacing-skin 0.9583 0.9369
Edit-Replacing-bladder 0.9583 0.9369
Edit-Replacing-liver 0.9583 0.9369
Edit-Replacing-stomach 0.9583 0.9369
Edit-Replacing-cervix 0.9583 0.9369
Edit-Replacing-ovary 0.9583 0.9369
Edit-Replacing-sarcoma 0.9583 0.9369
Edit-Replacing-adrenal gland 0.9583 0.9369
Edit-Replacing-pancreas 0.9583 0.9369
Edit-Replacing-oesophagus 0.9583 0.9369
Edit-Replacing-testes 0.9583 0.9369
Edit-Replacing-thymus 0.9583 0.9369
Edit-Replacing-melanoma 0.9583 0.9369
Edit-Replacing-leukemia/lymphoma 0.9583 0.9369
Edit-Replacing-bile duct 0.9583 0.9369
References
1. Köksal, Ö.; Akgül, Ö. A Comparative Text Classification Study with Deep Learning-Based Algorithms. In Proceedings of the
2022 9th International Conference on Electrical and Electronics Engineering (ICEEE), Alanya, Turkey, 29–31 March 2022; IEEE:
New York, NY, USA, 2022; pp. 387–391.
2. Varghese, M.; Anoop, V. Deep Learning-Based Sentiment Analysis on COVID-19 News Videos. In Proceedings of the International
Conference on Information Technology and Applications, Lisbon, Portugal, 20–22 October 2022; Spinger: Berlin/Heidelberg,
Germany, 2022; pp. 229–238.
312
Electronics 2023, 12, 129
3. Affi, M.; Latiri, C. BE-BLC: BERT-ELMO-Based deep neural network architecture for English named entity recognition task.
Procedia Comput. Sci. 2021, 192, 168–181. [CrossRef]
4. Zhang, W.E.; Sheng, Q.Z.; Alhazmi, A.; Li, C. Adversarial attacks on deep-learning models in natural language processing: A
survey. ACM Trans. Intell. Syst. Technol. (TIST) 2020, 11, 1–41. [CrossRef]
5. Alawad, M.; Yoon, H.J.; Tourassi, G.D. Coarse-to-fine multi-task training of convolutional neural networks for automated
information extraction from cancer pathology reports. In Proceedings of the 2018 IEEE EMBS International Conference on
Biomedical & Health Informatics (BHI), Las Vegas, NV, USA, 4–7 March 2018; pp. 218–221. [CrossRef]
6. Olthof, A.W.; van Ooijen, P.M.A.; Cornelissen, L.J. Deep Learning-Based Natural Language Processing in Radiology: The Impact
of Report Complexity, Disease Prevalence, Dataset Size, and Algorithm Type on Model Performance. J. Med. Syst. 2021, 45.
[CrossRef] [PubMed]
7. Wang, Y.; Bansal, M. Robust machine comprehension models via adversarial training. arXiv 2018, arXiv:1804.06473.
8. Suya, F.; Chi, J.; Evans, D.; Tian, Y. Hybrid batch attacks: Finding black-box adversarial examples with limited queries. In
Proceedings of the 29th USENIX Security Symposium (USENIX Security 20), Boston, MA, USA, 12–14 August 2020; pp. 1327–1344.
9. Yala, A.; Barzilay, R.; Salama, L.; Griffin, M.; Sollender, G.; Bardia, A.; Lehman, C.; Buckley, J.M.; Coopey, S.B.; Polubriaginof, F.;
et al. Using Machine Learning to Parse Breast Pathology Reports. bioRxiv 2016. [CrossRef] [PubMed]
10. Buckley, J.M.; Coopey, S.B.; Sharko, J.; Polubriaginof, F.C.G.; Drohan, B.; Belli, A.K.; Kim, E.M.H.; Garber, J.E.; Smith, B.L.; Gadd,
M.A.; et al. The feasibility of using natural language processing to extract clinical information from breast pathology reports. J.
Pathol. Inform. 2012, 3, 23. [CrossRef] [PubMed]
11. Devlin, J.; Chang, M.W.; Lee, K.; Toutanova, K. BERT: Pre-training of Deep Bidirectional Transformers for Language Understand-
ing. In Proceedings of the NAACL-HLT, Minneapolis, MN, USA, 2–7 June 2019; pp. 4171–4186.
12. Gao, S.; Alawad, M.; Young, M.T.; Gounley, J.; Schaefferkoetter, N.; Yoon, H.J.; Wu, X.C.; Durbin, E.B.; Doherty, J.; Stroup, A.;
et al. Limitations of Transformers on Clinical Text Classification. IEEE J. Biomed. Health Inform. 2021, 25, 3596–3607. [CrossRef]
[PubMed]
13. Chakraborty, A.; Alam, M.; Dey, V.; Chattopadhyay, A.; Mukhopadhyay, D. Adversarial Attacks and Defences: A Survey, 2018.
arXiv 2018, arXiv:1810.00069.
14. Long, T.; Gao, Q.; Xu, L.; Zhou, Z. A survey on adversarial attacks in computer vision: Taxonomy, visualization and future
directions. Comput. Secur. 2022, 121, 102847. [CrossRef]
15. Simoncini, W.; Spanakis, G. SeqAttack: On adversarial attacks for named entity recognition. In Proceedings of the 2021
Conference on Empirical Methods in Natural Language Processing: System Demonstrations, Punta Cana, Dominican Republic,
7–11 November 2021; pp. 308–318.
16. Araujo, V.; Carvallo, A.; Aspillaga, C.; Parra, D. On adversarial examples for biomedical nlp tasks. arXiv 2020, arXiv:2004.11157.
17. Jin, D.; Jin, Z.; Zhou, J.T.; Szolovits, P. Is bert really robust? a strong baseline for natural language attack on text classification
and entailment. In Proceedings of the AAAI Conference on Artificial Intelligence, New York, NY, USA, 7–12 February 2020;
Volume 34, pp. 8018–8025.
18. Gao, J.; Lanchantin, J.; Soffa, M.L.; Qi, Y. Black-box generation of adversarial text sequences to evade deep learning classifiers. In
Proceedings of the 2018 IEEE Security and Privacy Workshops (SPW), San Francisco, CA, USA, 24–24 May 2018; IEEE: New York,
NY, USA, 2018; pp. 50–56.
19. Yuan, L.; Zheng, X.; Zhou, Y.; Hsieh, C.J.; Chang, K.W. On the Transferability of Adversarial Attacksagainst Neural Text Classifier.
arXiv 2020, arXiv:2011.08558.
20. Pei, W.; Yue, C. Generating Content-Preserving and Semantics-Flipping Adversarial Text. In Proceedings of the 2022 ACM on
Asia Conference on Computer and Communications Security, Nagasaki, Japan, 30 May–3 June 2022; pp. 975–989.
21. Finlayson, S.G.; Kohane, I.S.; Beam, A.L. Adversarial Attacks Against Medical Deep Learning Systems. CoRR 2018, abs/1804.05296.
Available online: http://xxx.lanl.gov/abs/1804.05296 (accessed on 1 December 2022).
22. Mondal, I. BBAEG: Towards BERT-based biomedical adversarial example generation for text classification. arXiv 2021,
arXiv:2104.01782.
23. Zhang, R.; Zhang, W.; Liu, N.; Wang, J. Susceptible Temporal Patterns Discovery for Electronic Health Records via Adversarial
Attack. In Proceedings of the International Conference on Database Systems for Advanced Applications, Taipei, Taiwan, 11–14
April; Springer: Berlin/Heidelberg, Germany, 2021; pp. 429–444.
24. Sun, M.; Tang, F.; Yi, J.; Wang, F.; Zhou, J. Identify susceptible locations in medical records via adversarial attacks on deep
predictive models. In Proceedings of the 24th ACM SIGKDD International Conference on Knowledge Discovery & Data Mining,
London, UK, 19–23 August 2018; pp. 793–801.
25. Xu, H.; Ma, Y.; Liu, H.C.; Deb, D.; Liu, H.; Tang, J.L.; Jain, A.K. Adversarial attacks and defenses in images, graphs and text: A
review. Int. J. Autom. Comput. 2020, 17, 151–178. [CrossRef]
26. Szegedy, C.; Zaremba, W.; Sutskever, I.; Bruna, J.; Erhan, D.; Goodfellow, I.; Fergus, R. Intriguing properties of neural networks.
arXiv 2013, arXiv:1312.6199.
27. Wang, W.; Park, Y.; Lee, T.; Molloy, I.; Tang, P.; Xiong, L. Utilizing Multimodal Feature Consistency to Detect Adversarial Examples
on Clinical Summaries. In Proceedings of the 3rd Clinical Natural Language Processing Workshop, Online, 19 November 2020;
pp. 259–268.
28. Belinkov, Y.; Bisk, Y. Synthetic and natural noise both break neural machine translation. arXiv 2017, arXiv:1711.02173.
313
Electronics 2023, 12, 129
29. Alawad, M.; Gao, S.; Qiu, J.; Schaefferkoetter, N.; Hinkle, J.D.; Yoon, H.J.; Christian, J.B.; Wu, X.C.; Durbin, E.B.; Jeong, J.C.; et al.
Deep transfer learning across cancer registries for information extraction from pathology reports. In Proceedings of the 2019 IEEE
EMBS International Conference on Biomedical & Health Informatics (BHI), Chicago, IL, USA, 19–22 May 2019; IEEE: New York,
NY, USA, 2019; pp. 1–4. [CrossRef]
30. Gao, S.; Alawad, M.; Schaefferkoetter, N.; Penberthy, L.; Wu, X.C.; Durbin, E.B.; Coyle, L.; Ramanathan, A.; Tourassi, G. Using
case-level context to classify cancer pathology reports. PLoS ONE 2020, 15, e0232840. [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
314
electronics
Article
An Improved Hierarchical Clustering Algorithm Based
on the Idea of Population Reproduction and Fusion
Lifeng Yin 1 , Menglin Li 2 , Huayue Chen 3, * and Wu Deng 4,5, *
1 School of Software, Dalian Jiaotong University, Dalian 116000, China
2 School of Computer and Communication Engineering, Dalian Jiaotong University, Dalian 116028, China
3 School of Computer Science, China West Normal University, Nanchong 637002, China
4 School of Electronic Information and Automation, Civil Aviation University of China, Tianjin 300300, China
5 Traction Power State Key Laboratory, Southwest Jiaotong University, Chengdu 610031, China
* Correspondence: [email protected] (H.C.); [email protected] (W.D.)
Abstract: Aiming to resolve the problems of the traditional hierarchical clustering algorithm that
cannot find clusters with uneven density, requires a large amount of calculation, and has low efficiency,
this paper proposes an improved hierarchical clustering algorithm (referred to as PRI-MFC) based on
the idea of population reproduction and fusion. It is divided into two stages: fuzzy pre-clustering
and Jaccard fusion clustering. In the fuzzy pre-clustering stage, it determines the center point, uses
the product of the neighborhood radius eps and the dispersion degree fog as the benchmark to
divide the data, uses the Euclidean distance to determine the similarity of the two data points, and
uses the membership grade to record the information of the common points in each cluster. In the
Jaccard fusion clustering stage, the clusters with common points are the clusters to be fused, and
the clusters whose Jaccard similarity coefficient between the clusters to be fused is greater than the
fusion parameter jac are fused. The common points of the clusters whose Jaccard similarity coefficient
between clusters is less than the fusion parameter jac are divided into the cluster with the largest
membership grade. A variety of experiments are designed from multiple perspectives on artificial
Citation: Yin, L.; Li, M.; Chen, H.; datasets and real datasets to demonstrate the superiority of the PRI-MFC algorithm in terms of
Deng, W. An Improved Hierarchical clustering effect, clustering quality, and time consumption. Experiments are carried out on Chinese
Clustering Algorithm Based on the household financial survey data, and the clustering results that conform to the actual situation of
Idea of Population Reproduction and Chinese households are obtained, which shows the practicability of this algorithm.
Fusion. Electronics 2022, 11, 2735.
https://doi.org/10.3390/ Keywords: hierarchical clustering; Jaccard distance; membership grade; community clustering
electronics11172735
Academic Editor: Yu-Chen Hu
Received: 29 July 2022 1. Introduction
Accepted: 26 August 2022
Clustering [1] is a process of dividing a set of data objects into multiple groups or
Published: 30 August 2022
clusters, so that objects in a cluster have high similarity, but it is very dissimilar to objects
Publisher’s Note: MDPI stays neutral in other clusters [2–5]. It is also an unsupervised machine learning technique that does not
with regard to jurisdictional claims in require labels associated with data points [6–10]. As a data mining and machine learning
published maps and institutional affil- tool, clustering has been rooted in many application fields, such as pattern recognition,
iations. image analysis, statistical analysis, business intelligence, and other fields [11–15]. In
addition, the feature selection methods are also proposed to deal with data [16].
The basic idea of the hierarchical clustering algorithm [17] is to construct the hier-
archical relationship between data for clustering. The obtained clustering result has the
Copyright: © 2022 by the authors.
characteristics of a tree structure, which is called a clustering tree. It is mainly performed
Licensee MDPI, Basel, Switzerland.
This article is an open access article
using two methods, agglomeration techniques such as AGNE (agglomeration analysis) and
distributed under the terms and
divisive techniques such as DIANA (division analysis) [18]. Regardless of agglomeration
conditions of the Creative Commons technology or splitting technology, a core problem is measuring the distance between two
Attribution (CC BY) license (https:// clusters, and time is basically spent on distance calculation. Therefore, a large number
creativecommons.org/licenses/by/ of improved algorithms that use different means to reduce the number of distance calcu-
4.0/). lations have been proposed one after another to improve algorithmic efficiency [19–27].
Electronics 2022, 11, 2735. https://doi.org/10.3390/electronics11172735 https://www.mdpi.com/journal/electronics
315
Electronics 2022, 11, 2735
Guha et al. [28] proposed the CURE algorithm, which considers sampling the data in the
cluster and uses the sampled data as representative of the cluster to reduce the amount of
calculation of pairwise distances. The Guha team [29] improved CURE and proposed the
ROCK algorithm, which can handle non-standard metric data (non-Euclidean space, graph
structure, etc.). Karypis et al. [30] proposed the Chameleon algorithm, which uses the
K-nearest-neighbor method to divide the data points into many small cluster sub-clusters
in a two-step clustering manner before hierarchical aggregation in order to reduce the
number of iterations for hierarchical aggregation. Gagolewski et al. [31] proposed the
Genie algorithm which calculates the Gini index of the current cluster division before
calculating the distance between clusters. If the Gini index exceeds the threshold, the
merging of the smallest clusters is given priority to reduce pairwise distance calculation.
Another hierarchical clustering idea is to incrementally calculate and update the data nodes
and clustering features (abbreviated CF) of clusters to construct a CF clustering tree. The
earliest proposed CF tree algorithm BIRCH [32] is a linear complexity algorithm. When
a node is added, the number of CF nodes compared does not exceed the height of the
clustering tree. While having excellent algorithm complexity, the BIRCH algorithm cannot
ensure the accuracy and robustness of the clustering results, and it is extremely sensitive
to the input order of the data. Kobren et al. [33] improved this and proposed the PERCH
algorithm. This algorithm adds two optimization operations which are the rotation of the
binary tree branch and the balance of the tree height. This greatly reduces the sensitivity
of the data input order. Based on the PERCH algorithm, the PKobren team proposed the
GRINCH algorithm [34] to build a single binary clustering tree. The GRINCH algorithm
adds the grafting operation of two branches, allowing the ability to reconstruct, which
further reduces the algorithm sensitivity to the order of data input, but, at the same time,
it greatly reduces the scalability of the algorithm. Although most CF tree-like algorithms
have excellent scalability, their clustering accuracy on real-world datasets is generally lower
than that of classical hierarchical aggregation clustering algorithms.
To discover clusters of arbitrary shapes, density-based clustering algorithms are born.
Ester et al. [35] proposed a DBSCAN algorithm based on high-density connected regions.
This algorithm has two key parameters, Eps and Minpts. Many scholars at home and abroad
have studied and improved the DBSCAN algorithm for the selection of Eps and Minpts. The
VDBSCAN algorithm [36] selects the parameter values under different densities through
the K-dist graph and uses these parameter values to cluster clusters of different densities to
finally find clusters of different densities. The AF-DBSCAN algorithm [37] is an algorithm
for adaptive parameter selection, which adaptively calculates the optimal global parameters
Eps and MinPts according to the KNN distribution and mathematical statistical analysis.
The KANN-DBSCAN algorithm [38] is based on the parameter optimization strategy and
automatically determines the Eps and Minpts parameters by automatically finding the
change and stable interval of the cluster number of the clustering results to achieve a
high-accuracy clustering process. The KLS-DBSCAN algorithm [39] uses kernel density
estimation and the mathematical expectation method to determine the parameter range
according to the data distribution characteristics. The reasonable number of clusters in the
data set is calculated by analyzing the local density characteristics, and it uses the silhouette
coefficient to determine the optimal Eps and MinPts parameters. The MAD-DBSCAN
algorithm [40] uses the self-distribution characteristics of the denoised attenuated datasets
to generate a list of candidate Eps and MinPts parameters. It selects the corresponding Eps
and MinPts as the initial density threshold according to the denoising level in the interval
where the number of clusters tends to be stable.
To represent the uncertainty present in the data, Zadeh [41] proposed the concept of
fuzzy sets, which allow elements to contain rank membership values from the interval [0, 1].
Correspondingly, the widely used fuzzy C-means clustering algorithm [42] is proposed,
and many variants have appeared since then. However, membership levels alone are not
sufficient to deal with the uncertainty that exists in the data. With the introduction of the
hesitation class by Atanassov, Intuitive Fuzzy Sets (IFS) [43] emerge, in which a pair of
316
Electronics 2022, 11, 2735
membership and non-membership values for an element is used to represent the uncertainty
present in the data. Due to its better uncertainty management capability, IFS is used in
various clustering techniques, such as Intuitionistic Fuzzy C-means (IFCM) [44], improved
IFCM [45], probabilistic intuitionistic fuzzy C-means [46,47], Intuitive Fuzzy Hierarchical
Clustering (IFHC) [48], and Generalized Fuzzy Hierarchical Clustering (GHFHC) [49].
Most clustering algorithms assign each data object to one of several clusters, and
such cluster assignment rules are necessary for some applications. However, in many
applications, this rigid requirement may not be what we expect. It is important to study
the vague or flexible assignment of which cluster each data object is in. At present, the
integration of the DBSCAN algorithm and the fuzzy idea is rarely used in hierarchical
clustering research. The traditional hierarchical clustering algorithm cannot find clusters
with uneven density, requires a large amount of calculation, and has low efficiency. Using
the advantages of the high accuracy of classical hierarchical aggregation clustering and
the advantages of the DBSCAN algorithm for clustering data with uneven density, a new
hierarchical clustering algorithm is proposed based on the idea of population reproduction
and fusion, which we call the hierarchical clustering algorithm of population reproduction
and fusion (denoted as PRI-MFC). The PRI-MFC algorithm is divided into the fuzzy pre-
clustering stage and the Jaccard fusion clustering stage.
The main contributions of this work are as follows:
1. In the fuzzy pre-clustering stage, the center point is first determined to divide the data.
The benchmark of data division is the product of the neighborhood radius eps and the
dispersion grade fog. The overlapping degree of the initial clusters in the algorithm
can be adjusted by setting the dispersion grade fog so as to avoid misjudging outliers;
2. The Euclidean distance is used to determine the similarity of two data points, and the
membership grade is used to record the information of the common points in each
cluster. The introduction of the membership grade solves the problem that the data
points can flexibly belong to a certain cluster;
3. Comparative experiments are carried out on five artificial data sets to verify that the
clustering effect of PRI-MFC is superior to that of the K-means algorithm;
4. Extensive simulation experiments are carried out on six real data sets. From the
comprehensive point of view of the measurement indicators of clustering quality, the
PRI-MFC algorithm has better clustering quality;
5. Experiments on six real data sets show that the time consumption of the PRI-MFC
algorithm is negatively correlated with the parameter eps and positively correlated
with the parameter fog, and the time consumption of the algorithm is also better than
that of most algorithms;
6. In order to prove the practicability of this algorithm, a cluster analysis of household
financial groups is carried out using the data of China’s household financial survey.
The rest of this paper is organized as follows: Section 2 briefly introduces the relevant
concepts required in this paper. Section 3 introduces the principle of the PRI-MFC algorithm.
Section 4 introduces the implementation steps and flow chart of the PRI-MFC algorithm.
Section 5 presents experiments on the artificial datasets, various UCI datasets, and the
Chinese Household Finance Survey datasets. Finally, Section 6 contains the conclusion of
the work.
2. Related Concepts
This section introduces the related concepts involved in the PRI-MFC algorithm.
2.1. Data Normalization
The multi-index evaluation system, due to the different nature of each evaluation
index, usually has different dimensions and orders of magnitude. When the level of each
index differs greatly if the original index value is directly used for analysis, the role of the
index with a higher numerical value in the comprehensive analysis will be highlighted, and
the effect of the index with a lower numerical level will be relatively weakened. Therefore,
317
Electronics 2022, 11, 2735
in order to ensure the reliability of the results, it is necessary to standardize the original
indicator data. The normalization of data is performed to scale the data so that it falls into
a small specific interval. It removes the unit limitation of the data and converts it into a
pure, dimensionless value so that the indicators of different units or magnitudes can be
compared and weighted.
Data standardization methods can be roughly divided into three categories; linear
methods, such as the extreme value method and the standard deviation method; broken line
methods, such as the three-fold line method; and curve methods, such as the half-normal
distribution. This paper adopts the most commonly used z-score normalization (zero-mean
normalization) method [50], which is defined as Formula (1).
x−μ
x∗ = (1)
σ
Among them, x* are the transformed data, x are the original data, μ is the mean of
all sample data, and σ is the standard deviation of all sample data. Normalized data are
normally distributed with mean 0 and variance 1.
2.2. Membership Grade
In many clustering cases, the objects in the datasets cannot be divided into clearly
separated clusters, and absolutely assigning an object to a specific cluster can go wrong.
By assigning a weight to each object and each cluster and using the weight to indicate
the degree to which an object belongs to a certain cluster, the accuracy of clustering can
be improved.
Fuzzy C-means (FCM) incorporates the essence of fuzzy theory and is a clustering
algorithm that uses membership grade to determine the degree to which each data point
belongs to a certain cluster. The term ambiguity refers to something that is not clear
or ambiguous. Any changing event, process, or function cannot always be defined as
true or false. These activities need to be defined in an ambiguous way. Fuzzy logic is
similar to human decision-making methods. It is able to deal with vague and imprecise
information. Problems in the real world are often oversimplified to represent the existence
of things in terms of true or false or Boolean logic. In fuzzy systems, the existence of things
is represented by a number between 0 and 1. Fuzzy sets contain elements that satisfy
imprecise membership properties, and membership grade [51] is used to determine the
degree to which each element belongs to a certain cluster.
Assuming that any mapping from the universe X to the closed interval [0, 1] deter-
mines a fuzzy set A on X, then the fuzzy set A can be written as Formula (2).
A = {( x, μ A ( x ))| x ∈ X } (2)
Among them, μA (x) is the membership grade of x to fuzzy set A. When a certain point
in X makes μA (x) = 0.5, the point is called the transition point of fuzzy set A, which has the
strongest ambiguity.
2.3. Similarity
In a cluster analysis, the measurement of similarity between different samples is its
core. The similarity measurement methods involved in the PRI-MFC algorithm are the
Euclidean distance [52] and the Jaccard similarity coefficient [53]. Euclidean distance is a
commonly used definition of distance, which refers to the true distance between two points
in n-dimensional space. Assuming that there are two points x and y in the n-dimensional
space, the Euclidean distance formula is shown in (3). The featured parameters in the
Euclidean distance are equally weighted, and different dimensions are treated equally.
1
n 2
D ( x, y) = ( ∑ | xm − ym |2 ) (3)
m =1
318
Electronics 2022, 11, 2735
The Jaccard similarity coefficient can also be used to measure the similarity of samples.
Suppose there are two n-dimensional binary vectors X1 and X2 , and each dimension of X1
and X2 can only be 0 or 1. M00 represents the number of dimensions in which both vector
X1 and vector X2 are 0, M01 represents the number of dimensions in which vector X1 is 0
and vector X2 is 1, M10 represents the number of dimensions in which vector X1 is 1 and
vector X2 is 0, and M11 represents the number of dimensions in which vector X1 is 1 and
vector X2 are 1. Then each dimension of the n-dimensional vector falls into one of these
four classes, so Formula (4) is established.
M00 + M01 + M10 + M11 = n (4)
The Jaccard similarity index is shown in Formula (5). The larger the Jaccard value, the
higher the similarity, and the smaller the Jaccard value, the lower the similarity.
M11
J ( A, B) = (5)
M01 + M10 + M11
3. Principles of the PRI-MFC Algorithm
In the behavior of population reproduction and population fusion in nature, it is
assumed that there are initially n non-adjacent population origin points. Then new individ-
uals are born near the origin point, and the points close to the origin point are divided into
points where races multiply. This cycle continues until all data points have been divided.
At this point, the reproduction process ends, and the population fusion process begins.
Since data points can belong to multiple populations in the process of dividing, there are
common data points between different populations. When the common points between the
populations reach a certain number, the populations merge. On the basis of this idea, this
section designs and implements an improved hierarchical clustering algorithm with two
clustering stages denoted as the PRI-MFC algorithm. The general process of the clustering
division of the PRI-MFC is shown in Figure 1.
(a). Clustering center division (b). Fuzzy pre-clustering (c). Clustering results partition
Figure 1. Data sample division process.
In the fuzzy pre-clustering stage, based on the neighborhood knowledge of DBSCAN
clustering, starting from any point in the overall data, through the neighborhood radius
eps, multiple initial cluster center points (Suppose there are k) are divided in turn, and
the non-center points are divided into the corresponding cluster centers with eps as the
neighborhood radius, as shown in the Figure 1a. The red point in the figure is the cluster
center point, and the solid line is the initial clustering. Once again, the non-central data
points are divided into k cluster centers according to the neighborhood dispersion radius
eps*fog. The same data point can be divided into multiple clusters, and finally, k clusters are
formed to complete the fuzzy pre-clustering process. This process is shown in Figure 1b.
The radius of the circle drawn by the dotted line in the figure is eps*fog, and the point
of the overlapping part between the dotted circles is the common point to be divided.
The Euclidean distance is used to determine the similarity of two data points, and the
membership grade of a cluster to which the common point belongs is recorded. The
Euclidean distance between the common point di and the center point ci divided by eps*fog
is the membership grade of ci to which di belongs. The neighborhood radius eps is taken
319
Electronics 2022, 11, 2735
from the definition of ε-neighborhood proposed by Stevens. The algorithm parameter fog
is the dispersion grade. By setting fog, the overlapping degree of the initial clusters in the
algorithm can be adjusted to avoid the misjudgment of outliers. The value range of the
parameter fog is [1, 2.5].
In the Jaccard fusion clustering stage, the information of the common points of the
clusters is counted and sorted, and the cluster groups to be fused without repeated fusion
are found. Then, it sets the parameter jac according to the similarity coefficient of Jaccard to
perform the fusion operation on the clusters obtained in the clustering fuzzy pre-clustering
stage and obtains several clusters formed by the fusion of m pre-clustering small clusters.
The sparse clusters with a data amount of less than three in these clusters are individually
marked as outliers to form the final clustering result, as shown in Figure 1c.
The fuzzy pre-clustering of the PRI-MFC algorithm can input data in batches to
prevent the situation from running out of memory caused by reading all the data into the
memory at one time. The samples in the cluster are divided and stored in the records with
unique labels. The pre-clustering process coarsens the original data. In the Jaccard fusion
clustering stage, only the number of labels needs to be read to complete the statistics, which
reduces the computational complexity of the hierarchical clustering process.
4. Implementation of PRI-MFC Algorithm
This section mainly introduces the steps, flowcharts, and pseudocode of the PRI-
MFC algorithm.
4.1. Algorithm Steps and Flow Chart
Combined with optimization strategies [54,55] such as the fuzzy cluster membership
grade, coarse-grained data, and staged clustering, the PRI-MFC algorithm reduces the
computational complexity of the hierarchical clustering process and improves the execution
efficiency of the algorithm. The implementation steps are as follows:
Step 1. Assuming that there are n data points in the data set D, it randomly selects one
data point xi , adds it to the cluster center set centroids, and synchronously builds the cluster
dictionary clusters corresponding to the data center centroids set.
Step 2. The remaining n − 1 data points are compared with the points in the centroids,
the data points whose distance is greater than the neighborhood radius eps are added to the
centroids, and the clusters are updated to obtain all the initial cluster center points in a loop.
Step 3. It performs clustering based on centroids and divides the data points xi in the
data set D whose distance from the cluster center point ci is less than eps*fog to the clusters
with ci as the cluster center. In the process, if xi belongs to multiple clusters, it marks it
as the point to be fused and records its belonging cluster k and membership grade in the
fusion information statistical dictionary match_dic.
Step 4. It counts the number of common points between the clusters, merges the
clusters to be fused with repeated clusters to be fused, and calculates the Jaccard similarity
coefficient between the clusters to be fused.
Step 5. It fuses the clusters whose similarity between clusters is greater than the
fusion parameter jac and divides the common points of the clusters whose similarity
between clusters is less than the fusion parameter jac into the cluster with the largest
membership grade.
Step 6. In the clustering result obtained in step 5, the clusters with less than three data
in the cluster are classified as outliers.
Step 7. The clustering is completed, and the clustering result is output.
Through the description of the above algorithm steps, the obtained PRI-MFC algorithm
flowchart is shown in Figure 2.
320
Electronics 2022, 11, 2735
VWDUW
,QSXWGDWDDQHLJKERUKRRGUDGLXVepsMDFFDUG
VLPLODULW\FRHIILFLHQW jacGLVSHUVLRQfog
]VFRUHQRUPDOL]HGD
5DQGRPO\VHOHFWDQLQLWLDOFOXVWHUFHQWHUFDGGLWWRWKHFOXVWHU
FHQWHUVHW&(DQGXSGDWHWKHFOXVWHUVHW&/
1
1
D>i@Ă!CE < (XBGLVWDQFH D>i@CE>j@ !eps" 1
8SGDWH&/
UHPRYH'>L@IURP' < 6FDQIRU&(FRPSOHWH"
DFFRUGLQJWR&(
6FDQRI'LVFRPSOHWH"
<
D[i] belongs to
(XBGLVWDQFH D>i@&(>j@ !eps fog" 1 D>L@Ă!CL>M@
multiple clusters?
1
6WRUHWKHFOXVWHUDQGPHPEHUVKLSLQIRUPDWLRQWRUHSHDW <
<
1 1
6FDQIRU&(FRPSOHWH"
<
6FDQRI'LVFRPSOHWH"
<
5HYHUVHFDOFXODWLRQRIWKHMXGJPHQWVHW0WREHIXVHGDFFRUGLQJWRWKHUHSHDW
'LYLGHWKHFRPPRQSRLQWVLQ0>N@WRWKH
1 M>k@!jac" 1 FRUUHVSRQGLQJFOXVWHUVDFFRUGLQJWRWKH
PD[LPXPPHPEHUVKLSGHJUHH
)XVLRQRIFOXVWHUV
)XVLRQFOXVWHULV
< FRUUHVSRQGLQJWR
VWRUHGLQ0&/>N@
0>N@
M Scan completed?
<
$GG0&/>RXWOLHUV@WRWKHXQIXVHGFOXVWHUZLWKGDWDYROXPHOHVVWKDQDQGDGG0&/>N@LIWKH
GDWDYROXPHLVJUHDWHUWKDQ
RXWSXW0&/
)LQLVK
Figure 2. PRI-MFC algorithm flow chart.
321
Electronics 2022, 11, 2735
4.2. Pseudocode of the Improved Algorithm
The pseudo-code of the PRI-MFC Algorithm 1 is as follows:
Algorithm 1 PRI-MFC
Input: Data D, Neighborhood radius eps, Jaccard similarity coefficient jac, Dispersion fog
Output: Clustering results
1 X = read(D) // read data into X
2 Zscore(X) // data normalization
3 for x0 to xn
4 if x0 then
5 x0 divided into the cluster center set as the first cluster center centers
6 Delete x0 from X and added it into cluster[0]
7 else
8 if Eu_distance(xi , cj ) > eps then
9 xi as the j_th clustering center divided into centers
10 Delete xi from X, and added it into cluster
11 end if
12 end for
13 for x0 to xn
14 if Eu_distance(xi , cj ) < eps*fog then
15 xi divided into cluster
16 if xi ∈ multi clustering centers then
Recode the Membership information of xi to public point
17
collection repeat
18 end if
19 end if
20 end for
According to the information in repeat, reversely count the number of common points
21
between each cluster, save to merge
22 for m0 to mk // scan the cluster group to be fused in merge
23 if the public points of group mi > jac then
24 Merge the clusters in group mi , and save it into new clusters
25 else
Divide them into corresponding clusters according to the maximum
26
membership grade
27 Mark clusters with less than 3 data within clusters as outliers, save in outliers
28 end for
29 return clusters
5. Experimental Comparative Analysis of PRI-MFC Algorithm
This section introduces the evaluation metrics to measure the quality of the clustering
algorithm, designs a variety of experimental methods for different data sets, and illustrates
the superiority of the PRI-MFC algorithm by analyzing the experimental results from
multiple perspectives.
5.1. Cluster Evaluation Metrics
The experiments in this paper use Accuracy (ACC) [56], Normalized Mutual Informa-
tion (NMI) [57], and the Adjusted Rand Index (ARI) [58] to evaluate the performance of the
clustering algorithm.
The accuracy of the clustering is also often referred to as the clustering purity (purity).
The general idea is to divide the number of correctly clustered samples by the total number
of samples. However, for the results after clustering, the true category corresponding to
322
Electronics 2022, 11, 2735
each cluster is unknown, so it is necessary to take the maximum value in each case, and the
calculation method is shown in Formula (6).
1
max j wk ∩ c j
N∑
ACC(Ω, C ) = (6)
k
Among them, N is the total number of samples, Ω = {w1 , w2 , . . . , wk } represents the
classification of the samples in the cluster, C = {c1 , c2 , . . . , cj } represents the real class of the
samples, wk denotes all samples in the k-th cluster after clustering, and cj denotes the real
samples in the j-th class. The value range of ACC is [0, 1], and the larger the value, the
better the clustering result.
Normalized Mutual Information (NMI), that is, the normalization of the mutual infor-
mation score, can adjust the result between 0 and 1 using the entropy as the denominator.
For the true label, A, of the class in the data sets and a certain clustering result, B, the unique
value in A is extracted to form a vector, C, and the unique value in B is extracted to form a
vector, S. The calculation of NMI is shown in Formula (7).
I (C, S)
N MI ( A, B) = % (7)
H (C ) × H (S)
Among them, I(C, S) is the mutual information of the two vectors, C and S, and
H(C) is the information entropy of the C vector. The calculation formulas are shown in
Formulas (8) and (9). NMI is often used in clustering to measure the similarity of two
clustering results. The closer the value is to 1, the better the clustering results.
! "
p(c, s)
I (C, S) = ∑ ∑ log (8)
y∈S x ∈C
p(c) p(s)
n
H (C ) = −∑ p(ci ) log2 p(ci ) (9)
1
Adjusted Rand Index (ARI) assumes that the super-distribution of the model is a
random model, that is, the division of X and Y is random, and the number of data points for
each category and each cluster is fixed. To calculate this value, first calculate the contingency
table, as shown in Table 1.
Table 1. Contingency table.
X1 X2 ... Xs Sum
Y1 n11 n12 ... n1s a1
Y2 n21 n22 ... n2s a2
... ... ... ... ... ...
Yr nr1 nr2 ... nrs ar
sum b1 b2 ... bs
The rows in the table represent the actual divided categories, the columns of the table
represent the cluster labels of the clustering division, and each value nij represents the
number of files in both class(Y) and class(X) at the same time. Calculate the value of ARI
through this table. The calculation formula of ARI is shown in Formula (10).
! " ) ! " ! "*
nij a b
∑ − ∑ i ∑ j / n2
ij 2 i 2 j 2
ARI( X, Y ) = ) ! " ! "* ) ! " ! "* ! " (10)
ai bj ai bj n
1
2 ∑ + ∑ − ∑ ∑ /
i 2 j 2 i 2 j 2 2
323
Electronics 2022, 11, 2735
The value range of ARI is [−1, 1], and the larger the value, the more consistent the
clustering results are with the real situation.
5.2. Experimental Data
For algorithm performance testing, the experiments use five simulated datasets, as
shown in Table 2. The tricyclic datasets, bimonthly datasets, and spiral datasets are used to
test the clustering effect of the algorithm on irregular clusters, and the C5 datasets and C9
datasets are used to test the clustering effect of the algorithm on common clusters.
Table 2. Artificial datasets.
Serial Number Datasets Sample Feature Number of Clusters
D1 Three-ring 3600 2 3
D2 Bimonthly 1500 2 2
D3 Spiral 941 2 2
D4 C5 2000 2 5
D5 C9 1009 2 9
In addition, the algorithm performance comparison experiment also uses six UCI real
datasets, including Seeds datasets. The details of the data are shown in Table 3.
Table 3. UCI datasets.
Serial Number Datasets Sample Feature Number of Clusters
D1 Seeds 210 7 3
D2 Iris 150 4 3
D3 Breast 699 10 2
D4 Glass 214 9 6
D5 Ecoli 336 7 7
D6 Pima 768 9 2
5.3. Analysis of Experimental Results
This section contains experiments on the PRI-MFC algorithm on artificial datasets,
various UCI datasets, and the China Financial Household Survey datasets.
5.3.1. Experiments on Artificial Datasets
The K-means algorithm [53] and the PRI-MFC algorithm are used for experiments on
datasets shown in Table 1, and the experimental clustering results are visualized as shown
in Figures 3 and 4, respectively.
(a) Three-ring dataset (b) Bimonthly dataset (c) Spiral dataset
(d) C5 dataset (e) C9 dataset
Figure 3. Clustering results of the k-means algorithm on artificial datasets.
324
Electronics 2022, 11, 2735
(a) Three-ring dataset (b) Bimonthly dataset (c) Spiral dataset
(d) C5 dataset (e) C9 dataset
Figure 4. Clustering results of PRI-MFC algorithm on artificial datasets.
It can be seen from the figure that the clustering effect of K-means on the tricyclic
datasets, bimonthly datasets, and spiral datasets with uniform density distribution is not
ideal. However, K-means has a good clustering effect on both C5 datasets and C9 datasets
with uneven density distribution. The PRI-MFC algorithm has a good clustering effect
on the three-ring datasets, bimonthly datasets, spiral datasets, and C9 datasets. While
accurately clustering the data, it more accurately marks the outliers in the data. However,
it fails to distinguish adjacent clusters on the C5 datasets, and the clustering effect is poor
for clusters with insignificant clusters in the data.
Comparing the clustering results of the two algorithms, it can be seen that the cluster-
ing effect of the PRI-MFC algorithm is better than that of the K-means algorithm on most
of the experimental datasets. The PRI-MFC algorithm is not only effective on datasets with
uniform density distributions but also has better clustering effects on datasets with large
differences in density distributions.
5.3.2. Experiments on UCI Datasets
In this section, experiments on PRI-MFC, K-means [1], ISODATA [59], DBSCAN, and
KMM [1] are carried out on various UCI datasets to verify the superiority of the PRI-MFC
from the perspective of clustering quality, time, and algorithm parameter influence.
Clustering Quality Perspective
On the UCI data set, PRI-MFC is compared with K-means, ISODATA, DBSCAN, and
KMM, and the evaluation index values of the clustering results on various UCI data sets are
obtained, which are the accuracy rate (ACC), the standardized mutual information (NMI),
and the adjusted Rand coefficient (ARI). The specific experimental results are shown in
Table 4.
In order to better observe the clustering quality, the evaluation index data in
Table 4 are assigned weight values 5, 4, 3, 2, and 1 in descending order. The ACC
index values of the five algorithms on the UCI datasets are shown in Table 5, and
the weight values assigned to the ACC index values are shown in Table 6. Taking
the ACC of K-means as an example, the weighted average of the ACC of K-means is
(90.95 × 5 + 30.67 × 1 + 96.05 × 5 + 51.87 × 5 + 56.55 × 3 + 67.19 × 5)/24 = 72.11. Calculated
in this way, the weighted average of each algorithm evaluation index is obtained as shown
in Table 7.
325
Electronics 2022, 11, 2735
Table 4. Clustering evaluation index values of five algorithms on the UCI datasets(%).
Datasets Evaluation Metrics K-Means DBSCAN ISODATA KMM PRI-MFC
ACC 90.95 59.04 35.71 62.86 66.66
Seeds NMI 70.88 52 76.81 58.16 64.68
ARI 75.05 39.49 73.98 49.69 51.44
ACC 30.67 33.33 56.81 36.67 66.66
Iris NMI 0.8 0.33 73.37 0.44 73.36
ARI 0.42 0.64 56.81 0.33 76.81
ACC 96.05 64.57 41.29 1.17 95.16
Breast NMI 74.68 10.54 2.22 79.21 76.64
ARI 84.65 9.60 −2.74 87.98 85.43
ACC 51.87 42.52 50 32.71 34.11
Glass NMI 42.37 36.07 66.17 28.55 42.19
ARI 27.66 22.26 48.76 14.10 27.52
ACC 56.55 42.56 73.51 0.89 57.35
Ecoli NMI 58.38 11.31 73.63 44.17 61.97
ARI 46.50 3.80 78.45 36.99 75.34
ACC 67.19 63.80 32.94 34.51 35.28
Pima NMI 6.07 0.0 0.31 0.25 6.03
ARI 11.07 0.13 −0.54 0.43 9.08
Table 5. ACC index values of five algorithms on the UCI datasets (%).
Datasets K-Means DBSCAN ISODATA KMM PRI-MFC
Seeds 90.95 59.04 35.71 63.31 74.28
Iris 30.67 34.62 56.81 37.33 69.74
Breast 96.05 64.57 41.29 56.95 95.16
Glass 51.87 42.52 50 35.04 34.11
Ecoli 56.55 42.56 73.51 47.32 57.35
Pima 67.19 63.8 32.94 60.15 35.28
Table 6. The weight values of the ACC of five algorithms on the UCI datasets.
Datasets K-Means DBSCAN ISODATA KMM PRI-MFC
Seeds 5 2 1 3 4
Iris 1 2 4 3 5
Breast 5 3 1 2 4
Glass 5 3 4 2 1
Ecoli 3 1 5 2 4
Pima 5 4 1 3 2
Table 7. The weighted averages of the evaluation index of five algorithms (%).
Evaluation Metrics K-Means DBSCAN ISODATA KMM PRI-MFC
ACC 72.11 53.76 56.55 50.73 68.03
NMI 40.22 19.61 60.54 45.05 54.21
ARI 42.52 9.93 57.8 44.93 56.54
From Table 7, the weighted average of ACC of K-means is 0.7211 and the weighted
average of ACC of PRI-MFC is 0.6803. From the perspective of ACC, the K-means algorithm
is the best, and the PRI-MFC algorithm is better. The weighted average of NMI of ISODATA
is 0.6054, and the weighted average of NMI of the PRI-MFC algorithm is 0.5424. From the
perspective of NMI, the PRI-MFC algorithm is better. Similarly, it can also be seen that the
PRI-MFC algorithm has a better effect from the perspective of ARI.
In order to comprehensively consider the quality of the five clustering algorithms,
weights 5, 4, 3, 2, and 1 are assigned to each evaluation index data in Table 7 in descending
order, and the result is shown in Table 8.
326
Electronics 2022, 11, 2735
Table 8. The weight values of the weighted averages of the evaluation index of five algorithms.
Evaluation Metrics K-Means DBSCAN ISODATA KMM PRI-MFC
ACC 5 2 3 1 4
NMI 2 1 5 3 4
ARI 2 1 5 3 4
The weighted average of the comprehensive evaluation index of each algorithm is
calculated according to the above method, and the result is shown as Table 9. It can be seen
that the PRI-MFC algorithm proposed in this paper is the best in terms of clustering quality.
Table 9. The weighted averages of comprehensive evaluation index of five algorithms (%).
Evaluation Metrics K-Means DBSCAN ISODATA KMM PRI-MFC
comprehensive
56.91 34.27 58.57 44.93 58.76
evaluation index
Time Perspective
In order to illustrate the superiority of the algorithm proposed in this paper, the PRI-
MFC algorithm, the classical partition-based clustering algorithm, K-means, the commonly
used hierarchical clustering algorithm, BIRCH, and Agglomerative are tested on six real
data sets, respectively, as shown in Figure 5.
Figure 5. Comparison of running time of clustering algorithm on UCI datasets.
The BIRCH algorithm takes the longest time, with an average time of 34.5 ms. The
K-means algorithm takes second place, with an average time of 34.07 ms. The PRI-MFC
algorithm takes a shorter time, with an average time of 24.59 ms, and Agglomerative is the
shortest, with an average time-consuming of 15.35 ms. The PRI-MFC clustering algorithm
wastes time in fuzzy clustering processing so it takes a little longer than Agglomerative.
However, the PRI-MFC algorithm only needs to read the number of labels in the Jaccard
fusion clustering stage to complete the statistics which saves time. The overall time
consumption is shorter than the other algorithms.
Algorithm Parameter Influence Angle
In this section, the PRI-MFC algorithm is tested on UCI, and the eps parameter value
is modified. The time consumption of the PRI-MFC is shown in Figure 6. It can be seen
that with an increase in the eps parameter value, the time consumption of the algorithm
decreases again. It can be seen that the time of the algorithm is negatively correlated with
the eps parameter. In the fuzzy pre-clustering stage of the PRI-MFC algorithm, the influence
of the eps parameter on the time consumption of the algorithm is more obvious.
327
Electronics 2022, 11, 2735
Figure 6. Parameter eps and time consumption of PRI-MFC algorithm.
After modifying the fog parameter value, the time consumption of the PRI-MFC
algorithm is shown in Figure 7. It can be seen that, with the increase of the fog parameter
value, the time consumption of the algorithm increases again. It can be seen that the time
of the algorithm is positively correlated with the fog parameter.
Figure 7. Parameter fog and time consumption of PRI-MFC algorithm.
5.3.3. Experiments on China’s Financial Household Survey Data
The similarity of the hierarchical clustering algorithm is easy to define. It does not need
to pre-determine the number of clusters. It can discover the hierarchical relationship of the
classes and cluster them into various shapes, which is suitable for community analysis and
market analysis [60]. In this section, the PRI-MFC algorithm conducts experiments on real
328
Electronics 2022, 11, 2735
Chinese financial household survey data, displays the clustering results, and then analyzes
the household financial community to demonstrate the practicability of this algorithm.
Datasets
This section uses the 2019 China Household Finance Survey data, which covers
29 provinces (autonomous regions and municipalities), 343 districts and counties, and
1360 village (neighborhood) committees. Finally, the information of 34,643 households and
107,008 family members is collected. The data are nationally and provincially representative,
including three datasets: family datasets, personal datasets, and master datasets. The data
details are shown in Table 10.
Table 10. China household finance survey data details from 2019.
Data Name The Amount of Data Attributes
family data 34,643 2656
Personal data 107,008 423
master data 107,008 54
The attributes that have high values for the family financial group clustering experi-
ment in the three data sets are selected, redundant irrelevant attributes are deleted, and
then duplicate data are removed, and the family data set and master data set are combined
into a family data set. The preprocessed data are shown in Table 11.
Table 11. Preprocessed China household finance survey data.
Data Name The Amount of Data Attributes
Family 34,643 53
Personal 107,008 13
Experiment
The experiments of the PRI-MFC algorithm are carried out on the two data sets in
Table 11. The family data table has a total of 34,643 pieces of data and 53 features, of
which there are 16,477 pieces of household data without debt. First, the household data of
debt-free urban residents are selected to conduct the PRI-MFC algorithm experiment. The
data features are selected as total assets, total household consumption, and total household
income. Since there are 28 missing values in each feature of the data, there are 9373 actual
experimental data. Secondly, the household data of non-debt rural residents are selected.
The selected data features are the same as above. There are 10 missing values for each
feature of these data, and the actual experimental data have a total of 7066 items. The
clustering results obtained from the two experiments are shown in Table 12.
Table 12. Financial micro-data clustering of Chinese debt-free households.
Area Cluster Sample Proportion (%) Mean 1 Mean 2 Mean 3 Tag
1 8179 87.26 672,405.82 67,649.73 73,863.01 Well-off
Town 2 1047 11.17 4,454,086.8 130,084.35 185,686.23 Middle
3 144 1.53 10,647,847.47 239,064.97 390,016.64 Rich
1 6956 98.44 307,014.13 52,879.74 41,349.55 Well-off
Rural 2 105 1.48 4,647,506.43 113,648.82 228,253.08 Middle
3 5 0.07 20,590,783.60 66,631.20 69,243.30 Rich
It can be seen from Table 12 that regardless of urban or rural areas, the population
in my country can be roughly divided into three categories: well-off, middle-class, and
affluent. The clustering results are basically consistent with the distribution of population
income in my country. The total income of middle-class households in urban areas is lower
329
Electronics 2022, 11, 2735
than that of middle-class households in rural areas, but their expenditures are lower and
their total assets are higher. It can be seen that the fixed asset value of the urban population
is higher, the fixed asset value of the rural population is lower, and the well-off households
account for the highest proportion of the total rural households, accounting for 98.44%.
Obviously, urban people and a small number of rural people have investment needs,
but only a few wealthy families can have professional financial advisors. Most families
have minimal financial knowledge and do not know much about asset appreciation and
maintaining capital value stability. This clustering result is beneficial for financial managers
to make decisions and bring them more benefits.
5.4. Discussion
The experiment on artificial datasets shows that the clustering effect of the PRI-MFC
algorithm is better than that of the classical partitioned K-means algorithm regardless of
whether the data density is uniform or not. Because the first stage of PRI-MFC algorithm
clustering relies on the idea of density clustering, it can cluster uneven density data.
Experiments were carried out on the real data set from three aspects: clustering quality,
time consumption, and parameter influence. The evaluation metrics of ACC, NMI, and
ARI of the five algorithms obtained in the experiment were further analyzed. Calculating
the weighted average of each evaluation index of each algorithm, the experiment concludes
that the clustering quality of the PRI-MFC algorithm is better. The weighted average
of the comprehensive evaluation index of each algorithm was further calculated, and it
was concluded that the PRI-MFC algorithm is optimal in terms of clustering quality. The
time consumption of each algorithm is displayed through the histogram. The PRI-MFC
clustering algorithm wastes time in fuzzy clustering processing, and its time consumption
is slightly longer than that of Agglomerative. However, in the Jaccard fusion clustering
stage, the PRI-MFC algorithm only needs to read the number of labels to complete the
statistics, which saves time, and the overall time consumption is less than other algorithms.
Experiments from the perspective of parameters show that the time of this algorithm has a
negative correlation with the parameter eps and a positive correlation with the parameter
fog. When the parameter eps changes from large to small in the interval [0, 0.4], the time
consumption of the algorithm increases rapidly. When the eps parameter changes from
large to small in the interval [0.4, 0.8], the time consumption of the algorithm increases
slowly. When the eps parameter in the interval between [0.8, 1.3] changes from large to
small, the time consumption of the algorithm tends to be stable. In conclusion, from the
perspective of the clustering effect and time consumption, the algorithm is better when
the eps is 0.8. When the fog parameter is set to 1, the time consumption is the lowest,
because the neighborhood radius and the dispersion radius are the same at this time. With
the increase of the fog value, the time consumption of the algorithm gradually increases.
In conclusion, from the perspective of the clustering effect and time consumption, the
algorithm is better when fog is set to 1.8. Experiments conducted on Chinese household
finance survey data show that the PRI-MFC algorithm is practical and can be applied in
market analysis, community analysis, etc.
6. Conclusions
In view of the problems that the traditional hierarchical clustering algorithm cannot
find clusters with uneven density, requires a large amount of calculation and has low
efficiency, this paper takes advantage of the benefits of the classical hierarchical clustering
algorithm and the advantages of the DBSCAN algorithm for clustering data with uneven
density. Based on population reproduction and fusion, a new hierarchical clustering
algorithm PRI-MFC is proposed. This algorithm can effectively identify clusters of any
shape, and preferentially identify cluster-dense centers. It can effectively remove noise in
samples and reduce outlier pairs by clustering and re-integrating multiple cluster centers.
By setting different parameters for eps and fog, the granularity of clustering can be adjusted.
Secondly, various experiments are designed on artificial datasets and real datasets, and the
330
Electronics 2022, 11, 2735
results show that this algorithm is better in terms of clustering effect, clustering quality,
and time consumption. Due to the uncertainty of objective world data, the next step is to
study the fuzzy hierarchical clustering algorithm further. With the advent of the era of big
data, running the algorithm on a single computer is prone to bottleneck problems. The next
step is to study the improvement of clustering algorithms under the big data platform.
Author Contributions: Conceptualization, L.Y. and M.L.; methodology, L.Y.; software, M.L.; valida-
tion, LY., H.C. and M.L.; formal analysis, M.L.; investigation, M.L.; resources, H.C.; data curation,
M.L.; writing—original draft preparation, M.L.; writing—review and editing, L.Y.; visualization,
M.L.; supervision, L.Y.; project administration, W.D.; funding acquisition, L.Y., H.C. and W.D. All
authors have read and agreed to the published version of the manuscript.
Funding: This research was funded by the National Natural Science Foundation of China under
grant number U2133205 and 61771087, the Natural Science Foundation of Sichuan Province under
Grant 2022NSFSC0536, the Research Foundation for Civil Aviation University of China under Grant
3122022PT02 and 2020KYQD123.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: Not applicable.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Han, J.; Pei, J.; Tong, H. Data Mining Concepts and Techniques, 3rd ed.; China Machine Press: Beijing, China, 2016.
2. Li, X.; Zhao, H.; Yu, L.; Chen, H.; Deng, W.; Deng, W. Feature Extraction Using Parameterized Multisynchrosqueezing Transform.
IEEE Sens. J. 2022, 22, 14263–14272. [CrossRef]
3. Wu, D.; Wu, C. Research on the Time-Dependent Split Delivery Green Vehicle Routing Problem for Fresh Agricultural Products
with Multiple Time Windows. Agriculture 2022, 12, 793. [CrossRef]
4. Zhou, X.; Ma, H.; Gu, J.; Chen, H.; Deng, W. Parameter adaptation-based ant colony optimization with dynamic hybrid mechanism.
Eng. Appl. Artif. Intell. 2022, 114, 105139. [CrossRef]
5. Li, T.; Shi, J.; Deng, W.; Hu, Z. Pyramid particle swarm optimization with novel strategies of competition and cooperation. Appl.
Soft Comput. 2022, 121, 108731. [CrossRef]
6. Deng, W.; Xu, J.; Gao, X.-Z.; Zhao, H. An Enhanced MSIQDE Algorithm With Novel Multiple Strategies for Global Optimization
Problems. IEEE Trans. Syst. Man Cybern. Syst. 2020, 52, 1578–1587. [CrossRef]
7. Chen, H.; Miao, F.; Chen, Y.; Xiong, Y.; Chen, T. A Hyperspectral Image Classification Method Using Multifeature Vectors and
Optimized KELM. IEEE J. Sel. Top. Appl. Earth Obs. Remote Sens. 2021, 14, 2781–2795. [CrossRef]
8. Yao, R.; Guo, C.; Deng, W.; Zhao, H. A novel mathematical morphology spectrum entropy based on scale-adaptive techniques.
ISA Trans. 2021, 126, 691–702. [CrossRef]
9. Deng, W.; Li, Z.; Li, X.; Chen, H.; Zhao, H. Compound Fault Diagnosis Using Optimized MCKD and Sparse Representation for
Rolling Bearings. IEEE Trans. Instrum. Meas. 2022, 71, 1–9. [CrossRef]
10. Tian, C.; Jin, T.; Yang, X.; Liu, Q. Reliability analysis of the uncertain heat conduction model. Comput. Math. Appl. 2022, 119,
131–140. [CrossRef]
11. Zhao, H.; Liu, J.; Chen, H.; Chen, J.; Li, Y.; Xu, J.; Deng, W. Intelligent Diagnosis Using Continuous Wavelet Transform and Gauss
Convolutional Deep Belief Network. IEEE Trans. Reliab. 2022, 1–11. [CrossRef]
12. Wei, Y.; Zhou, Y.; Luo, Q.; Deng, W. Optimal reactive power dispatch using an improved slime mould algorithm. Energy Rep.
2021, 7, 8742–8759. [CrossRef]
13. Jin, T.; Xia, H.; Deng, W.; Li, Y.; Chen, H. Uncertain Fractional-Order Multi-Objective Optimization Based on Reliability Analysis
and Application to Fractional-Order Circuit with Caputo Type. Circuits Syst. Signal Process. 2021, 40, 5955–5982. [CrossRef]
14. He, Z.Y.; Shao, H.D.; Wang, P.; Janet, L.; Cheng, J.S.; Yang, Y. Deep transfer multi-wavelet auto-encoder for intelligent fault
diagnosis of gearbox with few target training samples. Knowl.-Based Syst. 2019. [CrossRef]
15. Li, X.; Shao, H.; Lu, S.; Xiang, J.; Cai, B. Highly Efficient Fault Diagnosis of Rotating Machinery Under Time-Varying Speeds
Using LSISMM and Small Infrared Thermal Images. IEEE Trans. Syst. Man Cybern. Syst. 2022, 1–13. [CrossRef]
16. An, Z.; Wang, X.; Li, B.; Xiang, Z.; Zhang, B. Robust visual tracking for UAVs with dynamic feature weight selection. Appl. Intell.
2022, 1–14. [CrossRef]
17. Johnson, S.C. Hierarchical clustering schemes. Psychometrika 1967, 32, 241–254. [CrossRef]
18. Kaufman, L.; Rousseeuw, P.J. Finding Groups in Data: An Introduction to Cluster Analysis; John Wiley & Sons: Hoboken, NJ, USA,
2009; Volume 344.
331
Electronics 2022, 11, 2735
19. Koga, H.; Ishibashi, T.; Watanabe, T. Fast agglomerative hierarchical clustering algorithm using Locality-Sensitive Hashing.
Knowl. Inf. Syst. 2006, 12, 25–53. [CrossRef]
20. Cao, H.; Shao, H.; Zhong, X.; Deng, Q.; Yang, X.; Xuan, J. Unsupervised domain-share CNN for machine fault transfer diagnosis
from steady speeds to time-varying speeds. J. Manuf. Syst. 2021, 62, 186–198. [CrossRef]
21. Deng, W.; Ni, H.; Liu, Y.; Chen, H.; Zhao, H. An adaptive differential evolution algorithm based on belief space and generalized
opposition-based learning for resource allocation. Appl. Soft Comput. 2022, 127, 109419. [CrossRef]
22. Rodrigues, J.; Von Mering, C. HPC-CLUST: Distributed hierarchical clustering for large sets of nucleotide sequences. Bioinformatics
2013, 30, 287–288. [CrossRef]
23. Li, T.; Qian, Z.; Deng, W.; Zhang, D.; Lu, H.; Wang, S. Forecasting crude oil prices based on variational mode decomposition and
random sparse Bayesian learning. Appl. Soft Comput. 2021, 113, 108032. [CrossRef]
24. Cui, H.; Guan, Y.; Chen, H. Rolling Element Fault Diagnosis Based on VMD and Sensitivity MCKD. IEEE Access 2021, 9,
120297–120308. [CrossRef]
25. Bouguettaya, A.; Yu, Q.; Liu, X.; Zhou, X.; Song, A. Efficient agglomerative hierarchical clustering. Expert Syst. Appl. 2014, 42,
2785–2797. [CrossRef]
26. Liu, Q.; Jin, T.; Zhu, M.; Tian, C.; Li, F.; Jiang, D. Uncertain Currency Option Pricing Based on the Fractional Differential Equation
in the Caputo Sense. Fractal Fract. 2022, 6, 407. [CrossRef]
27. Li, G.; Li, Y.; Chen, H.; Deng, W. Fractional-Order Controller for Course-Keeping of Underactuated Surface Vessels Based on
Frequency Domain Specification and Improved Particle Swarm Optimization Algorithm. Appl. Sci. 2022, 12, 3139. [CrossRef]
28. Guha, S.; Rastogi, R.; Shim, K. Cure: An Efficient Clustering Algorithm for Large Databases. Inf. Syst. 1998, 26, 35–58. [CrossRef]
29. Guha, S.; Rastogi, R.; Shim, K. Rock: A robust clustering algorithm for categorical attributes. Inf. Syst. 2000, 25, 345–366.
[CrossRef]
30. Karypis, G.; Han, E.-H.; Kumar, V. Chameleon: Hierarchical clustering using dynamic modeling. Computer 1999, 32, 68–75.
[CrossRef]
31. Gagolewski, M.; Bartoszuk, M.; Cena, A. Genie: A new, fast, and outlier resistant hierarchical clustering algorithm. Inf. Sci. 2017,
363, 8–23. [CrossRef]
32. Zhang, T.; Ramakrishnan, R.; Livny, M. BIRCH: A New Data Clustering Algorithm and Its Applications. Data Min. Knowl. Discov.
1997, 1, 141–182. [CrossRef]
33. Kobren, A.; Monath, N.; Krishnamurthy, A.; McCallum, A. A hierarchical algorithm for extreme clustering. In Proceedings of the
23rd ACM SIGKDD International Conference on Knowledge Discovery and Data Mining, New York, NY, USA, 13–17 August
2017; pp. 255–264.
34. Monath, N.; Kobren, A.; Krishnamurthy, A.; Glass, M.R.; McCallum, A. Scalable hierarchical clustering with tree grafting. In
Proceedings of the 25th ACM SIGKDD International Conference on Knowledge Discovery and Data Mining, New York, NY, USA,
4–8 August 2019; pp. 438–1448.
35. Ester, M.; Kriegel, H.; Sander, J.; Xu, X. A density-based algorithm for discovering clusters in large spatial databases with noise.
In Proceedings of the 2nd International Conference on Knowledge Discovery and Data Mining, Portland, OR, USA, 2–4 August
1996; Volume 34, pp. 226–231.
36. Zhou, D.; Liu, P. VDBSCAN: Variable Density Clustering Algorithm. Comput. Eng. Appl. 2009, 45, 137–141.
37. Zhou, Z.P.; Wang, J.F.; Zhu, S.W.; Sun, Z.W. An Improved Adaptive Fast AF-DBSCAN Clustering Algorithm. J. Intell. Syst. 2016,
11, 93–98.
38. Li, W.; Yan, S.; Jiang, Y.; Zhang, S.; Wang, C. Algorithm research on adaptively determining DBSCAN algorithm parameters.
Comput. Eng. Appl. 2019, 55, 1–7.
39. Wang, G.; Lin, G.Y. Improved adaptive parameter DBSCAN clustering algorithm. Comput. Eng. Appl. 2020, 56, 45–51.
40. Wan, J.; Hu, D.Z.; Jiang, Y. Algorithm research on multi-density adaptive determination of DBSCAN algorithm parameters.
Comput. Eng. Appl. 2022, 58, 78–85.
41. Zadeh, L.A. Fuzzy sets. Inf. Control 1965, 8, 338–353. [CrossRef]
42. Bezdek, J.C.; Ehrlich, R.; Full, W. FCM: The fuzzy c-means clustering algorithm. Comput. Geosci. 1984, 10, 191–203. [CrossRef]
43. Atanassov, K.T. Intuitionistic fuzzy sets. Fuzzy Sets Syst. 1986, 20, 87–96. [CrossRef]
44. Xu, Z.; Wu, J. Intuitionistic fuzzy C-means clustering algorithms. J. Syst. Eng. Electron. 2010, 21, 580–590. [CrossRef]
45. Kumar, D.; Verma, H.; Mehra, A.; Agrawal, R.K. A modified intuitionistic fuzzy c-means clustering approach to segment human
brain MRI image. Multimed. Tools Appl. 2018, 78, 12663–12687. [CrossRef]
46. Danish, Q.M.; Solanki, R.; Pranab, K. Novel adaptive clustering algorithms based on a probabilistic similarity measure over
atanassov intuitionistic fuzzy set. IEEE Trans. Fuzzy Syst. 2018, 26, 3715–3729.
47. Varshney, A.K.; Lohani, Q.D.; Muhuri, P.K. Improved probabilistic intuitionistic fuzzy c-means clustering algorithm: Improved
PIFCM. In Proceedings of the 2020 IEEE International Conference on Fuzzy Systems, Glasgow, UK, 19–24 July 2020; pp. 1–6.
48. Zeshui, X. Intuitionistic fuzzy hierarchical clustering algorithms. J. Syst. Eng. Electron. 2009, 20, 90–97.
49. Aliahmadipour, L.; Eslami, E. GHFHC: Generalized Hesitant Fuzzy Hierarchical Clustering Algorithm. Int. J. Intell. Syst. 2016,
31, 855–871. [CrossRef]
50. Gao, S.H.; Han, Q.; Li, D.; Cheng, M.M.; Peng, P. Representative batch normalization with feature calibration. In Proceedings of
the IEEE/CVF Conference on Computer Vision and Pattern Recognition, Virtual, 19–25 June 2021; pp. 8669–8679.
332
Electronics 2022, 11, 2735
51. Babanezhad, M.; Masoumian, A.; Nakhjiri, A.T.; Marjani, A.; Shirazian, S. Influence of number of membership functions on
prediction of membrane systems using adaptive network based fuzzy inference system (ANFIS). Sci. Rep. 2020, 10, 1–20.
[CrossRef]
52. Kumbure, M.M.; Luukka, P. A generalized fuzzy k-nearest neighbor regression model based on Minkowski distance. Granul.
Comput. 2021, 7, 657–671. [CrossRef]
53. Kongsin, T.; Klongboonjit, S. Machine component clustering with mixing technique of DSM, jaccard distance coefficient and
k-means algorithm. In Proceedings of the 2020 IEEE 7th International Conference on Industrial Engineering and Applications
(ICIEA), Bangkok, Thailand, 16–21 April 2020; pp. 251–255.
54. Karasu, S.; Altan, A. Crude oil time series prediction model based on LSTM network with chaotic Henry gas solubility optimiza-
tion. Energy 2021, 242, 122964. [CrossRef]
55. Karasu, S.; Altan, A.; Bekiros, S.; Ahmad, W. A new forecasting model with wrapper-based feature selection approach using
multi-objective optimization technique for chaotic crude oil time series. Energy 2020, 212, 118750. [CrossRef]
56. Cai, D.; He, X.; Han, J. Document clustering using locality preserving indexing. IEEE Trans. Knowl. Data Eng. 2005, 17, 1624–1637.
[CrossRef]
57. Strehl, A.; Ghosh, J. Cluster Ensembles—A Knowledge Reuse Framework for Combining Multiple Partitions. J. Mach. Learn. Res.
2003, 3, 583–617.
58. Hubert, L.; Arabie, P. Comparing partitions. J. Classif. 1985, 2, 193–218. [CrossRef]
59. Rajab, M.A.; George, L.E. Stamps extraction using local adaptive k-means and ISODATA algorithms. Indones. J. Electr. Eng.
Comput. Sci. 2021, 21, 137–145. [CrossRef]
60. Renigier-Biłozor, M.; Janowski, A.; Walacik, M.; Chmielewska, A. Modern challenges of property market analysis- homogeneous
areas determination. Land Use Policy 2022, 119, 106209. [CrossRef]
333
electronics
Article
An Intelligent Identification Approach Using VMD-CMDE and
PSO-DBN for Bearing Faults
Erbin Yang 1 , Yingchao Wang 2, *, Peng Wang 3 , Zheming Guan 4 and Wu Deng 5, *
1 Guoneng Railway Equipment Co., Ltd., Beijing 100120, China
2 Dalian Locomotive & Rolling Stock Co., Ltd., Dalian 116300, China
3 College of Mechanical Engineering, Dalian Jiaotong University, Dalian 116028, China
4 College of Rolling Stock Engineering, Dalian Jiaotong University, Dalian 116028, China
5 School of Electronic Information and Automation, Civil Aviation University of China, Tianjin 300300, China
* Correspondence: [email protected] (Y.W.); [email protected] (W.D.)
Abstract: In order to improve the fault diagnosis accuracy of bearings, an intelligent fault diagnosis
method based on Variational Mode Decomposition (VMD), Composite Multi-scale Dispersion Entropy
(CMDE), and Deep Belief Network (DBN) with Particle Swarm Optimization (PSO) algorithm—
namely VMD-CMDE-PSO-DBN—is proposed in this paper. The number of modal components
decomposed by VMD is determined by the observation center frequency, reconstructed according to
the kurtosis, and the composite multi-scale dispersion entropy of the reconstructed signal is calculated
to form the training samples and test samples of pattern recognition. Considering that the artificial
setting of DBN node parameters cannot achieve the best recognition rate, PSO is used to optimize
the parameters of DBN model, and the optimized DBN model is used to identify faults. Through
experimental comparison and analysis, we propose that the VMD-CMDE-PSO-DBN method has
certain application value in intelligent fault diagnosis.
Citation: Yang, E.; Wang, Y.; Wang, P.; Keywords: fault diagnosis; variational mode decomposition; composite multi-scale dispersion
Guan, Z.; Deng, W. An Intelligent entropy; particle swarm optimization; deep belief network
Identification Approach Using
VMD-CMDE and PSO-DBN for
Bearing Faults. Electronics 2022, 11,
2582. https://doi.org/10.3390/ 1. Introduction
electronics11162582
Rolling bearing is one of the most commonly used components in rotating machinery.
Academic Editor: George A. Its working state directly affects the performance of the whole equipment and even the
Papakostas safety of the whole production line [1–4]. Therefore, research on intelligent fault diagnosis
technology of rolling bearing has important theoretical value and practical significance in
Received: 18 July 2022
avoiding accidents. The operating conditions of rolling bearing in engineering applications
Accepted: 9 August 2022
are complex and changeable [5–9]. The collected fault vibration signal is easily disturbed
Published: 18 August 2022
by uncontrollable factors, and the subsequent diagnosis and prediction accuracy will also
Publisher’s Note: MDPI stays neutral be reduced [10–14].
with regard to jurisdictional claims in The complex problem of signal noise reduction in practical engineering was studied
published maps and institutional affil- and analyzed by combining with the characteristics of wavelet packet decomposition,
iations. leading to a new signal noise reduction method; experimental results show that the method
has good noise reduction ability [15–18]. A series of analyses on the problem were carried
out, revealing that the initial fault feature information of mechanical equipment is affected
by strong background noise, and verifying the effectiveness of the new denoising method
Copyright: © 2022 by the authors.
of the airspace and neighborhood of wavelet packet transforms [19–22]. In order to solve
Licensee MDPI, Basel, Switzerland.
This article is an open access article
the problem that the measured vibration signal of the discharge structure is interfered with
distributed under the terms and
by noise, the wavelet packet threshold with the optimized empirical mode decomposition
conditions of the Creative Commons was combined, and a new method to eliminate noise interference was proposed [23–28].
Attribution (CC BY) license (https:// On the basis of EMD algorithm, many optimization algorithms with good effects have
creativecommons.org/licenses/by/ been derived, which also have good performance in engineering applications. However,
4.0/). they are all based on EMD in essence, so the mode aliasing problem is difficult to solve.
Electronics 2022, 11, 2582. https://doi.org/10.3390/electronics11162582 https://www.mdpi.com/journal/electronics
335
Electronics 2022, 11, 2582
Konstantin [29] proposed Variational Mode Decomposition (VMD) in 2014; the VMD
method not only has good a signal-to-noise separation effect for non-stationary vibration
signals, but also the decomposition scale can be preset according to the vibration signal itself.
If an appropriate scale can be selected, the occurrence of mode aliasing will be effectively
suppressed. Mostafa et al. [30] proposed a new complexity theory, namely Dispersion
Entropy (DE), for the defects of slow calculation speed and unreasonable measurement
methods of general complexity theory. The entropy of a single scale often cannot show more
complete information in feature extraction, which leads to the final classification not having
ideal results. More signals are analyzed by multi-scale analysis of complexity theory. For
example, Zhang et al. [31] extracted fault features by LMD multi-scale approximate entropy.
Wang et al. [32] calculated the gear signal with the Variational Mode Decomposition (VMD)
method, and selected four modal components after decomposition to calculate permutation
entropy to extract features. Li et al. [33] have significantly improved the fault identification
by combining Empirical Wavelet Transform (EWT) with various algorithms of dispersion
entropy (DE). In 2006, Hinton et al. [34] published a significant paper. In Science, they
told many scholars about the concept of deep learning, and specifically expounded the
Deep Belief Network (DBN), which stimulated people’s enthusiasm for deep learning
theory research and learning. Lei et al. [35] have found that training mechanical vibration
signals of relevant faults through deep learning neural network is more conducive to fault
identification and classification. This paper also points out the advantages of using deep
learning theory for fault diagnosis, which is mainly reflected in breaking the researchers’
dependence on many types of signal processing technology and fault diagnosis experience.
Starting with the statistical characteristics of vibration signals, Shan et al. [36] achieved
the simultaneous identification of different types and degrees of bearing faults, and finally
obtained a high classification accuracy. It was confirmed that the application of DBN in
fault diagnosis has a good effect compared with traditional fault diagnosis. Shi et al. [37],
through experimental verification, found that when pattern recognition is carried out on
gears, the recognition rate of fault features using Particle Swarm Optimization support
vector machine is considerable. Other fault diagnosis methods have also been proposed in
recent years [38–47].
In this paper, the data of the Electrical laboratory of Case Western Reserve University
have been used for experiments. Through the noise reduction method of variational mode
decomposition, the signals of the four states of normal bearing condition, bearing inner ring
fault, rolling body fault, and bearing outer ring fault are decomposed into multiple modal
components. The reconstructed signals preprocessed by variational mode decomposition
were combined with multi-scale permutation entropy, multi-scale dispersion entropy, and
composite multi-scale dispersion entropy, and their method principles were analyzed. The
rolling bearing data were used for simulation, and the eigenvalues of the three methods
were calculated as the input of the classification model. Three kinds of multi-scale entropy
values were used as feature vectors and input into the Deep Belief Network (DBN) model
for fault pattern recognition. In order to solve the problem that it is time consuming to
debug the network layer structure in a deep belief network (DBN) when it is used for
bearing fault diagnosis, a fault identification model of DBN bearing based on Particle
Swarm Optimization (PSO) was proposed. The model uses particle swarm optimization
(PSO) algorithm to find the optimal solution of hidden layer node parameters, and then
compares the function between DBN model and PSO-DBN model and draws a conclusion.
2. Composite Multi-Scale Dispersion Entropy Based on VMD
2.1. Variational Mode Decomposition Algorithm
The essence of the VMD decomposition method is related to selecting the number of
components (parameter K) to decompose the original signal f (t) into a corresponding
number of sub-signal components uk ; these decomposed modal components can ensure
the sparsity and reproduce the input signal. In short, the Gaussian smoothing of demodu-
336
Electronics 2022, 11, 2582
lated signal is used to estimate the bandwidth, and then the constraints are divided into
the following:
⎧ ⎫
⎨ ⎬
min ∑
{ u k },{ ω k } ⎩
j −
||∂t δ(t) + πt ∗ uk (t) e k 2 , s.t.
jw t 2
⎭
uk = f (1) ∑
k k
Most of the optimal solutions of constrained models are solved by alternative direction
method of multipliers (ADMM), alternately updating unk +1 , ωkn+1 , and λn+1 to look for a
Lagrangian augmented
' ( ' “saddle
( point”; the specific steps are as follows:
Initialize ulk , ωkl , λ ; n ← O ; make n ← n + 1 for k = 1 : K to update Uk :
λ(ω.)
f ( ω ) − ∑i =k u ( ω ) +
ûkn+1 (ω ) = 2
(2)
1 + 2α(ω − ωk )2
For all ω ≥ 0, update ûk ; the formula is as follows:
λ̂n (ω )
fˆ(ω ) − ∑i<k ûin+1 (ω ) − ∑i>k ûin (ω ) +
ûkn+1 (ω ) ← 2
2
, k ∈ {1, K } (3)
1 + 2α ω − ωkn
Update ωk :
⎛ ∧ ⎞
λ̂ n +1
(ω ) ← λ̂ (ω ) + τ ⎝ fˆ(ω ) −
n
∑k
ukn+1 (ω )⎠ (4)
Repeat (3)~(4) until the following iterative conditions are met:
∧
∑ u n+1
k
∧ n
− u k
22 /ûnk 22 < ε (5)
k
Usually, the ukn+1 problem is transformed into the minimum problem; the same is true
for the solution of center frequency ωkn+1 :
/! " 0 1
∂
2
j
ωkn+1 = argmin t δ(t) + ∗ uk (t) e− jωk t (6)
ωk πt 2
2.2. Composite Multi-Scale Dispersion Entropy
2.2.1. Dispersion Entropy Algorithm
Dispersion Entropy (DE) is an index to measure the complexity of a time series. When
it was first proposed, it was mostly applied in the field of biology. The main construction
steps and descriptions of DE are described as follows [30]:
Supposing a time series x = { xi , i = 1, 2, · · · , N
} of length N, the normal
distribu-
tion Function (7) is used to map time series x to y = y j , j = 1, 2, · · · , N , y j ∈ (0, 1).
2 x −(t−μ)2
1 i
yj = √ e 2σ2 dt (7)
σ 2π −∞
where μ is mathematical expectation and σ2 is variance.
The linear transformation is performed using Formula (8), mapping y to the range of
[1, 2, . . . , c]:
zcj = R c · y j + 0.5 (8)
where R is an integral function and c is the number of categories.
337
Electronics 2022, 11, 2582
Calculating the embedded vector zim,c is as follows:
' (
zim,c = zic , zic+d , · · · , zic+(m−1)d , i = 1, 2, . . . , N − (m − 1)d (9)
where m is an embedded dimension and d is time delay.
Calculating the probability p πvv v1 ···vm−1 of πv0 v1 ···vm−1 for each dispersion mode is
as follows:
Number πv0 η1 ···vm−1
p πv0 v1 ···vm−1 = (10)
N − ( m − 1) d
where Number πv0 v1 ···vm−1 represents the number of maps zim,c to πv0 v1 ···vm−1 .
The DE value of the original signal x is
cm
DE( x, m, c, d) = − ∑π = 1 p πv0 v1 ···vm−1 ln p πv0 v1 ···vm−1 (11)
2.2.2. Composite Multi-Scale Dispersion Entropy
The calculation method of composite multi-scale dispersion entropy involves optimiz-
ing the multi-scale process on the basis of multi-scale dispersion entropy; the steps and
instructions are as follows:
For an initial time series {u(i ), i = 1, '
2, · · · , L}, when
( the time is in the k-th coarsening
(τ ) (τ )
sequence and the scale factor is τ, xkτ = xk,1 , xk,2 , . . . can be given by Formula (12):
τ 1 k + jτ −1
xk,j =
τ ∑i = k+τ( j−1) ui , 1 ≤ j ≤ L/τ (12)
where 1 ≤ k ≤ τ.
The CMDE under each scale factor is defined as
1 τ
CMDE( X, m, c, d, τ ) =
τ ∑k = 1 DE(xkτ , m, c, d) (13)
2.3. Fault Eigenvalue Based on VMD Composite Multi-Scale Entropy
In this paper, the experimental data of the bearing data center of Case Western Reserve
University are selected for the simulation test, and the selection of important parameters
is compared and analyzed. The specific data of bearing are as follows: the acquisition
frequency is 12,000 Hz; the motor speed is 1797 r/min; and four vibration signals are
included, namely an inner ring (IR) fault, outer ring (OR) fault, rolling element (BE) fault,
and a local single-point pitting normal state (Norm).
2.3.1. The Process of Fault Eigenvalue Calculation
The specific steps of VMD composite multi-scale dispersion entropy are as follows:
Step 1: Firstly, the original vibration signals (inner and outer ring fault signals, roller
fault signals, and normal signals) in the four bearing databases are decomposed and
preprocessed by VMD.
Step 2: The kurtosis of the decomposed modal components is calculated and sorted.
Step 3: The first three modal components are selected for signal reconstruction.
Step 4: The composite multi-scale dispersion entropy of the reconstructed four signals
is calculated.
2.3.2. Simulation Signal Analysis
In this paper, a vibration signal with a motor speed of 1797r/min in the bearing exper-
iment database of Western Reserve University is decomposed by VMD, where determining
the value of modal component K is the primary task. For example, the center frequency
of the modal component of the outer ring fault signal is simulated. The value of K in the
simulation diagram is reflected in the number of curves in the center frequency diagram of
the modal component, and its value is determined by observing the convergence trend of
338
Electronics 2022, 11, 2582
the curve. Selecting K = 4, K = 5, and K = 6, the corresponding center frequency curves are
described as follows.
The abscissa in the figure represents the number of iterations, and the ordinate repre-
sents the center frequency. The four curves represent the central frequency convergence
process of the four modal components, respectively. When K = 4, as shown in Figure 1, the
four curves do not overlap, which proves that there is no mode mixing. There are occasional
fluctuations in the previous iteration, and the convergence is fast. When the number of
components K is 5, the relationship between the center frequency of the modal component
and the iteration parameters is as shown in Figure 2. With the increase in the number of
abscissa iterations, the center frequencies corresponding to the five modal components
converge smoothly and fluctuate less, and there is no curve intersection. When the number
of decomposition K = 6 is selected and the same vibration signal is decomposed, the central
frequency convergence process of the modal component is as shown in Figures 3 and 4. The
abscissa in the figure represents the number of iterations, and the ordinate represents the
center frequency. From the curves corresponding to the six modal components, it is obvious
that the third, fourth, and fifth curves also correspond to the intersection of the third, fourth,
and fifth order modal components, respectively. This proves that there is modal mixing
between modal components, and the convergence speed is slow. In summary, in the VMD
decomposition preprocessing of this kind of bearing vibration signal, the preset value of
the modal component is 5, which is more effective for the signal decomposition effect and
helpful for the next feature extraction.
Figure 1. Center frequency of the modal component K = 4.
Figure 2. Center frequency of the modal component K = 5.
339
Electronics 2022, 11, 2582
Figure 3. Center frequency of the modal component K = 6.
Figure 4. VMD-CMDE at τ = 8.
From the calculation formulas of multi-scale dispersion entropy and composite multi-
scale dispersion entropy, it can be seen that five parameters need to be selected. They are
the length N of the sequence, the embedding dimension m, the number of categories c,
the time delay d and the scale factor τ. In this paper, the length n = 1024, the embedding
dimension m = 3, the number of categories c = 6, the time delay d = 1, and the scale factor
are selected through simulation analysis. Figures 4–6 show a random point entropy curve
corresponding to scale factors 8, 10, and 12, respectively.
340
Electronics 2022, 11, 2582
Figure 5. VMD-CMDE at τ = 10.
Figure 6. VMD-CMDE at τ = 12.
The abscissa in the figure is the number of scale factors, and the ordinate is the
composite multi-scale dispersion entropy. Since the selection of basic theory and parameters
and the multi-scale dispersion entropy are roughly the same, the curves are roughly the
same as a whole. Except for the normal signals, the overall trend of the vibration signals of
the other three faults is to decline first and then flatten. During the change of scale factors
from 1 to 4, except when they are in the upward trend under normal conditions, the other
three fault signals are in the downward trend, and the downward trend is obvious from
the instantaneous change rate. When the scale factor ranges from 4 to 8, the overall decline
is relatively gentle, with occasional fluctuations, and the decline of the inner ring fault is
341
Electronics 2022, 11, 2582
more obvious. When the scale factor ranges from 8 to 10, the decline is gentle, and the
entropy of the fault signal is slowly approaching. The reason why the normal situation
is different from the three fault signals is that there is no periodic vibration similar to the
fault signal. When the scale factor ranges from 10 to 12, the entropy of the fault signal has a
tendency to coincide, and the CMDE value does not change much, but the simulation time
is longer with the increase of parameters.
Combined with the above simulation and analysis of the CMDE of the four pre-
processed vibration signals, when the scale factor is 10, it can not only ensure that the
deep-seated information of the vibration signal is extracted, but also ensure that the time
will not be consumed too much. Therefore, the composite multi-scale dispersion entropy
scale factor in this paper is 10.
3. Fault Identification Model Based on PSO-DBN
3.1. DBN Network Structure
As one of the typical deep learning algorithms, the Deep Belief Network (DBN) has
good development prospects in the field of fault identification. The Deep Belief Network
(DBN) is a probabilistic artificial neural network with multiple hidden layers, constructed
by stacking multiple Restricted Boltzmann Machines (RBMs). By looking at the Restricted
Boltzmann Machine architecture, we can obtain the associated functions as follows:
n m n m
E(v, h | θ ) = − ∑i = 1 ai vi − ∑ j = 1 bi hi − ∑i = 1 ∑ j = 1 vi Wij h j (14)
where
θ—node parameters of Restricted Boltzmann Machine and θ = Wij , ai , b j are all real num-
bers;
ai —offset coefficient of visible unit i;
Wij —weight values of hidden unit j and visible unit i;
b j —offset coefficient of hidden unit j.
When these parameters are constant, based on this function, the joint probability
distribution can be obtained, as shown in Formula (15):
e− E(v,h|θ )
P(v, h | θ ) =
Z (θ )
, Z (θ ) = ∑v,h e−E(v,h|θ) (15)
where
Z (θ )—partition function (Normalization factor);
ai , bi —offset coefficient;
h j , vi —state variables for hidden and visible units;
Wij —hidden and visible unit weights.
In this energy function, it can be seen from the special structure that there is a connec-
tion between the layers of RBM and there is no connection between nodes in layers and
star lakes. When the state of the hidden layer is known, the activation states for different
visible units are conditionally independent. The probability of visible node activation is
shown in Formula (16):
P(vi = 1 | h, θ ) = σ ( ai + ∑ j Wji h j ) (16)
Similarly, the activation probability of the hidden unit is
P h j = 1 | v, θ = σ(b j + ∑i vi Wij ) (17)
where σ( x ) = 1+exp1 (− x) is the Sigmoid activation function. The complete Deep Belief
Network structure is shown in Figure 7.
342
Electronics 2022, 11, 2582
Figure 7. DBN model.
3.2. PSO-Optimized DBN Model
The particle swarm optimization algorithm is the same as many algorithms; that
is, after the system initialization, it starts to iterate through a group of solutions, and
constantly looks for the optimal solution in the iterative process. Particles (potential
solutions) will follow the best particles in space to explore, so the number of iterations
required to reach the best solution is relatively small. In the engineering application
in the field of bearing diagnosis, particle swarm optimization can be easily employed
because of its simple principle, strong universality, and strong anti-interference. Moreover,
the algorithm supports group search and takes a short time. Combined with the above
advantages, this paper selects the PSO optimization algorithm to improve the DBN model.
Bengio [48] has performed many experiments to illustrate a problem: the application
effect of a multi-layer deep confidence network is often higher than that of a single layer.
Larochelle and others [49] have proven through many tests that when the hidden layer
of the deep confidence network model is about three layers, the classification accuracy
reaches the highest value. Before the number of layers reaches four, the recognition rate is
directly proportional to the increase in the number of hidden layers. When the number of
hidden layers reaches four or more, the classification accuracy of the model will decline.
This paper selects three hidden layers, corresponding to m1 , m2 , m3 neurons. N represents
the number of particles, which generally ranges from 10 to 20. In this paper, the number of
particles is 10. The maximum iteration number of particle swarm optimization is M. This
paper takes 20. The process of the PSO-optimized DBN model is shown in Figure 8.
343
Electronics 2022, 11, 2582
Figure 8. General flow chart of PSO-optimized DBN model.
The specific steps are as follows:
Step 1: Preprocess the original vibration signal of the bearing of Western Reserve
University. Because the time and accuracy of training the original vibration signal are
directly greatly affected, VMD decomposition is needed to reconstruct the signal according
to kurtosis.
344
Electronics 2022, 11, 2582
Step 2: In order to improve the accuracy of fault identification, the decomposed and
reconstructed signals are combined with multi-scale arrangement entropy, multi-scale dis-
persion entropy, and composite multi-scale dispersion entropy to construct feature vectors.
Step 3: For the test data of four states, 100 samples are taken for each state, and a total
of 400 samples are obtained. The fault feature set is P; the 100 samples of each signal in the
obtained feature set are randomly divided into 70 training sets, recorded as P1, and 30 test
sample sets, recorded as P.
Step 4: Initialize particle swarm velocity Vik = 0 ; initialize the position of the particle
swarm Xik = 0 .
Step 5: Calculate the classification error rate of all particles, and find the optimal parti-
cles of this round of particle swarm, including the optimal particles that have completed
the search before.
Step 6: The velocity and position of each particle are updated by Formulas (18) and (19).
X kI +1 = Xik + Vik+1 (18)
Vik+1 = ωVik + c1 r1 Xiphest
k
− Xik + c2 r2 Xighest
k
− Xik (19)
where
ω—inertia weight;
c1 , c2 —acceleration parameters;
r1 , r2 —random value.
Among them, the value range of inertia weight is generally between 0 and 1, and
ω = 0.7 is taken in this paper. The acceleration parameters generally range from 0 to 4. Shi
et al. have done many tests; it was found that the selection of this parameter will affect the
optimization results. In order to make the results not too disturbed by external factors and
make the two acceleration parameters equal and have the best effect, parameter c1 = c2 = 2
is selected in this paper. Random values generally range from 0 to 1.
Step 7: One of two conditions needs to be met when PSO ends optimization. One is
that the classification error rate of experimental data is lower than the pre-set value, or the
number of iterations reaches the preset value. If one of the two meets, it can be stopped.
Otherwise, go to step 5, increase the number of iterations, and repeat step 6 and step 7 until
the discrimination conditions are met.
Step 8: The optimized parameters are substituted into the original DBN model, and
the rolling bearing fault classification results are obtained by retraining and retesting the
data samples.
4. Experimental Verification
The optimized DBN is applied to the experiment to analyze the data and construct the
classifier. Aiming at the problem of rolling bearing fault pattern recognition proposed in
this paper, the specific experimental steps and instructions are as follows:
Step 1: For the experimental data of four states, take 100 samples at random, with a
total of 400 samples. Calculate the eigenvalues according to the VMD-CMDE composition
method, combine them into the eigenvector set, and record them as the fault feature P.
A total of 70 groups of eigenvalues are randomly selected from P as the training set and
recorded as P1. The remaining 30 sets of eigenvalues are divided into test sets, namely P2.
Step2: Input P1 into DBN for training. In order to more comprehensively verify the
reliability of the rolling bearing fault identification model, this paper selects the rolling
bearing data of 1797r/min speed for research. Different bearing fault types are replaced by
different numbers, as shown in Table 1. Here, 1 represents inner ring fault, 2 represents
roller ring fault, 3 represents outer ring fault, and 4 represents normal condition.
345
Electronics 2022, 11, 2582
Table 1. Description of bearing pattern recognition dataset.
Training Sample Test Sample
Bearing Status Categorization Label
Numbers Numbers
Inner ring fault 70 30 1
Roller ring fault 70 30 2
Outer ring fault 70 30 3
Normal signal 70 30 4
Here, the experimental results of the DBN model input by the composite multi-scale
scattered entropy eigenvector obtained after the decomposition of the original signal are
analyzed. As shown in Figure 9, the recognition rate of each fault type of rolling bearing can
be seen. According to the different numbers marked in this paper, they represent different
fault types. Number 1 corresponds to the inner ring fault signal, and the recognition
rate is 90%. Number 3 represents the outer ring fault signal, and the recognition rate is
100%. Number 2 corresponds to the roller fault signal, and the recognition rate is 73.33%.
Number 4 corresponds to the normal bearing signal, and the recognition rate is 100%. After
calculation, the overall recognition accuracy reaches 90.33%.
Figure 9. VMD-CMDE-DBN fault recognition rate.
Among them, 27 groups were correctly identified by 30 groups of bearing with inner
ring fault, 22 groups were correctly identified by 30 groups of roller fault, 30 groups were
correctly identified by 30 groups of bearing with outer ring fault, and 30 groups were
correctly identified by 30 groups of bearing under normal conditions. Compared with
the previous two models, the overall recognition rate of this group can reach 90.33%, and
the roller fault recognition rate has also been greatly improved, but there is still room for
improvement. Based on this data, Table 2 is established.
Table 2. Accuracy rate of DBN model with VMD-CMDE as input.
Bearing Status Total Number of Test Set Samples Correct Number Accuracy
Inner ring fault 30 27 90%
Roller ring fault 30 22 73.3%
Outer ring fault 30 30 100%
Normal condition 30 30 100%
Whole bearing 120 109 90.33%
346
Electronics 2022, 11, 2582
The key parameters of the VMD-CMDE-DBN model are optimized by the particle
swarm optimization algorithm to obtain the VMD-CMDE-PSO-DBN model. Through the
analysis of the experimental results of the optimized DBN model input by the composite
multi-scale dispersion entropy eigenvector obtained after the decomposition of the original
signal, as shown in Figure 10, we can see the recognition rate of each fault type of rolling
bearing. According to the different numbers marked in this paper, they represent different
fault types. Numbers 1, 2, 3, and 4 correspond to inner ring fault signal, roller fault signal,
outer ring fault signal, and normal bearing signal, respectively.
Figure 10. VMD-CMDE-PSO-DBN fault recognition rate.
According to this data, Table 3 is established. From Table 3, we can clearly see the
identification number of each fault type; among them, 30 groups of bearing with inner ring
fault are correctly identified, 30 groups of roller fault are correctly identified, 30 groups
of bearing with outer ring fault are correctly identified, and 30 groups of bearing under
normal conditions are correctly identified.
Table 3. PSO-DBN model accuracy with VMD-CMDE as input.
Bearing Status Total Number of Test Set Samples Correct Number Accuracy
Inner ring fault 30 30 100%
Roller ring fault 30 30 100%
Outer ring fault 30 30 100%
Normal condition 30 30 100%
Whole bearing 120 120 100%
In order to fully prove the effectiveness of VMD-CMDE-PSO-DBN fault identification
model, Multi-scale Permutation Entropy (MPE) and Multi-scale Dispersion Entropy (MDE)
are substituted into the DBN model and optimized model in this paper. Observing and
compare the recognition rate, the number of samples in the training set and the test set is
the same as above; the recognition rate data input into the DBN model is shown in Table 4.
The number of nodes after particle swarm optimization is substituted into the three
models, and the same eigenvalues of the three entropy are used as the input of particle
swarm optimization DBN model. The recognition rate data are shown in Table 5.
347
Electronics 2022, 11, 2582
Table 4. DBN model accuracy.
Bearing Status VMD-MPE VMD-MDE VMD-CMDE
Inner ring fault 100% 100% 90%
Roller ring fault 43.33% 33.33% 73.33%
Outer ring fault 70% 100% 100%
Normal condition 100% 100% 100%
Whole bearing 78.33% 88.33% 90.33%
Table 5. PSO-DBN model accuracy.
Bearing Status VMD-MPE VMD-MDE VMD-CMDE
Inner ring fault 96.67% 100% 100%
Roller ring fault 96.67% 93.33% 100%
Outer ring fault 100% 100% 100%
Normal condition 100% 100% 100%
Whole bearing 98.33% 98.33% 100%
5. The Result Discussion
A total of 70 sets of multi-scale entropy eigenvalues of rolling bearing fault signals
were substituted into the DBN model for recognition training. The DBN model was
tested with 30 groups of test set data. Through the test, the experimental results show
that the recognition accuracy of multi-scale arrangement entropy and DBN is 78.33%,
the recognition accuracy of multi-scale dispersion entropy and DBN is 83.33%, and the
recognition accuracy of composite multi-scale dispersion entropy and DBN is 90.33%. Each
model is not particularly ideal in roller fault recognition. The experimental results show
that the recognition accuracy of multi-scale arrangement entropy and optimized DBN is
98.33%, the recognition accuracy of multi-scale dispersion entropy and optimized DBN
is 98.33%, and the recognition accuracy of composite multi-scale dispersion entropy and
optimized DBN is 100%. Compared vertically, the PSO-DBN classification effect of the
DBN model after optimizing parameters by the particle swarm optimization algorithm has
been improved in different multi-scale entropy. Compared horizontally, the classification
effect of the PSO-DBN model with different multi-scale entropy eigenvectors as input has
also been significantly improved. Especially in the identification of roller fault, the three
models have been greatly improved.
Through theoretical proof and experimental verification, the combination of VMD,
CMDE, DBN, and PSO algorithm is very effective in rolling bearing fault diagnosis and
identification. The main conclusions are as follows:
The rolling bearing fault recognition model is established; the eigenvectors are substi-
tuted into the DBN and PSO-DBN models, trained and tested; and the final experimental
results are obtained. By comparing the recognition accuracy of DBN and PSO-DBN, it can
be concluded that the PSO-DBN model has a higher recognition rate than the DBN model.
Overall, the recognition rate based on VMD-CMDE-PSO-DBN is the best, which provides
new insight for signal pattern recognition.
6. Conclusions
In this paper, an intelligent fault diagnosis method based on Variational Mode De-
composition (VMD), Composite Multi-scale Dispersion Entropy (CMDE), and Deep Belief
Network (DBN) with Particle Swarm Optimization (PSO) algorithm—namely VMD-CMDE-
PSO-DBN—is proposed. The decomposed number of modal components of VMD is deter-
mined by the observation center frequency, reconstructed according to the kurtosis, and
the composite multi-scale dispersion entropy of the reconstructed signal is calculated to
form the training samples and test samples of pattern recognition.
• The experimental data used in this paper are manually added faults, which may
not fully reflect the diversified faults of rolling bearings, single fault forms, and low
348
Electronics 2022, 11, 2582
bearing speed. Under actual working conditions, bearings are mostly in high-speed
operation and the fault forms are complex, so the next step should be to focus on the
high-speed operation of rolling bearings and the composite fault state.
• VMD multi-scale permutation entropy eigenvector, VMD multi-scale dispersion en-
tropy eigenvector, and VMD composite multi-scale dispersion entropy eigenvector is
used as the inputs of the Deep Belief Network classification model. The accuracy of
VMD decomposition composite multi-scale dispersion entropy is the best.
Author Contributions: Conceptualization, Z.G.; methodology, E.Y. and Y.W.; writing—original draft
preparation, E.Y.; writing—review and editing, P.W. and W.D.; Resources, W.D.; software, P.W. and
Z.G.; validation, E.Y., Y.W., P.W. and Z.G. All authors have read and agreed to the published version
of the manuscript.
Funding: This research was funded by the Department of Education Foundation of Liaoning
Province under grant JDL2020013, the Natural Science Foundation of Liaoning Province under
grant 2019ZD0112, and the National Natural Science Foundation of China under grant 62001079,
the Research Foundation for Civil Aviation University of China under Grant 3122022PT02 and
2020KYQD123.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: All data, models, and code generated or used during the study appear
in the submitted article.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. He, Z.; Shao, H.; Wang, P.; Lin, J.; Cheng, J. Deep transfer multi-wavelet auto-encoder for intelligent fault diagnosis of gearbox
with few target training samples. Knowl. Based Syst. 2020, 191, 105313. [CrossRef]
2. Li, X.; Zhao, H.; Yu, L.; Chen, H.; Deng, W.; Deng, W. Feature extraction using parameterized multisynchrosqueezing transform.
IEEE Sens. J. 2022, 2, 14263–14272. [CrossRef]
3. Xu, G.; Bai, H.; Xing, J.; Luo, T.; Xiong, N.N. SG-PBFT: A secure and highly efficient distributed blockchain PBFT consensus
algorithm for intelligent Internet of vehicles. J. Parallel Distrib. Comput. 2022, 164, 1–11. [CrossRef]
4. Zheng, J.J.; Yuan, Y.; Zou, L.; Deng, W.; Guo, C.; Zhao, H. Study on a novel fault diagnosis method based on VMD and BLM.
Symmetry 2019, 11, 747. [CrossRef]
5. Wu, D.; Wu, C. Research on the Time-Dependent Split Delivery Green Vehicle Routing Problem for Fresh Agricultural Products
with Multiple Time Windows. Agriculture 2022, 12, 793. [CrossRef]
6. Zhou, X.B.; Ma, H.J.; Gu, J.G.; Chen, H.L.; Deng, W. Parameter adaptation-based ant colony optimization with dynamic hybrid
mechanism. Eng. Appl. Artif. Intell. 2022, 114, 105139. [CrossRef]
7. Wu, X.; Wang, Z.C.; Wu, T.H.; Bao, X.G. Solving the family traveling salesperson problem in the adleman–lipton model based on
DNA computing. IEEE Trans. NanoBioscience 2021, 21, 75–85. [CrossRef]
8. Li, X.; Shao, H.; Lu, S.; Xiang, J.; Cai, B. Highly-efficient fault diagnosis of rotating machinery under time-varying speeds using
LSISMM and small infrared thermal images. IEEE Trans. Syst. Man Cybern. Syst. 2022, 50, 1–13. [CrossRef]
9. An, Z.; Wang, X.; Li, B.; Xiang, Z.L.; Zhang, B. Robust visual tracking for UAVs with dynamic feature weight selection. Appl.
Intell. 2022. [CrossRef]
10. Cao, H.; Shao, H.; Zhong, X.; Deng, Q.; Yang, X.; Xuan, J. Unsupervised domain-share CNN for machine fault transfer diagnosis
from steady speeds to time-varying speeds. J. Manuf. Syst. 2022, 62, 186–198. [CrossRef]
11. Li, T.Y.; Shi, J.Y.; Deng, W.; Hu, Z.D. Pyramid particle swarm optimization with novel strategies of competition and cooperation.
Appl. Soft Comput. 2022, 121, 108731. [CrossRef]
12. Deng, W.; Xu, J.; Gao, X.; Zhao, H. An enhanced MSIQDE algorithm with novel multiple strategies for global optimization
problems. IEEE Trans. Syst. Man Cybern. Syst. 2022, 52, 1578–1587. [CrossRef]
13. Chen, H.Y.; Miao, F.; Chen, Y.J.; Xiong, Y.J.; Chen, T. A hyperspectral image classification method using multifeature vectors and
optimized KELM. IEEE J. Sel. Top. Appl. Earth Obs. Remote Sens. 2021, 14, 2781–2795. [CrossRef]
14. Yao, R.; Guo, C.; Deng, W.; Zhao, H.M. A novel mathematical morphology spectrum entropy based on scale-adaptive techniques.
ISA Trans. 2022, 126, 691–702. [CrossRef]
15. Deng, W.; Li, Z.; Li, X.; Chen, H.; Zhao, H. Compound fault diagnosis using optimized MCKD and sparse representation for
rolling bearings. IEEE Trans. Instrum. Meas. 2022, 71, 3508509. [CrossRef]
349
Electronics 2022, 11, 2582
16. Tian, C.; Jin, T.; Yang, X.; Liu, Q. Reliability analysis of the uncertain heat conduction model. Comput. Math. Appl. 2022, 119,
131–140. [CrossRef]
17. Zhao, H.M.; Liu, J.; Chen, H.Y.; Chen, J.; Li, Y.; Xu, J.J.; Deng, W. Intelligent diagnosis using continuous wavelet transform and
gauss convolutional deep belief network. IEEE Trans. Reliab. 2022, 1–11. [CrossRef]
18. Zhou, Y.; Zhang, J.; Yang, X.; Ling, Y. Optimal reactive power dispatch using water wave optimization algorithm. Oper. Res. 2020,
20, 2537–2553. [CrossRef]
19. Cui, H.; Guan, Y.; Chen, H. Rolling element fault diagnosis based on VMD and sensitivity MCKD. IEEE Access 2021, 9,
120297–120308. [CrossRef]
20. Xu, Y.; Chen, H.; Luo, J.; Zhang, Q.; Jiao, S.; Zhang, X. Enhanced Moth-flame optimizer with mutation strategy for global
optimization. Inf. Sci. 2019, 492, 181–203. [CrossRef]
21. Liu, Q.; Jin, T.; Zhu, M.; Tian, C.; Li, F.; Jiang, D. Uncertain currency option pricing based on the fractional differential equation in
the Caputo sense. Fractal Fract. 2022, 6, 407. [CrossRef]
22. Li, G.; Li, Y.; Chen, H.; Deng, W. Fractional-order controller for course-keeping of underactuated surface vessels based on
frequency domain specification and improved particle swarm optimization algorithm. Appl. Sci. 2022, 12, 3139. [CrossRef]
23. Wei, Y.Y.; Zhou, Y.Q.; Luo, Q.F.; Deng, W. Optimal reactive power dispatch using an improved slime Mould algorithm. Energy
Rep. 2021, 7, 8742–8759. [CrossRef]
24. Jin, T.; Xia, H.; Deng, W.; Li, Y.; Chen, H. Uncertain fractional-order multi-objective optimization based on reliability analysis and
application to fractional-order circuit with Caputo type. Circ. Syst. Signal Pract. 2021, 40, 5955–5982. [CrossRef]
25. Xu, G.; Dong, W.; Xing, J.; Lei, W.; Liu, J. Delay-CJ: A novel cryptojacking covert attack method based on delayed strategy and its
detection. Digit. Commun. Netw. 2022. [CrossRef]
26. Wu, E.Q.; Zhou, M.; Hu, D.; Zhu, L.; Tang, Z. Self-paced dynamic infinite mixture model for fatigue evaluation of pilots’ brains.
IEEE Trans. Cybern. 2022, 52, 5623–5638. [CrossRef]
27. Jiang, M.; Yang, H. Secure outsourcing algorithm of BTC feature extraction in cloud computing. IEEE Access 2020, 8,
106958–106967. [CrossRef]
28. Deng, W.; Ni, H.C.; Liu, Y.; Chen, H.L.; Zhao, H.M. An adaptive differential evolution algorithm based on belief space and
generalized opposition-based learning for resource allocation. Appl. Soft Comput. 2022. [CrossRef]
29. Zosso, D.; Dragomiretskiy, K. Variational mode decomposition. In IEEE Transactions on Signal Processing: A Publication of the IEEE
Signal Processing Society; IEEE: Piscataway, NJ, USA, 2014.
30. Rostaghi, M.; Azami, H. Dispersion Entropy: A measure for time series analysis. IEEE Signal Process. Lett. 2016, 23, 610–614. [CrossRef]
31. Zhang, S.; Sun, G.; Li, L.; Li, X.; Jian, X. Study on mechanical fault diagnosis method based on LMD approximate entropy and
fuzzy C-means clustering. Chin. J. Sci. Instrum. 2013, 34, 714–720.
32. Wang, J.; Shuai, C.; Chao, Z. Fault diagnosis method of gear based on VMD and multi-feature fusion. J. Mech. Transm. 2017, 3, 032.
33. Li, C. Research on Rolling Bearing Fault Diagnosis Method Based on Empirical Wavelet Transform and Scattered Entropy; Anhui University
of Technology: Anhui, China, 2019.
34. Hinton, G.; Osindero, S.; Teh, Y. A fast learning algorithm for deep belief nets. Neura I Comput. 2006, 18, 1527–1554. [CrossRef] [PubMed]
35. Lei, Y.; Jia, F.; Zhou, X.; Lin, J. A Deep learning-based method for machinery health monitoring with big data. J. Mech. Eng. 2015,
51, 49–56. [CrossRef]
36. Li, W.; Shan, W.; Xu, Z.; Zeng, X. Bearing fault classification and recognition based on deep belief network. J. Vib. Eng. 2015, 29, 152–159.
37. Shi, P.; Liang, K.; Zhao, N. Gear intelligent fault diagnosis based on deep learning feature extraction and particle swarm support
vector machine state recognition. China Mech. Eng. 2017, 28, 1056–1061.
38. Wang, W.; Carr, M.; Xu, W.; Kobbacy, K. A model for residual life prediction based on Brownian motion with an adaptive drift.
Microelectron. Reliab. 2010, 51, 285–293. [CrossRef]
39. Sun, L.; Tang, X.G.; Zhang, X.H. Study of gearbox residual life prediction based on stochastic filtering model. Mech. Transm. 2011,
35, 56–60.
40. Deng, W.; Liu, H.; Xu, J.; Zhao, H.; Song, Y. An improved quantum-inspired differential evolution algorithm for deep belief
network. IEEE Trans. Instrum. Meas. 2020, 69, 7319–7327. [CrossRef]
41. Zhao, H.; Liu, H.; Xu, J.; Guo, C.; Deng, W. Research on a fault diagnosis method of rolling bearings using variation mode
decomposition and deep belief network. J. Mech. Sci. Technol. 2019, 33, 4165–4172. [CrossRef]
42. Li, T.; Qian, Z.; Deng, W.; Zhang, D.; Lu, H.; Wang, S. Forecasting crude oil prices based on variational mode decomposition and
random sparse Bayesian learning. Appl. Soft Comput. 2021, 113PB, 108032. [CrossRef]
43. Pan, Y.; Chen, J.; Guo, L. Robust bearing performance degradation assessment method based on improved wavelet packet–support
vector data description. Mech. Syst. Signal. Process. 2009, 23, 669–681. [CrossRef]
44. Dong, S.; Luo, T. Bearing degradation process prediction based on the PCA and optimized LS-SVM model. Measurement 2013, 46,
3143–3152. [CrossRef]
45. Xue, X.H. Evaluation of concrete compressive strength based on an improved PSO-LSSVM model. Comput. Concr. Int. J.
2018, 21, 505–511.
46. He, Q. Vibration signal classification by wavelet packet energy flow manifold learning. J. Sound Vib. 2013, 332, 1881–1894. [CrossRef]
47. Ishaque, K.; Salam, Z.; Amjad, M.; Mekhilef, S. An improved particle swarm optimization (PSO)–Based MPPT for PV with
reduced steady-state oscillation. IEEE Trans. Power Electron. 2012, 27, 3627–3638. [CrossRef]
350
Electronics 2022, 11, 2582
48. Roux, N.L.; Bengio, Y. Representational Power of Restricted Boltzmann Machines and Deep Belief Networks. Neural Comput.
2008, 20, 1631–1649. [CrossRef]
49. Larochelle, H.; Bengio, Y.; Louradour, J.; Lamblin, P. Exploring Strategies for Training Deep Neural Networks. J. Mach. Learn. Res.
2009, 1, 1–40.
351
electronics
Article
Improved LS-SVM Method for Flight Data Fitting of Civil
Aircraft Flying at High Plateau
Nongtian Chen 1,2 , Youchao Sun 1, *, Zongpeng Wang 1 and Chong Peng 1
1 College of Civil Aviation, Nanjing University of Aeronautics and Astronautics, Nanjing 211100, China;
[email protected] (N.C.); [email protected] (Z.W.); [email protected] (C.P.)
2 College of Aviation Engineering, Civil Aviation Flight University of China, Guanghan 618307, China
* Correspondence: [email protected]
Abstract: High-plateau flight safety is an important research hotspot in the field of civil aviation
transportation safety science. Complete and accurate high-plateau flight data are beneficial for
effectively assessing and improving the flight status of civil aviation aircrafts, and can play an
important role in carrying out high-plateau operation safety risk analysis. Due to various reasons,
such as low temperature and low pressure in the harsh environment of high-plateau flights, the
abnormality or loss of the quick access recorder (QAR) data affects the flight data processing and
analysis results to a certain extent. In order to effectively solve this problem, an improved least squares
support vector machines method is proposed. Firstly, the entropy weight method is used to obtain
the index weights. Secondly, the principal component analysis method is used for dimensionality
reduction. Finally, the data are fitted and repaired by selecting appropriate eigenvalues through
multiple tests based on the LS-SVM. In order to verify the effectiveness of this method, the QAR data
related to multiple real plateau flights are used for testing and comparing with the improved method
for verification. The fitting results show that the error measurement index mean absolute error of the
average error accuracy is more than 90%, and the error index value equal coefficient reaches a high
fit degree of 0.99, which proves that the improved least squares support vector machines machine
Citation: Chen, N.; Sun, Y.; Wang, Z.;
learning model can fit and supplement the missing QAR data in the plateau area through historical
Peng, C. Improved LS-SVM Method
flight data to effectively meet application needs.
for Flight Data Fitting of Civil
Aircraft Flying at High Plateau.
Keywords: least squares method; support vector machines; principal component analysis; quick
Electronics 2022, 11, 1558.
https://doi.org/10.3390/
access recorder; mean absolute error; high-plateau flight
electronics11101558
Academic Editor: Gyu Myoung Lee
Received: 24 March 2022 1. Introduction
Accepted: 10 May 2022 High-plateau flights represent an important safety issue for civil aviation, especially
Published: 13 May 2022 for China’s civil aviation transportation. High-plateau airports are mainly distributed in
Publisher’s Note: MDPI stays neutral
China, Nepal, Peru, Bolivia, Ecuador, and other countries. Among the 42 high-plateau
with regard to jurisdictional claims in
airports in the world, 16 are located in China, so their operation safety problems have
published maps and institutional affil- a profound impact on China’s civil aviation [1]. On 14 May 2018, the flight mission of
iations. Chinese Sichuan Airlines flight 3U8633 from Chongqing to Lhasa plateau was an example
of the typical unsafe event; the front windshield of the cockpit burst and fell off during the
flight in high-plateau airspace, and the crew made an emergency descent. Compared with
ordinary flight, high-plateau flight has low air density and atmospheric pressure, complex
Copyright: © 2022 by the authors. terrain, solar radiation, uneven heating of the terrain facing the sun, and many other
Licensee MDPI, Basel, Switzerland. environmental characteristics which result in stricter takeoff and landing conditions for
This article is an open access article aircrafts on high plateaus. The technical requirements of the personnel are more stringent
distributed under the terms and and certain factors such as modification on the basis of ordinary civil aircrafts will cause
conditions of the Creative Commons
the flight parameters of high-plateau civil airliners to change from those of civil airliners
Attribution (CC BY) license (https://
on general routes. During the entire flight phase, the quick access recorder (QAR) data
creativecommons.org/licenses/by/
may be abnormal or lost due to the influence of the high plateau’s harsh environment,
4.0/).
Electronics 2022, 11, 1558. https://doi.org/10.3390/electronics11101558 https://www.mdpi.com/journal/electronics
353
Electronics 2022, 11, 1558
detection equipment, transmission equipment, or other unknown conditions. QAR is an
important data warehouse for post-flight flight technical analysis, engine health analysis,
flight safety incident investigation, flight quality analysis, operational quality analysis, and
aircraft health management. The abnormality of these data will bring inconvenience and
hidden hazards for monitoring and analyzing the safety status of high-plateau flights for
theoretical research.
Many scholars have carried out fruitful research on flight data analysis and application,
mainly focusing on flight data processing, flight data application, and other application
research. Flight data have many applications in aviation operation safety research [2–6].
Some scholars have applied flight data to turbine fault diagnosis, general aviation anomaly
detection, aviation safety key landing index prediction [7–11], tower flight data manager
man–machine system integration design processes, and new methods for nonlinear aerody-
namic modeling of flight data [12–14]. Some scholars also analyze the flight characteristics
of QAR data for landing at high-altitude airports, and use it for airline flight data mon-
itoring machine learning methods, generating new operational safety knowledge from
existing data, safety science insights gained from black-box-to-flight data monitoring, com-
posite fault diagnosis using optimized MCKD and sparse representation of rolling bearings,
rolling elements based on VMD, and sensitivity MCKD fault diagnosis, etc. [15–19]. Some
scholars have carried out research on the impact of leveling operation on landing safety
based on variance analysis of real flight data, civil aircraft hazard identification and predic-
tion based on deep learning [20,21], unsteady aerodynamic modeling of unstable dynamic
processes [22], and small-sample inspection data-driven diagnosis of critical deviation
sources in aircraft structural assembly [23].
In the research of flight data processing methods and technologies, many scholars
have also carried out a series of studies [24–26]. Some scholars have proposed improved
binary gray wolf optimizer and support vector machine methods, arithmetic optimization
algorithms, particle swarm optimization, average impact value-support vector machine
algorithms, etc., for in-flight data processing and optimization [27–29]. Some scholars
combined multiple classifiers to quantitatively sort the impact of anomalies in flight data
based on frequency domain specification and improved particle swarm optimization
algorithms, as well as enhanced fast non-dominated solution sorting genetic algorithms for
multi-objective problems research [30–32].
In short, many scholars have carried out a series of researches on flight data collection
and analysis, as well as application methods and technologies, and have also achieved many
valuable results. However, research on high-altitude flight data is rare, especially research
on the filling and simulation of flight data loss due to high altitude, low temperature, low
pressure, and other elements of the special operating environments. To effectively solve
the problem of high-plateau QAR flight data padding, an improved least squares support
vector machines method is proposed. The entropy weight method is used to obtain the
index weights, and the principal component analysis method is used for dimensionality
reduction. The flight data are fitted and repaired by selecting appropriate eigenvalues
through multiple tests based on LS-SVM. The data are fitted and repaired by selecting
appropriate eigenvalues through multiple tests based on LS-SVM. In order to verify the
effectiveness of this method, the QAR data related to multiple real plateau flights are used
for testing and are compared with the improved method for verification.
2. Principle of Data Restoration Method
2.1. LS-SVM Principle
The support vector machine is a generalized linear classifier proposed to perform
binary classification of data in a supervised learning manner. Its decision boundary is
the maximum margin hyperplane for the learning sample solution. The basic principle is
shown in Figure 1.
354
Electronics 2022, 11, 1558
Figure 1. Support vector machine hyperplane conceptual model.
It is a machine learning method that is based on a complete statistical learning the-
ory and has excellent learning capabilities. It has strict mathematical theory support,
strong interpretability, and does not rely on statistical methods, thus simplifying the usual
problems of classification and regression. It can also find key samples (support vectors)
that are critical to the task. After adopting nuclear techniques, it can handle non-linear
classification–regression tasks. The final decision function is determined by only a small
number of support vectors and the complexity of the calculation depends on the number
of support vectors, not the dimensionality of the sample space.
The LS-SVM demonstrates an improvement in the standard support vector machine, a
new type of support vector machine method proposed by Suykens and Vandewalb. Com-
pared with the standard SVM, it replaces the inequality constraints in SVM with equality
constraints, which increases the convergence speed, improves classification progress in
problems with desired goals, and achieves good results [33].
Supposing the data training set of a given LS-SVM is expressed as (1)
( x1 , y1 ), . . . , ( x1 , y1 ), x ∈ Rn , y ∈ {−1, +1} (1)
xi ∈ Rn is the n-dimensional system input vector, yi ∈ Rn is the system output and
f ( x ) = ω T ϕ( x ) + b is the unknown function to be estimated. Making a nonlinear mapping
γ: Rn → H , where Φ is called the feature map and H is the feature space, the unknown
function is estimated to use the function of the form (2).
f ( x ) = ω T ϕ( x ) + b (2)
Among them, ω is the weight vector in Rn space, and b ∈ R is the bias. The SVM
algorithm uses the kernel function of the original space to replace the dot product operation
in the high-dimensional feature space, avoids complex operations, and uses structural risk
to minimize as a learning rule, which is mathematically described as ωTω ≤ constant.
The standard SVM algorithm takes the insensitive loss function as the structural risk
minimization estimation problem. The meaning of the ε-insensitive loss function is as
follows: when the difference between the observed value y of the x point and the predicted
value f ( x ) does not exceed the predetermined ε, it is considered that the predicted value
f ( x ) at this point is lossless, although the predicted value f ( x ) and the observed value y
may not be equal. On the other hand, LS-VSM chooses the second norm ei of ξ i as the loss
function to make the equation true. Therefore, the optimization equation is established as
(3) and (4).
1 1 N
minω,b,e ( Jωe) = ω T ω + γ ∑ e2 , γ > (3)
2 2 i =1
yi = ω T ϕ( xi ) + b + ei 2 , i = 1, 2, . . . , N (4)
355
Electronics 2022, 11, 1558
Here, γ is a real constant which determines the relative size of 12 ωTω and 12 ∑iN=1 e2 ,
which can be between the training error and the compromised model complexity so that
the function can seek better generalization ability. The LS-SVM algorithm defines a loss
function that is different from the standard SVM algorithm and changes its inequality
constraints to equality constraints, which can obtain ω in the dual space. The Lagrange
Function (5) is as follows:
1 T 1 N N
L(ω, b, e, a) = ω ω + γ ∑ ei 2 − ∑ a i ω T ϕ ( x i ) + b + ei − y i (5)
2 2 i =1 i =1
where αi ∈ R, αi > 0 is the Lagrange multiplier so the optimal solution condition is as
follows (6):
N
δL
δω = 0, ω = ∑ ai ϕ( xi )
i =1
N
δL
δb = 0, ∑ ai = 0 (6)
i =1
δL
δei = 0, ai = γei
δL
δai = 0, yi = ω T ϕ( xi ) + b + ei , i = 1, . . . , N
After eliminating ω and ei from Equation (6), this optimization problem is transformed
into solving the following equation:
/ 0 / 0 −1 / 0
b 0 1 0
= (7)
0 1 B + γ −1 γ
Among them, y = [y1 , y2 , . . . , y N ] T , a = [ a1 , a2 , . . . , a N ] T , 1 = [1, . . . , 1] T , and B repre-
sent a square matrix; the element in the i-th column and row j is Bij = ϕ( xi ) T ϕ( xi ) = K xi , x j ,
i, j = 1, . . . , N; and K xi , x j is the kernel function. On the basis of Formula (3), ω can be
further obtained, so as to obtain the nonlinear approximation of the training data set
N
f (x) = ∑ ai K xi , x j + b (8)
i =1
2.2. The Choice of Kernel Function
The kernel function is used to prevent the non-linear transformation from mapping
its input space to the high-latitude space, causing particularly high-dimensional complex
operations. When the support vector machine only needs the inner product operation and
looks for a function that represents a low-dimensional input space that is exactly equal
to the inner product in the high-dimensional space, the result can be obtained directly to
avoid complicated operations. The choice of the kernel function requires Mercer’s theorem
to be satisfied, that is, any Gram matrix of the kernel function in the sample space is a
semi-positive definite matrix (semi-positive definite) [34]. Currently, the commonly used
kernel functions in research and practice are as follows:
(1) Linear kernel function:
K ( x, xi ) = x · xi (9)
(2) Polynomial kernel function:
K ( x, xi ) = ( x · xi + 1)d (10)
(d value is the order of the polynomial)
(3) Radial basis kernel function:
( x − x i )2
K ( x, xi ) = exp(− ) (11)
2σ2
356
Electronics 2022, 11, 1558
(4) B-spline kernel function:
K ( x, xi ) = B2n+1 ( x − xi ) (12)
(5) Perceptual kernel function:
K ( x, xi ) = tanh( βxi + b) (13)
2.3. LS-SVM Principle
Entropy comes from physical thermodynamics and is one of the parameters that can
characterize matter. It was first introduced into information theory by C.E. Shannony and
called information entropy. The entropy weight method (EWM) abstracts information and
tests its degree of variation through various eigenvalues. In this way, the weight of each
feature is calculated and modified to achieve a more reasonable weight index [35]. The
specific process is as follows:
(1) Perform data standardization processing on each feature value. Suppose that k
x −min( x )
feature quantities Yij = maxij( x )−mini( x ) are given, where Xi = x1 , x2 , . . . , xn , assuming that
i i
the standardized value of each feature value is Y1 , Y2 , . . . , YK
xij − min( xi )
Yij = (14)
max( xi ) − min( xi )
(2) Find the information entropy of each eigenvalue. According to the definition of
information entropy in information theory, the information entropy of a set of data can be
written as
Yij
Pij = n (15)
∑i=1 Yij
Yij
where pij = ∑in=1 Yij
, if lim ∑in=1 Pij lnPij = 0, then define lim ∑in=1 Pij lnPij = 0, determine
pij =0 pij =0
the weight w of each feature quantity:
1 − Ei
wi = (i = 1, 2, . . . , k) (16)
k − ∑ Ei
2.4. Principles of Principal Component Analysis (PCA)
The principal component analysis (PCA) method is currently the most widely used
data dimensionality reduction algorithm. It aims to sequentially find a set of mutually
orthogonal coordinate axes from the original high-dimensional space to determine its
correlation by comparing the variance of the original data under the new coordinate axis;
the degree is used to exclude zero-correlation or low-correlation feature quantities to
achieve a dimensionality reduction of data features. Because of the efficiency and simplicity
of PCA processing high-dimensional data sets, it is widely used in various fields in practice,
especially in the field of compressed data [36].
2.5. Verification Method
In order to judge the conformity of the selected number of feature quantities, the
coefficient of determination (R2 ) is introduced. The coefficient of determination indicates
how much the fluctuation of the dependent variable can be described by the fluctuation of
the independent variable. Its expression is as follows:
∧
∧ ..
2
∑in=1 yi − y ∗ yi − y
R = (
2
) (17)
∧ 2 ∧ .. 2
∑in=1 ( yi − y ) ∗ ∑in=1 ( yi − y)
357
Electronics 2022, 11, 1558
∧
y and y represent the actual value and the predicted value of the simulation result.
The closer the R2 value is to 1, the better the correlation between the two.
For the evaluation of the complementation results, four commonly used indicators
for data repair are introduced for analysis purposes: mean square error (MSE), root mean
square error (RMSE), mean absolute error (MAE), and equal coefficient (EC). The calculation
is as follows:
N
∧ 2
MSE = N1 ∑ yi − yi
i =1
N ∧ 2
RMSE = 1
N∑ ( yi − y i )
i=∧1 (18)
MAE = N1 yi − yi
∧ 2
∑iN=1 (yi − y i )
EC = 1 − & &
∧
∑i=1 yi 2 − ∑iN=1 y i 2
N
∧
y and y still represent the actual value and predict the value of the simulation result,
and N represents the number of samples in the training set. The smaller value of MSE, the
higher the accuracy of the machine learning simulation results describing the experimental
data. EC indicates the degree of fit between the output value and the true value. Generally,
any value above 0.9 indicates a good fit.
3. Compensation Model and Simulation of High-Plateau Missing Data
The pseudo-compensation of missing data by other QAR data is essentially based
on the existence of a certain functional relationship between QAR parameters. The value
of the parameter can be derived from other parameter values. Therefore, the purpose of
simulation is to determine this functional relationship. To be more specific, high-plateau
flight data padding is essentially a function approximation problem.
This paper takes some flight parameters of QAR flight data as the assumed missing
data in order to show the feasibility of this method. According to the actual meaning of the
QAR data, the loss parameter N (τ ) = Nreal is set as the missing QAR parameter, where τ
is the current moment of the missing data and other intact QAR parameters are used as the
known vector set ωτ T according to the previous setting. Finding a functional relationship
between the two or its first approximation such that N (τ ) = Nreal , the relationship model
can be written as N (τ ) = ωτ T ϕ( x, t) + b, where the parameter requirements are (8) the
same, so LS-SVM can be used to complement the QAR loss parameters.
3.1. Data Selection
In order to verify the feasibility of the high-plateau QAR data patching, this paper
collects ten flight data of a certain airline’s civil transport aircraft in the same time period
and the same origin and destination for simulation analysis. In order to reduce irrelevant
external factors, interference data selection controls possible related variables, such as
changing in crew members, and determines whether it is pre-flight or post-flight to ensure
that the accuracy of the simulation is improved. After selection, nine groups were randomly
selected as the model training group and the last group was used as the comparison group
to test the accuracy of the experimental results.
3.2. Algorithm Improvement
Based on the support vector machine algorithm, an improved method is proposed for
the shortcomings of difficulty in training and analyzing large-scale samples. The eigenvalue
range definition plays a very important role in training. The input and output are put into
a small range and then predicted by the support vector machine model. On the one hand,
it can avoid overfitting caused by large-value data dominating small-value data. On the
other hand, scaling the data to a small range can avoid the “dimension disaster” and reduce
the computational load. The principal component analysis method, as a commonly used
358
Electronics 2022, 11, 1558
dimensionality reduction algorithm, can easily simplify and refine complex data, process
the data through the entropy method, and complete the algorithm optimization to achieve
concise and accurate data under the premise of ensuring the robustness of the data.
3.3. Algorithm Flow
Before the simulation starts, it is necessary to determine the key parameters γ and the
core width σ2 in advance and then use the above algorithm to perform simulation training
to fill in the missing data; the specific details and steps are shown in Figure 2.
Figure 2. Flow chart of flight data fitting based on improved LS-SVM.
3.4. Simulation Application
QAR’s overall data cannot be analyzed due to the existence of text items and 78 data
items remain after all text items are excluded. Python is taken as the expected environment,
which measures the weight of each item through the EWM method and divides the interval
to select the data items for simulation training. After multiple rounds of testing, the
coefficient of determination is compared. It is found that when the number of feature
quantities is smaller, the coefficient of fit is larger and the change tends to stably increase;
thus, few features are prone to overfitting. After weighing and selecting the 17 feature
items with the largest weight, they have good accuracy and credibility. The relationship
between the number of specific features and the accuracy rate, as well as the weight ratio
of the feature quantity, are shown in Figure 3.
Compared to the algorithm without the improved method, the improved algorithm
not only improves the fitting effect but also greatly reduces the amount of data in the
simulation. The fitting coefficient is increased by 0.64% but the amount of data calculation
is reduced by 78.21%. The details are shown in Table 1.
Table 1. Performance table of improved method.
Characteristics of Several No Improve Improve Promotion
R2 0.991 0.9973 0.64%
The amount of data 778284 169626 78.21%
359
Electronics 2022, 11, 1558
Figure 3. Relationship between the number of features and the correlation coefficient.
Among them, the selected feature quantities and the corresponding weights are shown
in Table 2 and Figure 4.
Table 2. Weight-characteristic quantity correspondents.
Serial Number Abbreviation Name Connotation Weight
1 N1_1 Left engine speed 0.041
2 N1_2 Right engine speed 0.042
3 N2_1 Left engine power 0.008
4 N2_2 Right engine power 0.011
5 FLIGHT_PHASE Flight phase 0.054
6 GS1 True ground speed 0.082
7 GS2 Captain’s instrument displays ground speed 0.083
8 GS_FO The co-pilot’s gauge shows ground speed 0.082
9 CAS Calibrated air speed 0.079
10 DRIFT Drift angle 0.041
11 TAS True airspeed 0.099
The captain’s instrument displays the pitch
12 PITCH11 0.064
angle on the left side
The captain’s instrument displays the pitch
13 PITCH12 0.064
angle on the inner left side
The captain’s instrument displays the pitch
14 PITCH21 0.064
angle to the outer right
The captain’s instrument displays the pitch
15 PITCH22 0.064
angle on the inner right side
The assistant captain’s gauge shows the
16 PITCH_DISP_FO1 0.061
outer left side of the pitch angle
The assistant captain’s instrument displays
17 PITCH_DISP_FO2 0.061
the pitch angle on the inner left side
360
Electronics 2022, 11, 1558
Figure 4. Weight-characteristic quantity correspondents.
Among them, the feature that has the greatest impact on the prediction is the true
flight speed (TAS), and the feature that has the least impact is the right engine speed (N2_1).
After determining the selection of the feature quantity, due to the large amplitude of the
QAR data, in order to reduce the modeling error, the input data and the expected data were
normalized on [−1, 0] and [0, 1], respectively. The original interval should be returned to
after analysis. In this paper, the kernel function selects the most commonly used radial
basis function for data repair:
( x − x i )2
K ( x, xi ) = exp(− ) (19)
2σ2
The simulation found that the parameters γ and the kernel width σ2 have a significant
impact on the complementation effect, which needs to be determined according to the
specific characteristics of the training data. Generally speaking, a reduction in the kernel
width σ2 can improve the training accuracy but can reduce the generalization ability, and
an increase in the parameter γ can also improve the training accuracy. The training shows
that when the parameter γ = 3 and the training model is filled with missing data, the data
with core width σ2 = 0.6 have the best complementation effect. With the left engine speed
(N1, unit: RPM), the aircraft pitch angle (pitch, unit: ◦ ) and the flap angle (flap angle, unit:
◦ ), as examples, intercept the data simulation results of the climb, approach, and landing
stages to show the degree of flight data padding. In order to facilitate the analysis and
observation, the predicted and actual values of the aircraft inclination angle are placed in
(−1,1) interval, the predicted value and actual value of the left engine speed are put in the
(1,3) interval, and the predicted value and actual value of the flap angle are put in the (3,5)
interval, as shown in Figures 5–7.
Figure 5. Climbing phase simulation diagram.
361
Electronics 2022, 11, 1558
Figure 6. Approach phase simulation diagram.
Figure 7. Landing phase simulation diagram.
By observing the image, it is found that the data fitting degree of each factor and each
stage is relatively good, so further simulation result analysis can be carried out.
4. Simulation and Discussion
The experimental results are analyzed through simulation methods, and the error
indicators of the complement results are shown in Table 3.
Table 3. Error index of missing data completion.
Pitch MSE MAE(%) RMSE EC
climb −4.81 × 10−17 3.59% 5.56 × 10−16 0.99
approach −5.15 × 10−16 7.70% 5.95 × 10−15 0.99
landing −1.78 × 10−17 2.64% 2.06 × 10−16 0.99
N1 MSE MAE(%) RMSE EC
climb −5.20 × 10−17 2.93% 6.02 × 10−16 0.99
approach 3.89 × 10−17 7.43% 4.51 × 10−16 0.99
landing 2.40 × 10−17 2.61% 2.78 × 10−16 0.99
Flap angle MSE MAE(%) RMSE EC
climb −9.53 × 10−17 4.07% 1.10 × 10−15 0.99
approach −5.15 × 10−16 9.00% 0.99 0.99
landing 7.66 × 10−17 2.41% 8.87 × 10−16 0.99
The error measurement index MAE in the table shows that the lower average error
accuracy is more than 90% and the error index value EC in the table has reached a high
degree of fit of 0.99. It can be seen that the QAR data item is used as the feature value
to assign weights through EWM, and the PCA dimensionality reduction method finally
uses the LS-SVM algorithm to fill in the missing data of the QAR to great effect. However,
since most of the routes sailed by the aircraft are repeated flights of the same route, when
faced with multiple losses or overall losses, the same method can be used to simulate the
historical data to restore the lost flight data.
362
Electronics 2022, 11, 1558
5. Conclusions
The previous data processing experience is based on the QAR itself to detect changes
in the body or environment and other actual conditions. Few studies have been conducted
on the preservation and restoration of the QAR data itself. This work provides some ideas
in this regard. In this paper, the improved LS-SVM method based on the entropy weight
method (EWM) and principal component analysis (PCA) is shown to effectively fit the
missing QAR data. The parameters are gradually stable during the training process, which
ensures that the model can be directly applied for data fitting without retraining, achieving
the purpose of fast and simple applicability. This article only considers the case of single
item loss, since most of the aircraft sailing on the same route repeats the flight; when faced
with multiple losses or overall loss, the same method can be used to simulate historical
data to restore this loss of flight data.
Due to the uniqueness of flying at high plateaus, there may be differences when flying
on normal routes and the same conclusion may not be applicable for the normal flight. Its
practical applicability remains to be further studied.
Author Contributions: Conceptualization, N.C. and Y.S.; data curation, N.C. and Z.W.; methodology,
N.C. and C.P.; formal analysis, N.C. and Z.W.; writing—original draft preparation, N.C. All authors
have read and agreed to the published version of the manuscript.
Funding: This research was funded by the National Natural Science Foundation of China (grant
number: U2033202); the Key R&D Program of the Sichuan Provincial Department of Science and Tech-
nology (2022YFG0213); and the Safety Capability Fund Project of the Civil Aviation Administration
of China (2022J026).
Data Availability Statement: The data used to support the findings of this study are included within
the article.
Acknowledgments: The authors would like to thank the National Natural Science Foundation
of China (U2033202), the Key R&D Program of the Sichuan Science and Technology Department
(2022YFG0213), the Safety Capability Fund Project of the Civil Aviation Administration of China
(2022J026), and the Flight Technology and Flight Safety Research Base Open Fund Project (F2019KF08).
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Xu, J.C.; Sun, Y.C. Airworthiness requirement of transportation category aircraft operation on high plateau airports. Aeronaut.
Comput. Tech. 2018, 48, 133–138.
2. Feng, Y.W.; Pan, W.H.; Lu, C. Research on Operation Reliability of Aircraft Power Plant Based on Ma-chine Learning. Acta
Aeronaut. Astronaut. Sin. 2021, 42, 524732. [CrossRef]
3. Ye, B.J.; Bao, X.; Liu, B. Machine learning for aircraft approach time prediction. Acta Aeronaut. Astronaut. Sin. 2020, 41, 359–370.
4. Fang, G.C.; Jia, D.P.; Liu, Y.F. Military airplane health assessment technique based on data mining of flight parameters. Acta
Aeronaut. Astronaut. Sin. 2020, 41, 296–306.
5. Liu, J.Y.; Wang, D.Q.; Cui, J.W. Research on classification of screw locking results based on improved kernel LS-SVM algorithm.
Ind. Instrum. Autom. 2020, 4, 12–15.
6. Li, S.; Wang, Y.; Xue, Z.L. Grounding resistance monitoring data regression prediction method based on LS-SVM. Foreign Electron.
Meas. Technol. 2019, 8, 19–22.
7. Wu, H.; Li, B.W.; Zhao, S.F.; Yang, X.; Song, H. Research on initial installed power loss of a certain type of turbo-shaft engine
using data mining and statistical approach. Math. Probl. Eng. 2018, 2018, 9412350. [CrossRef]
8. Puranik, T.G.; Mavris, D.N. Anomaly detection in general-aviation operations using energy metrics and flight-data records. J.
Aeros. Comp. Inf. Com. 2018, 15, 22–253. [CrossRef]
9. Puranik, T.G.; Rodriguez, N.; Mavris, D.N. Towards online prediction of safety-critical landing metrics in aviation using
supervised machine learning. Transp. Res. Part C Emerg. Technol. 2020, 120, 102819. [CrossRef]
10. Yildirim, M.T.; Kurt, B. Aircraft gas turbine engine health monitoring system by real flight data. Int. J. Aerospace Eng. 2018,
2018, 9570873. [CrossRef]
11. Yildirim, M.T.; Kurt, B. Confidence interval prediction of ANN estimated LPT parameters. Aircr. Eng. Aerosp. Technol. 2019, 9,
101–106. [CrossRef]
12. Martín, F.J.V.; Sequera, J.L.C.; Huerga, M.A.N. Using data mining techniques to discover patterns in an airline’s flight hours
assignments. Int. J. Data. Warehous. 2017, 13, 45–62. [CrossRef]
363
Electronics 2022, 11, 1558
13. Davison Reynolds, H.J.; Lokhande, K.; Kuffner, M.; Yenson, S. Human–Systems integration design process of the air traffic control
tower flight data manager. J. Cogn. Eng. Decis. Mak. 2013, 7, 273–292. [CrossRef]
14. Kumar, A.; Ghosh, K. GPR-based novel approach for non-linear aerodynamic modeling from flight data. Aeronaut. J. 2019, 123,
79–92. [CrossRef]
15. Lan, C.E.; Wu, K.Y.; Yu, J. Flight characteristics analysis based on QAR data of a jet transport during landing at a high-altitude
airport. Chin. J. Aeronaut. 2012, 25, 13–24. [CrossRef]
16. Oehling, J.; Barry, D.J. Using machine learning methods in airline flight data monitoring to generate new operational safety
knowledge from existing data. Saf. Sci. 2019, 114, 89–104. [CrossRef]
17. Walker, G. Redefining the incidents to learn from: Safety science insights acquired on the journey from black boxes to flight data
monitoring. Saf. Sci. 2017, 99, 14–22. [CrossRef]
18. Deng, W.; Li, Z.; Li, X.; Chen, H.; Zhao, H. Compound fault diagnosis using optimized MCKD and sparse representation for
rolling bearings. IEEE Trans. Instrum. Meas. 2022, 71, 1–9. [CrossRef]
19. Cui, H.; Guan, Y.; Chen, H. Rolling element fault diagnosis based on VMD and sensitivity MCKD. IEEE Access 2021, 9, 120297–120308.
[CrossRef]
20. Wang, L.; Ren, Y.; Wu, C.X. Effects of flare operation on landing safety: A study based on ANOVA of real flight data. Saf. Sci.
2018, 102, 14–25. [CrossRef]
21. Zhou, D.; Zhuang, X.; Zuo, H.; Wang, H.; Yan, H. Deep learning-based approach for civil aircraft for civil aircraft hazard
identification and prediction. IEEE Access 2020, 8, 103665–103683. [CrossRef]
22. Cheng, S.L.; Gao, Z.H.; Zhu, X.Q. Unsteady aerodynamic modelling of unstable dynamic process. Acta Aeronaut. Astronaut. Sin.
2020, 41, 238–249.
23. Li, M.; Wu, C. A distance model of intuitionistic fuzzy cross entropy to solve preference problem on alternatives. Math. Probl. Eng.
2016, 2016, 8324124. [CrossRef]
24. Zhang, X.; Wang, H.; Du, C.; Fan, X.; Cui, L.; Chen, H.; Deng, F.; Tong, Q.; He, M.; Yang, M.; et al. Custom-molded offloading
footwear effectively prevents recurrence and amputation, and lowers mortality rates in high-risk diabetic foot patients: A
multicenter, prospective observational study. Diabetes Metab. Syndr. Obes. Targets Ther. 2022, 15, 103–109. [CrossRef] [PubMed]
25. Zhu, Y.; Deng, B.; Huo, Z. Key deviation source diagnosis for aircraft structural component assembly driven by small sample
inspection data. China Mech. Eng. 2019, 30, 2725–2733.
26. Gao, X.; Hou, J. An improved SVM integrated GS-PCA fault diagnosis approach of Tennessee Eastman process. Neurocomputing
2016, 174, 906–911. [CrossRef]
27. Safaldin, M.; Otair, M.; Abualigah, L. Improved binary gray wolf optimizer and SVM for intrusion detection system in wireless
sensor networks. J. Amb. Intel. Hum. Comp. 2021, 12, 1559–1576. [CrossRef]
28. Abualigah, L.; Diabat, A.; Mirjalili, S.; Elaziz, M.A.; Gandomi, A.H. The arithmetic optimization algorithm. Comput. Methods Appl.
Mech. Eng. 2021, 376, 113609. [CrossRef]
29. Cai, J.; Bao, H.; Huang, Y.; Zhou, D. Risk identification of civil aviation engine control system based on particle swarm
optimization-mean impact value-support vector machine. Proc. Inst. Mech. Eng. Part G J. Aerosp. Eng. 2022, in press. [CrossRef]
30. Smart, E.; Brown, D.; Denman, J. Combining multiple classifiers to quantitatively rank the impact of abnormalities in flight data.
Appl. Soft Comput. 2012, 12, 2583–2592. [CrossRef]
31. Li, G.; Li, Y.; Chen, H.; Deng, W. Fractional-Order Controller for Course-Keeping of Underactuated Surface Vessels Based on
Frequency Domain Specification and Improved Particle Swarm Optimization Algorithm. Appl. Sci. 2022, 12, 3139. [CrossRef]
32. Deng, W.; Zhang, X.X.; Zhou, Y.Q.; Liu, Y.; Zhou, X.B.; Chen, H.L.; Zhao, H.M. An enhanced fast non-dominated solution sorting
genetic algorithm for multi-objective problems. Inf. Sci. 2022, 585, 441–453. [CrossRef]
33. Elisa, Q.M.; Lu, S.; Blazquez, C. Use of data imputation tools to reconstruct incomplete air quality datasets: A case-study in
Temuco, Chile. Atmos. Environ. 2019, 200, 40–49.
34. Hadeed, S.J.; O’Rourke, M.K.; Burgess, J.L.; Harris, R.B.; Canales, R.A. Imputation methods for addressing missing data in
short-term monitoring of air pollutants. Sci. Total Environ. 2020, 730, 139140. [CrossRef]
35. Liu, Z.J.; Wan, J.Q.; Ma, Y.W. Online prediction of effluent COD in the anaerobic wastewater treatment system based on
PCA-LS-SVM algorithm. Environ. Sci. Pollut. Res. 2019, 26, 12828–12841. [CrossRef]
36. Cheolmin, K.; Klabjan, D. A simple and fast algorithm for L1-norm Kernel PCA. IEEE Trans. Pattern Anal. Mach. Intell. 2019, 42,
1842–1855.
364
electronics
Article
A Hierarchical Heterogeneous Graph Attention Network for
Emotion-Cause Pair Extraction
Jiaxin Yu 1 , Wenyuan Liu 1,2, *, Yongjun He 3, * and Bineng Zhong 4
1 School of Information Science and Engineering, Yanshan University, Qinhuangdao 066004, China
2 The Engineering Research Center for Network Perception & Big Data of Hebei Province,
Qinhuangdao 066004, China
3 School of Computer Science and Technology, Harbin Institute of Technology, Harbin 150001, China
4 The Guangxi Key Lab of Multi-Source Information Mining & Security, Guangxi Normal University,
Guilin 541004, China
* Correspondence: [email protected] (W.L.); [email protected] (Y.H.)
Abstract: Recently, graph neural networks (GNN), due to their compelling representation learning
ability, have been exploited to deal with emotion-cause pair extraction (ECPE). However, current
GNN-based ECPE methods mostly concentrate on modeling the local dependency relation between
homogeneous nodes at the semantic granularity of clauses or clause pairs, while they fail to take full
advantage of the rich semantic information in the document. To solve this problem, we propose a
novel hierarchical heterogeneous graph attention network to model global semantic relations among
nodes. Especially, our method introduces all types of semantic elements involved in the ECPE, not
just clauses or clause pairs. Specifically, we first model the dependency between clauses and words,
in which word nodes are also exploited as an intermediary for the association between clause nodes.
Secondly, a pair-level subgraph is constructed to explore the correlation between the pair nodes and
their different neighboring nodes. Representation learning of clauses and clause pairs is achieved by
two-level heterogeneous graph attention networks. Experiments on the benchmark datasets show
Citation: Yu, J.; Liu, W.; He, Y.;
Zhong, B. A Hierarchical
that our proposed model achieves a significant improvement over 13 compared methods.
Heterogeneous Graph Attention
Network for Emotion-Cause Pair Keywords: emotion-cause pair extraction; heterogeneous graph; graph attention network; hierarchi-
Extraction. Electronics 2022, 11, 2884. cal model
https://doi.org/10.3390/
electronics11182884
Academic Editor: George
1. Introduction
Angelos Papadopoulos
As a research hotspot in natural language processing (NLP), emotion-cause extraction
Received: 15 August 2022 (ECE), aimed at extracting the causes corresponding to the emotions specified in a given
Accepted: 7 September 2022 document, has been widely utilized in public opinion analysis, human–machine dialogue
Published: 12 September 2022 systems, and so on. Originally, taking events as the causes, Lee et al. [1] regarded ECE as a
Publisher’s Note: MDPI stays neutral word-level sequence annotating task. Afterwards, some studies redefined the granularity of
with regard to jurisdictional claims in annotation in ECE to the clause level to make full use of context information [2,3]. Although
published maps and institutional affil- annotating emotions in advance contributes to cause extraction, it is very labor-consuming,
iations. which limits the real application of the ECE approach. To solve this problem, Xia and
Ding [4] put forward a new emotion analysis task called emotion-cause pair extraction
(ECPE), which extracts emotion clauses and their corresponding cause clauses in pairs.
ECPE does not rely on labeling emotions, so it is preferable, but more challenging, than ECE.
Copyright: © 2022 by the authors. Furthermore, they also proposed a two-stage pipelined framework to handle this new task,
Licensee MDPI, Basel, Switzerland. in which the emotions and causes are first extracted and then paired. Since this two-stage
This article is an open access article
approach may result in cross-stage propagation of errors, a lot of end-to-end approaches
distributed under the terms and
are presented and achieve improvements over two-stage approaches. In the end-to-end
conditions of the Creative Commons
ECPE approaches, the crucial issue is to learn good representations of semantic elements.
Attribution (CC BY) license (https://
GNN [5,6] can learn node representations based on node features and the graph structure;
creativecommons.org/licenses/by/
therefore, it is a powerful deep representation learning method and has been widely utilized
4.0/).
Electronics 2022, 11, 2884. https://doi.org/10.3390/electronics11182884 https://www.mdpi.com/journal/electronics
365
Electronics 2022, 11, 2884
in many application fields. Inspired by this, a few researchers attempted to apply GNN to
the ECPE task. They mostly construct a homogeneous graph with the semantic information
of a document and employed GNNs to learn these semantic representations. For example,
Wei et al. [7] and Chen et al. [8] model the inter-clause and inter-pair relations, respectively.
Nevertheless, existing GNN-based ECPE approaches only concentrate on one semantic
level, ignoring the rich semantic relations between different kinds of semantic elements.
Hence, the captured semantic information is local, rather than global. In fact, in the ECPE
task, a document involves different semantic granularity of words, clauses, clause pairs,
and so on; hence, the constructed text graph should come with multiple types of nodes,
also well-known as a heterogeneous graph. Furthermore, all the associations between these
nodes can provide clues for extracting causality. Therefore, it is conductive for the joint
extraction of emotion clauses, cause clauses, and emotion-cause pairs to take all semantic
elements into account and model the global semantic relations between them.
In this study, we propose an end-to-end hierarchical heterogeneous graph attention
model (HHGAT). Different from the existing methods that only consider clause or pair
nodes, we introduce word nodes into our heterogeneous graph, together with clause and
pair nodes, to cover all semantic elements. In particular, the introduced word nodes can
not only extract fine-grained clause features by modeling the dependency between clauses
and words, but also act as an intermediate node connecting clause nodes to enrich the
correlation between clause nodes. Moreover, a fully connected pair-level subgraph is
established to capture the relations between a pair node and its neighboring nodes on
different semantic paths. Depending on such a hierarchy of “word-clause-pair”, we realize
a model of the global semantics in a document.
2. Related Work
Emotion analysis is active in the field of NLP. In many application scenarios, it is more
important to understand the emotional cause than the emotion itself. Here, we focus on
two challenging tasks, namely ECE and ECPE.
2.1. ECE
Different from traditional emotion classification, the purpose of ECE is to extract
the causes of specific emotions. Lee et al. [1] first defined the ECE task and introduced
a method based on linguistic rules (RB). Subsequently, for different linguistic patterns, a
variety of RB methods are proposed [9–11]. In addition, Russo et al. [12] designed a novel
method combining RB and common-sense knowledge. However, the performance of these
RB methods is usually unsatisfactory. Considering that it is impossible for rules to cover
all language phenomena, some machine learning (ML)-based ECE methods are proposed.
Gui et al. [13] designed two ML-based methods, combined with 25 rules. Ghazi et al. [14]
employed conditional random field (CRF) to tag emotional causes. Moreover, Gui et al. [2]
constructed a new clause-level corpus and utilized support vector machine (SVM) to deal
with the ECE task. To benefit from the representation learning ability of deep learning
(DL), some DL-based methods achieved excellent performance on ECE. Gui et al. [15]
presented a new method based on convolutional neural network (CNN). Cheng et al. [16]
used long short-term memory networks (LSTM) to model the clauses. To obtain better
context representations, a series of hierarchical models [17–24] were explored. Inspired
by multitask learning, Chen et al. [25] and Hu et al. [26] focused on the joint extraction
of emotion and cause. In addition, Ding et al. [27] and Xu et al. [28] reformulated ECE
into a ranking problem. Considering the importance of emotion-independent features,
Xiao et al. [29] presented a multi-view attention network. Recently, Hu et al. [30] proposed
a graph convolution network (GCN) integrating semantics and structure information,
which is the state-of-the-art ECE method.
366
Electronics 2022, 11, 2884
2.2. ECPE
2.2.1. Pipelined ECPE
ECE requires the manual annotation of emotion clauses before cause extraction, which
is labor-consuming. To solve this problem, Xia and Ding [4] proposed a new task called
ECPE, and they introduced three two-stage pipelined models, namely Indep, Inter-CE, and
Inter-EC. For Inter-EC [4], Shan and Zhu [31] designed a new cause extraction component
based on transformer [32] to improve this model. Yu et al. [33] applied the self-distillation
method to train a mutually auxiliary multitask model. Jia et al. [34] realized mutual
promotion of emotion extraction and cause extraction by recursively modeling clauses.
To improve the pairing stage of two-stage pipelined methods, Sun et al. [35] presented a
dual-questioning attention network. Moreover, Shi et al. [36] simultaneously enhanced
both stages of the pipelined method.
2.2.2. End-to-End ECPE
Although the pipelined approach has been proved to be effective for ECPE, it leads
to cross-stage error propagation. To solve this problem, a series of end-to-end ECPE
approaches are proposed.
Wu et al. [37] jointly trained the three subtasks in ECPE via a unified framework
and had clause features shared to exploit the interaction between subtasks. To make
full use of the implicit connection between emotion detection and emotion-cause pair
extraction, Tang et al. [38] tackled these two tasks in a joint framework. Concentrating on
the interaction between emotion-cause pairs, Ding et al. [39] presented a 2D transformer and
its two variants. Fan et al. [40] introduced a scope controller to concentrate the predicted
distribution of emotion-cause pair. Ding et al. [41] restricted ECPE to the emotion-centered
cause extraction in the sliding window and proposed a multi-label learning method. Cheng
et al. [42] took advantage of two symmetrical subnetworks to conduct a local search [43,44]
around emotion or cause, respectively. Singh et al. [45] adopted the prediction results of
emotion extraction to promote the cause extraction. Considering the importance of order
information, Fan et al. [46] captured the sequential features of clauses through three LSTMs:
forward LSTM, backward LSTM, and BiLSTM. Yang et al. [47] utilized the consistency of
emotion type between the emotion clause and clause pair. Chen et al. [48] achieved the mutual
promotion of emotion extraction and cause extraction through iterative learning. Furthermore,
some studies [49–52] coincidentally reformulated ECPE as a sequence labeling problem.
Recently, some graph structure-based approaches are proposed. Song et al. [53] treated
ECPE as a link prediction task of directed graph; however, they did not adopt a GNN that
is more suitable for graph structure modeling. Despite Fan et al. [54] introduced a novel
approach that regards ECPE as an action prediction task in directed graph construction;
their model is not based on GNN, either. In addition, Wei et al. [7] exploited a graph
attention network (GAT) to enhance inter-clause relation modeling and deal with the
ECPE task from a ranking perspective. Chen et al. [8] developed an approach based on a
graph convolutional network to capture the relevance among local neighboring candidate
pairs. However, the above graph-based approaches ignored the relationship between
heterogeneous nodes, so they failed to model global semantics.
3. Methodology
3.1. Task Definition
In this section, the ECPE task is formalized as follows. Let d = [c1 , · · · ci · · · , cm ] be
a document that contains m clauses, where ci = [wi,1 , · · · wi,j · · · , wi,n ] is the i-th clause
and further decomposed into a sequence of n words. The aim of ECPE is to extract the
emotion-cause pairs from d:
| P| | P|
P = { pk }k=1 = {(cek , cck )}k=1 , (1)
367
Electronics 2022, 11, 2884
where cie is the emotion clause in the k-th emotion-cause pair, ccj corresponds to the cause
clause, and P represents the candidate pair set.
3.2. Overview
In this work, we first represent a document with a “word-clause-pair” heterogeneous
graph, as illustrated in Figure 1. Then, we present a hierarchical heterogeneous graph
attention network to model the “word-clause-pair” hierarchical structure and identify the
emotion-cause pairs according to the learned node representation. As shown in Figure 2,
our proposed model mainly includes three components: (1) the node initialization layer,
which utilizes word-level BiLSTM, followed by a self-attention module or pre-trained BERT
to obtain the initial semantic representations of word and clause nodes; (2) the clause
node encoding layer employs a node-level heterogeneous graph attention network to
integrate the inner-clause contextual features into the clause representations by capturing
the dependencies between clause nodes and word nodes they contains; (3) the pair node
encoding layer is a heterogeneous graph attention network based on meta-path, which
first applies a node-level attention and then a meta-path level attention. Finally, three
multilayer perceptrons (MLP) are adopted to predict the emotion clauses, cause clauses,
and emotion-cause pairs, respectively.
pair
clause
word
Node type
pair-pair
clause-pair
word-clause
Edge type
Figure 1. A toy example of heterogeneous graph composed of word, clause, and pair nodes.
3.3. Heterogeneous Graph Construction
We denote our hierarchical heterogeneous graph as G = (V , E ), where V = V w ∪ V c ∪ V p
represents a node set that
consists
n of three types of nodes, and E stands
mfor the edges between
all nodes. V w = ∪im=1 wi,j j=1 , V c = {ci }im=1 , and V p = ∪im=1 pi,j j=1 indicate the sets of
words, clauses, and pair nodes, respectively. As shown in Figure 2, a word-to-clause edge
distinctly indicates which clause a word is contained in. The two clause nodes connected with
the same pair node together form a candidate emotion-cause pair. Moreover, the association
between two pair nodes is represented by a pair-to-pair edge.
On the one hand, most current methods employ two clause-level subtasks (i.e., emotion
extraction and cause extraction) in a unified framework to facilitate the detection of emotion-
cause pairs. On the other hand, good clause representation is conducive to the feature
construction of clause pairs. Hence, in order to learn the semantic representations of clause
and pair nodes in detail, we divide our heterogeneous graph into two subgraphs, i.e., word-
clause G wc = (V w ∪ V c , E wc ) and pair-level G p = (V p , E p ) subgraphs. Here, E wc denotes
the word-to-clause edge set, and E p represents the pair-to-pair edge set. Furthermore, G wc
and G p are further divided into a series of more fine-grained subgraphs, i.e., ∪im=1 Giwc and
p
∪im=1 Gi , respectively, to facilitate the formalized description of our algorithm.
368
Electronics 2022, 11, 2884
Constructing word-clause Pairing clause-level Constructing pair-level
(a) subgraphs nodes subgraphs
hˆ is hˆ js hirep
,j
MLP
Heterogeneous Graph
wCLS
Homogeneous Graph
Yˆ e
Attention Network
Attention Network
Node Encoding
hˆ1s hˆ1,1
p
w1,1
Network
MLP
hˆ 2s hˆ1,2
p
Yˆ p
MLP
wm , n Yˆ c
hˆ ms hˆ mp , m
wSEP
s w
(b) h1 h1,1 h1,wn h2s w
h2,1 hms hmw ,1 hmw ,n (c) (d)
ai), j1 ai), jT
Projection
hi), j1 hˆ ip, j hi), jT
ai ,1 ai), jt
hiw,1 hiw,1 hi), jt
Node-Level
Projection
Attention
BERT hip,1 a()i ,1j ),( i , m ) hip, m hip,1 a()i ,Tj ),( i , m ) hip, m
a()i ,1j ),( i ,1) a()i ,Tj ),( i ,1)
his his ai ,n hˆ is hi), j1 hi), jT
a()i ,1j ),( i , k ) a()i ,Tj ),( i , k )
Projection
a()i ,1j ),( i ,2) a()i ,Tj ),( i ,2)
hip,2 hip, k hip,2 hip, k
wCLS w1,1 w1,n wSEP wCLS wCLS wm ,1 wSEP hiw,n hiw,n
Figure 2. (a) An overview of HHGAT; (b) node initialization layer; (c) clause node encoding layer;
(d) pair node encoding layer.
3.4. Hierarchical Heterogeneous Graph Attention Network
3.4.1. Node Initialization Layer
In this layer, a word embedding matrix Ew ∈ Rdw ×dv is first applied to transform
each word wi,j into a vector vi,j . Here, dw and dv are the vocabulary size and embedding
dimension, respectively. Next, the contextual information for each word is captured through
a BiLSTM module:
w
hi,1 , · · · hi,j
w
· · · , hi,n
w
] =BiLSTM([vi,1 , · · · vi,j · · · , vi,n ]), (2)
w represents the hidden state of the j-th word in the i-th clause. Then, an attention
where, hi,j
module is adopted to aggregate the word representations in the clause ci :
his = Attention([ hi,1
w
, · · · hi,j
w
· · · , hi,n
w
]), (3)
where his is the vectorization representation of the i-th clause.
Furthermore, inspired by the BERT [55], we implement another version of node
initialization layer, which utilizes the pre-trained BERT model to replace above BiLSTM
and attention modules. The tokens [CLS] and [SEP] are inserted at the beginning and end of
a given clause ci , respectively, to obtain a sequence ci = [wCLS , wi,1 , · · · wi,j · · · , wi,n , wSEP ].
It is worth noting that wi,j represents the j-th token, rather than j-th word of the clause ci , in
the BERT version. Afterwards, the sequences corresponding to all clauses in the document
are concatenated to form a whole sequence, and then input it to ' BERT. Through stacked (
transformer modules, we can obtain the output vectors ∪im=1 hi,1 w , · · · hw · · · , hw
i,j i,n and
s m
hi i=1 , which are the initialization representations of word and clause nodes, respectively.
Here, his is the output of wCLS corresponding to the clause ci .
3.4.2. Clause Node Encoding Layer
Inner-clause relationships plays an important role in semantic understanding. In
addition, a word can be also treated as a specific relation between the clauses containing
it. Therefore, to further learn the semantic representation of a clause node, we extract
each clause node and its connected word nodes from the hierarchical graph to build a
fine-grained word-clause subgraph. Given a constructed subgraph Giwc , with the clause
n
node ci and word nodes wi,j j=1 , we apply a heterogeneous graph attention network to
update the representation of the clause node.
369
Electronics 2022, 11, 2884
Since two types of nodes exist in the heterogeneous subgraph, different types of nodes
may belong to different feature spaces. Consequently, type-specific transformation matrices
Ws and Ww are adopted to respectively project the features of clause and word nodes, with
possibly different dimensions into the same feature space. The projection process can be
shown in the following:
his = Ws · his ,
w
hi,j = Ww · hi,j
w
, (4)
where his is the initialization representation of clause node ci , and hi,j
w denotes the initializa-
tion representation of word node wi,j .
The node-level attention mechanism is then applied to learn the importance of different
neighboring nodes to each target node. For a word-clause subgraph Giwc , the clause node
ci ∈ V c is the target
n node, while the corresponding neighboring nodes come from the word
node set wi,j j=1 . Specifically, importance scores are computed through a linear layer
parameterized by w1 , and then they are normalized to obtain weight coefficients via the
softmax function. Next, according to these weight coefficients, the node aggregation over
the subgraph is conducted by a weighted summation. In addition, we also apply a residual
connection when updating the semantic representation of the clause node ci . The specific
process is as follows:
ei,j = LeakyReLU(w1 · tanh(
his w
hi,j )), (5)
exp(ei,j )
ai,j = , (6)
∑nk=1 exp(ei,k )
ĥis = ReLU(∑ j=1 ai,j ·
n w
hi,j + bw ) + his , (7)
where w1 is trainable weight matrix, bw is the bias parameter, denotes the concatenation
operation, and represents the transpose of matrix. As a result, the clause representation
ĥis integrating word semantics is generated.
Once obtaining updated node representation ĥis , it is fed into the emotion clause
classifier to determine whether the clause corresponding to ci is an emotion clause or not,
and the classifier is implemented by a linear layer (parameterized by we and be ) with the
sigmoid function:
ŷie = sigmoid(we · ĥis + be ) , (8)
where ŷie is the predicted probability that the clause node ci is an emotion clause. The
calculation process of obtaining the cause probability ŷic is similar to that of ŷie , except that
the parameters are replaced by wc and bc .
3.4.3. Pair Node Encoding Layer
It can be observed that there are only simple subordinate relationships between the clause
and pair nodes, rather than complex semantic relationships. Hence, we just need to consider
pair nodes and the correlation between them when performing subgraph segmentation in this
p
section. Furthermore, in a fine-grained pair-level subgraph Gi , the neighboring nodes of a
node pi,j are restricted to those nodes with the same emotion candidate as this one. Therefore,
p m p
a pair-level, fully connected subgraph is formalized as Gi = ( pi,j j=1 , Ei ). Moreover,
a meta-path Φt is described as a kind of path in the forms of pi,k → · · · pi,j−1 → pi,j and
pi,j ← pi,j+1 · · · ← pi,k , where t =|k − j| represents the number of hops from a source node
pi,k to the target node pi,j . According to the statistical results of [8], the proportion that the
distance between an emotion clause and the corresponding cause clause less than or equal to
2 is 95.8%. Taking into account this, we introduce four kinds of meta-paths: Φ0 , Φ1 , Φ2 , and
Φ3 . Different from the other three types of paths, Φ3 indicates the length of the path from the
source node to the target node is ≥ 3.
p p
Given a pair-level subgraph Gi , the initial representation hi,j of a node pi,j = (cie , ccj ) in
p
Gi is obtained by concatenating three vectors:
370
Electronics 2022, 11, 2884
p rep
hi,j = ĥis ĥsj hi,j , (9)
where ĥis and ĥsj represent the semantic representations of candidate emotion clause cie
rep
and candidate cause clause ccj , respectively. hi,j indicates the relative position embedding,
which is randomly initialized by the sampling of a uniform distribution. Considering
that the meta-path-based neighbors play different roles in the representation of each node,
we apply a meta-path-based graph attention network, which aggregates the features of
neighboring nodes from different-typed paths to update the representation of this node.
Specifically, two aggregation operations need to be performed.
Firstly, node-level attention is leveraged to aggregate the path-specific node represen-
p
tations. Specifically, for all pair nodes in the subgraph Gi , a shared linear transformation,
followed by the tanh function, is employed. Given a target node pi,j and meta-path Φt , the
weight coefficient e(Φi,jt ),(i,k) of a neighboring node pi,k that is connected to node pi,j through
meta-path Φt is calculated. e(Φi,jt ),(i,k) reflects the importance of node pi,k to node pi,j . The
weight coefficients of all Φt -based neighboring nodes are then normalized via the softmax
function. By weighted summation, Φt -specific aggregate representation Φt
hi,j of the node pi,j
is generated:
hi,j = Wp · hi,j ,
p p p p
hi,k = Wp · hi,k , (10)
e(Φi,jt ),(i,k) = LeakyReLU(wΦt · tanh( hi,j
p p
hi,k )), (11)
Φt
1, pi,k ∈ Pi,j
e(Φi,jt ),(i,k) = I(Φi,jt ),(i,k) ·
e(Φi,jt ),(i,k) , I(Φi,jt ),(i,k) = Φt , (12)
0, pi,k ∈ / Pi,j
exp(e(Φi,jt ),(i,k) )
aΦ t
(i,j),(i,k)
= Φ
, (13)
k =1 exp( e(i,j),(i,k ) )
∑m t
Φt
hi,j = ReLU(∑k=1 aΦ
m t
·
p
hi,k + bΦt ), (14)
(i,j),(i,k)
p
where Wp and wΦt are trainable weight matrices, bΦt denotes the bias, and hi,j represents the
initial feature of node pi,j . In addition, I(Φi,jt ),(i,k) is the node mask, which injects structural
information into the model. Additionally, I(Φi,jt ),(i,k) = 1 means that pi,k belongs to the
Φt
Φt -based neighboring node set Pi,j of pi,j .
Secondly, path-level attention is applied to measure the importance of different meta-
paths to the target node. For this purpose, the path-specific aggregate representations
obtained by previous node-level attention are transformed into the weight values through
a linear transformation matrix. After that, the softmax function is employed to normalize
these weight values, so as to obtain the weight coefficients of different paths. Using the
learned weight coefficients, the aggregate representations from different meta-paths are
p p
fused with the initial node representation hi,j . The final semantic representation ĥi,j of node
pi,j is obtained by:
Φt
exp(w2 · Φt
hi,j )
ai,j = Φ
, (15)
∑t =0 exp(w2 · hi,jt )
T
∑t=0 ai,jΦt · hi,jΦt + hi,j ,
p T p
ĥi,j = (16)
where w2 is a trainable transformation matrix, the meta-path Φt belongs to the path set
Φt
Φ = {Φt }tT=0 , and T =|Φ|−1 . ai,j represents the weight coefficient of meta-path Φt to node
pi,j . Here, it is worth noting that, if the target nodes are different, the weight distribution of
the meta-paths is also different.
371
Electronics 2022, 11, 2884
Then, a logistic regression layer (parameterized by wp and b p ) is utilized to identify
whether each pair node is a true emotion-cause pair node:
ŷi,j = sigmoid(w
p p
p · ĥi,j + b p ) . (17)
3.5. Model Training and Optimization
The loss function of extracting emotion-cause pairs from a given document d is formu-
lated as follows:
m m
1
L p = − 2 · ∑ ∑ (yi,j · log(ŷi,j ) + (1 − yi,j ) · log(1 − ŷi,j )),
p p p p
(18)
m i =1 j =1
p
where yi,j is the ground-truth of node pi,j . To benefit from the other two subtasks, the loss
terms of the emotion extraction and cause extraction are introduced. For simplicity, only
the calculation process of loss term for the emotion extraction is provided in the following:
1 m
m ∑ i =1 i
Le = − · (ye · log(ŷie ) + (1 − yie ) · log(1 − ŷie )), (19)
where yie is the emotion annotation of clause ci . Therefore, the total loss of our model is
Ltotal = L p + Le + Lc . (20)
Finally, the purpose of the model training is to minimize the total loss. The overall
process is shown in Algorithm 1.
Algorithm 1: The overall process of HHGAT.
Input : The heterogeneous graph G = (V , E ), V = V w ∪ V c ∪ V p ,
The initial feature his of clause node ∀ci ∈ V c = {ci }im=1 ,
' (n
w of word node ∀ w ∈ V w = ∪m
The initial feature hi,j i,j i =1 wi,j j=1 .
' (m
Output: The clause node representations ĥis ,
' i=( 1
p m
The pair node representations ∪i=1 ĥi,j
m .
j =1
for word-clause subgraph Giwc ⊂ G wc do
Project feature space
his = Ws · his ;
' (n
for word node wi,j ∈ wi,j do
j =1
Project feature space w = W · hw ;
hi,j w i,j
Calculate the node-level weight coefficient ai,j ;
Update clause node feature ĥis = ReLU(∑nj=1 ai,j · w + b ) + hs ;
hi,j w i
p p
for pair-level subgraph Gi ⊂ Gi do
p
for pair node pi,j ∈ Gi do
p rep
Initialize the node representation hi,j = ĥis ĥsj hi,j ;
p
Project feature space h = Wp · h ;
p
i,j i,j
for meta-path Φt ∈ Φ do
Φt
for Φt −based neighboring node pi,k ∈ Pi,j do
Calculate the node-level weight coefficient aΦ t
(i,j),(i,k)
;
Aggregate node feature Φt Φt p
hi,j = ReLU(∑m a
k=1 (i,j),(i,k ) · h i,k + bΦt );
Φt
Calculate the weight coefficient ai,j of meta-path Φt ;
a Φt ·
h Φt + h ;
p p
Update pair node feature ĥ = ∑ T
i,j t=0 i,j i,j i,j
Calculate the total loss Ltotal = L p + Le + Lc ;
Back propagation and update parameters;
' (m ' (m
p
return ĥis , ∪im=1 ĥi,j .
i =1 j =1
372
Electronics 2022, 11, 2884
4. Experiments
4.1. Dataset and Evaluation Metrics
To evaluate our method, we utilized the benchmark ECPE dataset released by Xia and
Ding [4], which consists of 1945 Chinese news documents. In these documents, there are a
total of 490,367 candidate pairs, of which, the real emotion-cause pairs account for less than
1%, and each document possibly contains more than one emotion corresponding to multiple
causes. According to the data-split setting of previous work, the dataset was segmented
into 10 equal parts, and they were chosen as the train and test sets in the proportion of 9 to
1. In order to achieve statistically credible verification, we applied 10-fold cross-validation
and repeated the experiments 20 times to average the results. Furthermore, precision (P),
recall (R), and F1-score (F1) were selected as the evaluation metrics for emotion, cause, and
emotion-cause pair extraction.
4.2. Experimental Settings
In our experiments, to make a fair comparison, the word embedding trained in [4]
is utilized in our method. The dimensions of word embedding, BiLSTM’s hidden state,
and relative position embedding were set to 200, 100, and 50, respectively. In addition, for
our BERT version model, the output dimension of pre-trained BERT is 768. The weight
matrices and bias vectors involved in the two versions of our model were all randomly
initialized by a continuous uniform distribution, U( − 0.01, 0 .01). To avoid overfitting, we
applied dropout, and the dropout rate was set to 0.1. Compared to some excellent global
optimization algorithms [56–58], Adam [59] is more effective in deep learning. Therefore, in
the training process of our model, we utilized the Adam optimizer to update all parameters
with the learning rate of 0.005, mini-batch size of 32, and L2 regularization coefficient of
1 × 10−5 . Our models were performed on the NVIDIA GeForce RTX 2080 Ti GPUs.
4.3. Compared Methods
We compared our method with the following state-of-the-art methods. It is worth
noting that the models above the dotted line in Table 1 did not adopt BERT.
Table 1. Comparison of experimental results on the emotion extraction, cause extraction, and ECPE.
Emotion Extraction Cause Extraction Emotion-Cause Pair Extraction
Category Method P R F1 P R F1 P R F1
Inter-EC [4] 0.8364 0.8107 0.8230 0.7041 0.6083 0.6507 0.6721 0.5705 0.6128
Pipelined Inter-ECNC [31] - - - 0.6863 0.6254 0.6544 0.6601 0.5734 0.6138
DQAN [35] - - - 0.7732 0.6370 0.6979 0.6733 0.6040 0.6362
E2EECPE [53] 0.8552 0.8024 0.8275 0.7048 0.6159 0.6571 0.6491 0.6195 0.6315
MTNECP [37] 0.8662 0.8393 0.8520 0.7400 0.6378 0.6844 0.6828 0.5894 0.6321
SLSN [42] 0.8406 0.7980 0.8181 0.6992 0.6588 0.6778 0.6836 0.6291 0.6545
LAE-MANN [38] 0.8990 0.8000 0.8470 - - - 0.7110 0.6070 0.6550
TDGC [54] 0.8716 0.8244 0.8474 0.7562 0.6471 0.6974 0.7374 0.6307 0.6799
End-to-end ECPE-2D [39] 0.8627 0.9221 0.8910 0.7336 0.6934 0.7123 0.7292 0.6544 0.6889
PairGCN [8] 0.8857 0.7958 0.8375 0.7907 0.6928 0.7375 0.7692 0.6791 0.7202
UTOS [52] 0.8815 0.8321 0.8556 0.7671 0.7320 0.7471 0.7389 0.7062 0.7203
RANKCP [7] 0.9123 0.8999 0.9057 0.7461 0.7788 0.7615 0.7119 0.7630 0.7360
RSN [48] 0.8614 0.8922 0.8755 0.7727 0.7398 0.7545 0.7601 0.7219 0.7393
w/o BERT 0.8361 0.8327 0.8337 0.7157 0.6519 0.6811 0.7143 0.6238 0.6654
Ours
HHGAT 0.8655 0.9181 0.8906 0.7427 0.7988 0.7686 0.7458 0.7631 0.7525
• Inter-EC, which uses emotion extraction to facilitate cause extraction, archives the best
performance among the three pipelined methods proposed in [4].
• Inter-ECNC [31], as a variant of Inter-EC, employs transformer to optimize the extrac-
tion of cause clauses.
• DQAN [35] is a dual-questioning attention network, separately questioning candidate
emotions and causes.
373
Electronics 2022, 11, 2884
• E2EECPE [53] is an end-to-end link prediction model of directed graph, which estab-
lishes the directional links from emotions to causes by a biaffine attention.
• MTNECP [37] is a feature-shared, multi-task model and improves cause extraction
with the help of position-aware emotion information.
• SLSN [42] is a symmetrical network composed of two subnetworks. Each subnetwork
also performs a local pairing search, while extracting each target clause.
• LAE-MANN [38] explores a hierarchical attention to model the correlation between
each pair of clauses.
• TDGC [54] is a transition-based, end-to-end model that regards ECPE as the construc-
tion process of directed graph.
• ECPE-2D [39] designs a 2D transformer to model the interaction between candidate pairs.
• PairGCN [8] employs a GCN to learn the dependency relations between candidate pairs.
• UTOS [52] redefines the ECPE task as a unified sequence labeling task, in which each
label indicates not only the clause type, but also pairing index.
• RANKCP [7] is a ranking model that introduces a GAT to learn the representations of
clauses.
• RSN [48] explicitly realizes the pairwise interaction between the three subtasks through
multiple rounds of inference.
4.4. Main Results
The comparative results are shown in Table 1. We can observe that HHGAT achieves
the best performance. In general, the end-to-end models obviously perform better than
the pipelined models (e.g., Inter-EC, Inter-ECNC, and DQAN) because the end-to-end
manner can avoid the cross-stage propagation of errors. In addition, better performance is
usually achieved by the models with pre-trained BERT than those without it. Significantly,
in terms of the F1-score, the non-BERT version of HHGAT outperforms SLSN (i.e., it is
the best-performing model, without employing pre-trained BERT, and is based on LSTM)
by 1.09% on emotion-cause pair extraction, which verifies the effectiveness of HHGAT for
emotion-cause pair extraction.
By adopting BERT to encode the initial representation of nodes, the performance of
HHGAT is further improved. Although LAE-MANN also designs a hierarchical attention
network, it is not graph structure oriented, so it is inferior to our graph attention network in
modeling the structural features of text. As shown in Table 1, LAE-MANN underperforms
HHGAT by 9.75% in the F1-score of emotion-cause pair extraction. Inspired by Inter-
EC, which utilizes the prediction results of emotions to promote cause extraction, ECPE-
2D, UTOS, and RSN explicitly establish the interaction between emotion and cause, in
their respective ways, to improve their performance. However, even without using the
measures used in the above three methods, our model still outperforms them. Compared
to the best-performing model RSN, the F1-scores of our HHGAT are increased by 1.51%,
1.41%, and 1.32% on emotion, cause, and emotion-cause pair extraction, respectively. This
demonstrates that, even if the interaction between emotion and cause is not explicitly
constructed, HHGAT can achieve excellent performance because of powerful modeling
ability of the graph neural network.
Furthermore, TDGC, PairGCN, and RANKCP all employ graph structures to represent
documents. However, TDGC is not realized by the graph neural network, but by LSTM, so
its performance is the worst among these graph structure-based methods. Despite PairGCN
and RANKCP employ GCN and GAT to learn node representations, respectively, they are
all homogeneous graph oriented. This leads them to only focus on learning the correlations
between the same kind of semantic elements. Different from them, our heterogeneous
graph contains more kinds of nodes and richer semantic information. Compared to these
three-graph, structure-based methods, our method improves the F1 score of emotion-cause
pair extraction by 7.26%, 3.23%, and 1.65%, respectively. In summary, experimental results
indicate that our method, based on the heterogeneous graph, is effective.
374
Electronics 2022, 11, 2884
4.5. Ablation Study
To further validate the components of our model, we conduct an ablation experiment,
where G1 denotes the clause node encoding layer, G2 represents the pair node encoding
layer, and H1 and H2 correspond to the heterogeneous design of G1 and G2, respectively.
The ablation results are shown in Table 2.
Table 2. Experimental results of structural ablation.
Emotion Extraction Cause Extraction Emotion-Cause Pair Extraction
Method
P R F1 P R F1 P R F1
HHGAT 0.8655 0.9181 0.8906 0.7427 0.7988 0.7686 0.7458 0.7631 0.7525
w/o G2 0.8553 0.9164 0.8839 0.7365 0.7970 0.7644 0.7093 0.7692 0.7361
w/o G2&H1 0.8625 0.9116 0.8860 0.7300 0.7654 0.7464 0.6895 0.7296 0.7075
w/o G1 0.8618 0.9021 0.8808 0.7381 0.7583 0.7477 0.7113 0.7224 0.7164
w/o G1&H2 0.8375 0.9170 0.8748 0.7308 0.7615 0.7449 0.6884 0.7379 0.7111
w/o G1&G2 0.8596 0.9148 0.8858 0.7296 0.7456 0.7353 0.6831 0.7169 0.6974
Firstly, HHGAT removes G2, resulting in the absence of dependency relations between
local neighboring candidate pairs. As a result, the F1-score of emotion-cause pair extraction
is decreased by 1.64%. This demonstrates that it is not enough to rely solely on modeling
the word-clause connections. Specially, without an explicit interaction between emotion
and cause, local context from neighboring pair nodes plays an important role in pairing the
emotions and their corresponding causes.
Secondly, HHGAT w/o G2&H1 means that it only applies a graph attention network to
learn the inter-clause relationships. Compared with HHGAT, the F1-score on emotion-cause
pair extraction drops by 4.5%. The significant degradation of performance is mainly caused
by the following two aspects. On the one hand, as the basic elements in clauses, words
can provide more fine-grained semantic information. On the other hand, word nodes can
enrich the correlations among clause nodes.
Then, HHGAT w/o G1 underperforms HHGAT by 0.98%, 2.09%, and 3.61% in the F1
scores of the three subtasks, respectively, which shows that our hierarchical design is beneficial
to the ECPE task. This is because there is a natural hierarchical relationship between different
semantic elements in human language. In addition, in the joint learning of three subtasks,
good clause representation is helpful for the extraction of emotion-cause pairs.
Next, we can observe that the performance of HHGAT w/o G1&H2 is further dropped,
compared with HHGAT w/o G1, because HHGAT w/o G1&H2 does not consider that
the semantic information aggregated from neighboring nodes on different meta-paths is
different. Hence, to learn more comprehensive pair node representations, it is necessary to
employ a graph attention network based on meta-path on the pair-level subgraphs.
Finally, HHGAT w/o G1&G2 uses a clause-level BiLSTM to replace our two-layer
graph attention network, which means that it is not a GNN-based method. Consequently,
HHGAT w/o G1&G2 achieves the worst performance in all ablation models (F1-score
dropped by 5.51%). The above results further show that each module of our method is
helpful for the ECPE task.
4.6. Evaluation on Emotion-Cause Extraction
To provide a wider comparison, we also evaluate our model on the benchmark ECE
corpus [2], and the compared models are as follows:
• Multi-Kernel [2] proposes a convolution kernel-based learning method to train a
multi-kernel SVM.
• Memnet [15] is a convolutional deep memory network, which regards ECE as an
answer retrieval task.
• PAE-DGL [27], as a reordering model, integrates the relative position and global label,
with text content.
375
Electronics 2022, 11, 2884
• CANN [18] presents a co-attention network based on emotional context awareness.
• MBiAS [24] designs a multi-granularity bidirectional attention network in a machine
comprehension frame.
• RTHN [21] introduces a hierarchical neural network composed of RNN and transformer.
• FSS-GCN [30] adopts a graph convolutional network to model the dependency infor-
mation between clauses.
The comparative results are shown in Figure 3. It can be observed that our model
achieves slightly higher F1 than RTHN (i.e., the best-performing one in the models that are
not based on graph neural networks). This further verifies the effectiveness of our approach
on emotion-cause extraction. Furthermore, the performance of our model and FSS-GCN
(i.e., a graph structure-based model) is nearly matched, in terms of the F1-score. Different
from FSS-GCN, in which only clause nodes are considered, the heterogeneous graph built
by us contains more kinds of nodes, and the structure of our model is more complicated.
However, it is worth noting that the compared methods listed in Figure 3 all need to
annotate emotions before extracting causes. This is very labor-consuming. Therefore, when
the performance is equivalent, our method is more suitable for real applications.
Figure 3. Comparison of experimental results on ECE.
4.7. Case Study
4.7.1. Effect of Word-Clause Graph Attention
As shown in Figure 4, the information regarding the three clauses in one representative
case (i.e., Document 41) is introduced, including the word identifier, clause identifier, and de-
tails of the clause. This document consists of eight clauses and contains one emotion-cause
pair (c4 , c3 ), where c4 and c3 are the emotion and cause clauses, respectively. To examine
the effect of word-clause graph attention, we visualize the weight vector ai = [ ai,1 , . . . , ai,n ].
The visualization results are shown in Figure 4—where the darker the color is, the higher
the relevance is.
376
Electronics 2022, 11, 2884
Figure 4. Visualization of word-clause attention.
We can find that the dark color is mainly concentrated around the word “anxious” in
the emotion clause c4 , which indicates that HHGAT can effectively capture the emotion
keywords and ignore other non-emotion words. Moreover, in the cause clause c3 , the words
“unable”, “to”, and “consider” are significantly darker, which semantically constitutes the
cause for triggering the emotion “anxious”. This shows that our HHGAT is also able to
focus on the cause keywords. In sharp contrast, the color of all words in clause c2 is very
similar, which causes attention to be dispersed because c2 is neither an emotion clause nor
a cause clause. Consequently, HHGAT is effective in learning the features of emotion and
cause clauses.
4.7.2. Effect of Meta-Path-Based Attention
In this section, Document 41 is analyzed again to verify the effect of meta-path-based
attention. To this end, we visualize the weight coefficients of different-typed meta-paths
to each pair node, as shown in Figure 5. Since the document consists of eight clauses,
we divide the visualization results into eight subgraphs, and each subgraph shows the
attention visualization results of those pair nodes with the same candidate emotion clause.
The color instructions are the same as that in the previous section.
Figure 5. Visualization of meta-path-based attention.
From the visualization results in Figure 5, we can observe that the color distribution on
these subgraphs is very similar. In each subgraph, the color of Φ0 corresponding to the pair
node containing the ground-truth cause is the darkest. Additionally, in each row, the path
377
Electronics 2022, 11, 2884
with the largest weight coefficient to the target node is mostly the one where the real cause
lies. In addition, as the offset from the central node or path increases, the correlation usually
becomes lower. This shows that our method can find pair nodes containing ground-truth
causes, according to the meta-paths.
Next, we conduct an inter-graph analysis, comparing the maximum attention coeffi-
cients in those rows corresponding to the ground-truth causes. In addition to Document
41, we also select the documents numbered 43, 167, and 151 as representative cases, where
their emotion-cause pairs are p5,5 , p6,4 , and p5,4 , respectively. The comparison results are
shown in Figure 6. We can notice that the highest point on each fold line is consistent
with the ground-truth emotion-cause pair, which indicates that our meta-path-based graph
attention network can effectively identify the emotion-cause pairs. It is worth noting that
the values of all points on the fold line denoting Document 43 are relatively close. This
is because the clause c5 in Document 43 is both an emotion and cause clause, and each
pair node on the fold line includes the clause c5 . The above results further verify that our
method is effective for ECPE.
Figure 6. The inter-graph analysis of meta-path-based attention.
4.7.3. Error Analysis
In this section, we collect all emotion-cause pairs that were erroneously predicted on the
test set. Inspired by [52], we also classify these errors into four categories, i.e., emotion, cause,
both, and missing errors. Depending on the statistical results in Table 3, we can notice that the
proportion of cause errors is the largest, followed by both errors. However, we can find that
most of both errors are due to unlabeled emotions, which are usually irrelevant to the topic of
the document. Furthermore, the proportion of missing errors is also relatively large. Therefore,
we select two cases to analyze the cause and missing errors, respectively.
Table 3. The statistics of error emotion-cause pairs.
Category Emotion Error Cause Error Both Error Missing Error
Proportion 3.3% 46.2% 30.8% 19.7%
For the first case in Table 4, our model correctly predicts the emotion-cause pair p8,8 ,
while it identifies Clause 8 as the cause clause in the emotion-cause pair p10,9 by mistake. It
may be the cause of the prediction error that Clause 8 triggers the occurrence of the event
described in Clause 9. Therefore, the ability of our model in distinguishing the indirect
causes from direct causes needs to be further strengthened. Furthermore, in the prediction
result of Case 2, the ground-truth emotion-cause pair p3,5 is missing. We observe that
the clause “it feels like the sky is falling down” is a metaphor, so it expresses an implicit
emotion. Obviously, there are no emotion keywords in implicit emotional expression, and
378
Electronics 2022, 11, 2884
the identification of such emotions needs to comprehensively consider language style,
rhetoric, metaphor, and so on, so it is more difficult to identify implicit emotions.
Table 4. Two error cases.
Case Truth Prediction
[ ... ]. [Xiao was holding Long’s 2-year-old son]7 . [Fearing that
[8, 8] [8, 8]
Long would hurt the child]8 , [he knocked Long on the head with a
[10, 9] [10, 8]
lid]9 , [and then Long became angry]10 . [ ... ].
[ ... ]. [“It feels like the sky is falling down”]3 . [Xu Ping described
how she felt when she learned that her husband was ill]4 , [he [3, 5] []
knocked Long on the head with a lid]5 . [ ... ].
The superscript number at the end of a clause indicates the clause number.
5. Conclusions and Future Work
In this paper, we propose HHGAT to capture the global semantic information con-
tained in the documents. Specifically, we first constructed a heterogeneous graph that
considers all types of semantic elements involved in the ECPE and models the global
semantic relations between these elements. Secondly, we proposed a hierarchical het-
erogeneous graph attention network to learn the representations of clauses and clause
pairs with global semantic information. Thirdly, we conducted extensive experiments on
the benchmark ECPE dataset. The experimental results show that our proposed method
achieves a better performance than the 13 compared methods and out-performs the best
competitor, RSN, by a 1.32% F1-score.
In addition, the essence of pairing emotions and causes is to calculate the similarity
between them. Nevertheless, similarity is a fuzzy, and not clearly defined, concept. It is
difficult for traditional graph neural networks to handle the fuzzy relationship. Therefore,
we will introduce fuzzy graph theory [60–62] into graph neural networks in our future
work, so as to effectively learn the fuzzy relation between clauses.
Author Contributions: J.Y.: conceptualization, methodology, formal analysis, software, validation,
visualization, and writing original draft; W.L.: resources, supervision, project administration, and
writing review; Y.H.: conceptualization, formal analysis, writing review, and editing; B.Z.: funding
acquisition, data curation, and visualization. All authors have read and agreed to the published
version of the manuscript.
Funding: This work was funded in part by the National Natural Science Foundation of China, under
grant No. 61672448, grant No. 61673142, and grant No. 61972167, as well as, in part, by the Key
R&D project of Hebei Province, under grant No. 18270307D, and Natural Science Foundation of
Heilongjiang Province of China, under grant No. JJ2019JQ0013.
Data Availability Statement: Not applicable.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Lee, S.Y.M.; Chen, Y.; Huang, C.-R. A Text-Driven Rule-Based System for Emotion Cause Detection. In Proceedings of the
2010 North American Chapter of the Association for Computational Linguistics (NAACL), Los Angeles, CA, USA, 5 June 2010;
pp. 45–53.
2. Gui, L.; Wu, D.; Xu, R.; Lu, Q.; Zhou, Y. Event-Driven Emotion Cause Extraction with Corpus Construction. In Proceedings of the
2016 Empirical Methods in Natural Language Processing, Austin, TX, USA, 1–5 November 2016; pp. 1639–1649.
3. Xu, R.; Hu, J.; Lu, Q.; Wu, D.; Gui, L. An Ensemble Approach for Emotion Cause Detection with Event Extraction and Multi-Kernel
SVMs. Tsinghua Sci. Technol. 2017, 22, 646–659. [CrossRef]
4. Xia, R.; Ding, Z. Emotion-Cause Pair Extraction: A New Task to Emotion Analysis in Texts. In Proceedings of the 57th Association
for Computational Linguistics, Florence, Italy, 28 July 2019; pp. 1003–1012.
5. Gori, M.; Monfardini, G.; Scarselli, F. A New Model for Learning in Graph Domains. In Proceedings of the 2005 Neural Networks,
Montreal, QC, Canada, 31 July 2005–4 August 2005; Volume 2, pp. 729–734.
379
Electronics 2022, 11, 2884
6. Scarselli, F.; Gori, M.; Tsoi, A.C.; Hagenbuchner, M.; Monfardini, G. The Graph Neural Network Model. IEEE Trans. Neural Netw.
2009, 20, 61–80. [CrossRef] [PubMed]
7. Wei, P.; Zhao, J.; Mao, W. Effective Inter-Clause Modeling for End-to-End Emotion-Cause Pair Extraction. In Proceedings of the
58th Association for Computational Linguistics, Online, 5–10 July 2020; pp. 3171–3181.
8. Chen, Y.; Hou, W.; Li, S.; Wu, C.; Zhang, X. End-to-End Emotion-Cause Pair Extraction with Graph Convolutional Network. In
Proceedings of the 28th Computational Linguistics, Barcelona, Spain, 8–13 December 2020; pp. 198–207.
9. Chen, Y.; Lee, S.Y.M.; Li, S.; Huang, C.-R. Emotion Cause Detection with Linguistic Constructions. In Proceedings of the 23rd
Computational Linguistics (Coling 2010), Beijing, China, 23–27 August 2010; pp. 179–187.
10. Gao, K.; Xu, H.; Wang, J. Emotion Cause Detection for Chinese Micro-Blogs Based on ECOCC Model. Advances in Knowledge Discovery
and Data Mining; Springer International Publishing: Cham, Switzerland, 2015; pp. 3–14.
11. Gao, K.; Xu, H.; Wang, J. A Rule-Based Approach to Emotion Cause Detection for Chinese Micro-Blogs. Expert Syst. Appl. 2015,
42, 4517–4528. [CrossRef]
12. Russo, I.; Caselli, T.; Rubino, F.; Boldrini, E.; Martínez-Barco, P. EMOCause: An Easy-Adaptable Approach to Emotion Cause
Contexts. In Proceedings of the 2nd Computational Approaches to Subjectivity and Sentiment Analysis, Portland, OR, USA,
24 June 2011; pp. 153–160.
13. Gui, L.; Yuan, L.; Xu, R.; Liu, B.; Lu, Q.; Zhou, Y. Emotion Cause Detection with Linguistic Construction in Chinese Weibo Text. In
Proceedings of the Natural Language Processing and Chinese Computing, Shenzhen, China, 5–9 December 2014; pp. 457–464.
14. Ghazi, D.; Inkpen, D.; Szpakowicz, S. Detecting Emotion Stimuli in Emotion-Bearing Sentences. In Computational Linguistics and
Intelligent Text Processing; Springer International Publishing: Cham, Switzerland, 2015; pp. 152–165.
15. Gui, L.; Hu, J.; He, Y.; Xu, R.; Lu, Q.; Du, J. A Question Answering Approach for Emotion Cause Extraction. In Proceedings of the
2017 Empirical Methods in Natural Language Processing, Copenhagen, Denmark, 7–11 September 2017; pp. 1593–1602.
16. Cheng, X.; Chen, Y.; Cheng, B.; Li, S.; Zhou, G. An Emotion Cause Corpus for Chinese Microblogs with Multiple-User Structures.
ACM Trans. Asian Low-Resour. Lang. Inf. Process. 2017, 17, 1–19. [CrossRef]
17. Chen, Y.; Hou, W.; Cheng, X. Hierarchical Convolution Neural Network for Emotion Cause Detection on Microblogs. In
Proceedings of the International Conference on Artificial Neural Networks and Machine Learning (ICANN 2018), Cham,
Switzerland, 2018; pp. 115–122.
18. Li, X.; Song, K.; Feng, S.; Wang, D.; Zhang, Y. A Co-Attention Neural Network Model for Emotion Cause Analysis with
Emotional Context Awareness. In Proceedings of the 2018 Empirical Methods in Natural Language Processing, Brussels, Belgium,
31 October–4 November 2018; pp. 4752–4757.
19. Li, X.; Feng, S.; Wang, D.; Zhang, Y. Context-Aware Emotion Cause Analysis with Multi-Attention-Based Neural Network. Knowl.
Based Syst. 2019, 174, 205–218. [CrossRef]
20. Yu, X.; Rong, W.; Zhang, Z.; Ouyang, Y.; Xiong, Z. Multiple Level Hierarchical Network-Based Clause Selection for Emotion
Cause Extraction. IEEE Access 2019, 7, 9071–9079. [CrossRef]
21. Xia, R.; Zhang, M.; Ding, Z. RTHN: A RNN-Transformer Hierarchical Network for Emotion Cause Extraction. In Proceedings of
the 28th International Joint Conference on Artificial Intelligence, IJCAI-19, Macao, China, 10–16 August 2019; pp. 5285–5291.
22. Fan, C.; Yan, H.; Du, J.; Gui, L.; Bing, L.; Yang, M.; Xu, R.; Mao, R. A Knowledge Regularized Hierarchical Approach for Emotion
Cause Analysis. In Proceedings of the 2019 Empirical Methods in Natural Language Processing and the 9th International Joint
Conference on Natural Language Processing (EMNLP-IJCNLP), Hong Kong, China, 3–7 November 2019; pp. 5614–5624.
23. Hu, J.; Shi, S.; Huang, H. Combining External Sentiment Knowledge for Emotion Cause Detection. In Proceedings of the Natural
Language Processing and Chinese Computing, Dunhuang, China, 9–14 October 2019; pp. 711–722.
24. Diao, Y.; Lin, H.; Yang, L.; Fan, X.; Chu, Y.; Wu, D.; Xu, K.; Xu, B. Multi-Granularity Bidirectional Attention Stream Machine
Comprehension Method for Emotion Cause Extraction. Neural. Comput. Applic. 2020, 32, 8401–8413. [CrossRef]
25. Chen, Y.; Hou, W.; Cheng, X.; Li, S. Joint Learning for Emotion Classification and Emotion Cause Detection. In Proceedings of the
2018 Empirical Methods in Natural Language Processing, Brussels, Belgium, 3 October–4 November 2018; pp. 646–651.
26. Hu, G.; Lu, G.; Zhao, Y. Emotion-Cause Joint Detection: A Unified Network with Dual Interaction for Emotion Cause Analysis. In
Proceedings of the Natural Language Processing and Chinese Computing, Zhengzhou, China, 14–18 October 2020; pp. 568–579.
27. Ding, Z.; He, H.; Zhang, M.; Xia, R. From Independent Prediction to Reordered Prediction: Integrating Relative Position and
Global Label Information to Emotion Cause Identification. Proc. AAAI Conf. Artif. Intell. 2019, 33, 6343–6350. [CrossRef]
28. Xu, B.; Lin, H.; Lin, Y.; Diao, Y.; Yang, L.; Xu, K. Extracting Emotion Causes Using Learning to Rank Methods from an Information
Retrieval Perspective. IEEE Access 2019, 7, 15573–15583. [CrossRef]
29. Xiao, X.; Wei, P.; Mao, W.; Wang, L. Context-Aware Multi-View Attention Networks for Emotion Cause Extraction. In Proceedings
of the 2019 Intelligence and Security Informatics (ISI), Shenzhen, China, 1–3 July 2019; pp. 128–133.
30. Hu, G.; Lu, G.; Zhao, Y. FSS-GCN: A Graph Convolutional Networks with Fusion of Semantic and Structure for Emotion Cause
Analysis. Knowl. Based Syst. 2021, 212, 106584. [CrossRef]
31. Shan, J.; Zhu, M. A New Component of Interactive Multi-Task Network Model for Emotion-Cause Pair Extraction. In Proceedings
of the 3rd Computer Information Science and Artificial Intelligence (CISAI), Inner Mongolia, China, 25–27 September 2020;
pp. 12–22.
380
Electronics 2022, 11, 2884
32. Vaswani, A.; Shazeer, N.; Parmar, N.; Uszkoreit, J.; Jones, L.; Gomez, A.N.; Kaiser, Ł.; Polosukhin, I. Attention Is All You Need.
In Proceedings of the Advances in Neural Information Processing Systems (NIPS), Long Beach, CA, USA, 4–9 December 2017;
pp. 5998–6008.
33. Yu, J.; Liu, W.; He, Y.; Zhang, C. A Mutually Auxiliary Multitask Model with Self-Distillation for Emotion-Cause Pair Extraction.
IEEE Access 2021, 9, 26811–26821. [CrossRef]
34. Jia, X.; Chen, X.; Wan, Q.; Liu, J. A Novel Interactive Recurrent Attention Network for Emotion-Cause Pair Extraction. In
Proceedings of the 3rd Algorithms, Computing and Artificial Intelligence, New York, NY, USA, 24 December 2020; pp. 1–9.
35. Sun, Q.; Yin, Y.; Yu, H. A Dual-Questioning Attention Network for Emotion-Cause Pair Extraction with Context Awareness. In
Proceedings of the 2021 International Joint Conference on Neural Networks (IJCNN), Online, 18–22 July 2021; pp. 1–8.
36. Shi, J.; Li, H.; Zhou, J.; Pang, Z.; Wang, C. Optimizing Emotion–Cause Pair Extraction Task by Using Mutual Assistance Single-Task
Model, Clause Position Information and Semantic Features. J. Supercomput. 2021, 78, 4759–4778. [CrossRef]
37. Wu, S.; Chen, F.; Wu, F.; Huang, Y.; Li, X. A Multi-Task Learning Neural Network for Emotion-Cause Pair Extraction.
In Proceedings of the 24th European Conference on Artificial Intelligence—ECAI 2020, Santiago de Compostela, Spain,
29 August–8 September 2020.
38. Tang, H.; Ji, D.; Zhou, Q. Joint Multi-Level Attentional Model for Emotion Detection and Emotion-Cause Pair Extraction.
Neurocomputing 2020, 409, 329–340. [CrossRef]
39. Ding, Z.; Xia, R.; Yu, J. ECPE-2D: Emotion-Cause Pair Extraction Based on Joint Two-Dimensional Representation, Interaction and
Prediction. In Proceedings of the 58th Annual Meeting of the Association for Computational Linguistics, Online, 6–8 July 2020;
pp. 3161–3170.
40. Fan, R.; Wang, Y.; He, T. An End-to-End Multi-Task Learning Network with Scope Controller for Emotion-Cause Pair Extraction.
In Proceedings of the Natural Language Processing and Chinese Computing, Zhengzhou, China, 14–18 October 2020; pp. 764–776.
41. Ding, Z.; Xia, R.; Yu, J. End-to-End Emotion-Cause Pair Extraction Based on Sliding Window Multi-Label Learning. In Proceedings
of the 2020 Empirical Methods in Natural Language Processing (EMNLP), Online, 16–20 November 2020; pp. 3574–3583.
42. Cheng, Z.; Jiang, Z.; Yin, Y.; Yu, H.; Gu, Q. A Symmetric Local Search Network for Emotion-Cause Pair Extraction. In Proceedings
of the 28th International Conference on Computational Linguistics, Barcelona, Spain, 8–13 December 2020; pp. 139–149.
43. Wu, D.; Wu, C. Research on the Time-Dependent Split Delivery Green Vehicle Routing Problem for Fresh Agricultural Products
with Multiple Time Windows. Agriculture 2022, 12, 793. [CrossRef]
44. Deng, W.; Ni, H.; Liu, Y.; Chen, H.; Zhao, H. An Adaptive Differential Evolution Algorithm Based on Belief Space and Generalized
Opposition-Based Learning for Resource Allocation. Appl. Soft Comput. 2022, 127, 109419. [CrossRef]
45. Singh, A.; Hingane, S.; Wani, S.; Modi, A. An End-to-End Network for Emotion-Cause Pair Extraction. In Proceedings of the
Eleventh Workshop on Computational Approaches to Subjectivity, Sentiment and Social Media Analysis, Online, 19 April 2021;
pp. 84–91.
46. Fan, W.; Zhu, Y.; Wei, Z.; Yang, T.; Ip, W.H.; Zhang, Y. Order-Guided Deep Neural Network for Emotion-Cause Pair Prediction.
Appl. Soft Comput. 2021, 112, 107818. [CrossRef]
47. Yang, X.; Yang, Y. Emotion-Type-Based Global Attention Neural Network for Emotion-Cause Pair Extraction. In Proceedings of
the International Conference on Natural Computation, Fuzzy Systems and Knowledge Discovery (ICNC-FSKD), Fuzhou, China,
July 30–August 1 2022; pp. 546–557.
48. Chen, F.; Shi, Z.; Yang, Z.; Huang, Y. Recurrent Synchronization Network for Emotion-Cause Pair Extraction. Knowl. Based Syst.
2022, 238, 107965. [CrossRef]
49. Yuan, C.; Fan, C.; Bao, J.; Xu, R. Emotion-Cause Pair Extraction as Sequence Labeling Based on A Novel Tagging Scheme. In
Proceedings of the Empirical Methods in Natural Language Processing (EMNLP), Online, 16–20 November 2020; pp. 3568–3573.
50. Fan, C.; Yuan, C.; Gui, L.; Zhang, Y.; Xu, R. Multi-Task Sequence Tagging for Emotion-Cause Pair Extraction Via Tag Distribution
Refinement. IEEE/ACM Trans. Audio Speech Lang. Process. 2021, 29, 2339–2350. [CrossRef]
51. Chen, X.; Li, Q.; Wang, J. A Unified Sequence Labeling Model for Emotion Cause Pair Extraction. In Proceedings of the 28th
International Conference on Computational Linguistics, Barcelona, Spain, 8–13 December 2020; pp. 208–218.
52. Cheng, Z.; Jiang, Z.; Yin, Y.; Li, N.; Gu, Q. A Unified Target-Oriented Sequence-to-Sequence Model for Emotion-Cause Pair
Extraction. IEEE/ACM Trans. Audio Speech Lang. Process. 2021, 29, 2779–2791. [CrossRef]
53. Song, H.; Zhang, C.; Li, Q.; Song, D. An End-to-End Multi-Task Learning to Link Framework for Emotion-Cause Pair Extraction.
arXiv 2020, arXiv:2002.10710.
54. Fan, C.; Yuan, C.; Du, J.; Gui, L.; Yang, M.; Xu, R. Transition-Based Directed Graph Construction for Emotion-Cause Pair
Extraction. In Proceedings of the 58th Annual Meeting of the Association for Computational Linguistics, Online, 5–10 July 2020;
pp. 3707–3717.
55. Devlin, J.; Chang, M.-W.; Lee, K.; Toutanova, K. BERT: Pre-Training of Deep Bidirectional Transformers for Language Understand-
ing. In Proceedings of the 2019 Conference of the North American Chapter of the Association for Computational Linguistics:
Human Language Technologies, Volume 1 (Long and Short Papers), Minneapolis, MN, USA, 2–7 June 2019; pp. 4171–4186.
56. Yao, R.; Guo, C.; Deng, W.; Zhao, H. A Novel Mathematical Morphology Spectrum Entropy Based on Scale-Adaptive Techniques.
ISA Trans. 2022, 126, 691–702. [CrossRef] [PubMed]
57. Zhou, X.; Ma, H.; Gu, J.; Chen, H.; Deng, W. Parameter Adaptation-Based Ant Colony Optimization with Dynamic Hybrid
Mechanism. Eng. Appl. Artif. Intell. 2022, 114, 105139. [CrossRef]
381
Electronics 2022, 11, 2884
58. Deng, W.; Xu, J.; Gao, X.-Z.; Zhao, H. An Enhanced MSIQDE Algorithm with Novel Multiple Strategies for Global Optimization
Problems. IEEE Trans. Syst. Man Cybern. Syst. 2022, 52, 1578–1587. [CrossRef]
59. Kingma, D.P.; Ba, J. Adam: A Method for Stochastic Optimization. In Proceedings of the 3rd International Conference for Learning
Representations (ICLR), San Diego, CA, USA, 7–9 May 2015.
60. Akram, M. M−Polar Fuzzy Graphs: Theory, Methods & Applications; Studies in Fuzziness and Soft Computing; Springer International
Publishing: Cham, Switzerland, 2019; pp. 1–3, ISBN 978-3-030-03750-5.
61. Akram, M.; Zafar, F. Hybrid Soft Computing Models Applied to Graph Theory; Studies in Fuzziness and Soft Computing; Springer
International Publishing: Cham, Switzerland, 2020; Volume 380, ISBN 978-3-030-16019-7.
62. Akram, M.; Luqman, A. Fuzzy Hypergraphs and Related Extensions; Studies in Fuzziness and Soft Computing; Springer: Singapore,
2020; Volume 390, ISBN 9789811524028.
382
electronics
Article
Application of Improved YOLOv5 in Aerial Photographing
Infrared Vehicle Detection
Youchen Fan 1,† , Qianlong Qiu 1,† , Shunhu Hou 1 , Yuhai Li 1 , Jiaxuan Xie 1 , Mingyu Qin 2 and Feihuang Chu 1, *
1 School of Space Information, Space Engineering University, Beijing 101416, China; [email protected] (Y.F.);
[email protected] (Q.Q.); [email protected] (S.H.); [email protected] (Y.L.);
[email protected] (J.X.)
2 Graduate School, Department of Electronic and Optical Engineering, Space Engineering University,
Beijing 101416, China; [email protected]
* Correspondence: [email protected]; Tel.: +86-189-5518-5670
† These authors contributed equally to this work.
Abstract: Aiming to solve the problems of false detection, missed detection, and insufficient detec-
tion ability of infrared vehicle images, an infrared vehicle target detection algorithm based on the
improved YOLOv5 is proposed. The article analyzes the image characteristics of infrared vehicle
detection, and then discusses the improved YOLOv5 algorithm in detail. The algorithm uses the
DenseBlock module to increase the ability of shallow feature extraction. The Ghost convolution
layer is used to replace the ordinary convolution layer, which increases the redundant feature graph
based on linear calculation, improves the network feature extraction ability, and increases the amount
of information from the original image. The detection accuracy of the whole network is enhanced
by adding a channel attention mechanism and modifying loss function. Finally, the improved per-
formance and comprehensive improved performance of each module are compared with common
algorithms. Experimental results show that the detection accuracy of the DenseBlock and EIOU
module added alone are improved by 2.5% and 3% compared with the original YOLOv5 algorithm,
Citation: Fan, Y.; Qiu, Q.; Hou, S.; Li,
respectively, and the addition of the Ghost convolution module and SE module alone does not in-
Y.; Xie, J.; Qin, M.; Chu, F. crease significantly. By using the EIOU module as the loss function, the three modules of DenseBlock,
Application of Improved YOLOv5 in Ghost convolution and SE Layer are added to the YOLOv5 algorithm for comparative analysis, of
Aerial Photographing Infrared which the combination of DenseBlock and Ghost convolution has the best effect. When adding three
Vehicle Detection. Electronics 2022, 11, modules at the same time, the mAP fluctuation is smaller, which can reach 73.1%, which is 4.6%
2344. https://doi.org/10.3390/ higher than the original YOLOv5 algorithm.
electronics11152344
Academic Editor: José L. Abellán
Keywords: target detection; infrared; deep learning; YOLOv5 algorithm
Received: 14 June 2022
Accepted: 13 July 2022
Published: 27 July 2022
1. Introduction
Publisher’s Note: MDPI stays neutral With the gradual development of deep learning research, in-depth research in the field
with regard to jurisdictional claims in of computer vision constitutes not only a new change and development for people’s daily
published maps and institutional affil- lives, but also gives prospects for development in war and military training [1]. Among
iations. these prospects, the infrared imaging detection system is often used to detect and track local
targets in military reconnaissance, to collect enemy military intelligence, and to provide
guidance information for individual soldiers or conventional weapons to quickly obtain
battlefield intelligence. In recent years, land-vehicle reconnaissance technology is the key
Copyright: © 2022 by the authors.
research direction of battlefield control and surveillance capacity building, because in the
Licensee MDPI, Basel, Switzerland.
This article is an open access article
actual combat environment [2,3], the ground environment is very complex. Vehicle targets
distributed under the terms and
may have the characteristics of occlusion, overlap, blur, etc., and so through infrared vehicle
conditions of the Creative Commons
detection technology, ground vehicle targets and deployment can be more effectively found,
Attribution (CC BY) license (https:// which is conducive to the control of the battlefield and the overall situation.
creativecommons.org/licenses/by/ In terms of infrared vehicle detection, in 2013, Iwasaki et al. proposed an algorithm
4.0/). to detect vehicle position and motion by using thermal imaging obtained with an in-
Electronics 2022, 11, 2344. https://doi.org/10.3390/electronics11152344 https://www.mdpi.com/journal/electronics
383
Electronics 2022, 11, 2344
frared imaging sensor [4]. The algorithm specifies the vehicle position by applying a
pattern-recognition algorithm according to the change of pixel values. The algorithm uses
Haar-like features in each frame of the image, adopts a correction program for vehicle
misidentification. The two detections can be combined to obtain vehicle position and
motion information, and the vehicle detection accuracy is 96.3%. In 2017, Tang Tianyu
proposed an improved aerial vehicle detection method based on Faster R-CNN, which
was evaluated on the Munich vehicle dataset and the collected vehicle dataset, which
improved accuracy and robustness compared with existing methods [5]. In 2018, Liu
Xiaofei proposed a new method for ground-vehicle detection in aerial infrared images
based on convolutional neural network [6], and experiments on four different scenarios
on the NPU_CS_UAV_IR_DATA dataset showed that the proposed method was effective
and efficient for the identification of ground vehicles. The overall recognition accuracy
rate could reach 91.34%. In 2019, Lecheng Ouyang et al. [7] aimed at solving the problem
of the low accuracy of traditional vehicle target-detection methods in complex scenarios,
by combining them with the current hot development of deep learning. The YOLOv3
algorithm framework is used to achieve vehicle target detection, and by using the PASCAL
VOC2007 and VOC2012 datasets, the images containing vehicle targets are screened out to
form the VOC car dataset, and the target detection problem is transformed into a binary
classification problem. Compared with the traditional target detection algorithm, the recog-
nition accuracy of this method can reach 89.16%, and the average operating speed is 21FPS.
In 2020, H. Li et al. proposed an incremental learning infrared vehicle-detection method
based on (single-hot multiBox detector (SSD) for problems related to the lack of details in
infrared vehicle images [8], the difficulty in extracting feature information, and low detec-
tion accuracy. This detection method can effectively identify and locate infrared vehicles,
compared with the results of infrared vehicle detection using incremental datasets and
non-incremental datasets. Experimental results show that the use of incremental datasets
has significantly improved the error detection and missed detection of infrared vehicles,
and the mAP has increased by 10.61%. In the same year, Mohammed Thakir Mahmood
et al. proposed an infrared image vehicle-detection system by using YOLO’s computer,
combined with YOLO to propose an infrared-based technology [9]. Compared with the
machine learning technique of K-means++ clustering algorithm, multi-object detection
using convolutional neural networks, and the deep learning mechanism of infrared images,
the method can run at a speed of 18.1 frames per second, with good performance. In 2022,
Zhu Zijian et al. proposed a small target detection method for aerial infrared vehicles based
on parallel fusion network [10]. An improved YOLOv3 algorithm based on cross-layer
connection is proposed, which can accurately detect small targets of infrared vehicles in
the background of complex motion, and achieve higher detection accuracy in the case of
low false alarm rate, of which the false alarm rate is only 0.01% and the missed detection
rate is only 1.36%.
Existing technologies have proven that the YOLOv3 algorithm has a good recognition
performance for infrared vehicles [11–17]; however, on the basis of the YOLOv3 algorithm,
in order to further improve the extraction ability of small targets, the YOLOv5 algorithm is
generated [18–20]. In 2021, Kasper–Eulaers used the YOLOv5 algorithm to detect heavy
trucks in winter rest areas, and the results showed that the trained algorithm could detect
the front cabin of heavy trucks with high confidence. This article will also use the vehicle as
an identification object for experiments under the improved YOLOv5 model. In the same
year, Wu et al. combined local FCN and YOLOv5 to the detection of small targets in remote
sensing images [20]. The application effects of R-CNN, FRCN, and R-FCN in image feature
extraction are analyzed, and the high adaptability of the YOLOv5 algorithm to different
scenarios is realized, and the proposed YOLOv5 algorithm + R-FCN detection method is
compared with other algorithms. Experimental results show that the YOLOv5+R-FCN
detection method has better detection ability among many algorithms.
Although the above literature has proven the applicability and advanced nature of the
existing YOLOv3 and YOLOv5 infrared vehicle-detection algorithms, there is no unified
384
Electronics 2022, 11, 2344
and efficient detection method for the problems of false detection, missed detection, and
detection accuracy in the multi-target and small target scenarios in the infrared vehicle
images, so this paper proposes an infrared vehicle target detection algorithm based on
improved YOLoOv5. The algorithm uses the EnseBlock module to improve the missed
detection rate and detection accuracy through the dense characteristics between the feature
layers. The use of Ghost convolutional layers to replace ordinary convolutional layers
reduces the amount of parameters under the same characteristics, reduces the size of
the model, and increases the amount of information in the original image. By adding
channel attention mechanisms and changing the loss function, the inter-channel features
are interrelated, and the anchor frame description is more accurate, which enhances the
detection accuracy of the overall network, reduces the rate of missed detection, and is
experimented and verified on the public infrared vehicle dataset.
2. Infrared Vehicle Image Data and Characteristic Analysis
2.1. Dataset Introduction
The dataset is derived from the public dataset used in the Space Cup competition [21],
consisting of 16,000 images of infrared vehicles captured by drones equipped with infrared
cameras. The dataset contains images of a single infrared vehicle target, as well as multi-
target images. Some of the images contain false targets similar to vehicle targets, whereas
others have the phenomenon of vehicles obscured by complex environments. Therefore,
this dataset can be used for multi-target detection, as well as detection under complex
ambient occlusion. At the same time, the pixel ratio of the ground truth of the detection
target is between 0.04 and 0.1 in the training set, and most of them are small targets, due to
the blurry edge characteristics of infrared images. Most target recognition is difficult, so it
is a relatively complete dataset in general. Part of the dataset image is shown in Figure 1.
Figure 1. Dataset partial image example. (a) Single target. (b) Multi-target. (c) Single target in
complex environment. (d) Multi-target in complex environment.
2.2. Image Characteristic Analysis
The images in the dataset are infrared vehicle images, which are single-channel
grayscale images from 0 to 255. For this kind of image, a three-dimensional coordinate
system is used to visualize the gray value information of the entire image. The xoy plane
is used as the image plane, and the value of the z axis represents the gray value of the
corresponding coordinate pixel. Secondly, the grayscale histogram is used for data analysis,
reflecting the frequency of each gray level in the image. In the histogram, the abscissa is
the gray level and the ordinate is the frequency of the gray level in the image, as shown in
Figure 2.
As can be seen from Figure 2a, when the drone is closer to the target, its characteristics
are apparent. The target image can be seen in the original image, and the target three-
dimensional grayscale plot in Figure 2b is significantly higher than that of the background
image, and the frequency of pixels is close to the actual target gray value in the grayscale
histogram. Figure 2c is less high, making it easier to detect such a target. In Figure 2d,
when the target shooting distance is far away, and the target is in a complex environment,
the gray value of the three-dimensional grayscale plot Figure 2e is relatively more chaotic.
The pixel frequency is similar to the actual target gray value in the grayscale histogram.
385
Electronics 2022, 11, 2344
Figure 2f is higher, so that the target is easily submerged in the background of the similar
gray value, and the detection is more difficult.
Figure 2. Image Characteristic analysis. (a) Original image. (b) 3D grayscale plot. (c) Grayscale
histogram. (d) Original image in complex environment. (e) 3D grayscale plot. (f) Grayscale histogram.
Because the drone shoots at a distance, the infrared vehicle pixels in the figure account
for a relatively small proportion of the entire image, as shown in Figure 2d, where the
ground truth of a single target vehicle occupies 0.04% of the entire image in the training set.
Therefore, the image has the characteristics of both infrared grayscale images and small
targets, and is accompanied by the influence of multi-target and false targets. As shown
in Figure 2d, target 4 is a false target, which increases the difficulty of infrared vehicle
detection and not only reduces the accuracy of the detection algorithm, but also the feature
extraction quality of the target detection network will be affected by different data content,
resulting in a certain randomness of the training model. That is, for the training sets and
verification sets for different images, the detection probability of the infrared vehicle target
will fluctuate randomly within a certain range.
3. Improved Algorithm for YOLOv5
3.1. Model Improvement Ideas
The improvement of neural networks is an important field in neural networks [22,23],
based on a baseline, adding, replacing, and deleting the middle layer on the original
network, improving the loss function, optimizer, and related parameters, or combining
other target processing techniques. Its purpose is to fuse and optimize various neural
networks to improve the positioning accuracy, classification accuracy, classification speed
and model size of the data.
The improved algorithm uses the main module of DenseNet to increase the extraction
ability of shallow features by linking the dense superposition between the feature layers; it
replaces the ordinary convolution layer with the Ghost convolution layer, to improve the
network redundant feature-extraction ability and increase the amount of information in the
original image by extracting the redundant feature map obtained by linear calculation of
input images based on different parameters. By adding the channel attention mechanism,
the features between the channels can be correlated with each other to improve the detection
accuracy of the network layer and change the loss function to more accurately describe
386
Electronics 2022, 11, 2344
the relationship between the prediction box and the real box, and enhance the detection
accuracy of the overall network anchor frame.
3.2. Dense Convolutional Network (DenseNet)
The Dense Convolutional Network (DenseNet) has four main advantages, namely
alleviating the gradient disappearance problem, enhancing feature propagation (retain low-
latitude features), promoting feature reuse, and greatly reducing the number of parameters.
When the CNN layers get deeper, the path from output to input will become longer, which
will cause a problem: the gradient will probably disappear when it is backpropagated to
the input through such a long path, DenseNet proposes a very simple way to make the
network deep and the gradient does not disappear by establishing dense connections to
reuse features. To solve this problem, the following is the schematic diagram of DenseBlock,
as shown in Figure 3.
Figure 3. Schematic diagram of the DenseBlock structure.
As can be seen from Figure 3, the output of each layer is connected to the input of
the latter layer, for an L layer network, there will be connections. For each layer, all the
previous feature layers are the inputs of the current layer, and the feature layers are the
subsequent inputs, forming a full interlink, and the feature maps extracted by each layer
can be used by subsequent layers.
DenseNet consists of four DenseBlocks and the connected translation layers. The
text additionally extracts DenseBlock as a pluggable module for acquiring and connecting
denser image features at the beginning of the network structure, but due to its own
characteristics, the number of output channels is determined by the number of input
channels, module layers, and the learning multiple, which cannot be freely defined. The
robustness is poor, and specific parameters need to be adjusted to join the network as
a module.
3.3. End-Side Neural Networks (GhostNet)
In CNN models, redundancy in feature maps is very important, but few people
consider the problem of redundancy in feature maps in the model structure design. In
2021, He Kaiming et al. proposed a novel Ghost module that can use fewer parameters to
generate more feature maps. In the Ghost module, the feature map generated by the linear
operation is called the Ghost feature maps, and the feature map manipulated is called the
intrinsic feature maps. Obviously, the Ghost module’s computation is significantly reduced
compared to using conventional convolution directly. From another point of view, it can be
considered that the feature map obtained by convolution has been enhanced, similar to the
data augmentation. The Ghost convolutional structure is shown in Figure 4 below.
387
Electronics 2022, 11, 2344
Figure 4. Schematic diagram of Ghost convolutional structure.
3.4. Squeeze-and-Excitation Networks (SENet)
Squeeze-and-Excitation Networks (SENet) constitute a new image recognition struc-
ture announced by the autonomous driving company Momenta in 2017, which improves
accuracy by modeling correlations between feature channels and enhancing important
features. This structure is the winner of the 2017 ILSVR competition, with a top 5 error rate
of 2.251%, 25% lower than the first place in 2016. SENet strengthens the characteristics of
important channels and weakens the characteristics of non-important channels, which has
obtained good results. The SE layer structure is shown in Figure 5 below.
Figure 5. Schematic diagram of the structure of the SE layer.
3.5. EIOU Loss
YOLOv5 uses a combination of IOU Loss, GIOU Loss, and CIOU Loss, although CIOU
considers the overlapping area, center point distance, and aspect ratio of bounding box
regression. However, the difference in aspect ratio reflected by v in the formula is not the
true difference between the width and height and its confidence, so it sometimes hinders
the effective optimization similarity of the model. In response to this problem, in 2021,
Yi-Fan Zhang, Weiqiang Ren, Zhang Zhang, etc. took apart the aspect ratio on the basis
of CIOU, proposed EIOU Leoss, and added Focal and Efficient IOU Loss for Accurate
Bounding Box Regression.
The formula for the loss function EIOU Loss is as follows:
L EIOU = L IOU + Ldis + L asp
ρ2 (b,b gt ) ρ2 (w,w gt ) ρ2 (h,h gt ) (1)
= 1 − IOU + c2
+ Cw 2
+ Ch 2
The EIOU formula consists of three parts, namely the overlap loss, the center point
distance loss, and the width and height loss. The first part of the overlapping area loss is the
definition of the IOU itself: the area where the prediction box and the real box are combined
with the area ratio intersection, and the second part continues the center distance loss in
CIOU, that is, the Euclidean distance ratio between the prediction box and the real box
contains the square of the diagonal distance of the minimum external box of the prediction
box and the real box. The third part innovatively uses the Euclidean distance of the width
and height difference between the target box and the real box divided by the square of the
width and height of the minimum external box.
In summary, EIOU Loss describes the image overlapping area, the center point dis-
tance, the true difference between the length and width of the sides, solves the blurry
definition of aspect ratio based on CIOU, and adds Focal Loss to solve the sample imbal-
ance problem in BBox regression.
388
Electronics 2022, 11, 2344
3.6. Improved YOLOv5 Network
To describe improvement ideas, the improvement of the YOLOv5 network in this
paper is mainly divided into four parts:
1. For the image input network layer, the DenseBlock module is used to strengthen
the extraction of strong correlation features for shallow images, and reduce the im-
age correlation features lost in the initial stage of the network through multi-layer
dense networks.
2. For the backbone network, the Ghost convolution layer is used to replace the first
two general convolution layers, which increases the feature redundancy, reduces the
computation amount of the overall network, and increases the detection speed.
3. For the feature extraction network, the channel attention mechanism is introduced by
using the SE network layer, which strengthens the network detection capability on
the basis of the integration of image channel features.
4. For the loss function, the latest EIOU is used to replace the original CIOU of YOLOv5,
which improves the accuracy of the description relationship between the prediction
box and the GT box, and improves the network binding ability.
The four improved modules in this article are pluggable modules as shown in Figure 6.
The corresponding modules can be selected and added to the target detection network
according to the needs.
Figure 6. Improved YOLOv5 network.
4. Experiments on Improved Algorithms for Each Module
4.1. Training Environment Configuration
The specific experimental parameters are configured as shown in Table 1.
Table 1. Experimental parameter configuration.
Parameter Disposition
Operating system Linux
Redaction language Python 3.8
CUDA version 10.2
Pytorch 1.8.1
YOLOv5 6.0
GPU TITAN RTX
CPU Intel i9-10900K
Internal storage 125.8GB
389
Electronics 2022, 11, 2344
4.2. Experiments with Dense Convolutional Networks (DenseBlock)
In the experiment, first, the parameter adjustment experiment is carried out for each
improved module in the text, and then a single improved network is compared with
YOLOv5s. Finally the improved modules are synthesized and compared with the original
network and the current mainstream target detection network.
4.2.1. Experimental Parameters
Under the dataset, optimize the parameter settings of the DenseBlock module, i.e.,
Grow_rate and layers. Grow_rate represents how many feature layers are connected to the
previous feature layer and how many are connected to the back. The layers represent how
many DenseBlock dense link layers are used.
The DenseBlock module has the characteristics of the number of input channels and
parameter settings that determine the number of output channels, so there are two sets of
parameter settings for matching the number of channels before and after the experiment,
as shown in Table 2.
Table 2. DenseBlock module experimental parameter table.
Parameter Settings 8-3 16-1
Training times 100 100
Recognition rate(mAP) 0.616 0.602
Model size(mb) 14.43 14.43
Inference time(ms) 4.8 4.5
4.2.2. Training Results
The training results for different parameter selections are shown in Figure 7.
Figure 7. Comparison results of DenseBlock parameters. (a) Target loss. (b) Accuracy rate. (c) Recalling
rate. (d) mAP value.
From Figure 7a, it can be seen that the target loss value of the 8-3 experimental
group is lower than that of the 16-1 experimental group. That is, the target anchor frame
390
Electronics 2022, 11, 2344
classification is more accurate, and from Figure 7b,d, it can be seen that the detection
accuracy of the 8-3 experimental group in the first 20 epochs is lower than that of the 16-1
experimental group, but with the increase of the number of trainings. When the epoch
reaches more than 40 times and the experimental result tends to stabilize, the detection
accuracy of the 8-3 experimental group is higher. As can be seen from Figure 7c, there is no
significant difference in recall rates.
For the parameter growth_rate and num_layers used in the DenseBlock module, due
to the limitation of input and output channels, a total of 2 parameter combinations were
used for comparative experiments. It can be seen that under the premise of the same model
size, the DenseBlock module with more dense layers and lower learning rate has an obvious
performance advantage, but it is worth mentioning that the training time of adding the
DenseBlock module is longer, the training configuration requirements are higher, and the
amount of computation is greater.
4.2.3. Testing Results
The detection results before and after adding the DenseBlock module are shown in
Figures 8–10.
Figure 8. YOLOv5s detection map. (a) Scene 1. (b) Scene 2. (c) Scene 3. (d) Scene 4.
Figure 9. 8-3 DenseBlock detection results. (a) Scene 1. (b) Scene 2. (c) Scene 3. (d) Scene 4.
Figure 10. 16-1 DenseBlock detection results. (a) Scene 1. (b) Scene 2. (c) Scene 3. (d) Scene 4.
As can be seen from Figures 8–10, whether the 8-3 experimental group or the 16-1
experimental group, the average confidence in detecting infrared small target vehicles is
higher than that of the original algorithm, and the experimental group of 8-3 performed
better than the experimental group of 16-1. This shows that the DenseBlock module with
391
Electronics 2022, 11, 2344
8-3 parameters is more suitable for the detection of this dataset, and this parameter group
is used in the comprehensive module of subsequent experiments.
4.3. Experiments with End-Side Neural Networks (GhostNet)
4.3.1. Experimental Parameters
According to the feature map redundancy of the Ghost convolutional layer, it can be
inferred that the deep feature map is not suitable for feature redundancy inference by using
linear calculation. Therefore, the replaced convolutional layers are close to the input layer,
which are the backbone network convolutional layers. The parameter settings such as the
number of Ghost convolutional layers replaced, training time, and recognition rate in the
experiment are shown in Table 3.
Table 3. Ghost module experimental parameter table.
Ghost Convolutional
1 2 3 4
Replacement Quantity
Training times 100 100 100 100
Recognition rate(mAP) 0.64 0.655 0.613 0.599
Model size(mb) 14.05 13.99 13.71 12.57
Inference time(ms) 4.2 4.3 4.4 4.4
4.3.2. Training Results
The training results for different parameter selections are shown in Figure 11.
Figure 11. Comparison of the number of GhostConv replacements. (a) Confidence loss. (b) Accuracy
rate. (c) Recalling rate. (d) mAP value.
From Figure 11a, it can be seen that the Ghost experimental group replacing the
two convolution layers had lower target loss values during training, and it can be seen
392
Electronics 2022, 11, 2344
from Figure 11b that the detection accuracy of the 4-2 experimental group was higher in
the 30 epochs after the training results tended to stabilize. From Figure 11c,d, it can be
seen that the recall rate and detection accuracy of the 4-2 experimental group in a total of
100 epoch training are always higher than that of other experimental groups, and the gap
is noticeable.
For a single Ghost module, although the model size is effectively reduced with the
increase of the number of substitutions, after replacing three ordinary convolution layers,
the recognition rate shows a downward trend. That is, too much feature map redundancy
harms the detection accuracy, and in terms of model size and inference time, the more Ghost
convolutional replacements, the smaller the model, and the slower the inference time.
When replacing two convolution layers, the network recognition rate shows a peak
due to the increase of the redundancy feature map, which proves that the redundancy
of the feature map is not always positive for the recognition rate, at the same time, the
inference time is faster, and the model size increases less. It is the best choice to replace the
two convolution layers, so the subsequent Ghost modules use a replacement number of
two Ghost convolutional modules by default.
4.3.3. Testing Results
After adding the corresponding Ghost module, the test result is shown in Figure 12.
Figure 12. Ghost convolutional test results. (a) Scene 1. (b) Scene 2. (c) Scene 3. (d) Scene 4.
From the comparison of Figures 8 and 12, it can be seen that the network that joins
the Ghost convolution can accurately detect the vehicle target, and the detection accuracy
has been improved in each scene. Among the two targets in scene 1, the detection accuracy
was the highest, increasing by 26% and 50% respectively.
4.4. Experiments with the Squeeze-and-Excitation Layer (SE Layer)
In the SE layer, the module position of the SE layer is optimized by parameter re-
duction, and the more suitable module position and parameters have been pre-selected
according to the previous experiments. See Table 4 for experimental parameters.
Table 4. SE module experimental parameter table.
Module Position and
Before SPPF After SPPF Reduction = 16 Reduction = 4
Parameters
Training times 50 50 50 50
Recognition rate (mAP) 0.661 0.655 0.612 0.667
Model size (mb) 14.67 14.67 14.67 14.47
Extrapolation time (ms) 4.5 4.4 4.4 4.4
4.4.1. Training Results
The training results for different parameter selections are shown in Figures 13 and 14.
393
Electronics 2022, 11, 2344
Figure 13. SE reduction parameter comparison results. (a) Target loss. (b) Accuracy rate. (c) Recalling
rate. (d) mAP value.
Figure 14. SE module position comparison result. (a) Target loss. (b) Accuracy rate. (c) Recalling rate.
(d) mAP value.
From Figure 13a, it can be seen that the target loss value is higher when the reduction
parameter is taken with reduction = 16. From Figure 13b–d, it can be seen that the totality
is relatively stable after 40 epochs, and the experimental group with a parameter of 16 has
a higher detection accuracy. As can be seen from Figure 14a,b, the target loss values of the
two experimental control groups are similar. The detection accuracy is generally similar.
As can be seen from Figure 14c,d, the overall mAP value of the target detection in the
pre-SPPF experimental group was higher due to the higher recall rate in the pre-SPPF
experimental group.
In terms of attention parameters, try where different SE layers are added, and finally
select SPPF before and after doing the comparison experiment. It can be seen that the SE
module is more suitable before the SPPF, according to the analysis of the role of SPPF can
be obtained. The SE module for the high-level features of the channel attention mechanism
is more biased toward the image features before the pooling layer rather than the semantic
features after the pooling layer. At the same time, according to the comparison of reduction
parameters, the SE model with a reduction of 4 performs prominently in a single epoch
but is not stable overall, whereas the overall trend results with a parameter of 16 perform
better. That is to say, increasing the decline rate of the hidden layer channel can improve
the detection rate of the image attention mechanism. Finally, the parameter reduction of
16 is selected according to the image.
4.4.2. Testing Results
When the SE module is added to the SPPF and the reduction parameter is selected 16,
the detection results are shown in Figure 15.
394
Electronics 2022, 11, 2344
Figure 15. SE layer detection results. (a) Scene 1. (b) Scene 2. (c) Scene 3. (d) Scene 4.
Compared with Figures 8 and 15, the average detection accuracy of the network with
the addition of an attention mechanism is significantly improved in each scene.
4.5. Experiments with EIOU
For the replacement loss function, because YOLOv5 used a total of GIOU, DIOU,
and CIOU, three kinds of loss functions, along with the development of the loss function
research, now YOLOv5 mainly uses CIOU. This article uses EIOU to replace CIOU. For
improved models, replacement loss function increases the detection recognition rate, so
the subsequent experiments are all replaced with EIOU loss functions. Training results are
shown in Figure 16 below.
Figure 16. EIOU detection results. (a) Target loss. (b) Accuracy rate. (c) Recalling rate. (d) mAP value.
As can be seen from Figure 16, compared with CIOU, the recall value increases and
the object loss value decreases in the detection results by using EIOU, and the mAP value
of the EIOU group in the overall model detection is significantly improved.
395
Electronics 2022, 11, 2344
5. Modular Combination Improved Algorithm Experiment
5.1. Improved YOLOv5 Network Experiment
In order to improve the detection effect of the comprehensive improved model, the
single module is compared, and they are added to the original YOLOv5 algorithm in pairs.
The results are shown in Tables 5 and 6. Refer to [24,25] for a graphical representation of
the optimization results. Convert the mAP column in Table 5 to a histogram as Figure 17
shows and convert the mAP column in Table 6 to a histogram as Figure 18 shows.
Table 5. Comparison table of results for individual module.
Improved Modules YOLOv5s Ghost Convolution DenseBlock SE Module
Number of trainings 100 100 100 100
Recognition rate(mAP) 0.685 0.650 0.713 0.660
Model size(mb) 14.07 13.99 14.43 14.67
Extrapolation time(ms) 4.2 4.3 4.8 4.4
Table 6. Comparison table of results for the synthesis improved module.
Network Structure YOLOv5s Dense + Ghost + SE Dense + Ghost Ghost + SE Dense + SE
Number of trainings 100 100 100 100 100
Recognition rate(mAP) 0.685 0.731 0.73 0.753 0.685
Model size(mb) 14.07 14.80 14.36 14.59 15.15
Extrapolation time(ms) 4.2 8.5 5.0 4.5 8.6
Figure 17. Single-module mAP histogram.
Figure 18. Comprehensive improvement of mAP histogram.
5.1.1. Training Results
Figure 16 shows the comparison between the detection accuracy of the DenseBlock, Ghost
convolution and SE modules and the detection accuracy of the original YOLOv5 algorithm.
The characteristics and applicable scenes of each module can be drawn from Figure 19,
and from Figure 19a, the confidence loss of the DenseBlock module is significantly lower
than that of other modules. That is, the module is more effective in improving the detection
396
Electronics 2022, 11, 2344
accuracy and stability of the target. As can be seen from Figure 19b,c, although the SE mod-
ule can improve the recognition accuracy, it will lead to a decrease in the recall rate; from
Figure 19d, when used alone, the DenseBlock module has the most obvious improvement,
but the mAP value of Ghost convolution and SE module does not improve significantly. A
combination of these modules and the comprehensive improvement comparison chart is
shown in Figure 20.
Figure 19. Comparison of results of single-module training. (a) Target loss. (b) Accuracy rate.
(c) Recalling rate. (d) mAP value.
As can be seen from Figure 20a,b, the target loss value and anchor-frame loss value
after the combination of DenseBlock, Ghost Convolution and SE module are the lowest.
As can be obtained from Figure 20c, the accuracy of the three module combinations is also
the highest. In Figure 20d, although the recall rate after the combination of DenseBlock,
Ghost convolution, and SE module is not the highest. It has the smallest fluctuation
after 40 epochs and is more stable. As can be seen from Figure 20e, although the mAP
value is not significantly improved when using the Ghost convolution and SE module
alone, the combined effect is obvious. There is a mutual inhibition effect between the
DenseBlock module and the SE module, resulting in no obvious difference between the
superimposed effect of the two and the original algorithm. From the analysis of the module
principle, SE is a hybrid single-layer, multi-channel information feature used to improve the
detection ability. At the same time, the use of the DenseBlock module with multiple feature
layers in series makes the feature complexity increase instead of decrease, reducing the
detection accuracy. Compared with other improvements, the comprehensive improvement
in detection ability has improved the detection stability, while maintaining the lowest
target loss value and the best detection effect. However, in some cases where the model
detection speed is required to be high, or the size and computing power of the model are
397
Electronics 2022, 11, 2344
limited by the installed equipment, using the Ghost + SE improvement module with similar
comprehensive improvement effect may be an option.
Figure 20. Comprehensive improvement comparison chart. (a) Target loss. (b) Anchor-frame loss;
(c) Accuracy rate. (d) Recalling rate. (e) mAP value.
398
Electronics 2022, 11, 2344
5.1.2. Testing Results
The results of the improved network for infrared vehicle target detection are shown in
Figures 21–25.
Figure 21. YOLOv5 detection map. (a) Scene 1. (b) Scene 2. (c) Scene 3. (d) Scene 4.
Figure 22. Dense + Ghost detection diagram. (a) Scene 1. (b) Scene 2. (c) Scene 3. (d) Scene 4.
Figure 23. Dense + SE detection diagram. (a) Scene 1. (b) Scene 2. (c) Scene 3. (d) Scene 4.
Figure 24. Dense + Ghost detection diagram. (a) Scene 1. (b) Scene 2. (c) Scene 3. (d) Scene 4.
399
Electronics 2022, 11, 2344
Figure 25. Dense + Ghost + SE detection diagram. (a) Scene 1. (b) Scene 2. (c) Scene 3. (d) Scene 4.
It can be seen from Figures 21–25 that for the two small targets in scene 1, the de-
tection accuracy of Dense + Ghost is improved by 18% and 46%, respectively, compared
with the original YOLOv5. Dense + SE is improved by 16% and 43%, respectively, and
Dense + Ghost is respectively improved by 18% and 46%. Dense + Ghost is improved by
20% and 51%, and Dense + Ghost + SE is improved by 18% and 52%, respectively. In
the objectives of scene 2 and scene 3, the combination of the two modules is improved
compared to the original YOLOv5, and the detection effect of the Dense + Ghost + SE
combination is not much different from that of the two combinations. At the same time,
in scene 4, the Dense + Ghost + SE modules detect the target vehicle that is not detected
by other modules. In general, the Dense + Ghost + SE modules combination has better
detection performance for small targets, and has a higher probability to detect targets that
could not be found in the previous network due to low accuracy.
6. Conclusions
The article analyzes the characteristics of infrared vehicle images, starting from the
four improvement modules of DenseBlock, Ghost Convolution, SE Module, and EIOU. The
original YOLOv5 network is improved, and experiments are carried out on the effect of
each module. The advantages and disadvantages of each module are analyzed, and the
two combinations are compared and analyzed, and the following conclusions are drawn:
1. When the module is used alone, the accuracy of DenseBlock and EIOU modules are
significantly improved, and the Ghost convolution and SE modules are not signifi-
cantly improved, which is almost the same as the original network, or even lower.
2. When the module is used in combination, in addition to the combination of Dense-
Block module and SE module, the other combinations have obvious improvement
effects. When using three modules at the same time, the target loss value is the lowest,
the accuracy rate is the highest, and the mAP value is the most stable.
3. For a small target with occlusion, whether it is the original YOLOv5 or the two–
two combination module, it has not been detected, and the phenomenon of missed
detection has occurred. When using three modules at the same time, the occlusion
targets can be effectively detected, and the rate of missed detection can be reduced.
4. When using the improved algorithm in this paper, the insertion-extraction module
can be adjusted according to different task requirements. For example, the DenseBlock
module can be added to the detection target requiring higher stability. If a higher
detection probability is required, the SE module can be added to the neck layer of the
improved network. If higher detection speed is required, DenseBlock or SE module
can be removed.
Combined with the experimental results and conclusions, the next steps are clarified:
1. Although the missed target is detected, the confidence is not high, and the network
needs to be further optimized.
2. In the actual scene, the infrared vehicle target is not only interfered by the background
of vegetation, buildings, etc., but also by smoke and electromagnetic interference,
resulting in the degradation of the image quality. How to extract the vehicle target in
the complex interference environment is a challenge for future work.
400
Electronics 2022, 11, 2344
Author Contributions: Conceptualization, Y.F. and Q.Q.; methodology, Y.F.; software, Q.Q.; valida-
tion, S.H.; Y.L. and J.X.; formal analysis, Y.F.; resources, F.C.; data curation, Q.Q.; writing-original
draft preparation, S.H.; writing-review and editing, M.Q.; supervision, M.Q.; funding acquisition, Y.F.
All authors have read and agreed to the published version of the manuscript.
Funding: This research was funded by Key Basic Research Projects of the Basic Strengthening
Program, grant number 2020-JCJQ-ZD-071.
Data Availability Statement: Not applicable.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Kim, J.; Hong, S.; Baek, J.; Lee, H. Autonomous vehicle detection system using visible and infrared camera. In Proceedings of the
2012 12th International Conference on Control, Automation and Systems, Jeju, Korea, 17–21 October 2012; pp. 630–634.
2. Chen, D.; Jin, G.; Lu, L.; Tan, L.; Wei, W. Infrared Image Vehicle Detection Based on Haar-like Feature. In Proceedings of the
2018 IEEE 3rd Advanced Information Technology, Electronic and Automation Control Conference (IAEAC), Chongqing, China,
12–14 October 2018; pp. 662–667.
3. Liu, Y.; Su, H.; Zeng, C.; Li, X. A Robust Thermal Infrared Vehicle and Pedestrian Detection Method in Complex Scenes. Sensors
2021, 21, 1240. [CrossRef] [PubMed]
4. Iwasaki, Y.; Kawata, S.; Nakamiya, T. Vehicle detection even in poor visibility conditions using infrared thermal images and
its application to road traffic flow monitoring. In Emerging Trends in Computing, Informatics, Systems Sciences, and Engineering;
Springer: New York, NY, USA, 2013; pp. 997–1009.
5. Tang, T.; Zhou, S.; Deng, Z.; Zou, H.; Lei, L. Vehicle detection in aerial images based on region convolutional neural networks and
hard negative example mining. Sensors 2017, 17, 336. [CrossRef] [PubMed]
6. Liu, X.; Yang, T.; Li, J. Real-time ground vehicle detection in aerial infrared imagery based on convolutional neural network.
Electronics 2018, 7, 78. [CrossRef]
7. Ouyang, L.; Wang, H. Vehicle target detection in complex scenes based on YOLOv3 algorithm. IOP Conf. Ser. Mater. Sci. Eng.
2019, 569, 052018. [CrossRef]
8. Li, L.; Yuan, J.; Liu, H.; Cao, L.; Chen, J.; Zhang, Z. Incremental Learning of Infrared Vehicle Detection Method Based on
SSD. In Proceedings of the 2020 IEEE 20th International Conference on Communication Technology (ICCT), Nanning, China,
28–31 October 2020; pp. 1423–1426.
9. Mahmood, M.T.; Ahmed, S.R.A.; Ahmed, M.R.A. Detection of vehicle with Infrared images in Road Traffic using YOLO
computational mechanism. IOP Conf. Ser. Mater. Sci. Eng. 2020, 928, 022027. [CrossRef]
10. Zhu, Z.; Liu, Q.; Chen, H.; Zhang, G.; Wang, F.; Huo, J. Infrared Small Vehicle Detection Based on Parallel Fusion Network. Acta
Photonica Sin. 2022, 51, 0210001.
11. Redmon, J.; Divvala, S.; Girshick, R.; Farhadi, A. You Only Look Once: Unified, Real-Time Object Detection. In Proceedings of the
2016 IEEE Conference on Computer Vision and Pattern Recognition (CVPR), Las Vegas, NV, USA, 27–30 June 2016; pp. 779–788.
[CrossRef]
12. Zhang, X.; Zhu, X. Vehicle Detection in the aerial infrared images via an improved YOLOv3 network. In Proceedings of the 2019
IEEE 4th International Conference on Signal and Image Processing (ICSIP), Wuxi, China, 19–21 July 2019; pp. 372–376.
13. Li, Z.; Zhou, F. FSSD: Feature fusion single shot multibox detector. arXiv 2017, arXiv:1712.00960.
14. Redmon, J.; Farhadi, A. Yolov3: An incremental improvement. arXiv 2018, arXiv:1804.02767.
15. Han, J.; Liao, Y.; Zhang, J.; Wang, S.; Li, S. Target Fusion Detection of LiDAR and Camera Based on the Improved YOLO Algorithm.
Mathematics 2018, 6, 213. [CrossRef]
16. Deng, Z.; Yang, R.; Lan, R.; Liu, Z.; Luo, X. SE-IYOLOV3: An Accurate Small Scale Face Detector for Outdoor Security. Mathematics
2020, 8, 93. [CrossRef]
17. Zhang, X.; Zhu, X. Moving vehicle detection in aerial infrared image sequences via fast image registration and improved YOLOv3
network. Int. J. Remote Sens. 2020, 41, 4312–4335. [CrossRef]
18. Wang, Z.; Wu, L.; Li, T.; Shi, P. A Smoke Detection Model Based on Improved YOLOv5. Mathematics 2022, 10, 1190. [CrossRef]
19. Kasper-Eulaers, M.; Hahn, N.; Berger, S.; Sebulonsen, T.; Myrland, Ø.; Kummervold, P. Short Communication: Detecting Heavy
Goods Vehicles in Rest Areas in Winter Conditions Using YOLOv5. Algorithms 2021, 14, 114. [CrossRef]
20. Wu, W.; Liu, H.; Li, L.; Long, Y.; Wang, X.; Wang, Z. Application of local fully Convolutional Neural Network combined with
YOLO v5 algorithm in small target detection of remote sensing image. PLoS ONE 2021, 16, e0259283. [CrossRef] [PubMed]
21. The Third “Aerospace Cup” National Innovation and Creativity Competition Preliminary Round, Proposition 2, Track 2, Optical
Target Recognition, Preliminary Data Set. Available online: https://www.atrdata.cn/#/customer/match/2cdfe76d-de6c-48f1
-abf9-6e8b7ace1ab8/bd3aac0b-4742-438d-abca-b9a84ca76cb3?questionType=model (accessed on 15 March 2022).
22. Jiang, B.; Ma, X.; Lu, Y.; Li, Y.; Feng, L.; Shi, Z. Ship detection in spaceborne infrared images based on Convolutional Neural
Networks and synthetic targets. Infrared Phys. Technol. 2019, 97, 229–234. [CrossRef]
401
Electronics 2022, 11, 2344
23. Shi, M.; Wang, H. Infrared Dim and Small Target Detection Based on Denoising Autoencoder Network. Mob. Netw. Appl. 2020, 25,
1469–1483. [CrossRef]
24. Alrasheedi, A.F.; Alnowibet, K.A.; Saxena, A.; Sallam, K.M.; Mohamed, A.W. Chaos Embed Marine Predator (CMPA) Algorithm
for Feature Selection. Mathematics 2022, 10, 1411. [CrossRef]
25. Sharma, A.K.; Saxena, A. A demand side management control strategy using Whale optimization algorithm. SN Appl. Sci. 2019,
1, 870. [CrossRef]
402
electronics
Article
Monitoring Tomato Leaf Disease through Convolutional
Neural Networks
Antonio Guerrero-Ibañez 1 and Angelica Reyes-Muñoz 2, *
1 Faculty of Telematics, University of Colima, Colima 28040, Mexico
2 Computer Architecture Department, Polytechnic University of Catalonia, 08860 Barcelona, Spain
* Correspondence: [email protected]
Abstract: Agriculture plays an essential role in Mexico’s economy. The agricultural sector has a 2.5%
share of Mexico’s gross domestic product. Specifically, tomatoes have become the country’s most
exported agricultural product. That is why there is an increasing need to improve crop yields. One
of the elements that can considerably affect crop productivity is diseases caused by agents such as
bacteria, fungi, and viruses. However, the process of disease identification can be costly and, in
many cases, time-consuming. Deep learning techniques have begun to be applied in the process
of plant disease identification with promising results. In this paper, we propose a model based on
convolutional neural networks to identify and classify tomato leaf diseases using a public dataset
and complementing it with other photographs taken in the fields of the country. To avoid overfitting,
generative adversarial networks were used to generate samples with the same characteristics as the
training data. The results show that the proposed model achieves a high performance in the process
of detection and classification of diseases in tomato leaves: the accuracy achieved is greater than 99%
in both the training dataset and the test dataset.
Keywords: convolutional neural networks; deep learning; disease classification; generative adversarial
network; tomato leaf
Citation: Guerrero-Ibañez, A.; 1. Introduction
Reyes-Muñoz, A. Monitoring Tomato Tomato is one of the most common vegetables grown worldwide and is a high source
Leaf Disease through Convolutional of income for farmers. The 2020 statistical report of the Food and Agriculture Organization
Neural Networks. Electronics 2023, 12, Corporate Statistical Database (FAOSTAT) indicates that world tomato production was
229. https://doi.org/10.3390/ 186.821 million tons [1]. In Mexico, the tomato is one of the main crops within the national
electronics12010229
production, being considered as a basic ingredient both in Mexican cuisine and in general in
Academic Editors: Taiyong Li, the cuisine of various parts of the world. According to a report published by Our World in
Wu Deng and Jiang Wu Data in 2020, Mexico is among the top ten countries with the highest production of tomatoes,
with a production of 4.1 million tons per year [2]. The Mexican Ministry of Agriculture,
Received: 8 November 2022
Livestock, Rural Development, Fishing and Food (MALRDFF) through the AgriFood and
Revised: 20 December 2022
Fisheries Information Service presented the report on Mexico’s AgriFood Trade Balance,
Accepted: 20 December 2022
indicating that tomato is the second most exported agricultural product, with avocado
Published: 2 January 2023
taking the first place. Besides this, tomato production in Mexico has an annual variation
of 5.3% from 2011 to 2020 [3]. However, production is affected by different circumstances.
The Food and Agriculture Organization (FAO) estimates that crop diseases are responsible
Copyright: © 2023 by the authors. for losses ranging from 20 to 40% of total production [4]. Various diseases of the tomato
Licensee MDPI, Basel, Switzerland. plant can affect the product in terms of quantity and quality, thus decreasing productivity.
This article is an open access article Diseases can be classified into two main groups [5]. The first group of diseases is related to
distributed under the terms and infectious microorganisms including viruses, bacteria, and fungi. These types of diseases
conditions of the Creative Commons can spread rapidly from plant to plant in the field when environmental conditions are
Attribution (CC BY) license (https:// favorable. The second group of diseases is caused by non-infectious chemical or physical
creativecommons.org/licenses/by/ factors including adverse environmental factors, physiological or nutritional disorders and
4.0/).
Electronics 2023, 12, 229. https://doi.org/10.3390/electronics12010229 https://www.mdpi.com/journal/electronics
403
Electronics 2023, 12, 229
herbicide injury. While it is true that non-infectious diseases cannot spread from plant to
plant, diseases can spread if the entire plantation is exposed to the same adverse factor [6].
Some special conditions can cause plant diseases. Specifically, there is a conceptual
model known as the disease triangle which describes the relationship between three essen-
tial factors: the environment, the host and the infectious agent. If any of these three factors
is not present, then the triangle is incomplete, and therefore the disease does not occur.
There are abiotic factors such as air flow, temperature, humidity, pH, and watering that
can significantly affect the plant. The infectious agent is a kind of organism that attacks the
plant such as fungi, bacteria, virus, among others. The host is the plant which is affected by
a pathogen. When these factors occur simultaneously, disease is produced [7]. Generally,
diseases are manifested by symptoms that affect the plant from the bottom up and many of
these diseases have a rapid spread process after infection.
Figure 1 shows some of the most common diseases affecting tomato leaves including
mosaic virus, yellow leaf curl virus, target spot, two-spotted spider mite, septoria leaf spot,
leaf mold, late blight, early blight, and bacterial spot.
Figure 1. Representative images of the most common diseases affecting tomato leaves: (a) mosaic
virus, (b) yellow leaf curl virus, (c) target spot, (d) two-spotted spider mite, (e) septoria leaf spot,
(f) leaf mold, (g) late blight, (h) early blight and (i) bacterial spot.
Crops require continuous monitoring for early disease detection and thus the ability
to apply proper mechanisms to prevent its spread and the loss of production [8].
The traditional methods used for the detection of plant diseases focus on the visual
estimation of the disease by experts; studies of morphological characteristics to identify
the pathogens; and molecular, serological, and microbiological diagnostic techniques [9].
The visual estimation method for plant disease identification is based on the analysis of
characteristic disease symptoms (such as lesions, blight, galls and tumors) or visible signs
of a pathogen (uredinospores of Pucciniales, mycelium or conidia of Erysiphales). Visual
estimation is very subjective, as it is performed according to the experience of experts, so the
accuracy of identification cannot be measured, and it is affected by temporal variation [10].
Microscopic methods focus on pathogen morphology for disease detection. However, these
methods are expensive, time-consuming in the detection process and lead to low detection
efficiency and poor reliability. In addition, farmers do not have the necessary knowledge to
carry out the detection process, and agricultural experts cannot be in the field all the time
to carry out proper monitoring.
New innovative techniques need to address the challenges and trends demanded by
the new vision of agricultural production that requires higher accuracy levels and near
real-time detection.
In recent years, different technologies such as image processing [11,12], pattern recog-
nition [13,14] and computer vision [15,16] have rapidly developed and been applied to
agriculture, specifically on automation of disease and pest detection processes. Traditional
computer vision models face serious problems due to their complex preprocessing and
design of image features that are time-consuming and labor-intensive. In addition, their
404
Electronics 2023, 12, 229
efficiency is conditioned by the accuracy in the design of feature extraction mechanisms
and the learning algorithm [17].
Recently, the problem of plant disease detection has been addressed by deep learning
technology, a subset of machine learning that is gaining momentum in disease identification
due to the increase in computing power, storage capabilities and the availability of large
data sets. Within the deep learning environment, one of the most widely used techniques
for image classification, object detection and semantic segmentation are Convolutional
Neural Networks (CNN) [18,19]. CNNs are useful for locating patterns in images, objects,
and scenes by learning from the data obtained from the image for classification, eliminating
the need for manual extraction of the features being searched for. CNN consist of several
layers (such as convolutional, pooling and fully connected layers) to learn features from
different training data [20,21]. This paper presents an architecture based on CNNs and
data augmentation for early disease identification and classification in tomato leaves. The
objective of the work is to implement a robust architecture that allows examining the
relationship between the images of tomato leaves and the detection of a possible disease
and performing a classification task to predict the type of disease with high accuracy levels.
The remainder of this article is organized as follows. Section 2 presents a brief dis-
cussion of previous research that has been conducted addressing the problem of disease
identification in tomato. Section 3 explains in detail the CNN architecture proposed for
tomato leaf disease identification and classification. A discussion of the experimental re-
sults obtained is presented in Section 4. Finally, Section 5 closes the paper with conclusions
and future direction of the research work.
2. Related works
Plants disease detection has been studied for a long time. With respect to disease iden-
tification in tomatoes, much effort has been made using different tools such as classifiers
focused on color [22,23], texture [24,25] or shape of tomato leaves [26]. Early efforts focused
on support vector machines [27–30], decision trees [31,32] or neural network-based [33–35]
classifiers. Visual spectrum images obtained from commercial cameras have been used for
disease detection in tomato. The images obtained were processed under laboratory condi-
tions, applying mechanisms such as stepwise multiple linear regression [36] and clustering
process [37]. It is worth mentioning that the sample population for both works ranged
between 22 and 47 for the first method and included 180 samples for the second experiment.
CNNs have rapidly become one of the preferred methods for disease detection in
plants [38–40]. Some works have focused their efforts on identifying features with better
quality through the process of eliminating the limitations generated by lighting conditions
and uniformity in complex environment situations [41,42]. Some authors have developed
real-time models to accelerate the process of disease detection in plants [43,44]. Other
authors have created models that contribute to the early detection of plant diseases [45,46].
In [47], the authors make use of images of tomato leaves to discover different types of
diseases. The authors apply artificial intelligence algorithms and CNN to perform a
classification model to detect five types of diseases obtaining an accuracy of 96.55%. Some
works evaluated the performance of deep neural network models applied to tomato leaf
disease detection such as in [48], where the authors evaluated the LeNet, VGG16, ResNet
and Xception models for the classification of nine types of diseases, determining that the
VGG16 model is the one that obtained the best performance with an accuracy of 99.25%.
In [49], the authors applied the AlexNet, GoogleNet and LeNet models to solve the same
problem, obtaining accuracy results ranging between 94% and 95%. Agarwal et al. [50]
developed their own CNN model based on the structure of VGG16 and compared it with
different machine learning models (including random forest and decision trees) and deep
learning models (VGG16, Inceptionv3 and MobileNet) to perform the classification of the
10 classes, obtaining an accuracy of 98.4%.
Several researches have focused on combining deep learning algorithms with machine
learning algorithms to address and improve the accuracy of the classification problem,
405
Electronics 2023, 12, 229
for example, MobileNetv2 and NASNetMobile that were used to extract features from
leaves and those features were combined with classification networks such as random
forest, support vector machines and multinomial logistic regression [51]. Other works have
applied algorithms such as YOLOv3 [45], Faster R-CNN [52,53] and Mask R-CNN [54,55]
to detect disease states in plants.
Some efforts have been made to reduce the computational cost and model size such
as Gabor filters [56] and K-nearest neighbors (KNN) [57] that have been implemented to
reduce computational costs and overhead generated by deep learning. In [58], the authors
reduced the computational cost by using the SqueezeNet architecture and minimizing the
number of 3 × 3 filters.
3. Materials and Methods
In this section, we explain in detail the proposed architecture for the detection of
diseases in tomato leaves. In general, the proposed architecture takes tomato leaves as
input images and the output is a set of labels indicating (1) the type of disease in the image
being analyzed or whether the leaf is healthy, (2) the label showing the predicted value
obtained by our model, and (3) the prediction percentage.
Figure 2 shows the complete process of the algorithm that we applied for the process
of detection and classification of diseases in tomato leaves. The global algorithm is com-
posed of four stages: (a) creation of the experimental dataset, (b) creation of the proposed
architecture, (c) distribution of the dataset, and (d) process of training and evaluation of
the model.
Figure 2. Representation of the proposed architecture for tomato disease detection.
3.1. Dataset Creation
As a first step, we proceeded to create the experimental dataset that would be used
for training, validation, and performance evaluation of the proposed architecture. The
public dataset available in [59] consists of 11,000 images that were the basis of our dataset.
The images represent 10 categories, including nine types of diseases (tomato mosaic virus,
target spot, bacterial spot, tomato yellow leaf curl virus, late blight, leaf mold, early blight,
two-spotted spider mites, septoria leaf spot) and one category of healthy leaves. The dataset
was complemented with 2500 images obtained from different crop fields in Mexico. The
total number of images that made up our dataset was 13,500.
One of the problems that datasets face with deep neural network models is that when
training the model, overfitting can occur, i.e., a model with high capacity may be able to
“memorize” the dataset [60]. A technique known as data augmentation is used to avoid the
406
Electronics 2023, 12, 229
problem of overfitting. The goal of applying data augmentation is to increase the size of the
dataset, and it is widely used in all fields [61]. Commonly, data augmentation is performed
by two methods. The first method, known as the traditional method, aims to obtain a
new image, which contains the same semantic information but does not have the ability of
generalization. These methods include translation, rotation, flip, brightness adjustment,
affine transformation, Gaussian noise, etc. The main drawbacks of these methods may be
their poor quality and inadequate diversity.
Another method is the use of Generative Adversarial Networks (GANs), which are
an approach to generative modeling using deep learning methods, such as CNNs, that
aim to generate synthetic samples with the same characteristics as the given training
distribution [62]. GAN models mainly consist of two parts, namely the generator and the
discriminator [63]. The generator is a model used to generate new plausible examples from
the problem domain. The discriminator is a model used to classify examples as real (from
the domain) or fake (generated).
To create our experimental dataset, we made use of GAN to avoid the overfitting
problem. To build our GAN, we define two separate networks: the generator network
and the discriminator network. The first network receives a random noise, and from that
number, the network generates images. The second network, the discriminator, defines
whether the image it receives as input is “real” or not.
Because the images that complemented the dataset were not balanced for each category,
the GAN network generated images that contributed to balance the dataset. The dataset
was increased from 13,500 to 15,000 images, distributing the generated images in the
different categories to create a balanced dataset.
3.2. Model Creation
Figure 3 shows the proposed CNN architecture for disease detection in tomato. The
network has 112 × 112 color images as input, which are normalized to (0, 1) values. The
proposed convolutional network has four convolutional layers that use filters whose values
were 16, 32, 64, and 128, respectively. These values were assigned in that order since the
layers closer to the beginning of the model learn convolutional filters less effectively than
the layers closer to the result. In addition, the kernel size, which represents the width and
height of the 2D convolution window, was set to a value of 3 × 3. This value was the
recommended value for the number of filters to be used. Finally, rectified linear unit (ReLU)
was used as the activation model for each convolved node.
After applying the convolutional layer, the maximum clustering layer was applied to
down-sample the acquired feature map and condense the most relevant features into patches.
This process is repeated for each of the convolutional layers defined in the architecture.
The result of the last MaxPooling layer is passed to a MaxAveragePooling layer to
be converted to a column vector and connected to the dense layer of 10 output nodes
(which represent the 10 categories) used as softmax activation. Each node represents the
probability of each category for the evaluated image. Table 1 shows the information of the
layer structure of the proposed model.
407
Electronics 2023, 12, 229
Figure 3. Representation of the proposed algorithm for tomato disease detection.
Table 1. Information on the layers structure of the proposed model.
Layers Parameters
Filters: 128, kernel size: (3,3), activation: “relu”,
Conv2D
input shape: (112,112,3)
MaxPool2D Pool size: (2,2)
Conv2D Filters: 64, kernel size: (3,3), activation: “relu”
MaxPool2D Pool size: (2,2)
Conv2D Filters: 32, kernel size: (3,3), activation: “relu”
MaxPool2D Pool size: (2,2)
Conv2D Filters: 16, kernel size: (3,3), activation: “relu”
MaxPool2D Pool size: (2,2)
Dropout Rate: 0.2
GlobalAveragePooling2D
Dense Units: 10, activation: “softmax”
3.3. Data Distribution
One of the most common strategies to split the dataset into training and validation sets
is assigning percentages, for example, 70:30 or 80:20. However, one of the problems that
can arise with this strategy is that it is uncertain whether high validation accuracy indicates
a good model. When performing this division, it could happen that some information is
missing in the data that are not used for training, causing a bias in the results.
We apply a k-fold cross-validation method to evaluate the performance of the model.
The k-folds method tries to ensure that all features of the dataset are in the training and
validation phases. The k-fold cross-validation method divides the dataset into subsets as
k number. Therefore, it repeats the cross-validation method k times. Common values in
machine learning are k = 3, k = 5, and k = 10. We use k = 5 to provide good trade-off of low
computational cost and low bias in an estimate of model performance.
3.4. Model Creation
For the training process, we use Adam as the optimization algorithm. Adam up-
dates network weights iterative based on training data. The loss function was categori-
cal_crossentropy, one of the most used loss functions for multi-class classification models
408
Electronics 2023, 12, 229
where there are two or more output labels. The number of epochs for the training and vali-
dation process was 200. The steps_per_epoch parameter was 12,000, and for the validation
the parameter it was 3000. Table 2 shows a summary of some of the parameters used for
the training and validation phase.
Table 2. Training Parameters for the Proposed Model.
Parameter Value
Optimization algorithm Adam
Loss function Categorical cross entropy
Batch size 32
Number of epochs 200
Steps per epoch 12,000
Validation steps 3000
Activation function for conv layer ReLu
4. Results
In this section, we describe the scenario setup and the results obtained in the perfor-
mance evaluation process of the proposed model.
4.1. Environmental Setup
Our model was developed in Google Collaboratory, a free Python development envi-
ronment that runs in the cloud. Google Collaboratory is widely used for the development
of machine learning and deep leaning projects. In our project, we use the following libraries:
Tensorflow, an open-source library used for numerical computation and automated learn-
ing; Keras, a library used for the creation of neural networks; numpy, used for data analysis
and mathematical calculations; matplotlib used for graph management and TensorBoard to
visually inspect the different runs and graphs.
The model was trained with 200 epochs. We applied early stopping to monitor the
performance of the model for the 200 epochs on a held-out validation set during the training
to reduce overfitting and to improve the generalization of the neural network. For the
evaluation of the model, the validation accuracy scheme allowed early stopping to be
activated during the process.
Since our problem is a multi-class classification model, we use the Adam algorithm as
the optimizing algorithm. In addition, the cross-entropy categorical loss function was used
due to the nature of the multi-class classification environment. During the training process,
we implemented checkpoints to save the model with the best validation accuracy, and thus
be able to load it later to continue training from the saved state if necessary.
4.2. Evaluation Metrics
To analyze the performance of our model, the following four metrics were considered.
The first metric to evaluate was accuracy, which represents the behavior of the model across
all classes. Accuracy is calculated as the ratio between the number of correct predictions to
the total number of predictions (Equation (1)).
Precision was our second metric, which represents the accuracy of the model in
classifying a sample as positive. This parameter is calculated as the ratio of the number of
positive samples correctly classified to the total number of samples classified as positive
(Equation (2)).
We also analyzed the recall parameter, which measures the ability of the model to
detect positive samples and is calculated as the ratio of the number of positive samples
correctly classified to the total number of positive samples (Equation (3)).
Finally, we analyzed the F1 score parameter. This metric combines the precision and
recall measures to obtain a single value. This value is calculated by taking the harmonic
mean between precision and recall (Equation (4)).
409
Electronics 2023, 12, 229
The following equations were used to calculate accuracy, precision, recall and F1 score:
TP + TN
Accuracy = (1)
TP + TN + FP + FN
TP
Precision = (2)
TP + FP
TP
Recall = (3)
TP + FN
( precision × recall )
F1 Score = 2 × . (4)
( precision + recall )
4.3. Results and Discussion
In this section, we analyze the results obtained in the evaluation of the performance
of the proposed CNN model in tomato crops. We compare our results with some of the
proposed models published in the literature.
4.3.1. Validation of the Proposed Model
The validation of the model was analyzed by applying the k-fold cross-validation
procedure to estimate the performance of our algorithm on the tomato images dataset. We
define a k-value of 5 to split the dataset. The Scikit-Learn machine learning library was
used to implement the k-fold method returning a list of scores calculated for each of our
five folds.
Figure 4 shows the results obtained by applying the k-folds method to evaluate the
performance of the model. The results show a stability of the model, as it is observed in the
different metrics analyzed. There is a very similar behavior with the five folds both in the
training phase and in the validation phase, demonstrating that there is no overfitting in the
proposed model.
Figure 4. Results obtained for k-folds.
410
Electronics 2023, 12, 229
Figure 5 demonstrates the performance of our model in the training and validation
stages for identification and classification of tomato leaf diseases. The results achieved
a training accuracy of 99.99%. The time used for the training process was 6234 s in the
MGPU (Multiple-Graphics Processing Unit) environment. The proposed model achieved a
validation accuracy of 99.64% in leaf disease classification.
Figure 5. Results obtained of the proposed model during the training and validation phases: (a) accu-
racy and (b) loss.
Figure 6 shows the confusion matrix obtained in the evaluation of the proposed model.
The confusion matrix shows the true positive (TP), true negative (TN), false positive (FP)
and false negative (FN) values obtained for each class evaluated [64].
Figure 6. Confusion matrix of the proposed model.
411
Electronics 2023, 12, 229
According to the results, which are reflected in the confusion matrix, we can see
that the proposed model was able to predict half of the classes that were evaluated using
the test dataset with a 100% accuracy. For the rest of the classes, the model reached an
accuracy level of at least 98%, thus obtaining better values than those of several of the
works proposed in the literature.
Table 3 presents the results obtained in the classification performance of the proposed
model on each of the classes defined within the experimental dataset. According to the
data reflected in the table, the value obtained for the recall metric is high for each category
defined in the dataset; this allows inferring the performance of the proposed model, which
is able to correctly classify the corresponding disease with accuracy higher than 98%.
Table 3. Class-wise Performance of the Proposed Model.
Class Precision Recall F1 Score Support
Tomato bacterial spot 0.99 0.990 0.99 100
Tomato early blight 1 1 0.98 100
Tomato late blight 0.97 0.98 0.97 100
Tomato leaf mold 1 1 0.99 100
Tomato Septoria leaf spot 0.99 0.98 0.97 100
Tomato Two-spotted spider mite 1 1 0.98 100
Tomato target spot 0.99 0.98 0.99 100
Tomato yellow leaf curl virus 0.98 0.98 0.98 100
Tomato mosaic virus 1 1 0.99 100
Tomato healthy 1 1 0.99 100
The architecture and weights obtained from the proposed model were saved as a
hierarchical data file to be used during the prediction process. The prediction process
uses a dataset with a total of 1350 images. The matplotlib library was used to visualize
the prediction result. For each prediction, the image, the true result, and the result of the
prediction made with the proposed model were displayed, together with the percentage of
accuracy. Figure 7 shows some results of the predictions made by the model.
Figure 7. Sample predicted images using the proposed model.
4.3.2. Comparison of the Model
Finally, our model was compared with other techniques proposed in the literature
(Widiyanto et al. [65], Afif Al Mamun et al. [66], Kaur et al. [67], AlexNet [68]; Inception-v3-
412
Electronics 2023, 12, 229
Net, ResNet-50 and VGG16Net [69]). Figure 8 presents the results of the comparison and
shows that for the accuracy and recall metrics, the proposed model obtained the best results,
reaching an accuracy of 99.9%. With respect to the precision metric, the proposed algorithm
had a result only lower than the VGG16Net technique, but with a result of 0.99. For the F1
metric, the proposed model had a similar result to that of the VGG16Net technique.
Figure 8. Performance comparison of proposed model and existing models.
In addition, a comparison was made of the complexity of the proposed model and
some of the other models included in the comparison (data were not obtained for some
of the models used in the comparison). Specifically, the number of trainable parameters
and the size of the model were analyzed. The data obtained are shown in Table 4. Finally,
Table 5 shows a summary of the performance of the models using the metrics accuracy,
precision, recall and F1 score.
Table 4. Complexity comparison of proposed model and existing models.
ResNet VGG16Net Inception-v3-Net AlexNet Proposed
Trainable parameters
26.7 39.4 24.9 44.7 5.6
(Millions)
Model size (MB) 98 128 92 133 36
413
Electronics 2023, 12, 229
Table 5. Class-wise Performance of the Proposed Model.
Reference Accuracy Precision Recall F1 Score
Widiyanto, et al. (2019) 97.6 0.98 0.98 0.98
Afif Al Mamum et al. (2020) 98.77 0.98 0.98 0.98
Kaur et al. (2019) 98.8 0.98 0.98 0.98
Proposed model 99.64 0.99 0.99 0.99
5. Conclusions
In this research, we propose an architecture based on CNNs to identify and classify
nine different types of tomato leaf diseases. The complexity in detecting the type of disease
lies in the fact that the leaves deteriorate in a similar way in most of the tomato diseases. It
means that it is necessary to develop a deep image analysis to judge the types of tomato
leave diseases with a proper accuracy level.
The CNN that we design is a high-performance deep learning network that allows
us to have a complex image processing and feature extraction through four modules:
the module dataset creation that makes an experimental dataset using public datasets
and photographs taken in the fields of the country; model creation that is in charge of
parameters configuration and layers definition; data distribution to train, validate and test
data; and processing for the optimization and performance verification.
We evaluate the performance of our model via accuracy, precision, recall and the F1-
score metrics. The results showed a training accuracy of 99.99% and a validation accuracy
of 99.64% in the leaf disease classification. The model correctly classifies the corresponding
disease with a precision of 0.99 and an F1 score of 0.99. The recall metric has a value of 0.99
on the classification of the nine tomato diseases that we analyzed.
The resulting confusion matrix describes that our classification model was able to
predict half of the classes that were evaluated using the test dataset with a 100% accuracy.
For the rest of the classes, the model reached an accuracy level of 98%, thus obtaining better
values than those of several of the works proposed in the literature.
Author Contributions: Conceptualization, A.G.-I.; Methodology, A.G.-I. and A.R.-M.; Software
A.G.-I.; Validation, A.G.-I. and A.R.-M.; Formal analysis, A.G.-I.; Resources, A.R.-M.; Data curation,
A.G.-I.; Writing—review & editing, A.G.-I. and A.R.-M. All authors have read and agreed to the
published version of the manuscript.
Funding: This work was partially funded by the State Research Agency of Spain under grant number
PID2020-116377RB-C21.
Data Availability Statement: The datasets generated during the current study are available from
authors on reasonable request.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Food and Agriculture Organization of the United Nations. “FAOSTAT” Crops and Livestock Products. Available online:
https://www.fao.org/faostat/en/#data/QCL (accessed on 19 October 2022).
2. Los Productos Agropecuarios Más Exportados. 1 July 2022. Available online: https://mundi.io/exportacion/exportacion-
productos-agropecuarios-mexico/ (accessed on 2 November 2022).
3. Ritchie, H.; Rosado, P.; Roser, M. Agricultural Production—Crop Production Across the World. 2020. Available online: https:
//ourworldindata.org/agricultural-production (accessed on 2 December 2022).
4. Food and Agriculture Organization of the United Nations. FAO—News Article: Climate Change Fans Spread of Pests and
Threatens Plants and Crops—New FAO Study. Available online: https://www.fao.org/news/story/en/item/1402920/icode/
(accessed on 19 October 2022).
5. Gobalakrishnan, N.; Pradeep, K.; Raman, C.J.; Ali, L.J.; Gopinath, M.P. A Systematic Review on Image Processing and Machine
Learning Techniques for Detecting Plant Diseases. In Proceedings of the 2020 International Conference on Communication and
Signal Processing (ICCSP), Chennai, India, 28–30 July 2020; pp. 0465–0468. [CrossRef]
414
Electronics 2023, 12, 229
6. Damicone, J.; Brandenberger, L. Common Diseases of Tomatoes: Part I. Diseases Caused by Fungi—Oklahoma State University.
2016. Available online: https://extension.okstate.edu/fact-sheets/common-diseases-of-tomatoes-part-i-diseases-caused-by-
fungi.html (accessed on 19 October 2022).
7. Ahmad, A.; Saraswat, D.; El Gamal, A. A survey on using deep learning techniques for plant disease diagnosis and recommenda-
tions for development of appropriate tools. Smart Agric. Technol. 2023, 3, 100083. [CrossRef]
8. DeChant, C.; Wiesner-Hanks, T.; Chen, S.; Stewart, E.L.; Yosinski, J.; Gore, M.A.; Nelson, R.J.; Lipson, H. Automated Identification
of Northern Leaf Blight-Infected Maize Plants from Field Imagery Using Deep Learning. Phytopathology 2017, 107, 1426–1432.
[CrossRef]
9. Bock, C.H.; Poole, G.H.; Parker, P.E.; Gottwald, T.R. Plant Disease Severity Estimated Visually, by Digital Photography and Image
Analysis, and by Hyperspectral Imaging. Crit. Rev. Plant Sci. 2010, 29, 59–107. [CrossRef]
10. Bock, C.H.; Parker, P.E.; Cook, A.Z.; Gottwald, T.R. Visual Rating and the Use of Image Analysis for Assessing Different Symptoms
of Citrus Canker on Grapefruit Leaves. Plant Dis. 2008, 92, 530–541. [CrossRef] [PubMed]
11. Devaraj, A.; Rathan, K.; Jaahnavi, S.; Indira, K. Identification of Plant Disease using Image Processing Technique. In Proceed-
ings of the 2019 International Conference on Communication and Signal Processing (ICCSP), Chennai, India, 4–6 April 2019;
pp. 0749–0753. [CrossRef]
12. Mugithe, P.K.; Mudunuri, R.V.; Rajasekar, B.; Karthikeyan, S. Image Processing Technique for Automatic Detection of Plant
Diseases and Alerting System in Agricultural Farms. In Proceedings of the 2020 International Conference on Communication and
Signal Processing (ICCSP), Chennai, India, 28–30 July 2020; pp. 1603–1607. [CrossRef]
13. Phadikar, S.; Sil, J. Rice disease identification using pattern recognition techniques. In Proceedings of the 2008 11th International
Conference on Computer and Information Technology, Khulna, Bangladesh, 24–27 December 2008; pp. 420–423. [CrossRef]
14. Sarayloo, Z.; Asemani, D. Designing a classifier for automatic detection of fungal diseases in wheat plant: By pattern recognition
techniques. In Proceedings of the 2015 23rd Iranian Conference on Electrical Engineering, Tehran, Iran, 10–14 May 2015;
pp. 1193–1197. [CrossRef]
15. Thangadurai, K.; Padmavathi, K. Computer Visionimage Enhancement for Plant Leaves Disease Detection. In Proceedings of
the 2014 World Congress on Computing and Communication Technologies, Trichirappalli, India, 27 February–1 March 2014;
pp. 173–175. [CrossRef]
16. Yong, Z.; Tonghui, R.; Changming, L.; Chao, W.; Jiya, T. Research on Recognition Method of Common Corn Diseases Based
on Computer Vision. In Proceedings of the 2019 11th International Conference on Intelligent Human-Machine Systems and
Cybernetics (IHMSC), Hangzhou, China, 24–25 August 2019; Volume 1, pp. 328–331. [CrossRef]
17. Khirade, S.D.; Patil, A.B. Plant Disease Detection Using Image Processing. In Proceedings of the 2015 International Conference on
Computing Communication Control and Automation, Pune, India, 26–27 February 2015; pp. 768–771. [CrossRef]
18. Kamilaris, A.; Prenafeta-Boldú, F.X. Deep learning in agriculture: A survey. Comput. Electron. Agric. 2018, 147, 70–90. [CrossRef]
19. Li, L.; Zhang, S.; Wang, B. Plant Disease Detection and Classification by Deep Learning—A Review. IEEE Access 2021, 9,
56683–56698. [CrossRef]
20. Lee, S.H.; Chan, C.S.; Wilkin, P.; Remagnino, P. Deep-plant: Plant identification with convolutional neural networks. In
Proceedings of the 2015 IEEE International Conference on Image Processing (ICIP), Quebec City, QC, Canada; 2015; pp. 452–456.
[CrossRef]
21. Zhang, Y.; Song, C.; Zhang, D. Deep Learning-Based Object Detection Improvement for Tomato Disease. IEEE Access 2020, 8,
56607–56614. [CrossRef]
22. Widiyanto, S.; Wardani, D.T.; Pranata, S.W. Image-Based Tomato Maturity Classification and Detection Using Faster R-CNN
Method. In Proceedings of the 2021 5th International Symposium on Multidisciplinary Studies and Innovative Technologies
(ISMSIT), Ankara, Turkey, 21–23 October 2021; pp. 130–134. [CrossRef]
23. Zhou, X.; Wang, P.; Dai, G.; Yan, J.; Yang, Z. Tomato Fruit Maturity Detection Method Based on YOLOV4 and Statistical Color
Model. In Proceedings of the 2021 IEEE 11th Annual International Conference on CYBER Technology in Automation, Control,
and Intelligent Systems (CYBER), Jiaxing, China, 27–31 July 2021; pp. 904–908. [CrossRef]
24. Hlaing, C.S.; Zaw, S.M.M. Tomato Plant Diseases Classification Using Statistical Texture Feature and Color Feature. In Proceedings
of the 2018 IEEE/ACIS 17th International Conference on Computer and Information Science (ICIS), Singapore, 6–8 June 2018;
pp. 439–444. [CrossRef]
25. Lu, J.; Shao, G.; Gao, Y.; Zhang, K.; Wei, Q.; Cheng, J. Effects of water deficit combined with soil texture, soil bulk density and
tomato variety on tomato fruit quality: A meta-analysis. Agric. Water Manag. 2021, 243, 106427. [CrossRef]
26. Kaur, S.; Pandey, S.; Goel, S. Plants Disease Identification and Classification Through Leaf Images: A Survey. Arch. Comput.
Methods Eng. 2018, 26, 507–530. [CrossRef]
27. Bhagat, M.; Kumar, D.; Haque, I.; Munda, H.S.; Bhagat, R. Plant Leaf Disease Classification Using Grid Search Based SVM. In
Proceedings of the 2nd International Conference on Data, Engineering and Applications (IDEA), Bhopal, India, 28–29 February
2020; pp. 1–6. [CrossRef]
28. Rani, F.A.P.; Kumar, S.N.; Fred, A.L.; Dyson, C.; Suresh, V.; Jeba, P.S. K-means Clustering and SVM for Plant Leaf Disease Detection
and Classification. In Proceedings of the 2019 International Conference on Recent Advances in Energy-efficient Computing and
Communication (ICRAECC), Nagercoil, India, 7–8 March 2019; pp. 1–4. [CrossRef]
415
Electronics 2023, 12, 229
29. Padol, P.B.; Yadav, A.A. SVM classifier based grape leaf disease detection. In Proceedings of the 2016 Conference on Advances in
Signal Processing (CASP), Pune, India, 9–11 June 2016; pp. 175–179. [CrossRef]
30. Mokhtar, U.; Ali, M.A.S.; Hassenian, A.E.; Hefny, H. Tomato leaves diseases detection approach based on Support Vector
Machines. In Proceedings of the 2015 11th International Computer Engineering Conference (ICENCO), Cairo, Egypt, 29–30
December 2015; pp. 246–250. [CrossRef]
31. Sabrol, H.; Satish, K. Tomato plant disease classification in digital images using classification tree. In Proceedings of the 2016
International Conference on Communication and Signal Processing (ICCSP), Melmaruvathur, India, 6–8 April 2016; pp. 1242–1246.
[CrossRef]
32. Chopda, J.; Raveshiya, H.; Nakum, S.; Nakrani, V. Cotton Crop Disease Detection using Decision Tree Classifier. In Proceedings
of the 2018 International Conference on Smart City and Emerging Technology (ICSCET), Mumbai, India, 5 January 2018; pp. 1–5.
[CrossRef]
33. Molina, F.; Gil, R.; Bojacá, C.; Gómez, F.; Franco, H. Automatic detection of early blight infection on tomato crops using a color
based classification strategy. In Proceedings of the 2014 XIX Symposium on Image, Signal Processing and Artificial Vision,
Armenia, Colombia, 17–19 September 2014; pp. 1–5. [CrossRef]
34. Pratheba, R.; Sivasangari, A.; Saraswady, D. Performance analysis of pest detection for agricultural field using clustering
techniques. In Proceedings of the 2014 International Conference on Circuits, Power and Computing Technologies [ICCPCT-2014],
Nagercoil, India, 20–21 March 2014; pp. 1426–1431. [CrossRef]
35. Shijie, J.; Peiyi, J.; Siping, H.; Haibo, L. Automatic detection of tomato diseases and pests based on leaf images. In Proceedings of
the 2017 Chinese Automation Congress (CAC), Jinan, China, 20–22 October 2017; pp. 2510–2537. [CrossRef]
36. Jones, C.; Jones, J.; Lee, W.S. Diagnosis of bacterial spot of tomato using spectral signatures. Comput. Electron. Agric. 2010, 74,
329–335. [CrossRef]
37. Borges, D.L.; Guedes, S.T.D.M.; Nascimento, A.R.; Melo-Pinto, P. Detecting and grading severity of bacterial spot caused by
Xanthomonas spp. in tomato (Solanum lycopersicon) fields using visible spectrum images. Comput. Electron. Agric. 2016, 125,
149–159. [CrossRef]
38. Lakshmanarao, A.; Babu, M.R.; Kiran, T.S.R. Plant Disease Prediction and classification using Deep Learning ConvNets. In
Proceedings of the 2021 International Conference on Artificial Intelligence and Machine Vision (AIMV), Gandhinagar, India,
24–26 September 2021; pp. 1–6. [CrossRef]
39. Militante, S.V.; Gerardo, B.D.; Dionisio, N.V. Plant Leaf Detection and Disease Recognition using Deep Learning. In Proceedings
of the 2019 IEEE Eurasia Conference on IOT, Communication and Engineering (ECICE), Yunlin, Taiwan, 3–6 October 2019;
pp. 579–582. [CrossRef]
40. Marzougui, F.; Elleuch, M.; Kherallah, M. A Deep CNN Approach for Plant Disease Detection. In Proceedings of the 2020 21st
International Arab Conference on Information Technology (ACIT), Giza, Egypt, 28–30 November 2020; pp. 1–6. [CrossRef]
41. Ngugi, L.C.; Abdelwahab, M.; Abo-Zahhad, M. Tomato leaf segmentation algorithms for mobile phone applications using deep
learning. Comput. Electron. Agric. 2020, 178, 105788. [CrossRef]
42. Elhassouny, A.; Smarandache, F. Smart mobile application to recognize tomato leaf diseases using Convolutional Neural Networks.
In Proceedings of the 2019 International Conference of Computer Science and Renewable Energies (ICCSRE), Agadir, Morocco,
22–24 July 2019; pp. 1–4. [CrossRef]
43. Mattihalli, C.; Gedefaye, E.; Endalamaw, F.; Necho, A. Real Time Automation of Agriculture Land, by automatically Detecting
Plant Leaf Diseases and Auto Medicine. In Proceedings of the 2018 32nd International Conference on Advanced Information
Networking and Applications Workshops (WAINA), Krakow, Poland, 16–18 May 2018; pp. 325–330. [CrossRef]
44. Divyashri., P.; Pinto, L.A.; Mary, L.; Manasa., P.; Dass, S. The Real-Time Mobile Application for Identification of Diseases in
Coffee Leaves using the CNN Model. In Proceedings of the 2021 Second International Conference on Electronics and Sustainable
Communication Systems (ICESC), Coimbatore, India, 4–6 August 2021; pp. 1694–1700. [CrossRef]
45. Liu, J.; Wang, X. Early recognition of tomato gray leaf spot disease based on MobileNetv2-YOLOv3 model. Plant Methods 2020,
16, 83. [CrossRef] [PubMed]
46. Khasawneh, N.; Faouri, E.; Fraiwan, M. Automatic Detection of Tomato Diseases Using Deep Transfer Learning. Appl. Sci. 2022,
12, 8467. [CrossRef]
47. Mim, T.T.; Sheikh, M.H.; Shampa, R.A.; Reza, M.S.; Islam, M.S. Leaves Diseases Detection of Tomato Using Image Processing.
In Proceedings of the 2019 8th International Conference System Modeling and Advancement in Research Trends (SMART),
Moradabad, India, 22–23 November 2019; pp. 244–249. [CrossRef]
48. Kumar, A.; Vani, M. Image Based Tomato Leaf Disease Detection. In Proceedings of the 2019 10th International Conference on
Computing, Communication and Networking Technologies (ICCCNT), Kanpur, India, 6–8 July 2019; pp. 1–6. [CrossRef]
49. Tm, P.; Pranathi, A.; SaiAshritha, K.; Chittaragi, N.B.; Koolagudi, S.G. Tomato Leaf Disease Detection Using Convolutional Neural
Networks. In Proceedings of the 2018 Eleventh International Conference on Contemporary Computing (IC3), Noida, India, 2–4
August 2018; pp. 1–5. [CrossRef]
50. Agarwal, M.; Gupta, S.K.; Biswas, K. Development of Efficient CNN model for Tomato crop disease identification. Sustain.
Comput. Inform. Syst. 2020, 28, 100407. [CrossRef]
51. Al-Gaashani, M.S.A.M.; Shang, F.; Muthanna, M.S.A.; Khayyat, M.; El-Latif, A.A.A. Tomato leaf disease classification by exploiting
transfer learning and feature concatenation. IET Image Process. 2022, 16, 913–925. [CrossRef]
416
Electronics 2023, 12, 229
52. Pathan, S.M.K.; Ali, M.F. Implementation of Faster R-CNN in Paddy Plant Disease Recognition System. In Proceedings of the
2019 3rd International Conference on Electrical, Computer & Telecommunication Engineering (ICECTE), Rajshahi, Bangladesh,
26–28 December 2019; pp. 189–192. [CrossRef]
53. Zhou, G.; Zhang, W.; Chen, A.; He, M.; Ma, X. Rapid Detection of Rice Disease Based on FCM-KM and Faster R-CNN Fusion.
IEEE Access 2019, 7, 143190–143206. [CrossRef]
54. Mu, W.; Jia, Z.; Liu, Y.; Xu, W.; Liu, Y. Image Segmentation Model of Pear Leaf Diseases Based on Mask R-CNN. In Proceedings
of the 2022 International Conference on Image Processing and Media Computing (ICIPMC), Xi’an, China, 27–29 May 2022;
pp. 41–45. [CrossRef]
55. Wang, Q.; Qi, F.; Sun, M.; Qu, J.; Xue, J. Identification of Tomato Disease Types and Detection of Infected Areas Based on Deep
Convolutional Neural Networks and Object Detection Techniques. Comput. Intell. Neurosci. 2019, 2019, 9142753. [CrossRef]
56. Kirange, D. Machine Learning Approach towards Tomato Leaf Disease Classification. Int. J. Adv. Trends Comput. Sci. Eng. 2020, 9,
490–495. [CrossRef]
57. Lu, J.; Ehsani, R.; Shi, Y.; De Castro, A.I.; Wang, S. Detection of multi-tomato leaf diseases (late blight, target and bacterial spots)
in different stages by using a spectral-based sensor. Sci. Rep. 2018, 8, 2793. [CrossRef]
58. Durmuş, H.; Güneş, E.O.; Kırcı, M. Disease detection on the leaves of the tomato plants by using deep learning. In Proceedings of
the 2017 6th International Conference on Agro-Geoinformatics, Fairfax, VA, USA, 7–10 August 2017; pp. 1–5. [CrossRef]
59. Tomato Leaf Disease Detection. Available online: https://www.kaggle.com/datasets/kaustubhb999/tomatoleaf (accessed on 24
October 2022).
60. Konidaris, F.; Tagaris, T.; Sdraka, M.; Stafylopatis, A. Generative Adversarial Networks as an Advanced Data Augmentation
Technique for MRI Data. In Proceedings of the VISIGRAPP, Prague, Czech Republic, 25–27 February 2019.
61. Kukacka, J.; Golkov, V.; Cremers, D. Regularization for Deep Learning: A Taxonomy. arXiv 2017, arXiv:1710.10686.
62. Pandian, J.A.; Kumar, V.D.; Geman, O.; Hnatiuc, M.; Arif, M.; Kanchanadevi, K. Plant Disease Detection Using Deep Convolutional
Neural Network. Appl. Sci. 2022, 12, 6982. [CrossRef]
63. Goodfellow, I.; Pouget-Abadie, J.; Mirza, M.; Xu, B.; Warde-Farley, D.; Ozair, S.; Courville, A.; Bengio, Y. Generative Adversarial
Networks. Commun. ACM 2020, 63, 139–144. [CrossRef]
64. Geetharamani, G.; Arun Pandian, J. Identification of plant leaf diseases using a nine-layer deep convolutional neural network.
Comput. Electr. Eng. 2019, 76, 323–338. [CrossRef]
65. Widiyanto, S.; Fitrianto, R.; Wardani, D.T. Implementation of Convolutional Neural Network Method for Classification of Diseases
in Tomato Leaves. In Proceedings of the 2019 Fourth International Conference on Informatics and Computing (ICIC), Semarang,
Indonesia, 16–17 October 2019; pp. 1–5. [CrossRef]
66. Mamun, M.A.A.; Karim, D.Z.; Pinku, S.N.; Bushra, T.A. TLNet: A Deep CNN model for Prediction of tomato Leaf Diseases. In
Proceedings of the 2020 23rd International Conference on Computer and Information Technology (ICCIT), Dhaka, Bangladesh,
19–21 December 2020; pp. 1–6. [CrossRef]
67. Kaur, M.; Bhatia, R. Development of an Improved Tomato Leaf Disease Detection and Classification Method. In Proceedings
of the 2019 IEEE Conference on Information and Communication Technology, Allahabad, India, 6–8 December 2019; pp. 1–5.
[CrossRef]
68. Nachtigall, L.; Araujo, R.; Nachtigall, G.R. Classification of apple tree disorders using convolutional neural networks. In
Proceedings of the 2016 IEEE 28th International Conference on Tools with Artificial Intelligence (ICTAI), San Jose, CA, USA, 6–8
November 2016; pp. 472–476.
69. Ferentinos, K.P. Deep learning models for plant disease detection and diagnosis. Comput. Electron. Agric. 2018, 145, 311–318.
[CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
417
electronics
Article
Hemerocallis citrina Baroni Maturity Detection Method Integrating
Lightweight Neural Network and Dual Attention Mechanism
Liang Zhang 1,† , Ligang Wu 1,2, *,† and Yaqing Liu 2, *
1 College of Mechanical and Electrical Engineering, Shanxi Datong University, Datong 037003, China
2 School of Information Science and Technology, Dalian Maritime University, Dalian 116026, China
* Correspondence: [email protected] (L.W.); [email protected] (Y.L.)
† These authors contributed equally to this work.
Abstract: North of Shanxi, Datong Yunzhou District is the base for the cultivation of Hemerocallis
citrina Baroni, which is the main production and marketing product driving the local economy.
Hemerocallis citrina Baroni and other crops’ picking rules are different: the picking cycle is shorter, the
frequency is higher, and the picking conditions are harsh. Therefore, in order to reduce the difficulty
and workload of picking Hemerocallis citrina Baroni, this paper proposes the GGSC YOLOv5 algorithm,
a Hemerocallis citrina Baroni maturity detection method integrating a lightweight neural network
and dual attention mechanism, based on a deep learning algorithm. First, Ghost Conv is used to
decrease the model complexity and reduce the network layers, number of parameters, and Flops.
Subsequently, combining the Ghost Bottleneck micro residual module to reduce the GPU utilization
and compress the model size, feature extraction is achieved in a lightweight way. At last, the dual
attention mechanism of Squeeze-and-Excitation (SE) and the Convolutional Block Attention Module
(CBAM) is introduced to change the tendency of feature extraction and improve detection precision.
The experimental results show that the improved GGSC YOLOv5 algorithm reduced the number of
parameters and Flops by 63.58% and 68.95%, respectively, and reduced the number of network layers
by about 33.12% in terms of model structure. In the case of hardware consumption, GPU utilization
Citation: Zhang, L.; Wu, L.; Liu, Y.
is reduced by 44.69%, and the model size was compressed by 63.43%. The detection precision is up to
Hemerocallis citrina Baroni Maturity
84.9%, which is an improvement of about 2.55%, and the real-time detection speed increased from
Detection Method Integrating
64.16 FPS to 96.96 FPS, an improvement of about 51.13%.
Lightweight Neural Network and
Dual Attention Mechanism.
Electronics 2022, 11, 2743. https://
Keywords: deep learning; lightweight neural networks; attentional mechanisms; Hemerocallis citrina
doi.org/10.3390/electronics11172743 Baroni; maturity detection
Academic Editor: Rashid Mehmood
Received: 2 August 2022
Accepted: 25 August 2022 1. Introduction
Published: 31 August 2022 In recent years, the policies of agricultural revitalization strategy and agricultural
Publisher’s Note: MDPI stays neutral
poverty alleviation have achieved many successes. Under the background of a rural
with regard to jurisdictional claims in revitalization strategy, facing the opportunities and challenges in the process of rapid
published maps and institutional affil- development of agriculture, the Ministry of Agriculture and Rural Affairs has implemented
iations. science and technology to assist agriculture, accelerate the integration of rural industries and
digital economy, solve the problems of low efficiency and quality, and actively encourage
and promote the efficient development of smart agriculture.
In the process of sowing and growing [1–3], fertilizing and watering [4–6], pest moni-
Copyright: © 2022 by the authors. toring [7–9], and fruit picking [10,11] of agricultural products [12], smart agriculture plays
Licensee MDPI, Basel, Switzerland. an irreplaceable role in improving the quality of agricultural products; it makes all the work
This article is an open access article more convenient and efficient, so smart agriculture has received a wide range of attention
distributed under the terms and
from researchers.
conditions of the Creative Commons
At present, the effective combination of artificial intelligence technology and smart
Attribution (CC BY) license (https://
agriculture has become a key research topic, whereas computer vision [13] and deep
creativecommons.org/licenses/by/
learning technology have become effective measures to promote rural revitalization and
4.0/).
Electronics 2022, 11, 2743. https://doi.org/10.3390/electronics11172743 https://www.mdpi.com/journal/electronics
419
Electronics 2022, 11, 2743
agricultural poverty alleviation. Based on deep learning methods and computer vision
techniques, in Ref. [14], an accurate quality assessment of different fruits was efficiently
accomplished by using the Faster RCNN target detection algorithm. Similarly, in Ref. [15],
the authors accomplished tomato ripening detection based on color and size differentiation
using a two-stage target detection algorithm, Faster R-CNN, which has an accuracy of
98.7%. In addition, Wu [16] completed the detection of strawberries in the process of
strawberry picking by a Uˆ2-Net network image segmentation technique, and applied it to
the automated picking process.
Compared with two-stage target detection algorithms, single-stage target detection
algorithms are more advantageous, and the YOLO algorithm is a typical representative.
With the YOLOv3 target detection algorithm, Zhang et al. [17] precisely located the fruit
and handle of a banana, which is convenient for intelligent picking and operation, and the
average precision was as high as 88.45%. In Ref. [18], the detection of a palm oil bunch
was accomplished using the YOLOv3 algorithm and its application in embedded devices
through mobile and the Internet of Things. Wu et al. [19] accomplished the identification
and localization of fig fruits in complex environments by using the YOLOv4 target detection
algorithm, which distinguishes and discriminates whether the fig fruits are ripe or not.
Zhou et al. [20] completed the ripening detection of tomatoes by K-means clustering and
noise reduction processing based on the YOLOv4 algorithm, but the detection speed was
only 5–6 FPS, which could not meet the needs of real-time detection.
In summary, it can be seen that deep learning methods and computer vision techniques
are widely used in smart agriculture in previous studies [21,22]. However, with the
improvement and update of the YOLO algorithm, the YOLOv5 algorithm was proposed,
but, currently, there are less applications in agriculture related fields. Inspired by existing
studies, we applied the YOLOv5 algorithm to the maturity detection process of Hemerocallis
citrina Baroni because North of Shanxi, Datong Yunzhou District, has been known as the
hometown of Hemerocallis citrina Baroni since ancient times, and is also the planting base of
organic Hemerocallis citrina Baroni.
In recent years, the Hemerocallis citrina Baroni industry in Yunzhou District has entered
the fast track of development. As the leading industry of “one county, one industry”, it
has brought rapid economic development while promoting rural revitalization. However,
at present, the picking of Hemerocallis citrina Baroni mainly relies on manual completion,
and whether the Hemerocallis citrina Baroni is mature or not relies entirely on experience to
distinguish. Therefore, the main work and contributions of this paper are as follows:
a. Computer vision technology and deep learning algorithms are applied to the matu-
rity detection of Hemerocallis citrina Baroni, and highly accurate maturity detection
of whether the Hemerocallis citrina Baroni are mature and meet the picking stan-
dards, providing ideas for improving the picking method and reducing the cost of
picking labor.
b. The lightweight neural network is introduced to reduce the number of network
layers and model complexity, compress the model volume, and lay the foundation
for the embedded development of picking robots.
c. Combined with the dual attention mechanism, it improves the tendency of feature
extraction and enhances the detection precision and real-time detection efficiency.
The remainder of this paper is organized as follows. Section 2 offers YOLOv5 object
detection algorithms. In Section 3, the GGSC YOLOv5 network structure and its constituent
modules are presented. Section 4 introduces the model training parameters, advantages of
the lightweight model, and analysis of experiments results. Finally, conclusions and future
work are given in Section 5.
2. YOLOv5 Object Detection Algorithms
Currently, there are two types of deep learning target detection algorithms, one-stage
and two-stage. The one-stage target detection algorithm performs feature extraction on the
entire image to complete end-to-end training, and the detection process is faster, but less
420
Electronics 2022, 11, 2743
precise. Common algorithms include YOLO, SSD, Retina Net, etc. The two-stage target
detection algorithm selectively traverses the entire image by pre-selecting the boxes, which
is a slower detection process, but has higher precision. Faster RCNN, Cascade RCNN,
Mask RCNN, etc. are common algorithms.
With continuous improvements and updates [23], the YOLOv5 target detection algo-
rithm has improved detection precision and model fluency. As shown in Figure 1, YOLOv5
mainly consists of four parts: input head, backbone, neck, and prediction head. The in-
put head is used as the input of the convolutional neural network, which completes the
cropping and data enhancement of the input image, and backbone and neck complete the
feature extraction and feature fusion for the detected region, respectively. The prediction
head is used as the output to complete the recognition, classification, and localization of
the detected objects [24].
Figure 1. YOLOv5 algorithm process.
In the version 6.0 of the YOLOv5 algorithm, the focus module is replaced by a rect-
angular convolution with stride = 2, the CSP residual module [25] is replaced by the C3
module, and the size of the convolution kernel in the spatial pyramid pooling (SPP) [26]
module is unified to 5. However, the problems of the complex model structure, redundant
feature extraction during convolution, and large number of parameters and computation
of the model still exist, which are not suitable for mobile and embedded devices.
To address the above problems, the GGSC YOLOv5 detection algorithm based on
a lightweight and double attention mechanism is proposed in this paper, and applied
to Hemerocallis citrina Baroni recognition, with the obvious advantages of the lightweight
model and excellent detection performance in the detection process.
3. Deep Learning Detection Algorithm GGSC YOLOv5
3.1. Ghost Lightweight Convolution
In limited memory and computational resources, deploying efficient and lightweight
neural networks is the future development direction of convolutional neural networks [27].
In the feature extraction process, the traditional convolution traverses the entire input
image sequentially, with many similar feature maps generated by adjacent regions dur-
ing the convolution process. Therefore, traditional convolutional feature extraction is
computationally intensive, inefficient, and redundant in terms of information.
As shown in Figure 2, Ghost Conv [28] takes advantage of the redundancy character-
istic of the feature map, and first generates m intrinsic feature maps by a few traditional
convolutions. Then, the Φi cheap linear operation is performed on m intrinsic feature maps,
such that each intrinsic feature map produces s − 1 new feature maps. Lastly, the m intrinsic
feature maps and s − 1 new feature maps are spliced together to complete the lightweight
convolution operation.
421
Electronics 2022, 11, 2743
Figure 2. The Ghost Convolution process.
The Ghost Conv process is less computationally intensive and more lightweight
than traditional convolution due to the cheap linear operations introduced in the process.
Therefore, the theoretical speedup ratio (rs ) and model compression ratio (rc ) of Ghost
Conv and traditional convolution are as follows, respectively:
CT c × k × k × ms × h × w c×s
rs = = = ≈ s (1)
CG c × k × k × m × h × w + m × k × k × ( s − 1) × h × w c+s−1
c × k × k × ms c×s
rc = = ≈s (2)
c × k × k × m + m × k × k × ( s − 1) c+s−1
where h × w and h × w are the height and width sizes of the input and output images.c is
the number of input channels, ms is the number of output channels, and k × k is the custom
convolution kernel size. CT and CG are the convolutional computations of traditional
convolution and Ghost Conv, respectively.
In summary, the rs and rc of Ghost Conv are only 1/s of the traditional convolution due
to the introduction of cheap linear operations. It can be seen that Ghost Conv has obvious
advantages of being lightweight, with a lower number of parameters and computation
compared with the traditional convolution.
3.2. Ghost Lightweight Bottleneck
Ghost Bottleneck [28] is a lightweight module consisting of Ghost Conv, Batch Nor-
malization (BN) layers, down sampling, and activation functions. Its design method and
model structure are similar to that of the Res Net residual network, which has the features
of a simple model structure, easy application, and high operational efficiency. Since the
number of channels remains constant before and after feature extraction, the module can
be plug-and-play.
The structure of the Ghost Bottleneck model is shown in Figure 3. Ghost Bottleneck
mainly consists of two Ghost Conv stacks, where the input image is passed through the
first Ghost Conv to increase the number of channels, normalized by the BN layer, and the
nonlinear properties of the neural network model are increased by the ReLU activation
function. Subsequently, it goes through a second Ghost Conv to reduce the number of
channels, thus ensuring that the number of output channels is the same as before the first
Ghost Conv operation. Lastly, the output after twice Ghost Conv and the original input
after down sampling are spliced and stacked by Add operation, which increases the amount
of information of the desired features, while the number of channels remains the same.
422
Electronics 2022, 11, 2743
Figure 3. Ghost Bottleneck modules.
The structure of the Ghost Bottleneck model is similar to MobileNetv2. The BN layer
is retained after compressing the channels without using the activation function, so the
original information of feature extraction is retained to the maximum extent. Compared
with other residual modules and cross-stage partial (CSP) network layers, Ghost Bottleneck
uses fewer convolutional and BN layers, and the model structure is simpler. Therefore,
using Ghost Bottleneck makes the number of model parameters and the Flops calculation
lower, the number of network layers less, and the lightweight feature more obvious.
3.3. SE Attentional Mechanisms
The Squeeze-and-Excitation channel attention mechanism module (SE Module) [29]
consists of two parts: Squeeze and Excitation. First, the SE Module performs the Squeeze
operation on the feature map obtained by convolution to get the global features on the
channel. Subsequently, the Excitation operation is performed on the global features, which
learns the relationship between each channel and obtains the weight values of different
channels. Lastly, the weight values of each channel are multiplied on the original feature
map to obtain the final features after performing the SE Module.
The SE Module feature extraction process is shown in Figure 4. During the Squeeze
operation, global average pooling is used to obtain global features, and the output zc
is obtained by the compression function Fsq according to the compression aggregation
strategy. During the Excitation operation, the dimension is first reduced, and then, the
dimension is increased. The output s after Excitation is obtained by the excitation function
Fex , and the relationship between channels is obtained by the feature capture mechanism of
Sigmoid to complete the feature extraction.
Figure 4. SE attentional mechanisms.
In the SE channel attention mechanism model, the Squeeze-Excitation function can
be expressed as xc = Fscale (uc , sc ) = sc uc , where uc represents the c-th feature map in the
Squeeze-Excitation process, and sc represents the weight of the c-th feature map.
The SE channel attention mechanism adaptively [30] accomplishes the adjustment
of feature weights during feature extraction, which is more conducive to obtaining the
required feature information. Therefore, the SE channel attention mechanism is introduced
into the model structure, which can enhance the discrimination ability of the model, and
improve the detection accuracy and maturity detection effect.
3.4. CBAM Attentional Mechanisms
The Convolutional Block Attention Module (CBAM) [31] attention mechanism is an
efficient feed-forward convolutional attention model, which can perform the propensity
423
Electronics 2022, 11, 2743
extraction of features sequentially in channel and spatial dimensions, and it consists of two
sub-modules: Channel Attention Module (CAM) and Spatial Attention Module (SAM).
The CBAM feature extraction process is shown in Figure 5. First, compared with
the SE Module, the channel attention mechanism in CBAM adds a parallel maximum
pooling layer, which can obtain more comprehensive information. Second, the CAM and
SAM modules are used sequentially to make the model recognition and classification more
effective. Lastly, since CAM and SAM perform feature inference sequentially along two
mutually independent dimensions, the combination of the two modules can enhance the
expressive ability of the model.
Figure 5. CBAM attentional mechanisms.
In the CAM module, with the input feature map performing maximum pooling and av-
erage pooling in parallel, the shared network in the multilayer perceptron (MLP) performs
feature extraction based on the maximum pooling feature maps Fmax and average pooling
feature maps Favg to produce a 1D channel attention map Mc . The CAM convolution
calculation can be expressed as:
Mc ( F ) = σ[ MLP( AvgPool ( F )) + MLP( MaxPool ( F ))]
(3)
= σ[W1 (W0 ( Favg
c )) + W (W ( F c ))]
1 0 max
where σ denotes the sigmoid function, and W0 and W1 denote the weights after pooling
and sharing the network, respectively.
In the SAM module, the input feature map performs maximum pooling and aver-
age pooling in parallel, and a 2D spatial attention map Ms is generated by traditional
convolution. The SAM convolution calculation can be expressed as:
Ms ( F ) = σ[ f k×k ( AvgPool ( F ); MaxPool ( F ))]
(4)
= σ[ f k×k ( Favg
s ; F s )]
max
where f k×k represents a traditional convolution operation with the filter size of k × k.
The CBAM attention mechanism is an end-to-end training model with plug-and-play
functionality, and, thus, can be seamlessly fused into any convolutional neural network.
Combined with the YOLO algorithm, it can complete feature extraction more efficiently
and obtain the required feature information without additional computational cost and
operational pressure.
3.5. GGSC YOLOv5 Model Structure
The improved GGSC YOLOv5 algorithm model structure and module parameters are
shown in Figure 6, which combines Ghost Conv and Ghost Bottleneck modules to achieve
a light weight, and introduces the dual attention mechanism of SE and CBAM to improve
detection precision (P) and real-time detection efficiency.
424
Electronics 2022, 11, 2743
Figure 6. GGSC YOLOv5 model structure.
In the GGSC YOLOv5 algorithm feature extraction network backbone, Ghost Conv
and Ghost Bottleneck module sets are used instead of traditional convolution and C3
modules, respectively, which reduces the consumption of memory and hardware resources
in the convolution process. The SE and CBAM attention mechanisms are used alternately
after each module group (Ghost Conv and Ghost Bottleneck) to enhance the tendency of
feature extraction, enabling the underlying fine-grained information and the high-level
semantic information to be extracted effectively. In the feature fusion network neck, images
with different resolutions are fused by Concatenate and Up-sample, which makes the
localization information, classification information, and confidence information of the
feature map more accurate.
After the feature extraction and feature fusion, three different tensor are generated
at the output prediction head by conventional convolution, Conv2d: (256, na × (nc + 5)),
(512, na × (nc + 5)), and (1024, na × (nc + 5)), corresponding to three sizes of output:
80 × 80, 40 × 40, and 20 × 20, where 256, 512, and 1024 denote the number of channels,
respectively. na × (nc + 5) represents the relevant parameters of the detected object; the
number of anchors for each category and the number of categories of detected objects are
denoted by na and nc, respectively. The four localization parameters and one confidence
parameter of the anchor are represented by 5.
4. Experiments and Results Analysis
4.1. Model Training
The experiments in this paper were carried out using the Python 3.8.5 environment
and CUDA 11.3, under Intel Core [email protected] GHz, NVidia GeForce RTX 3080 10G, and
DDR4 3600 MHz dual memory hardware.
For the dataset, 800 images of Hemerocallis citrina Baroni were available after pho-
tographs on the spot, screening, dataset production, and classification. Among them,
597 images are used as the training set, 148 images are used as the validation set, and
55 images are used as the test set.
In this paper, the original YOLOv5 and the improved GGSC YOLOv5 algorithm
use the same parameter settings, the image input is 640 × 640, the learning rate is 0.01,
the cosine annealing hyper-parameter is 0.1, the weight decay coefficient is 0.0005, and
the momentum parameter in the gradient descent with momentum is 0.937. A total of
300 epochs and a batch size of 12 are used during training.
425
Electronics 2022, 11, 2743
The GGSC YOLOv5 training process of the Hemerocallis citrina Baroni recognition
method based on the lightweight neural network and dual attention mechanism is shown
in Algorithm 1.
Algorithm 1: Training process of GGSC YOLOv5.
Determine: Parameters, Anchor, lr, Lciou , IOUth .
InPut: Training dataset, Valid dataset, Label set.
Loading: Train models, Valid models.
Ensure: In Put, Backbone, Neck, OutPut. Algorithm environment.
N iterations of training. i-th iteration training(i ≤ N):
Feature extraction Net:
a: Rectangular convolution
b: i-th iteration(i ≤ 2):
Ghost Conv-Ghost Bottleneck-SE, feature extraction.
Ghost Conv-Ghost Bottleneck-CBAM, feature extraction.
c: Feature fusion.
d: Predicted Head: classification ci , confidence pi .
e: Positioning error, category error, confidence error.
f: ∑ loss.
Val Net:
a: Test effect of model i .
b: Calculate P, R and Val loss.
c: Adjust lr and update strategy.
Save results of the i-th training: weight πi , and model i .
Update: Weight: πi+1 ← πi , Model: i+1 ← i .
Temporary storage model .
Plot: Result curve, Save best model , Output.
End Train
4.2. Model Lightweight Analysis
The cultivation of Hemerocallis citrina Baroni has the characteristics of vast area, dense
plants, and different growth. Therefore, recognition methods based on computer vision
and deep learning are widely used in robotic picking, and the lightweight features are more
in line with the practical needs and future development direction of embedded devices.
The GGSC YOLOv5 algorithm takes advantage of the redundancy of the feature maps
to reduce the model complexity while improving the efficiency of feature extraction and
the relationship between channels.
A comparison of the model parameters of GGSC YOLOv5 and the original YOLOv5
is shown in Figure 7. The improved algorithm has the obvious advantages of being
lightweight. In terms of model structure, the number of network layers is reduced from
468 to 313, which is about 33.12% less. The number of parameters and the number of Flops
operations decreased significantly, by about 63.58% and 68.95%, respectively. In terms of
memory occupation and hardware consumption, the GPU utilization [32] was reduced
from 6.9 G to 3.8 G, a reduction of about 44.69%. The volume of the model trained is
reduced from 92.7 M to 33.5 M, a compression of about 63.43%. At the same time, the time
required for training 300 epochs is reduced by 3.4%.
Neural network algorithms based on computer vision and deep learning have high
requirements on the hardware and computing power of microcomputers. The memory
and computational resources of the picking robot are limited in the recognition process of
Hemerocallis citrina Baroni, so the GGSC YOLOv5 algorithm can show its advantages of being
lightweight, and can reduce the demand of hardware equipment for the picking device.
426
Electronics 2022, 11, 2743
Figure 7. Comparison of the number of model parameters.
4.3. Model Training Process Analysis
The loss function convergence curves during model training are shown in Figure 8.
As can be seen from the figure, the loss function curves of the training and validation sets
of the training process show an obvious convergence trend, and the convergence speed of
the validation set is faster, which proves that the model has excellent learning performance
during the training process, so it shows more satisfactory results in the validation process.
Figure 8. Loss value convergence curve with epoch times.
During the training process of the previous 50 times, the feature extraction is obvious,
the learning efficiency is high, and the loss function continues to decline. After 100 iterations
of training, the convergence trend of GGSC YOLOv5 and YOLOv5 algorithms is roughly
the same, showing a gradual stabilization trend, and the loss function value does not
decrease, the model converges, and the detection accuracy tends to be stable.
In the field of deep learning target detection, the reliability of the resulting model can
be evaluated by calculating the precision (P), recall (R), and harmonic mean (F1 ) based on
the number of positive and negative samples.
The R − P curve consists of R and P. It can show the variation trend of model P with
R. The area under the R − P curve line can indicate the average precision (AP) of the model,
and the larger the area under the R − P curve line, the higher the AP of the model, and the
better the comprehensive performance.
The R − P curves of the GGSC YOLOv5 and YOLOv5 algorithms are shown in Figure 9.
In the figure, the trend and area under the line are approximately the same for both curves.
During the model training, the AP value of GGSC YOLOv5 is 0.884, whereas the AP value
of the YOLOv5 algorithm is 0.890, which is a very small difference. However, the model
427
Electronics 2022, 11, 2743
structure of the GGSC YOLOv5 algorithm is simpler, lighter, and requires less hardware
devices, memory size, and computer computing power.
Figure 9. Comparison with R − P curve.
The harmonic mean F1 is influenced by P and R, which can reflect the comprehensive
performance of the model. The value of F1 is higher, and the model has better equilibrium
performance for P and R, and vice versa. P and R indexes in the model can be effectively
assessed by F1 , which can determine whether there is a sharp increase in one and a sudden
decrease in the other. Therefore, it is an important indicator to assess the reliability and
comprehensiveness of the model.
The variation trend of YOLOv5 and GGSC YOLOv5 harmonic mean value curves F1
with confidence is shown in Figure 10. After combining the lightweight network and the
dual attention mechanism, the GGSC YOLOv5 algorithm has the same harmonic mean
value as YOLOv5, both of which are 0.84. The results show that the harmonic performance
of the improved algorithm is not affected on the basis of achieving lightweight.
Figure 10. Comparison of the F1 curves for before and after algorithm improvement.
In the process of identifying whether Hemerocallis citrina Baroni is mature, detection
precision (P) is a key performance indicator that has a decisive impact on the picking results.
In the process of picking Hemerocallis citrina Baroni, the higher the P, the more accurate the
picking, and the lower the loss, the higher the income, and vice versa.
The precision curves of the YOLOv5 algorithm and the GGSC YOLOv5 algorithm,
as well as the curve fitting, are shown in Figure 11. As can be seen from the figures,
Figure 11a shows the original data and precision curves of the YOLOv5 and GGSC YOLOv5
algorithms. Figure 11b,c show the original and fitted curves of the YOLOv5 and GGSC
428
Electronics 2022, 11, 2743
YOLOv5 algorithms, respectively. Figure 11d shows the fitted precision curves of the
YOLOv5 and GGSC YOLOv5 algorithms.
Figure 11. Model precision curve.
In the original precision curve and the fitted precision curve, GGSC YOLOv5 has
less fluctuation range and higher precision compared with YOLOv5. During the training
process, the final precision of YOLOv5 is 82.36%, whereas the final precision of GGSC
YOLOv5 is 84.90%. After the introduction of Ghost Conv, Ghost Bottleneck, and the double
attention mechanism, not only is a light weight achieved, but also the detection precision is
improved by 2.55%.
The precision and fast picking of Hemerocallis citrina Baroni is a prerequisite to ensure
picking efficiency. Therefore, for the maturity detection of Hemerocallis citrina Baroni, in
addition to the detection precision, the real-time detection speed is also a crucial factor.
The real-time detection speed is determined by the number of image frames processed
per second (FPS). The more frames processed per second, the faster the real-time detection
speed and the better the real-time detection performance of the model, and vice versa. In
the maturity detection process of Hemerocallis citrina Baroni, the real-time detection speed
of the YOLOv5 algorithm is 64.14 FPS, whereas the GGSC YOLOv5 is 96.96 FPS, which
exceeds the original algorithm by about 51.13%. It can be seen that based on computer
vision technology and deep learning methods, the GGSC YOLOv5 algorithm can complete
the recognition of Hemerocallis citrina Baroni with high accuracy and efficiency.
In summary, the average precision and harmonic mean performance of GGSC YOLOv5
and YOLOv5 algorithms are approximately the same. However, in model lightweight
analysis, the GGSC YOLOv5 algorithm has more prominent advantages, which is in
line with the future development direction of neural networks, and can also meet the
needs of embedded devices in agricultural production. The experimental results of the
training process show that GGSC YOLOv5 has higher detection precision and real-time
detection speed, which can effectively improve the picking efficiency and meet the needs
of Hemerocallis citrina Baroni picking.
Figure 12 compares the maturity detection results of the YOLOv5 algorithm and the im-
proved GGSC YOLOv5 lightweight algorithm for Hemerocallis citrina Baroni. It can be seen
from Figure 12a that the improved algorithm has higher coverage and detection precision
429
Electronics 2022, 11, 2743
for yellow flower detection, with the same confidence threshold and intersection-over-
union ratio threshold. In the multi-plant environment, GGSC YOLOv5 was more effective
in detecting the overlap of Hemerocallis citrina Baroni fruits, whereas in the single-plant
environment, the GGSC YOLOv5 algorithm gave a higher confidence in classification and
maturity detection. In contrast, the GGSC YOLOv5 algorithm proposed in this paper has
better maturity detection ability, and it can accurately identify highly dense, overlapping,
and obscured Hemerocallis citrina Baroni fruits.
Figure 12. Cont.
430
Electronics 2022, 11, 2743
(a)
(b)
Figure 12. Maturity detection results of Hemerocallis citrina Baroni by different algorithms. (a) Test
results of multi-plant and single-plant environment. (b) Test results of rainy weather environment.
In crop growing and picking, special environmental factors (e.g., rainy weather) can
affect the normal picking work. Therefore, in order to verify the effectiveness of the
proposed algorithm in this paper under multiple scenarios, the detection results of different
algorithms in rainy weather environments are presented in Figure 12b. The experiments
show that special factors such as rain and dew adhesion do not affect the effectiveness of
the proposed algorithm, and it shows better maturity detection and detection results than
the original algorithm, which shows that the proposed algorithm has good generalization
and derivation ability.
5. Conclusions
In this paper, we propose a deep learning target detection algorithm, GGSC YOLOv5,
based on a lightweight and dual attention mechanism, and apply it to the picking maturity
detection process of Hemerocallis citrina Baroni. Ghost Conv and Ghost Bottleneck are used
as the backbone networks to complete feature extraction, and reduce the complexity and
redundancy of the model itself, and the dual attention mechanisms of SE and CBAM
431
Electronics 2022, 11, 2743
are introduced to increase the tendency of the model feature extraction, and improve the
detection precision and real-time detection efficiency. The experimental results show that
the proposed algorithm achieves an improvement of detection precision and detection
efficiency under the premise of being lightweight, and has strong discrimination and
generalization ability, which can be widely applied in a multi-scene environment.
In future research and work, the multi-level classification of Hemerocallis citrina Baroni
will be carried out. Through the accurate maturity detection of different maturity levels
of Hemerocallis citrina Baroni, it will be able to play different edible and medicinal roles at
different growth stages, and can then be fully exploited to enhance the economic benefits.
Author Contributions: Conceptualization, L.Z., L.W. and Y.L.; methodology, L.Z., L.W. and Y.L.;
software, L.Z. and Y.L.; validation, L.W. and Y.L.; investigation, Y.L.; resources, L.W.; data curation,
L.Z.; writing—original draft preparation, L.Z., L.W. and Y.L.; writing—review and editing, L.W. and
Y.L.; visualization, L.Z.; supervision, L.W. and Y.L.; project administration, Y.L.; funding acquisition,
L.W. All authors have read and agreed to the published version of the manuscript.
Funding: This research was funded by the Shanxi Provincial Philosophy and Social Science Planning
Project, grant number 2021YY198; and Shanxi Datong University Scientific Research Yun-Gang
Special Project (2020YGZX014 and 2021YGZX27).
Acknowledgments: The authors would like to thank the reviewers for their careful reading of our paper
and for their valuable suggestions for revision, which make it possible to present our paper better.
Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design
of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or
in the decision to publish the results.
References
1. Lin, Y.D.; Chen, T.T.; Liu, S.Y.; Cai, Y.L.; Shi, H.W.; Zheng, D.; Lan, Y.B.; Yue, X.J.; Zhang, L. Quick and accurate monitoring peanut
seedlings emergence rate through UAV video and deep learning. Comput. Electron. Agric. 2022, 197, 106938. [CrossRef]
2. Perugachi-Diaz, Y.; Tomczak, J.M.; Bhulai, S. Deep learning for white cabbage seedling prediction. Comput. Electron. Agric. 2021,
184, 106059. [CrossRef]
3. Feng, A.; Zhou, J.; Vories, E.; Sudduth, K.A. Evaluation of cotton emergence using UAV-based imagery and deep learning. Comput.
Electron. Agric. 2020, 177, 105711. [CrossRef]
4. Azimi, S.; Wadhawan, R.; Gandhi, T.K. Intelligent Monitoring of Stress Induced by Water Deficiency in Plants Using Deep
Learning. IEEE Trans. Instrum. Meas. 2021, 70, 1–13. [CrossRef]
5. Patel, A.; Lee, W.S.; Peres, N.A.; Fraisse, C.W. Strawberry plant wetness detection using computer vision and deep learning.
Smart Agric. Technol. 2021, 1, 100013. [CrossRef]
6. Liu, W.; Wu, G.; Ren, F.; Kang, X. DFF-ResNet: An insect pest recognition model based on residual networks. Big Data Min. Anal.
2020, 3, 300–310. [CrossRef]
7. Wang, K.; Chen, K.; Du, H.; Liu, S.; Xu, J.; Zhao, J.; Chen, H.; Liu, Y.; Liu, Y. New image dataset and new negative sample
judgment method for crop pest recognition based on deep learning models. Ecol. Inf. 2022, 69, 101620. [CrossRef]
8. Jiang, H.; Li, X.; Safara, F. IoT-based Agriculture: Deep Learning in Detecting Apple Fruit Diseases. Microprocess. Microsyst. 2021,
91, 104321. [CrossRef]
9. Orano, J.F.V.; Maravillas, E.A.; Aliac, C.J.G. Jackfruit Fruit Damage Classification using Convolutional Neural Network. In Proceedings
of the 2019 IEEE 11th International Conference on Humanoid, Nanotechnology, Information Technology, Communication and Control,
Environment, and Management (HNICEM), Laoag, Philippines, 29 November–1 December 2019; pp. 1–6. [CrossRef]
10. Herman, H.; Cenggoro, T.W.; Susanto, A.; Pardamean, B. Deep Learning for Oil Palm Fruit Ripeness Classification with DenseNet.
In Proceedings of the 2021 International Conference on Information Management and Technology (ICIMTech), Jakarta, Indonesia,
19–20 August 2021; pp. 116–119. [CrossRef]
11. Gayathri, S.; Ujwala, T.U.; Vinusha, C.V.; Pauline, N.R.; Tharunika, D.B. Detection of Papaya Ripeness Using Deep Learning
Approach. In Proceedings of the 2021 3rd International Conference on Inventive Research in Computing Applications (ICIRCA),
Coimbatore, India, 2–4 September 2021; pp. 1755–1758. [CrossRef]
12. Wu, D.; Wu, C. Research on the Time-Dependent Split Delivery Green Vehicle Routing Problem for Fresh Agricultural Products
with Multiple Time Windows. Agriculture 2022, 12, 793. [CrossRef]
13. An, Z.; Wang, X.; Li, B.; Xiang, Z.; Zhang, B. Robust visual tracking for UAVs with dynamic feature weight selection. Appl. Intell.
2022, 14, 392–407. [CrossRef]
432
Electronics 2022, 11, 2743
14. Kumar, A.; Joshi, R.C.; Dutta, M.K.; Jonak, M.; Burget, R. Fruit-CNN: An Efficient Deep learning-based Fruit Classification and Quality
Assessment for Precision Agriculture. In Proceedings of the 2021 13th International Congress on Ultra-Modern Telecommunications
and Control Systems and Workshops (ICUMT), Brno, Czech Republic, 25–27 October 2021; pp. 60–65. [CrossRef]
15. Widiyanto, S.; Wardani, D.T.; Wisnu Pranata, S. Image-Based Tomato Maturity Classification and Detection Using Faster R-CNN
Method. In Proceedings of the 2021 5th International Symposium on Multidisciplinary Studies and Innovative Technologies
(ISMSIT), Ankara, Turkey, 21–23 October 2021; pp. 130–134. [CrossRef]
16. Wu, H.; Cheng, Y.; Zeng, R.; Li, L. Strawberry Image Segmentation Based on Uˆ 2-Net and Maturity Calculation. In Proceedings of
the 2022 14th International Conference on Advanced Computational Intelligence (ICACI), Wuhan, China, 15–17 July 2022; pp. 74–78.
[CrossRef]
17. Zhang, R.; Li, X.; Zhu, L.; Zhong, M.; Gao, Y. Target detection of banana string and fruit stalk based on YOLOv3 deep learning
network. In Proceedings of the 2021 IEEE 2nd International Conference on Big Data, Artificial Intelligence and Internet of Things
Engineering (ICBAIE), Nanchang, China, 26–28 March 2021; pp. 346–349. [CrossRef]
18. Mohd Basir Selvam, N.A.; Ahmad, Z.; Mohtar, I.A. Real Time Ripe Palm Oil Bunch Detection using YOLO V3 Algorithm. In
Proceedings of the 2021 IEEE 19th Student Conference on Research and Development (SCOReD), Kota Kinabalu, Malaysia, 23–25
November 2021; pp. 323–328. [CrossRef]
19. Wu, Y.J.; Yi, Y.; Wang, X.F.; Jian, C. Fig Fruit Recognition Method Based on YOLO v4 Deep Learning. In Proceedings of the 2021
18th International Conference on Electrical Engineering/Electronics, Computer, Telecommunications and Information Technology
(ECTI-CON), Chiang Mai, Thailand, 19–22 May 2021; pp. 303–306. [CrossRef]
20. Zhou, X.; Wang, P.; Dai, G.; Yan, J.; Yang, Z. Tomato Fruit Maturity Detection Method Based on YOLOV4 and Statistical Color
Model. In Proceedings of the 2021 IEEE 11th Annual International Conference on CYBER Technology in Automation, Control,
and Intelligent Systems (CYBER), Jiaxing, China, 27–31 July 2021; pp. 904–908. [CrossRef]
21. Jose, N.T.; Marco, M.; Claudio, F.; Andres, V. Disease and Defect Detection System for Raspberries Based on Convolutional Neural
Networks. Electronics 2021, 11, 11868. [CrossRef]
22. Wang, J.; Wang, L.Q.; Han, Y.L.; Zhang, Y.; Zhou, R.Y. On Combining Deep Snake and Global Saliency for Detection of Orchard
Apples. Electronics 2021, 11, 6269. [CrossRef]
23. Zhou, X.; Ma, H.; Gu, J.; Chen, H.; Deng, W. Parameter adaptation-based ant colony optimization with dynamic hybrid mechanism.
Eng. Appl. Artif. Intell. 2022, 114, 105139. [CrossRef]
24. Chen, H.Y.; Miao, F.; Chen, Y.J.; Xiong, Y.J.; Chen, T. A Hyperspectral Image Classification Method Using Multifeature Vectors
and Optimized KELM. IEEE J. Sel. Top. Appl. Earth Obs. Remote Sens. 2021, 14, 2781–2795. [CrossRef]
25. Wang, C.Y.; Mark Liao, H.Y.; Wu, Y.H.; Chen, Y.H.; Hsieh, J.W.; Yeh, I.H. CSPNet: A New Backbone that can Enhance Learning
Capability of CNN. In Proceedings of the 2020 IEEE/CVF Conference on Computer Vision and Pattern Recognition Workshops
(CVPRW), Seattle, WA, USA, 14–19 June 2020; pp. 1571–1580. [CrossRef]
26. He, K.; Zhang, X.; Ren, S.; Sun, J. Spatial Pyramid Pooling in Deep Convolutional Networks for Visual Recognition. IEEE Trans.
Pattern Anal. Mach. Intell. 2015, 37, 346–361. [CrossRef] [PubMed]
27. Zhao, H.; Liu, J.; Chen, H.; Li, Y.; Xu, J.; Deng, W. Intelligent diagnosis using continuous wavelet transform and gauss
convolutional deep belief network. IEEE Trans. Reliab. 2022, 2022, 1–11. [CrossRef]
28. Han, K.; Wang, Y.; Tian, Q.; Guo, J.; Xu, C. GhostNet: More Features from Cheap Operations. In Proceedings of the 2020 IEEE/CVF
Conference on Computer Vision and Pattern Recognition (CVPR), Seattle, WA, USA, 14–19 June 2020; pp. 1577–1586. [CrossRef]
29. Hu, J.; Shen, L.; Albanie, S.; Sun, G.; Wu, E. Squeeze-and-Excitation Networks. IEEE Trans. Pattern Anal. Mach. Intell. 2020, 42,
2011–2023. [CrossRef] [PubMed]
30. Yao, R.; Guo, C.; Deng, W.; Zhao, H. A novel mathematical morphology spectrum entropy based on scale-adaptive techniques.
ISA Trans. 2022, 126, 691–702. [CrossRef] [PubMed]
31. Woo, S.; Park, J.; Lee, J.Y.; Kweon, I.S. CBAM: Convolutional Block Attention Module. In Proceedings of the 15th European
Conference on computer vision (ECCV), Munich, Germany, 8–14 September 2018; Springer: Cham, Switzerland, 2018; pp. 3–19.
32. Deng, W.; Ni, H.; Liu, Y.; Chen, H.; Zhao, H. An adaptive differential evolution algorithm based on belief space and generalized
opposition-based learning for resource allocation. Appl. Soft Comput. 2022, 127, 109419. [CrossRef]
433
electronics
Article
Abnormal Cockpit Pilot Driving Behavior Detection Using
YOLOv4 Fused Attention Mechanism
Nongtian Chen 1, *, Yongzheng Man 2 and Youchao Sun 3
1 College of Aviation Engineering, Civil Aviation Flight University of China, Guanghan 618307, China
2 College of Civil Aviation Safety Engineering, Civil Aviation Flight University of China,
Guanghan 618307, China
3 College of Civil Aviation, Nanjing University of Aeronautics and Astronautics, Nanjing 211106, China
* Correspondence: [email protected]; Tel.: +86-83-8518-3621
Abstract: The abnormal behavior of cockpit pilots during the manipulation process is an important
incentive for flight safety, but the complex cockpit environment limits the detection accuracy, with
problems such as false detection, missed detection, and insufficient feature extraction capability.
This article proposes a method of abnormal pilot driving behavior detection based on the improved
YOLOv4 deep learning algorithm and by integrating an attention mechanism. Firstly, the semantic
image features are extracted by running the deep neural network structure to complete the image and
video recognition of pilot driving behavior. Secondly, the CBAM attention mechanism is introduced
into the neural network to solve the problem of gradient disappearance during training. The
CBAM mechanism includes both channel and spatial attention processes, meaning the feature
extraction capability of the network can be improved. Finally, the features are extracted through the
convolutional neural network to monitor the abnormal driving behavior of pilots and for example
verification. The conclusion shows that the deep learning algorithm based on the improved YOLOv4
method is practical and feasible for the monitoring of the abnormal driving behavior of pilots during
the flight maneuvering phase. The experimental results show that the improved YOLOv4 recognition
Citation: Chen, N.; Man, Y.; Sun, Y. rate is significantly higher than the unimproved algorithm, and the calling phase has a mAP of
Abnormal Cockpit Pilot Driving 87.35%, an accuracy of 75.76%, and a recall of 87.36%. The smoking phase has a mAP of 87.35%, an
Behavior Detection Using YOLOv4 accuracy of 85.54%, and a recall of 85.54%. The conclusion shows that the deep learning algorithm
Fused Attention Mechanism.
based on the improved YOLOv4 method is practical and feasible for the monitoring of the abnormal
Electronics 2022, 11, 2538. https://
driving behavior of pilots in the flight maneuvering phase. This method can quickly and accurately
doi.org/10.3390/electronics11162538
identify the abnormal behavior of pilots, providing an important theoretical reference for abnormal
Academic Editor: George A. behavior detection and risk management.
Papakostas
Keywords: pilot abnormal behavior; behavior detection; YOLOv4 algorithm; CBAM; flight safety
Received: 26 July 2022
Accepted: 9 August 2022
Published: 13 August 2022
Publisher’s Note: MDPI stays neutral 1. Introduction
with regard to jurisdictional claims in
Overall, 60% to 80% of flight accidents are caused by human factors. The statistics
published maps and institutional affil-
iations.
from the Civil Aviation Safety Annual Report show that in the past 10 years, the proportion
of flight accidents caused by pilot and flight crew factors has been as high as 67.16% [1].
With the rapid development of civil aviation, the air transportation volume has increased
significantly, and ensuring aviation safety has resulted in higher requirements for civil
Copyright: © 2022 by the authors. aviation pilots. According to relevant aviation accident statistics, most of the flight accidents
Licensee MDPI, Basel, Switzerland. are caused by the abnormal behavior of pilots, and the abnormal behavior of pilots in the
This article is an open access article cockpit is directly or indirectly related to flight accidents and symptoms. On 10 July 2018,
distributed under the terms and an oxygen mask incident occurred in the airspace of Guangzhou on a flight from Hong
conditions of the Creative Commons Kong to Dalian in China. The investigation results showed that the cause of the incident
Attribution (CC BY) license (https:// was that the co-pilot smoked electronic cigarettes in the cockpit (abnormal behavior). An
creativecommons.org/licenses/by/ adjacent air conditioning unit was mistakenly shut down, resulting in a lack of oxygen
4.0/).
Electronics 2022, 11, 2538. https://doi.org/10.3390/electronics11162538 https://www.mdpi.com/journal/electronics
435
Electronics 2022, 11, 2538
in the cabin, triggering the incident. The Civil Aviation Administration of China issued
an advisory circular (AC-121-FS-2018-130) on the flight operation style of civil aviation
pilots, regulating pilots during the whole process of flight operations from the pre-flight
stage to the flight operation stage, post-flight, and short-stop and station-based stages,
driving behavior to improve the professionalism of pilot teams. Possible solutions for how
to identify and monitor the abnormal behavior of pilots effectively, prevent the possible
consequences of the risk of abnormal behavior of pilots, and explore and establish an
effective mechanism to reduce human errors from the perspective of intrinsic safety have
attracted the attention of many researchers. Therefore, it is of great practical significance to
carry out research on the identification, monitoring, and early warnings of the abnormal
driving behavior of pilots to regulate this driving behavior of pilots and ensure the safety
of aviation operations.
Abnormal behavior research originated in the 1960s, and first explored the mechanism
of abnormal behavior from the perspective of the behavioral environment [2]. Action
recognition is an important field in computer vision and has been the subject of exten-
sive research. It is widely used in pedestrian detection [3], robot vision [4], car driver
detection [5], intelligent monitoring [6], and worker detection [7]. With the development
of information technology, more scholars are using information detection technology to
carry out abnormal behavior research. Abnormal behavior identification and detection
processes are used to locate and detect abnormal actions; that is, the accurate identifica-
tion of a certain action. The traditional detection technology has problems such as poor
robustness to changing targets and long and redundant detection windows, which limit the
improvement of the accuracy and speed during target detection. With the emergence of con-
volutional neural networks, due to their better representative learning ability, the research
on abnormal behavior detection began to develop in the direction of convolutional neural
network technology. In 2017, Wang et al. [8] tried to use the depth map method for the
first time to identify the hand movements of cockpit pilots and to implement an approach
and landing safety analysis. Liu et al. extracted time series of 3D human skeleton key
points using Yolov4 and applied a mean shift target tracking algorithm, then converted key
points into spatial RGB data and put them into a multi-layer convolution neural network
for recognition [9]. Zhou et al. proposed a new framework for behavior recognition [10]. In
this framework, we propose an object depth estimation algorithm to compute the 3D spatial
location object information and use this information as the input to the action recognition
model. At the same time, to obtain more spatiotemporal information and better deal with
long-term videos, combined with the attention mechanism, spatiotemporal convolution
and attention-based LSTMs (ST-CNN and ATT-LSTM) are proposed. Incorporating deep
spatial information into each segment, the model focuses on the extraction of key informa-
tion, which is crucial for improving the behavior recognition performance. Some scholars
have proposed an abnormal target detection method based on the T-TINY-YOLO network
model. The YOLO network model is used to train the calibrated abnormal behavior data to
achieve end-to-end abnormal behavior classification, thereby achieving abnormal target de-
tection for specific application scenarios [11]. Some scholars have studied the impact of civil
aviation pilots’ work stress on unsafe behavior based on a correlation analysis and multiple
regression analysis [12]. In 2018, Yang et al. used the heads-up display to perform pattern
recognition for pilot behavior, and for the first time proposed a behavior recognition frame-
work that included pilot eye movements, head movements, and hand movements [13].
The deep-learning-based anomaly detection reduces human labor and its decision making
ability is comparatively reliable, thereby ensuring public safety. Waseem et al. proposed
a two-stream neural network in this direction for anomaly detection in surveillance [14].
Qu proposed a future frame prediction framework and a multiple instance learning (MIL)
framework by leveraging attention schemes to learn anomalies [15]. Other scholars have
used 3D ConvNets to identify anomalies from surveillance videos [16]. Waseem et al.
presented an efficient light-weight convolutional neural network (CNN)-based anomaly
recognition framework that is functional in surveillance environments with reduced time
436
Electronics 2022, 11, 2538
complexity [17]. One-shot image recognition has been explored for many applications in
the computer vision community. One-shot anomaly recognition can be efficiently handled
according to the 3D-CNN model [18]. The low reliability during feature and tracking box
detection is still a problem in visual object tracking, An et al. proposed a robust tracking
method for unmanned aerial vehicles (UAV) using dynamic feature weight selection [19].
Wu designed a road travel time calculation method across time periods. Considering
the time-varying vehicle speed, fuel consumption, carbon emissions, and customer time
window, the satisfaction measure function and economic cost measure function based on
the time window were adopted [20]. Regarding the study by Chen [21], in order to improve
the accuracy and generalization ability during hyperspectral image classification, in their
paper a feature extraction method combining a principal component analysis (PCA) and
local binary pattern (LBP) was developed for hyperspectral images, which provided a new
idea for processing hyperspectral images. Zhou [22] proposed an ant colony optimization
(ACO) algorithm based on parameter adaptation using a particle swarm optimization (PSO)
algorithm with global optimization ability, a fuzzy system with fuzzy reasoning ability, and
a 3-Opt algorithm with local search ability, namely PF3SACO. Yao et al. proposed a scale-
adaptive mathematical morphological spectral entropy (AMMSE) approach to improve
the scale selection. In support of the proposed method, two properties of the mathematical
morphological spectra (MMS), namely the non-negativity and monotonic decrease, were
demonstrated [23].
In recent years, deep learning has achieved outstanding performance in many fields,
such as image processing, speech recognition, and semantic segmentation. Now, the
commonly used neural networks include deep Boltzmann machines (DBM), recurrent
neural networks (RNNs) [24], and convolutional neural networks (CNNs) [25]. In 2015,
Girshick [26] first proposed the R-CNN algorithm for abnormal behavior recognition,
which effectively improved the recognition accuracy. The improved algorithms, such as
Fast R-CNN and Faster R-CNN, proposed later have higher efficiency and accuracy in
abnormal behavior recognition [27,28]. These improved methods improve the speed of the
information collection, information processing ability, and transmission speed, and provide
important theoretical and technical support for abnormal behavior identification and early
warnings. There are many regional models based on deep learning, including SSP [29],
SSD [30], and YOLO [31,32].
In short, many scholars have carried out studies on abnormal behavior recognition
and have achieved many effective results, but further research is needed on the abnormal
behavior recognition algorithms and monitoring effects, especially as research combined
with the abnormal behavior of pilots in the civil aviation industry is rare. This paper
proposes an abnormal pilot behavior monitoring and identification algorithm based on an
improved YOLOv4 (you only look once) approach, adopts a deep-learning-based abnormal
behavior target detection algorithm, and introduces a convolutional attention mechanism
module (CBAM) for the feature fusion of the backbone network. A convolutional back
attention module is used to enhance the perception of the model in the channel and
space, and finally to extract the features through the convolutional neural network and
monitor and identify the abnormal behavior of pilots in order to provide a reference for the
identification of the abnormal behavior of pilots and the norms of pilot behavior.
2. Overview of the Method
2.1. Convolutional Neural Networks
In recent years, convolutional neural networks (CNNs) have made great progress in
image and video processing. The CNNs extract the high-level semantic features of images
through the deep neural network structure, and complete the recognition and classification
of complex images and videos. A convolutional neural network is generally a feed-forward
neural network formed by overlapping convolutional layers, pooling layers, and fully
connected layers, and the characteristics include local connections, weight sharing, and
aggregation. These properties make convolutional neural networks invariant to certain
437
Electronics 2022, 11, 2538
degrees of translation, scaling, and rotation. The role of the convolutional layer is to extract
the features of a local area, and the different convolution kernels are equivalent to different
feature extractors. The role of the pooling layer is to perform feature selection and reduce
the number of features, thereby reducing the number of parameters. The learning rate is a
very important parameter in such algorithms. Here, Softmax is selected as the classifier,
and the optimization algorithm of the learning rate is the adaptive algorithm Adam. Its
calculation formula is:
m t = β 1 m t −1 + (1 − β 1 ) gt (1)
vt = β 2 vt−1 + (1 − β 2 ) gt2 (2)
Here, t is the time, mt is the first-order moment estimation of the gradient, vt is the
second-order moment estimation of the gradient, and β 1 and β 2 are the exponential decay
rated of the moment estimation, ranging from 0 to 1. When calculating the deviation
correction, Equation (2) will be used, where mˆt and vˆt are the corrections of the sum:
mt
mˆt = (3)
1 − β1 t
vt
vˆt = (4)
1 − β2 t
The gradient is updated using Equation (5):
√
θt+1 = θt − μmˆt /( v ˆt + ε) (5)
Here, ε is a numerically stable small constant; θ t represents the gradient to be updated,
generally 10−8 ; and μ is the step size, generally 0.001.
2.2. YOLO
The YOLO algorithm is an object recognition and localization algorithm based on a
deep neural network. It is characterized by improving the speed of the deep learning target
detection process and meeting the requirements for real-time monitoring to a certain extent.
The CNN algorithm convolves the image through the convolutional neural network, but
the detection speed is low, which cannot meet the needs of real-time monitoring. The
characteristic of the YOLO algorithm is that only one CNN operation is needed for the
image, and the corresponding region and position of the regression prediction frame can
be obtained in the output layer. The algorithm steps are as follows.
Divide the original image into S × S grid cells. If an object falls in the grid, then the
feature of the grid is the object (if multiple objects fall in this grid, the closest object in the
center is the feature of this grid).
(1) The features of each grid need B bounding boxes (Bbox) to return. To ensure accuracy,
the B box features corresponding to each grid are also the same.
(2) Each Bbox also predicts 5 values: x, y, w, h, and the confidence. The (x, y) is the relative
position of the center of the Bbox in the corresponding grid, and (w, h) is the length
and width of the Bbox relative to the full image. The range of these 4 values is [0, 1],
and these 4 values can be calculated from the features. The confidence is a numerical
measure of how accurate a prediction is. Let us set the reliability as C, where I refers
to the intersection ratio between the predicted Bbox and the ground-truth box in the
image; the probability of containing objects in the corresponding grid of the Bbox is P,
and the formula is:
C=Pi (6)
(3) If the grid corresponding to the Bbox contains objects, then P = 1, otherwise it is equal
to 0. If there are N prediction categories, plus the confidence of the previous Bbox
438
Electronics 2022, 11, 2538
prediction, the S × S grid requires o output information. The calculation method is
as follows:
o = S × S × (1 + B + N ) (7)
For each grid, the confidence that it belongs to each category will also be predicted.
Among them, the B boxes can only belong to one category, which corresponds to the first
step, and its characteristics are the same.
2.3. YOLOv4
2.3.1. CSPDarkent–53
CSPDarknet-53 is based on the YOLOv4 backbone network, and is modified and
improved on the basis of it, finally forming a backbone structure that includes 5 CSP
modules. The CSP module divides the feature map of the base layer into two parts; that is,
the original stack of residual blocks is split into two different parts on the left and right.
The main part is used to continue the original stack of residual blocks, and the other part is
similar to the residual edge, which is directly connected to the end after a small amount of
processing. They are then merged through a cross-stage hierarchy. Through this processing,
the accuracy of the model is also ensured based on reducing the amount of calculation.
2.3.2. Prediction Box Selection
The prediction principle of YOLOv4 is to divide the image into 13 × 13, 26 × 26, and
52 × 52 networks, and each network node is responsible for the prediction of one area.
YOLOv4 uses a clustering method to select candidate frames, and the cluster centers are
divided into 3 scales of different sizes according to the different sizes used for prediction.
The calculation formula for the offset predicted by the network is:
bx = σ (t x ) + c x (8)
by = σ ( t y ) + c y (9)
bw = p w e t w (10)
bh = p h e tw
(11)
Here, (cx , cy ) is the distance from the upper left corner (when the prediction frame is
selected, the values of cx and cy are 1); (pw , ph ) are the length and width of the prior frame,
respectively; pw and ph are determined manually; (tx , ty ) is the offset of the target center
point relative to the upper left corner of the grid, where the prediction point is located;
(tw , th ) are the width and height of the prediction frame, which are related to pw and ph ,
respectively (see Equations (10) and (11)) and with which the width and height of the Bbox
are obtained; σ is the activation function, indicating the probability between [0, 1].
3. The Improved Network Model
3.1. Channel Attention Mechanism
An attention mechanism is a method of processing data, which imitates the human vi-
sual system, integrates local visual structures, focuses attention on important points among
a lot of information, selects key information, and ignores other unimportant information. A
Channel attention block (CAB) can model the dependencies of different channel features,
fuse multi-channel feature images, and adaptively adjust their feature weights. The channel
attention module rescales the weights of each input channel so that the key region feature
channels containing the target object have a greater contribution during convolution. The
idea is to enhance the weight of the key channels and reduce the weight of invalid channels.
The channel attention can be expressed as Equation (12):
MC ( F ) = σ ( MLP( AvgPool ( F ))+ MLP( MaxPool ( F ))) (12)
439
Electronics 2022, 11, 2538
In the formula, F represents the feature of the input, where σ represents the activation
function, and AvgPool() and MaxPool() represent the processes of average pooling and
maximum pooling, respectively.
3.2. Spatial Attention Mechanism
In the process of behavior recognition, when the pilots perform abnormal behaviors
such as calling and smoking, the location features (such as gradients and grayscales) will
change drastically. Therefore, the spatial attention mechanism (SAB) can be used in the
feature map. By increasing the weights of the key parts, the network can focus more on
crucial features and improve the feature extraction ability of the network. The channel
attention mechanism is the part that the network one must pay attention to, and the spatial
attention mechanism gives the locations of key features. The specific implementation
process is shown in Equation (13):
MS ( F ) = σ ( f 7×7 ([ AvgPool ( F ); MaxPool ( F )])) (13)
In the formula, F also represents the feature of the input; 7 × 7 convolution is used for
feature extraction, then average pooling and maximum pooling are used for evaluation,
and finally normalization is performed according to the activation function σ.
3.3. Attention Mechanism Fusion
This article involves the fusion of the spatial attention mechanism and channel at-
tention mechanism, which will be used for the detection of behavior recognition in the
YOLOv4 algorithm. For an input video F, the global information for each feature channel is
obtained using the global average pooling and maximum pooling operations, and then the
future channel attention vector is obtained through two fully connected layers, which are
used to weigh the input feature F channel using MC (F). In addition, this feature is input to
the 3 × 3 convolution layer and output by the sigmoid function and MS (F), which gives the
feature F’. Its structure is shown in Figure 1. In this paper, the attention mechanism is added
to the two effective feature layers extracted from the backbone network, and the attention
mechanism is also added to the results after up-sampling. The attention mechanism in
this paper can enhance the feature extraction ability of the model based by increasing a
small amount of the computation. Due to the large size gap in the image dataset, after
the attention mechanism is introduced, the image features can be extracted from multiple
scales, which strengthens the model’s ability to detect images.
Figure 1. Fusion of CAB and SAB attention mechanisms.
4. Test and Analysis
4.1. Environment Settings
The environmental configuration of this experiment is shown in Table 1, and the
hardware configuration of the comparison experiment is the same configuration.
440
Electronics 2022, 11, 2538
Table 1. Numbers of various types of images.
Operating System Windows 10
CPU i7-10750H
RAM 16G
GPU RTX 2060Ti
Language Python 3.6
Backbone Network CSPDarkent–53
The research subjects in this paper are pilots. There is no special public dataset
available at present, so the database must be established by itself. The database data in
this paper mainly come from the relevant action pictures taken by us, pictures that meet
the requirements for the existing datasets, and relevant pictures searched on the Internet.
The dataset is prepared according to the deep learning standard dataset format in VOC
2007. The specific steps are: (1) use the labeling tool to classify the abnormal behavior in
the image, whereby the category names are calling and smoking; (2) create relevant files
according to the standard dataset format and save the files, including pictures, sizes, and
coordinates for target detection, then divide the dataset into a training set and test set at a
ratio of 9:1. Table 2 shows the numbers of images in the various categories in the dataset.
Table 2. Numbers of various types of images.
Type Calling Smoking
Number 500 500
4.2. Detection Process
According to the driving behavior requirements and flight guidelines for civil air-
craft pilots, smoking and calling during the flight can be called abnormal pilot behaviors.
Therefore, in the identification process, these typical abnormal behaviors are identified to
provide a basis for the implementation of abnormal driving behavior monitoring and early
warning processes. The process of detecting abnormal pilot behaviors is shown in Figure 2.
The main process is as follows.
Figure 2. Abnormal behavior detection process.
(1) Taking with a camera in the cockpit of an aircraft simulator, capture images in frame
units from the live video stream captured by the camera;
(2) Perform abnormal behavior detection on the pilots. Use the model trained by the deep
learning YOLO v4 algorithm to locate the pilot area, and when the area is detected,
the abnormal behavior can be identified according to the model;
441
Electronics 2022, 11, 2538
(3) Monitor the video. When there is abnormal behavior, it will give a warning. After the
frame detection ends, enter the next frame.
4.3. Model Training
In the improved YOLOv4 model training, the smaller the loss value of the model
structure the better, and the expected value is 0. To achieve the best performance for the
model, during training the number of iterations is set to 600, the weight decay coefficient
is set to 0.0001, and the learning rate momentum is set to 0.9 to prevent the model from
overfitting. The maximum training batch is set to 8, the loss function value drops sharply
from 0 to 300 times, and the loss number decreases slowly from 300 to 600 times. After
400 iterations, the loss value tends to stabilize around 0.05, and the model reaches the
maximum excellence state. The training loss is shown in Figure 3.
/RVV
(SRFK
Figure 3. Loss map.
4.4. Evaluation of the Model Performance
It can be seen from the Figure 4 below that for the two types of abnormal behaviors,
the recognition rate of the improved YOLOv4 is significantly higher than that of the
unimproved algorithm.
(a) (b)
(c) (d)
Figure 4. Object detection results using the YOLOv4 method (a,c) and object detection results using
our proposed method (b,d).
442
Electronics 2022, 11, 2538
When compared with the original YOLOv4 algorithm, the unified video is input and
the darknet backbone network is used for training. In order to make the model converge as
soon as possible, this experiment adopts the method of transfer learning. The experimental
data are shown in Table 3.
Table 3. Comparison between the original YOLO algorithm and the improved YOLO algorithm used
in this article.
YOLOv4/% Improved YOLOv4/%
Smoking 71 82
Calling 50 82
In the evaluation of the pilots’ abnormal behavior recognition effect, the important
parameters are as follows: TP indicates that abnormal behavior is detected, and there
is also abnormal behavior in the actual picture (the number of samples detected by the
algorithm); TN indicates that no abnormal behavior is detected, and the actual picture is
not abnormal (the number of correct error samples detected by the algorithm); FN means
that no abnormal behavior is detected, but abnormal behavior is present in the actual graph
(the number of samples that the algorithm detects wrong); FP means that no abnormal
behavior is detected, and there is no abnormal behavior in the actual graph (the number of
correct samples needed for the algorithm to detect errors); the recall rate (R) is the ratio of
the number of abnormal behaviors detected to the total number of abnormal behaviors;
the precision rate (P) is the ratio of the number of correctly detected abnormal behaviors to
the total number of abnormal behaviors [33–35]. The average precision (AP) measures the
accuracy of the model from the two aspects of precision and recall. It is a direct evaluation
standard for model accuracy, and it can also be analyzed using the detection effect of a
single category.
TP
R= (14)
TP + FN
TP
P= (15)
TP + FP
The abnormal behavior recognition results obtained according to Equations (14) and (15)
are shown in Table 4.
Table 4. Evaluation indicators of behavior detection.
Abnormal Behavior P/% R/% mAP/%
Smoking 85.54 85.54 89.23
Calling 75.76 87.36 87.35
5. Conclusions
An abnormal pilot behavior monitoring method based on the improved YOLO v4
algorithm was proposed. The method was verified by collecting abnormal behavior recog-
nition datasets. The recognition rate was improved compared to the original basis. The
CSPDarkent-53 framework was used to train the recognition model, which enhanced the
method. The robustness of the training model was 85.54% for docking calls and smoking
recognition. This method expands the training set through data augmentation, thereby
achieving high-accuracy recognition with less training data. The algorithm performance
needs to be further improved in later research. The next step is to explore the implantation
of the algorithm into the camera terminal for practical applications.
The deep learning algorithm based on the improved YOLOv4 abnormal driving
behavior monitoring algorithm can effectively identify the abnormal driving behavior of
pilots. The attention mechanisms (CAB and SAB) were introduced to enhance the model’s
perception in channels and spaces. The image semantic features are extracted based on the
443
Electronics 2022, 11, 2538
deep neural network structure, and the image and video recognition and classification of
the pilots’ driving behavior are then completed.
In the next step, we will continue to improve the network so that the network is not
limited to feature extraction in the spatial domain, and we will also add some information
in the time domain so as to further improve the generalization ability of the model.
Author Contributions: Conceptualization, N.C. and Y.S.; formal analysis, investigation, writing
of the original draft, N.C. and Y.M. All authors have read and agreed to the published version of
the manuscript.
Funding: This research was funded by the National Natural Science Foundation of China, grant
number U2033202; the Key R&D Program of the Sichuan Provincial Department of Science and Tech-
nology (2022YFG0213); and the Safety Capability Fund Project of the Civil Aviation Administration
of China (ASSA2022/17).
Data Availability Statement: The data used to support the findings of this study are included within
the article.
Acknowledgments: Written informed consent has been obtained from the patients to publish
this paper.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Annual Report on Aviation Safety in China, 2018; Civil Aviation Administration of China: Beijing, China, 2019.
2. Xiao, W.; Liu, H.; Ma, Z.; Chen, W. Attention-based deep neural network for driver behavior recognition. Future Gener. Comput.
Syst. 2022, 132, 152–161. [CrossRef]
3. Zhang, S.; Benenson, R.; Omran, M.; Hosang, J.; Schiele, B. How far are we from solving pedestrian detection? In Proceedings
of the IEEE Conference on Computer Vision and Pattern Recognition, Las Vegas, NV, USA, 27–30 June 2016; Volume 12,
pp. 1259–1267.
4. Senicic, M.; Matijevic, M.; Nikitovic, M. Teaching the methods of object detection by robot vision. In Proceedings of the IEEE
International Convention on Information and Communication Technology, Kansas City, MO, USA, 20–24 May 2018; Volume 7,
pp. 558–563.
5. Nemcová, A.; Svozilová, V.; Bucsuházy, K.; Smíšek, R.; Mezl, M.; Hesko, B.; Belák, M.; Bilík, M.; Maxera, P.; Seitl, M.; et al.
Multimodal features for detection of driver stress and fatigue. IEEE Trans. Intell. Transp. Syst. 2021, 22, 3214–3233. [CrossRef]
6. Popescu, D.; Stoican, F.; Stamatescu, G.; Ichim, L.; Dragana, C. Advanced UAV-WSN system for intelligent monitoring in precision
agriculture. Sensors 2020, 20, 817. [CrossRef] [PubMed]
7. Mneymneh, B.E.; Abbas, M.; Khoury, H. Vision-based framework for intelligent monitoring of hardhat wearing on construction
sites. J. Comput. Civ. Eng. 2019, 33, 04018066. [CrossRef]
8. Wang, T.; Fu, S.; Huang, D.; Cao, J. Pilot action identification in the cockpit. Electron. Opt. Control. 2017, 24, 90–94.
9. Liu, Y.; Zhang, S.; Li, Z.; Zhang, Y. Abnormal Behavior Recognition Based on Key Points of Human Skeleton. IFAC-PapersOnLine
2020, 53, 441–445. [CrossRef]
10. Zhou, K.; Hui, B.; Wang, J.; Wang, C.; Wu, T. A study on attention-based LSTM for abnormal behavior recognition with variable
pooling. Image Vis. Comput. 2021, 108, 104–120. [CrossRef]
11. Ji, H.; Zeng, X.; Li, H.; Ding, W.; Nie, X.; Zhang, Y.; Xiao, Z. Human abnormal behavior detection method based on T-TINY-YOLO.
In Proceedings of the 5th International Conference on Multimedia and Image Processing, Nanjing, China, 10–12 January 2020;
pp. 1–5.
12. Li, L.; Cheng, J. Research on the relationship between work stress and unsafe behaviors of civil aviation pilots. Ind. Saf. Environ.
Prot. 2019, 45, 46–49.
13. Yang, K.; Wang, H. Pilots use head-up display behavior pattern recognition. Sci. Technol. Eng. 2018, 18, 226–231.
14. Ullah, W.; Ullah, A.; Hussain, T.; Muhammad, K.; Heidari, A.A.; Del Ser, J.; Baik, S.W.; De Albuquerque, V.H.C. Artificial
Intelligence of Things-assisted two-stream neural network for anomaly detection in surveillance Big Video Data. Future Gener.
Comput. Syst. 2022, 129, 286–297. [CrossRef]
15. Li, Q.; Yang, R.; Xiao, F.; Bhanu, B.; Zhang, F. Attention-based anomaly detection in multi-view surveillance videos. Knowl.-Based
Syst. 2022, 252, 109348. [CrossRef]
16. Maqsood, R.; Bajwa, U.; Saleem, G.; Raza, R.H.; Anwar, M.W. Anomaly recognition from surveillance videos using 3D convolution
neural network. Multimed. Tools Appl. 2021, 80, 18693–18716. [CrossRef]
17. Ullah, W.; Ullah, A.; Hussain, T.; Khan, Z.A.; Baik, S.W. An efficient anomaly recognition framework using an attention residual
LSTM in surveillance videos. Sensors 2021, 21, 2811. [CrossRef]
444
Electronics 2022, 11, 2538
18. Ullah, A.; Muhammad, K.; Haydarov, K.; Haq, I.U.; Lee, M.; Baik, S.W. One-shot learning for surveillance anomaly recognition
using siamese 3d. In Proceedings of the International Joint Conference on Neural Networks, Glasgow, UK, 19–24 July 2020;
pp. 1–8.
19. An, Z.; Wang, X.; Li, B.; Xiang, Z.; Zhang, B. Robust visual tracking for UAVs with dynamic feature weight selection. Appl. Intell.
2022, 1–14. [CrossRef]
20. Wu, D.; Wu, C. Research on the Time-Dependent Split Delivery Green Vehicle Routing Problem for Fresh Agricultural Products
with Multiple Time Windows. Agriculture 2022, 12, 793. [CrossRef]
21. Chen, H.; Miao, F.; Chen, Y.; Xiong, Y.; Chen, T. A hyperspectral image classification method using multifeatured vectors and
optimized KELM. IEEE J. Sel. Top. Appl. Earth Obs. Remote Sens. 2021, 14, 2781–2795. [CrossRef]
22. Zhou, X.; Ma, H.; Gu, J.; Chen, H.; Deng, W. Parameter adaptation-based ant colony optimization with dynamic hybrid mechanism.
Eng. Appl. Artif. Intell. 2022, 114, 105139. [CrossRef]
23. Yao, R.; Guo, C.; Deng, W.; Zhao, H. A novel mathematical morphology spectrum entropy based on scale-adaptive techniques.
ISA Trans. 2022, 126, 691–702. [CrossRef]
24. Sherstinsky, A. Fundamentals of recurrent neural network (RNN) and long short-term memory (LSTM) network. Phys. D
Nonlinear Phenom. 2020, 404, 132306. [CrossRef]
25. Kattenborn, T.; Leitloff, J.; Schiefer, F.; Hinz, S. Review on Convolutional Neural Networks (CNN) in vegetation remote sensing.
ISPRS J. Photogramm. Remote Sens. 2021, 173, 24–49. [CrossRef]
26. Girshick, R. Fast R–CNN. Computer Science. In Proceedings of the 2015 IEEE International Conference on Computer Vision
(ICCV), Santiago, Chile, 7–13 December 2015.
27. Ren, S.; He, K.; Girshick, R.; Sun, J. Faster r-cnn: Towards real-time object detection with region proposal networks. Adv. Neural
Inf. Processing Syst. 2015, 28, 1137–1149. [CrossRef] [PubMed]
28. Deng, W.; Ni, H.; Liu, Y.; Chen, H.; Zhao, H. An adaptive differential evolution algorithm based on belief space and generalized
opposition-based learning for resource allocation. Appl. Soft Comput. 2022, 127, 109419. [CrossRef]
29. Huang, Z.; Huang, L.; Gong, Y.; Huang, C.; Wang, X. Mask scoring r-cnn. In Proceedings of the IEEE Conference on Computer
Vision and Pattern Recognition, Long Beach, CA, USA, 15–20 June 2019; pp. 6409–6418.
30. He, K.; Zhang, X.; Ren, S.; Sun, J. Spatial Pyramid Pooling in Deep Convolutional Networks for Visual Recognition. IEEE Trans.
Pattern Anal. Mach. Intell. 2015, 37, 1904–1916. [CrossRef]
31. Liu, W.; Anguelov, D.; Erhan, D.; Szegedy, C.; Reed, S.; Fu, C.Y.; Berg, A.C. SSD: Single shot multibox detector. In Lecture Notes in
Computer Science; Springer: Cham, Swizerland, 2016; Volume 9905, pp. 21–37.
32. Redmon, J.; Divvala, S.; Girshick, R.; Farhadi, A. You Only Look Once: Unified, Real-Time Object Detection. In Proceedings of the
2016 IEEE Conference on Computer Vision and Pattern Recognition, Las Vegas, NV, USA, 27–30 June 2016; pp. 779–788.
33. Chen, B.; Wang, X.; Bao, Q.; Jia, B.; Li, X.; Wang, Y. An Unsafe Behavior Detection Method Based on Improved YOLO Framework.
Electronics 2022, 11, 1912. [CrossRef]
34. Kumar, T.; Rajmohan, R.; Pavithra, M.; Ajagbe, S.A.; Hodhod, R.; Gaber, T. Automatic face mask detection system in public
transportation in smart cities using IoT and deep learning. Electronics 2022, 11, 904. [CrossRef]
35. Wahyutama, A.; Hwang, M. YOLO-Based Object Detection for Separate Collection of Recyclables and Capacity Monitoring of
Trash Bins. Electronics 2022, 11, 1323. [CrossRef]
445
electronics
Article
Quantum Dynamic Optimization Algorithm for Neural
Architecture Search on Image Classification
Jin Jin 1 , Qian Zhang 2 , Jia He 3, * and Hongnian Yu 4
1 School of Software Engineering, Chengdu University of Information Technology, Chengdu 610225, China
2 Active Network (Chengdu) Co., Ltd., Chengdu 610021, China
3 School of Computer Science, Chengdu University of Information Technology, Chengdu 610225, China
4 School of Computing, School of Engineering and the Built Environment, Edinburgh Napier University,
Edinburgh 16140, UK
* Correspondence: [email protected]
Abstract: Deep neural networks have proven to be effective in solving computer vision and natural
language processing problems. To fully leverage its power, manually designed network templates,
i.e., Residual Networks, are introduced to deal with various vision and natural language tasks.
These hand-crafted neural networks rely on a large number of parameters, which are both data-
dependent and laborious. On the other hand, architectures suitable for specific tasks have also grown
exponentially with their size and topology, which prohibits brute force search. To address these
challenges, this paper proposes a quantum dynamic optimization algorithm to find the optimal
structure for a candidate network using Quantum Dynamic Neural Architecture Search (QDNAS).
Specifically, the proposed quantum dynamics optimization algorithm is used to search for meaningful
architectures for vision tasks and dedicated rules to express and explore the search space. The
proposed quantum dynamics optimization algorithm treats the iterative evolution process of the
optimization over time as a quantum dynamic process. The tunneling effect and potential barrier
estimation in quantum mechanics can effectively promote the evolution of the optimization algorithm
to the global optimum. Extensive experiments on four benchmarks demonstrate the effectiveness
Citation: Jin, J.; Zhang, Q.; He, J.; Yu, of QDNAS, which is consistently better than all baseline methods in image classification tasks.
H. Quantum Dynamic Optimization Furthermore, an in-depth analysis is conducted on the searchable networks that provide inspiration
Algorithm for Neural Architecture for the design of other image classification networks.
Search on Image Classification.
Electronics 2022, 11, 3969. https:// Keywords: quantum dynamics; global optimization; neural architecture search; image classification
doi.org/10.3390/electronics11233969
Academic Editor: Dimitris Apostolou
Received: 4 November 2022 1. Introduction
Accepted: 23 November 2022
Deep learning (DL) methods have shown great potential for such applications as
Published: 30 November 2022
computer vision and natural language processing [1]. Image classification is one of the four
Publisher’s Note: MDPI stays neutral major tasks of computer vision. Given an input image, the image classification task aims to
with regard to jurisdictional claims in determine the category of the image [2].
published maps and institutional affil- To effectively deal with a classification task, multiple network architectures, i.e.,
iations. ResNet [3], DensNet [4], and SENet [5], have been proposed. These new architectures
have heuristic significance for designing neural networks, such as the residual module in
ResNet, which has now become the basic module in many network architectures.
However, designing DL algorithms requires designers to have rich experiences. It is a
Copyright: © 2022 by the authors.
challenging task to design neural network architectures due to the fact that little prior knowl-
Licensee MDPI, Basel, Switzerland.
This article is an open access article
edge on architecture design is available and the designed structures are problem-dependent.
distributed under the terms and
In that case, the ability to automatically generate the correct network architecture for any
conditions of the Creative Commons given task has become a new requirement [6,7]. One way to generate these architectures is
Attribution (CC BY) license (https:// to use evolutionary algorithms (EA) [8]. Traditional topological neuroevolution research is
creativecommons.org/licenses/by/ the exploration of early neural network architecture searches [9,10]. EA uses neural net-
4.0/). works to simplify search, weighting, structured search, and multi-objective search [11,12].
Electronics 2022, 11, 3969. https://doi.org/10.3390/electronics11233969 https://www.mdpi.com/journal/electronics
447
Electronics 2022, 11, 3969
Google Research showed that Regular Evolutionary Algorithms (REA) [13] work well in
neural network architecture.
Recent research on the neural network architecture search problem has brought a new
trend in evolutionary neural network architecture search. However, there are two main
challenges: (1) most well-designed new algorithms could not be used for neural network
architecture search [14–16]; and (2) each search algorithm is only experimented on for a
specific search space during the search process and is not verified on other, well-known
search spaces [17,18].
The quantum dynamics optimization algorithm (QDO) is an iterative optimization
algorithm [19] constructed by simulating the optimization process of the quantum dynamics
equation. In the quantum dynamics optimization algorithm, the evolutionary process of the
optimization algorithm over time is transformed into a quantum dynamics process. In the
quantum dynamics optimization algorithm, the modulus of the wave function represents
the distribution of the solution. Therefore, the evolution process is the evolution process of
the optimization algorithm solution. The modulus of the quantum wave function can be
obtained from the ensemble theory in physics, where the probability distribution represents
the probability distribution of the quantum particles in a given state. The tunneling effect,
potential barrier estimation, and other theories in quantum mechanics can effectively
facilitate the optimization process of the optimization algorithm.
Here we explore an application of quantum dynamic optimization algorithms for a
neural architecture search (NAS) problem. In the neural network architecture search prob-
lem, novelty search facilitates the discovery of excellent architectures [20]. The quantum
dynamics optimization algorithm can effectively jump out of the local optimum and find
the global optimum by using the tunnel effect. It is a well-designed intelligent optimization
algorithm. The potential barrier estimation in quantum mechanics can make reasonable
use of the information on non-optimal solutions in the process of algorithm optimization,
thereby increasing the diversity of solutions. In the neural network architecture search
problem, some non-optimal architectures may evolve into optimal architectures after itera-
tion. The properties of these two aspects of the quantum dynamics optimization algorithm
suggest that it may be a better solution to the neural network architecture search problem.
The proposed method is shown in Figure 1. Quantum dynamics optimization algo-
rithms are competitive optimizations proposed in [19]. Recent research primarily focuses
on improving quantum dynamics optimization algorithms [21]. By introducing different
mechanisms, the optimization performance of the algorithm is further improved by improv-
ing the performance of the algorithm. Unlike previous studies, the method in [19] does not
improve the performance of the algorithm for specific optimization tasks. Instead, it uses
the most basic quantum dynamic optimization algorithm (QDO) to explore its application
in neural network architecture research.
The NAS method relies on a search strategy to determine the next architecture to be
evaluated, and a performance evaluation strategy to evaluate its performance [8]. This arti-
cle will focus on search strategies. To evaluate the performance of the search algorithm more
comprehensively, we use table-based NAS benchmarks as the benchmark dataset [22–24].
The contributions of this work can be summarized as follows:
• In addition to conventional evolutionary algorithms, for the first time, this paper
applies a quantum heuristic optimization algorithm as a search algorithm for a neural
network architecture search problem. We transform the applicability of quantum
dynamics optimization algorithms from traditional optimization problems to neural
network architecture search problems. The designed algorithm does not depend on
specific data and is a general neural network architecture search algorithm.
• Reduce the problem search space by defining reasonable discretization encoding
methods, and quantum heuristic rules. The use of the quantum tunneling effect and
barrier estimation principle makes the proposed algorithm more competitive with
general evolutionary methods.
448
Electronics 2022, 11, 3969
• Conduct extensive experiments on NAS-Benchmark to demonstrate the effectiveness
of the proposed models.
Figure 1. Pipeline of the QDO-NAS.
We first describe the quantum dynamic optimization algorithm (QDO; Section 2), then
describe how to apply QDO to NAS (Section 3), and then Section 4 verifies the effectiveness
of the search algorithm proposed for table-based benchmarks, such as NAS-Bench-101 [22],
NAS-Bench-1Shot1 [23], NAS-Bench-201 [24], and NSATs-Bench [25].
2. Quantum Dynamic Optimization
The quantum dynamics optimization algorithm is an iterative optimization algo-
rithm [19], in which the evolution of the optimization algorithm is transformed over time
into a quantum dynamic process. The theories such as the tunneling effect and potential
barrier estimation in quantum mechanics can effectively promote the optimization process
of optimization algorithms.
According to the basic iterative operation of the optimization algorithm under the
quantum dynamics model, the basic iterative process can be obtained in Algorithm 1.
Algorithm 1: Pseudocode of QDO.
1 Randomly generate k copies of free particle in the domain [dmin ,dmax ],
σs =dmax -dmin
2 while (stop condition is not satisfied) do
3 Initialize Ac = 0
4 while (σ < σk ) do
5 for i=1 to k do
6 Generate x [i ] ∼ N x [i ], σ2
7 if ( f ( x [i ]) ≤ f ( x [i ])) then
8 x [i ] = x [i ], update the ith particle
9 else √
Δx Δf
10 x [i ] = x [i ], update the ith particle according to T ∝ e− σ
11 end
12 end
13 Ac = Ac + 1
14 Calculate the σk for k copies
15 end
16 xworse [i ] = xaver [i ]
17 σ=σ/2
18 end
19 Output: xbest [i ]
449
Electronics 2022, 11, 3969
All operations of this basic iterative process are obtained by using the theoretical
platform of the quantum dynamics of the optimization algorithm and the approximation
and estimation of the objective function. The specific steps of QDO are as follows.
1. Generate k sampled individuals in the domain [dmin ,dmax ].
2. The probability evolution of the location distribution of k sampled individuals can
be considered as the evolution of the particle wave function modulus. The larger the
value of k, the closer to the probability distribution of the wave function modulus.
The initial mean square error σ takes the length of the domain. When the initial mean
square error is large, the algorithm is not sensitive to the initial position of the sampled
individual.
3. Generate new solutions with a normal distribution x [i ] ∼ N x [i ], σ2 , if the new
solution f ( x [i ]) ≤ f ( x [i ]); that is, the new solution is better than the old solution,
then the new solution is directly accepted; if the new solution is worse than the old
solution, it can be considered from the physical image that the particle is blocked
by the potential barrier, and the difference solution is accepted according to the
probability that the barrier penetrates the transmission coefficient T.
4. This iterative process is repeated until the mean square error of the x [i ] positions of
the k sampled individuals is less than or equal to the mean square error of the current
normal sampling.
5. Replacing the worst position with the mean of the sampled individuals x [i ], xworse [i ] =
xaver [i ] reduces the mean square error of normal sampling and enters a smaller scale
to perform the same iterative process.
6. If the algorithm meets the set maximum function evolution times maxFE, the entire
iterative process ends, and the optimal solution xbest [i ] among the current k sampled
individuals x [i ] is output.
3. Proposed Method
3.1. NAS Problem Black Box Modeling
The principle of NAS is to give a set of candidate neural network structures called the
search space and use a certain strategy. During the search for the optimal network structure,
the pros and cons of the neural network structure are measured via the performance of some
indicators, such as accuracy and speed degree to measure, called performance evaluation.
In the NAS problem, the form of the fitness function is unknown; it belongs to the
black-box optimization problem [26]. It has the characteristics of nonlinearity and non-
convexity, and intelligent optimization algorithms have natural advantages for solving
such problems.
In the neural network architecture search problem, the search space represents and
defines the variables of the optimization problem; that is, it is the basic components of the
problem that need to be optimized, such as convolution size, stride, what kind of pooling,
and the number of layers of the network.
The search strategy specifies the algorithm used to search for the optimal architecture.
These algorithms include: random search [27], Bayesian optimization [28], evolutionary
algorithms [26], reinforcement learning [29], and gradient-based algorithms [30]. Among
them, Google’s reinforcement learning search method was an earlier exploration in 2017.
This paper made architecture search more popular [31], and later research institutions, such
as Uber, OpenAI, and Deepmind, began to apply evolutionary algorithms to this field. NAS
has become a key application of evolutionary computing, and many domestic companies
have also begun the same attempt.
Formally, NAS can be modeled as a black-box optimization problem, as shown in
Equation (1):
arg min A = L( A, Dtrain , Dfitness )
(1)
s.t. A ∈ A
450
Electronics 2022, 11, 3969
where A represents the search space of the potential neural architecture, and L(·) measures
the fitness evaluation D f itness on the dataset Dtrain . L(·) is usually non-convex and non-
differentiable. s.t. is the abbreviation of subject to (such that), which means to be bound.
In principle, NAS is a complex optimization problem with a series of challenges, such as
complex constraints, discrete representations, two-layer structures, a high computational
cost, and multiple conflicting criteria. A NAS algorithm refers to an optimization algo-
rithm specially designed to efficiently and efficiently solve the problem represented by
Equation (1). The following section will explore the application of the quantum dynamics
optimization algorithm (QDO) in neural network architecture search.
3.2. QDNAS
Recent NAS methods and benchmarks parameterize the unit structure of deep neural
networks into directed graphs. The realization of the unit structure can be seen as assigning
related operations from a set of choices or values, such as selecting the predecessor and
successor of a node in a directed graph or an operator that selects a node.
The selection of the candidate unit structure belongs to the discrete optimization
problem. It can be seen from the basic iterative process of QDO that the basic operation of
QDO is Gaussian sampling in continuous space.
We discretize it, that is, set a function as Equation (2). For example, the value obtained
by sampling [cov3,cov1,maxpool] is [0.8,0.3,0.4], then the discretized value is [1,0,0].
1, x 0.5
f (x) = (2)
0, else
The algorithm involves the problem of replacing the difference solution with the
mean value, which is explained here with the solution search matrix of NAS-Bench-
101. When NAS-Bench-101 searches, the adjacency matrix is used to encode the net-
work architecture; that is, the sampled particles are the adjacency matrix. Suppose the
⎡ ⎤ ⎡ ⎤
0.3 0.2 0.4 0.2 0.8 0.3
two sampled particles are x1 = ⎣ 0.1 0.6 0.3 ⎦ and x2 = ⎣ 0.9 0.1 0.4 ⎦ , then x aver =
0.3 0.7 0.2 0.6 0.2 0.1
⎡ ⎤
0.25 0.5 0.35
⎣ 0.5 0.35 0.35 ⎦. The final architectural adjacency matrix obtained by the function
0.45 0.45 0.5
⎡ ⎤
0 1 0
discrete( x ) is X= ⎣ 1 0 0 ⎦ QDNAS is shown in Algorithm 2. Figure 1 shows the
0 0 0
framework of the algorithm. To demonstrate the performance of the framework, several
state-of-the-art NAS methods are compared in the simulation experiments section.
The specific steps of QDONAS are:
1. Initialize the population, specifying the dataset D to use.
2. Randomly sample the architecture in the search space and assign it to a queue popi .
3. The particles are discretized according to Equation (2).
4. Generate new particle according to POPi = regularized( POPi + σN (0, 1)).
5. If f ( POPi ) < f ( POPi ), then POPi is assigned to POPi . Otherwise, the poor solution is
accepted with a certain probability. In this part, the probability is 0.1. This probability
is selected on the basis of many trials.
6. Replace the worst position with the mean of the sampled individuals popworst =
pop aver , and discretize the sampled individuals again.
7. Keep repeating lines 2 to 12 in QDNAS until the maximum number of iterations is
reached.
QDO is a sampling-based method, but the difference from random sampling is that
QDO can effectively use the information from the previous generation of individuals. QDO
introduces a Gaussian distribution in the sampling process. The probability of a Gaussian
451
Electronics 2022, 11, 3969
distribution in the range of σ is 65.26%, and the probability of falling into the range of
3σ is 99.74%. In other words, the particles will move to the vicinity of the better solution
with a small step length, which ensures the mining of the algorithm. At the same time, in
order to ensure the diversity of the population, the difference is accepted with a certain
probability to ensure the diversity of the population. At the end of the iteration of each
group, a certain perturbation mechanism is introduced through mean replacement to avoid
premature stagnation of the algorithm.
Algorithm 2: Pseudocode of QDNAS.
1 Input: f :NAS problem with evaluation,D:The reference dataset,k:Population size
2 Output: Best architecture.
3 while (stop condition is not satisfied) do
4 for i = 1 to k do
5 popi ← random_con f iguration()
6 POPi ← discretized_architecture()
7 f i ← evaluatea rchitecture( POPi )
8 Generate POPi for POPi to POPi = regularized( POPi + σN (0, 1))
9 if ( f ( POPi ) < f ( POPi )) then
10 POPi = POPi , update the ith particle
11 else
12 POPi = POPi , update the ith particle according to T
13 end
14 end
15 end
16 POPworst =POPaver
17 Output:POPbest
The pipeline of our method is shown in Figure 1. Initialization is performed first, the
initial population is uniformly sampled, and the initial population is discretized. That is,
discretization is performed with 0.5 as the threshold. Each individual obtains an initial
structure through decoding. We evaluate these structures and record the evaluation results
as the fitness value of the individual. We choose the better individual as the next generation
and accept the difference with a certain probability. We generate new individuals with a
Gaussian distribution around the current individual. We judge whether the termination
condition is met; if it is met, the loop ends; if it is not met, the loop will continue.
4. Experiments
We verified the performance of QDNAS in four recent NAS benchmark tests, NAS-
Bench-101, NATs-Bench, NAS-Bench-1shot1, and NAS-Bench-201. Different articles use
different hyperparameters/data enhancement/regularization/etc. when retraining the
searched network structure. Using NAS-Bench can make a fair comparison of each NAS
algorithm.
For the image classification task, this paper chooses the default dataset Cifar-10 of
NAS-Bench. The CIFAR-10 dataset has a total of 6 × 104 color images, and the size of these
images is 32 × 32, divided into 10 non-overlapping classes. During an architecture search,
the training dataset uses CIFAR-10, and the final search network is a network suitable for
image classification.
The benchmark test algorithm is Random Search (RS) [27], Tree-Structured Parzen
Estimator (TPE) [8], and Regularized Evolution Algorithm (REA) [32]. The experimental
parameters are set to NP = 40 and the transmission coefficient is 0.1. Among these algo-
rithms, REA is the preferred benchmarking algorithm, first because REA and QDO are both
heuristic algorithms and secondly, because REA has demonstrated excellent performance
in past work. For each algorithm, we conduct 500 independent experiments and record the
mean performance of the immediate validation regret.
452
Electronics 2022, 11, 3969
4.1. Nas-Bench-101
The NAS-Bench-101 dataset contains 423k samples, mapping the model structure to
the corresponding index (run time and accuracy) traverses the entire search space, making
it possible to perform complex analysis on the entire search space.
NAS-Bench-101: The dataset table contains the CNN structure and corresponding
training/evaluation indicators using Cell coding. The dataset is Cifar-10 (40k training/10k
verification/10k test). Each model
' was repeatedly trained
( and evaluated three times under
four types of Epochs Estop ∈ E3max Emax Emax
3 , 32 , 31 , Emax = {4, 12, 36, 108}. The indicators
used in NASBench101 are: training accuracy, validation accuracy, testing accuracy, number
of parameters, and training time.
Figures 2 and 3 show the performance of the search algorithm QDO. Figure 2 shows
the trajectory of test accuracy and verification accuracy in 10 tests. Red represents the
verification accuracy, and blue represents the test accuracy. It can be seen from the figure
that for Random search, the curve is more scattered, which means that the results of each
run are quite different, indicating that the randomness is strong. Regarding the regular
evolutionary algorithm, this problem has been improved to a certain extent, but it still has
a certain degree of randomness. The QDO algorithm verification accuracy rate is relatively
concentrated, indicating that the algorithm is robust. However, only two test accuracy rates
have large deviations. Furthermore, in the visualization of Figure 2, the comparison of the
three can be seen.
Figure 2. Search trajectories of Random search, REA, and QDO on NAS-Bench-101.
4.2. Nas-Bench-201
NAS-Bench-201 has trained more than 15,000 neural networks on three datasets
(CIFAR-10, CIFAR-100, and ImageNet-16-120) based on different random number seeds and
different hyperparameters many times. It provides the training and testing time after each
training epoch, the loss function and accuracy of the model in the training set/validation
set/test set, model parameters after training, model size, model calculation amount, and
other important information. With NAS-Bench-201, every NAS algorithm can be compared
fairly. Different articles use different hyperparameters/data enhancement/regulations/etc.
453
Electronics 2022, 11, 3969
when retraining the searched network structure. Using the NAS-Bench-201 API, each
researcher can fairly compare the searched network structure.
Figure 3. Comparison of the mean test accuracy along with error bars on NAS-Bench-101.
Figures 4 and 5 show the comparative performance of the algorithms. From the
comparative performance analysis of the four algorithms, it can be seen that in 10 test
experiments, the random search algorithm is more random, and the accuracy of each search
changes greatly.
Figure 4. Search trajectories of Random search, REA, and QDO on NAS-Bench-201.
454
Electronics 2022, 11, 3969
Figure 6 shows the instant validation regret after 500 independent runs. From the
results, we can see that for Cifar10, we conclude that even though TPE is better than other
algorithms at the beginning it is much slower when approaching the global optimum. The
test regrets of DE and RE are almost the same, while RS has shown excellent convergence
performance after recovering from the misleading early assessment, and its convergence
speed is faster than other algorithms.
Figure 5. Comparison of the mean test accuracy along with error bars on NAS-Bench-201.
Figure 6. A comparison of the mean test regret performance of 500 independent runs as a function of
estimated training time for NAS-Bench-201 on Cifar10
4.3. Nas-Bench-1shot1
NAS-Bench-1shot1 modifies the cell-level topology based on NAS-Bench-101 while
keeping the network-level topology unchanged. NAS-Bench-1shot1 makes the NAS ap-
proach more practical. It defines three search spaces that are convenient for the weight-
sharing algorithm to use: search space 1, search space 2, and search space 3. The number of
schemas available for searching are 6240, 29160, and 363648.
It can be seen from Figure 7 that RS has better performance in the initial search stage,
the reason may be that a better architecture is randomly searched, and when the iteration
time is around the point of 2500, REA and QDO are better due to the algorithm itself
having a better search mechanism, so it quickly locks in a better search area. When the
time is 2700, QDO shows an overwhelming advantage, and the accuracy of the searched
455
Electronics 2022, 11, 3969
architecture is higher. As the iteration progresses, the performance of several algorithms on
the NAS-Bench-1Shot1 test set gradually tends to be the same.
Figure 8 shows the immediate test regret after 500 independent runs. It can be seen
from the results that both RS and REA performed better in the initial stage, but the QDO
algorithm performed better in the later stage, and TPE performed better in the middle stage,
but there was premature stagnation. The performance of the QDO algorithm is average
in the early stage, but there is a rapid convergence in the later stage. The REA algorithm
outperforms other algorithms in the later architecture search.
Figure 7. A comparison of the mean test regret performance of 500 independent runs as a function of
estimated training time for NAS-Bench-1Shot1 on Cifar10
Figure 8. Search trajectories of Random search, REA, and QDO on NAS-Bench-1Shot1.
4.4. NATs-Bench
NATs-Bench is based on NAS-Bench201, which expands the NAS-Bench201 dataset
into three, namely CIFAR10, CIFAR100, and ImageNet-16-120. NATS Bench includes
15,625 candidate neurons in the three datasets. Among them, the topological search space
St is applicable to all NAS methods and the size of the search space Ss complements the
lack of architecture size analysis. The average convergence curves of the four algorithms
on the NATs-Bench test set are shown in Figure 9. From the visual analysis of the average
convergence curve, it is known that QDO and REA have better robustness.
456
Electronics 2022, 11, 3969
Figure 9. Comparison of the mean test accuracy along with error bars.
4.5. Results Discussion
We record the statistical results of the experimental data of the QDO algorithm, as
shown in the table, in which Table 1 records the experiments of the benchmark algorithm
for the NAS-Bench-101, NAS-Bench-201, and NAS-Bench-1Shot1 test sets results. The
bold words in the table indicate the top ranking. From the experimental results, on the
Cifar10 classification dataset; the optimal architecture searched by the QDO algorithm
on NAS-Bench-101 is 0.003 higher than the accuracy rate of RS and REA, while in NAS,
excellent results were also obtained on Bench-210 and NAS-Bench-1Shot1. REA is a baseline
algorithm proposed by the Google AI research team. It is proven that QDO is competitive
in architecture search problems.
Table 1. Statistical experimental results for NAS-Bench on the Cifar10 dataset.
NAS-101 NAS-201 NAS-1Shot1
RS 0.940 0.939 0.946
TPE 0.933 0.936 0.947
RE 0.940 0.940 0.947
Ours 0.943 0.942 0.947
In addition to the optimization performance, robustness is also an important factor.
Whether the algorithm is sensitive to randomness during training and searching is also a
measure of whether the NAS algorithm is good. Since REA and QDO performed better in
the previous experiments, this part of the experiment only compares the REA and QDO
algorithms. Figure 10 is the empirical cumulative distribution of the final test regret after
500 runs of REA and QDO. Based on the robust performance ratios of REA and DE on
different test sets in the figure, it can be seen that the robustness of the QDO algorithm on
NAS-Bench-101 is significantly better than that of the REA algorithm, while on the other
three datasets, the two algorithms’ robustness differs little.
457
Electronics 2022, 11, 3969
Figure 10. Empirical cumulative distribution of the final test regret after 500 runs of REA and QDNAS.
5. Conclusions
We proved that the quantum dynamics optimization algorithm can be used for a neural
network architecture search. The quantum dynamics optimization algorithm is a sampling-
based algorithm. Due to the quantum tunneling effect, it has advantages in dealing with
mixed data types and high-dimensional optimization problems. Therefore, QDO may be a
good candidate for NAS, which may help discover novel but unknown architectures. Since
the quantum dynamics optimization algorithm has a natural parallelism, we will explore
the parallel implementation of the algorithm in the architecture search in the future.
First, we performed classification recognition on the CIFAR-10 image classification
dataset. It should be noted here that by adjusting the core size and number of channels of
the convolutional and pooling layers, the algorithm can be easily applied to other fields.
Author Contributions: Conceptualization, Q.Z. and H.Y.; methodology, J.J.; formal analysis, J.H.
All authors have read and agreed to the published version of the manuscript.
Funding: Project of Sichuan Science and Technology Department (2021Z005).
Data Availability Statement: Not applicable.
Acknowledgments: Thanks to Sichuan Intelligent Tolerance Design and Testing Engineering Re-
search Center.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. LeCun, Y.; Bengio, Y.; Hinton, G. Deep learning. Nature 2015, 521, 436–444. [CrossRef] [PubMed]
2. Yin, D.; Gontijo Lopes, R.; Shlens, J.; Cubuk, E.D.; Gilmer, J. A fourier perspective on model robustness in computer vision. Adv.
Neural Inf. Process. Syst. 2019, 32, 13276–13286.
3. He, K.; Zhang, X.; Ren, S.; Sun, J. Deep residual learning for image recognition. In Proceedings of the IEEE Conference on
Computer Vision and Pattern Recognition, Las Vegas, NV, USA, 27–30 June 2016; pp. 770–778.
4. Huang, G.; Liu, Z.; Van Der Maaten, L.; Weinberger, K.Q. Densely connected convolutional networks. In Proceedings of the IEEE
Conference on Computer Vision and Pattern Recognition, Honolulu, HI, USA, 21–26 July 2017; pp. 4700–4708.
5. Hu, J.; Shen, L.; Sun, G. Squeeze-and-excitation networks. In Proceedings of the IEEE Conference on Computer Vision and
Pattern Recognition, Salt Lake City, UT, USA, 18–23 June 2018; pp. 7132–7141.
6. Guo, Y.; Luo, Y.; He, Z.; Huang, J.; Chen, J. Hierarchical neural architecture search for single image super-resolution. IEEE Signal
Process. Lett. 2020, 27, 1255–1259. [CrossRef]
458
Electronics 2022, 11, 3969
7. Wang, Y.; Liu, Y.; Dai, W.; Li, C.; Zou, J.; Xiong, H. Learning Latent Architectural Distribution in Differentiable Neural Architecture
Search via Variational Information Maximization. In Proceedings of the IEEE/CVF International Conference on Computer Vision,
Montreal, QC, Canada, 10–17 October 2021; pp. 12312–12321.
8. Elsken, T.; Metzen, J.H.; Hutter, F. Neural architecture search: A survey. J. Mach. Learn. Res. 2019, 20, 1997–2017.
9. Sun, Y.; Xue, B.; Zhang, M.; Yen, G.G. Evolving deep convolutional neural networks for image classification. IEEE Trans. Evol.
Comput. 2019, 24, 394–407. [CrossRef]
10. Stanley, K.O.; Miikkulainen, R. Evolving neural networks through augmenting topologies. Evol. Comput. 2002, 10, 99–127.
[CrossRef] [PubMed]
11. Sun, J.D.; Yao, C.; Liu, J.; Liu, W.; Yu, Z.K. GNAS-U 2 Net: A New Optic Cup and Optic Disc Segmentation Architecture With
Genetic Neural Architecture Search. IEEE Signal Process. Lett. 2022, 29, 697–701. [CrossRef]
12. Gong, M.; Liu, J.; Qin, A.K.; Zhao, K.; Tan, K.C. Evolving deep neural networks via cooperative coevolution with backpropagation.
IEEE Trans. Neural Netw. Learn. Syst. 2020, 32, 420–434. [CrossRef]
13. Real, E.; Moore, S.; Selle, A.; Saxena, S.; Suematsu, Y.L.; Tan, J.; Le, Q.V.; Kurakin, A. Large-scale evolution of image classifiers.
In Proceedings of the International Conference on Machine Learning. PMLR, Sydney, NSW, Australia, 6–11 August 2017;
pp. 2902–2911.
14. Niu, R.; Li, H.; Zhang, Y.; Kang, Y. Neural Architecture Search Based on Particle Swarm Optimization. In Proceedings of the
2019 3rd International Conference on Data Science and Business Analytics (ICDSBA), Istanbul, Turkey, 11–12 October 2019;
pp. 319–324.
15. Xie, L.; Yuille, A. Genetic cnn. In Proceedings of the IEEE International Conference on Computer Vision, Venice, Italy, 22–29
October 2017; pp. 1379–1388.
16. Junior, F.E.F.; Yen, G.G. Particle swarm optimization of deep neural networks architectures for image classification. Swarm Evol.
Comput. 2019, 49, 62–74. [CrossRef]
17. Sun, Y.; Xue, B.; Zhang, M.; Yen, G.G.; Lv, J. Automatically designing CNN architectures using the genetic algorithm for image
classification. IEEE Trans. Cybern. 2020, 50, 3840–3854. [CrossRef] [PubMed]
18. Xue, Y.; Wang, Y.; Liang, J.; Slowik, A. A self-adaptive mutation neural architecture search algorithm based on blocks. IEEE
Comput. Intell. Mag. 2021, 16, 67–78. [CrossRef]
19. Wang, P.; Xin, G.; Jiao, Y. Quantum Dynamics Interpretation of Black-box Optimization. arXiv2021, arXiv:2106.13927.
20. Zhang, M.; Li, H.; Pan, S.; Liu, T.; Su, S.W. One-Shot Neural Architecture Search via Novelty Driven Sampling. In Proceedings of
the IJCAI, Yokohama, Japan, 11–17 July 2020; pp. 3188–3194.
21. Jin, J.; Wang, P. Multiscale Quantum Harmonic Oscillator Algorithm with Guiding Information for Single Objective Optimization.
Swarm Evol. Comput. 2021, 65, 100916. [CrossRef]
22. Ying, C.; Klein, A.; Christiansen, E.; Real, E.; Murphy, K.; Hutter, F. Nas-bench-101: Towards reproducible neural architecture
search. In Proceedings of the International Conference on Machine Learning. PMLR, Long Beach, CA, USA, 9–15 June 2019;
pp. 7105–7114.
23. Zela, A.; Siems, J.; Hutter, F. Nas-bench-1shot1: Benchmarking and dissecting one-shot neural architecture search. arXiv 2020,
arXiv:2001.10422.
24. Dong, X.; Yang, Y. Nas-bench-201: Extending the scope of reproducible neural architecture search. arXiv 2020, arXiv:2001.00326.
25. Dong, X.; Liu, L.; Musial, K.; Gabrys, B. Nats-bench: Benchmarking nas algorithms for architecture topology and size. IEEE Trans.
Pattern Anal. Mach. Intell. 2021, 44, 3634–3646. [CrossRef] [PubMed]
26. Liu, Y.; Sun, Y.; Xue, B.; Zhang, M.; Yen, G.G.; Tan, K.C. A survey on evolutionary neural architecture search. IEEE Trans. Neural
Netw. Learn. Syst. 2021. 1–21. [CrossRef] [PubMed]
27. Li, L.; Talwalkar, A. Random search and reproducibility for neural architecture search. In Proceedings of the Uncertainty in
Artificial Intelligence. PMLR, virtual online, 3–6 August 2020; pp. 367–377.
28. Kandasamy, K.; Neiswanger, W.; Schneider, J.; Poczos, B.; Xing, E.P. Neural architecture search with bayesian optimisation and
optimal transport. In Proceedings of the 32nd International Conference on Neural Information Processing Systems, Montréal,
Canada, 3–8 December 2018; pp. 2020–2029
29. Chen, Y.; Meng, G.; Zhang, Q.; Xiang, S.; Huang, C.; Mu, L.; Wang, X. Renas: Reinforced evolutionary neural architecture search.
In Proceedings of the IEEE/CVF Conference on Computer Vision and Pattern Recognition, Long Beach, CA, USA, 15–20 June
2019; pp. 4787–4796.
30. Santra, S.; Hsieh, J.W.; Lin, C.F. Gradient descent effects on differential neural architecture search: A survey. IEEE Access 2021,
9, 89602–89618. [CrossRef]
31. Zoph, B.; Le, Q.V. Neural architecture search with reinforcement learning. arXiv 2016, arXiv:1611.01578.
32. Real, E.; Aggarwal, A.; Huang, Y.; Le, Q.V. Regularized evolution for image classifier architecture search. In Proceedings of the
AAAI Conference on Artificial Intelligence, Honolulu, HI, USA, 27 January–1 February 2019; Volume 33, pp. 4780–4789.
459
electronics
Article
A Lightweight Border Patrol Object Detection Network for
Edge Devices
Lei Yue, Haifeng Ling *, Jianhu Yuan and Linyuan Bai
Field Engineering College, Army Engineering University of PLA, Nanjing 210022, China
* Correspondence: [email protected]; Tel.: +86-181-8498-2962
Abstract: Border patrol object detection is an important basis for obtaining information about the
border patrol area and for analyzing and determining the mission situation. Border Patrol Staffing is
now equipped with medium to close range UAVs and portable reconnaissance equipment to carry
out its tasks. In this paper, we designed a detection algorithm TP-ODA for the border patrol object
detection task in order to improve the UAV and portable reconnaissance equipment for the task
of border patrol object detection, which is mostly performed in embedded devices with limited
computing power and the detection frame imbalance problem is improved; finally, the PDOEM
structure is designed in the neck network to optimize the feature fusion module of the algorithm.
In order to verify the improvement effect of the algorithm in this paper, the Border Patrol object
dataset BDP is constructed. The experiments show that, compared to the baseline model, the TP-ODA
algorithm improves mAP by 2.9%, reduces GFLOPs by 65.19%, reduces model volume by 63.83%
and improves FPS by 8.47%. The model comparison experiments were then combined with the
requirements of the border patrol tasks, and it was concluded that the TP-ODA model is more
suitable for UAV and portable reconnaissance equipment to carry and can better fulfill the task of
border patrol object detection.
Keywords: object detection; deep learning; computer vision; border patrol
Citation: Yue, L.; Ling, H.; Yuan, J.;
Bai, L. A Lightweight Border Patrol
Object Detection Network for Edge
Devices. Electronics 2022, 11, 3828.
1. Introduction
https://doi.org/10.3390/ In recent years, illegal acts such as drug trafficking, smuggling, border crossing
electronics11223828 and smuggling have been prohibited in border areas, and the workload of border patrol
tasks has only increased. Considering the problem of limited patrol force, the relevant
Academic Editor: Taiyong Li
management departments have equipped border patrol staffing with drones or handheld
Received: 22 October 2022 portable reconnaissance equipment [1], which has greatly improved the management
Accepted: 15 November 2022 capability of the border, while reducing the risk of border patrol and solving many of the
Published: 21 November 2022 existing problems of traditional border patrol [2]. However, the use of UAV (Unmanned
Publisher’s Note: MDPI stays neutral
Aerial Vehicle) platforms and portable reconnaissance equipment for border patrol missions
with regard to jurisdictional claims in has also raised some issues that need to be further addressed, the most important of which
published maps and institutional affil- is the ability of the patrol reconnaissance equipment to detect border patrol objects. Most
iations. of the existing UAV and reconnaissance equipment are equipped with high-definition
optical cameras, which can acquire objects at different distances, but at the same time will
generate a large amount of image video data. However, the computing power of edge
devices is generally insufficient, so it is important to develop a border patrol detection
Copyright: © 2022 by the authors. model that can be easily deployed on edge devices such as UAV platforms and handheld
Licensee MDPI, Basel, Switzerland. portable reconnaissance terminals. The traditional method of border patrol reconnaissance
This article is an open access article is mainly through close reconnaissance, or the use of long-range photographic equipment
distributed under the terms and to capture images and video data of suspicious areas, and then use the communication
conditions of the Creative Commons
transmission equipment carried to transmit the data to the rear for analysis and judgment.
Attribution (CC BY) license (https://
However, subject to technical problems, the detection field of view is limited, inefficient
creativecommons.org/licenses/by/
and ineffective, which is a very prominent problem. With the continuous development
4.0/).
Electronics 2022, 11, 3828. https://doi.org/10.3390/electronics11223828 https://www.mdpi.com/journal/electronics
461
Electronics 2022, 11, 3828
of computer technology, faster, more accurate, more efficient object detection technology
has emerged.
In recent years, deep learning has been greatly developed. Whether deep learning
can be used in the field of object detection is also being studied by scholars. An important
turning point in the field of object detection occurred when AlexNet [3] was proposed.
As a result, the scope of object detection application research has been expanded. Thus
far, deep learning has been widely used in various fields of computer vision, which has
important research significance and application value in national security, military [4],
transportation [5], medical [6] and life.
After the emergence of Alex Net, Ross B Girshick et al. [7] proposed R-CNN in 2014,
and then the R-CNN algorithm underwent the evolution of Fast R-CNN and Faster R-
CNN. Compared to the traditional detection algorithm, the performance has been greatly
improved. Since then, more and more detection algorithms based on convolutional neural
networks have been proposed, such as MSCNN [8], M2Det [9], EfficientNet [10], etc., and
the accuracy and detection speed are constantly improving.
According to different network design paradigms, we classify existing object detection
algorithms into one-stage detection algorithms and two-stage detection algorithms. The
above detection algorithm is a two-stage detection algorithm, which has a high detection
accuracy, but a slow detection speed, and is not applicable to the problem of border patrol
object detection proposed in this paper. In order to solve this problem, this paper uses the
representative one-stage detection algorithm YOLOv5 [11] as the baseline model, which
is the representative one-stage detection algorithm of the YOLO series. Compared to the
YOLOv1-4 [12–15] detection algorithm and the two-stage detection algorithm, the most
prominent features of the YOLOv5 detection algorithm are its fast detection speed and high
detection accuracy, which can meet the requirements of real-time.
In this study, a border patrol object detection algorithm, TP-ODA, was designed
for the carriage of UAV platforms or portable border patrol reconnaissance equipment.
As the most widely used detection algorithm of the current YOLO series, the YOLOv5
detection algorithm has made a good balance between detection accuracy and detection
speed, but there are still many redundant parameters in its network, which need to be
further improved. We therefore propose a lightweight and less resource intensive border
patrol object detection algorithm. First, the Ghost structure is improved based on the
lightweight attention module and is combined with the benchmark network to rebuild
the feature extraction network. Then, the bounding box loss function of the benchmark
algorithm was modified to solve the problem of sample detection box imbalance. Finally,
a depth-separable convolution was introduced, and the neck network was reconstructed,
while the feature fusion module PDOEM (Patrol Duty Object Detection Efficient Modules)
was designed to optimize the feature fusion structure of the algorithm. The experiments
were conducted on our self-built border patrol task dataset BDP (Border Defense Patrol),
which was prepared for this study. The results show that the TP-ODA (Typical Border
Patrol-Object Detection Algorithm) network reduces many parameters and reduces the
size, which is very suitable for border patrol object detection tasks. Compared to previous
studies, the main contributions of this paper are as follows.
1. In order to improve the feature extraction capability of the network for different
dimensions and improve the performance degradation of the model after compression,
we proposed a lightweight feature extraction structure BP-Sim, which takes into account
the functions of the original feature extraction structure and reduces the occupation of
computing resources. Aiming at the unbalance problem of the sample detection frame
of the benchmark model, the EIOU loss function is introduced to further improve the
detection accuracy of the model.
2. In order to further compress the volume of the model and reduce the resource
occupation, we designed the feature fusion module PDOEM to improve the fusion ability of
the model to the deep feature information. Combined with the depth-separable convolution,
the neck feature fusion network of the model was reconstructed.
462
Electronics 2022, 11, 3828
3. To address the problem of the confidentiality of the information involved in the
border patrol domain and the existing public datasets that cannot be well used for border
patrol detection tasks, the border patrol task dataset BDP is constructed to train and evaluate
the performance of the object detection model.
The rest of this paper is structured as follows. Section 2 describes some of the most
important related works. Section 3 describes the proposed the object detection network.
Section 4 describes the experimental preparation. The experimental results and analysis
are described in Section 5. Finally, a summary and outlook are given in Section 6.
2. Related Work
At present, series detection algorithms are widely used, and many scholars have
undertaken a lot of research work in common detection fields. In medicine, the detection
algorithm is used to detect breast tumors [16] and to fight against COVID-19 [17,18]. In
the field of agriculture, it is used to detect plant diseases [19] and pests and for crop
production [20]. In industrial applications, it is used to detect defects on the surface of steel
strips [21]. In the transportation field, it is used to solve road congestion [22] and road
failure problems [23].
Many scholars have also done a lot of research in the field of military object detec-
tion [24,25]. As our border patrol object detection task is not only a military object detection
task, with the complexity of security maintenance, border patrol, reconnaissance and duty
operation tasks, the border patrol object detection algorithm is required to have a cer-
tain generalization detection performance, but also the ability to detect military objects.
Guangdi Zheng et al. [26] used the YOLOv3 algorithm for the detection of low-resolution
infrared objects present on the terrestrial battlefield and trained the model with the aid of
visible samples. Hui Peng et al. [4] used the YOLO detection algorithm to detect five com-
mon military weapons in order to obtain a fuller sense of the battlefield situation. Xingkui
Zhu et al. [27] proposed TPH-YOLOv5 based on the YOLOv5x network, combining the
transformer and CBAM, and used a larger network to detect small objects in UAV aerial
photography. M. Krišto et al. [28] used the YOLOv3 detection model to detect abnormal
behaviors in border areas and found the case of sneaking around objects and illegal border
crossings in a timely manner.
From the above study, it can be concluded that the YOLO series detection algorithm
generalizes well and the detectability can basically meet the needs of various fields. How-
ever, based on our research, we believe that the existing detection algorithms for detecting
border patrol objects still need to address two aspects:
1. Most studies have improved the detection accuracy of military-type objects in
complex environments and UAV aerial images, but the model resource consumption has
increased accordingly, which poses a serious limitation for embedded devices with limited
computing power.
2. Border patrol object detection differs from traditional image detection in that the
data obtained during border patrol has obvious peculiarities because of the various forms
of data collection. The first is that the border patrol objects have strong regional restrictions
and can only be collected in special areas, and the second is that most of the border patrol
objects are in the state of obscuration and camouflage, so the quality of the collected images
is not high, so for the object detection model, objects with a camouflage nature and tiny
objects in aerial images are difficult to detect.
In order to apply large neural network models to UAV platforms and portable recon-
naissance equipment, we have conducted an in-depth study of network model parameter
reduction. Lightweight detection networks have gained more attention because they can
reduce the resource footprint of the model and speed up detection by reducing a small
amount of detection accuracy. The core idea of the detection algorithm compression is to
reduce the computational complexity and spatial complexity of the model by modifying
the way the network is constructed while ensuring the model accuracy as much as possible,
so that the neural network detection algorithm can be deployed in UAVs with limited com-
463
Electronics 2022, 11, 3828
putational performance, embedded edge devices such as portable reconnaissance devices,
thus establishing a link from academic research to practical applications.
Currently, there are two main types of model volume optimizations. One type is
compression of the model, using methods such as knowledge distillation and model
de-branching to reduce the number of parameters and unnecessary computational con-
sumption of the model, which has a limited scope for model compression and a large impact
on accuracy. We therefore chose another type of light-weighting method for optimization.
This class of optimization method mainly introduces the idea of lightweight networks
in the structure of benchmark models, such as SqueezeNet [29], MobileNet series [30,31],
ShuffleNet series [32,33], Xception [34], etc. By using different convolution methods and
structures, the models are made lighter. Currently, it is common to use lightweight net-
works to optimize benchmark models for object detection tasks in common scenarios. A
common approach is to use lightweight backbone networks in large detection models,
such as Youchen Fan et al. [35] used YOLOv3 and improved with GhostNet to have good
detection results when detecting infrared images of vehicles. Minghua Zhang et al. [36] pro-
posed light-weighting using MobileNetV2 and depth-separable convolution for detecting
underwater objects; J. Feng et al. [37] used MobileNet as the backbone network to modify
the original model for detecting rail defects. Tianhao Wu et al. [38] adapted the network
structure of YOLOv5 and designed the YOLOv5-Ghost algorithm for use on a CARLA
vehicle and a distance detection system in a virtual environment. The aforementioned
study significantly reduced the model resource consumption, but the detection accuracy
was not high.
While research work on lightweight networks has great application, there has been
little research in the area of border patrol object detection. In response to the current
situation, we have designed a border patrol object detection model that is less resource
intensive and more efficient in detection.
3. Method
The basic framework of the YOLOv5 detection model mainly includes Input, Backbone,
Neck, Prediction and four other parts. Input part: Mainly adjust the image to 640 × 640
ratio, and zoom, enhance and other processing. The Backbone module uses the Darknet-
53 network to facilitate the training of the model and the extraction of multiple scale
features. The Neck module draws on the function of fusing multi-scale feature information
completed by FPN [39] and PANet [40]. This part can fuse the feature information of
different depths so as to reduce the loss of semantic information due to feature extraction,
so that the model training can obtain more training information, which is conducive to the
improvement in algorithm performance. The Prediction part is composed of three detection
heads, which are used to predict the feature map and to obtain the position and category of
the detected object in the image.
3.1. The Improved Network Structure
In order to make the model less resource intensive, we compared various lightweight
networks and finally chose GhostNet to optimize the backbone network. In order to im-
prove the feature representation of the detected object, we embed the lightweight attention
mechanism module SimAM into the GhostNet network and design the BP-Sim (Border
Patrol-SimAM module) structure to optimize the feature extraction network, which further
reduces the parameters of the model while improving the accuracy. In addition, in order to
improve the feature fusion performance of the model, the PDOEM feature fusion module is
designed and combined with depth separable convolution to reconstruct the feature fusion
structure, and finally, the EIOU loss function is introduced to optimize the design for the
problem that the loss function in the original benchmark model has the problem of sample
detection box imbalance leading to the decrease in detection accuracy and the slowdown of
the model convergence.
464
Electronics 2022, 11, 3828
In Figure 1, the images are input into the backbone network, and feature extraction
and slicing are first performed using ordinary convolution, and then the processed images
are input into GhostConv and BP-Sim structures, and the feature images after the above
operations are divided into multiple levels and passed to the Neck for concat operation. In
the Neck structure, the feature information is extracted using depth-separable convolution,
then the feature map is resized after upsampling and connected with the feature information
of the backbone part, and finally the feature map obtained from the concat operation is
input to the PDOEM module for information mining.
Backbone Neck Head
SPPF DwConv PDOEM Detect
Up
BP-Sim Sample Concat
Ghost Concat
Conv DwConv
BP-Sim PDOEM PDOEM Detect
Ghost Concat
Conv DwConv
BP-Sim Up
Sample DwConv
Ghost Concat PDOEM Detect
Conv
BP-Sim CBS CONV BN SILU
SPPF CBS MaxPool MaxPool MaxPool
Ghost
Conv
Concat CBS
CBS
Input
Figure 1. TP-ODA border patrol object detection network architecture.
3.2. Lightweight Network Design Module
Border patrol missions using UAVs or portable reconnaissance devices require not only
the accurate detection of suspicious objects in the border area, but also requires minimizing
the resource consumption of the network to meet the edge device load requirements. Next,
we optimize the design of the backbone part of the benchmark network.
The common convolution operation is to apply the convolution kernel to the local
image, slide the high latitude and low latitude in the local image, then form the correspon-
dence in space and complete the convolution, and obtain the convolution kernel after many
repetitions. The above operation enables the model to achieve better accuracy through
multiple training, but it also requires many convolution operations, which has an enormous
consumption of computational resources. Due to this problem, some lightweight networks
remove some redundant features by removing some of the redundant feature information
while reducing the model performance to achieve the effect of streamlining the model.
However, some scholars’ research proves that the redundant feature information also exists
in the redundant features contributing to the model’s comprehensive understanding of
image data, which becomes an important part of the model performance improvement.
As shown in Figure 2, it is with this in mind that, instead of trying to eliminate redun-
dant feature maps, GhostNet uses cheaper computation to obtain redundant feature maps.
465
Electronics 2022, 11, 3828
According to our previous research on the lightweight network, it is concluded that Ghost-
Net [41,42] is more prominent in terms of comprehensive performance. Therefore, we will
carry out further optimization of the detection model’s resource footprint in conjunction
with GhostNet.
identity
ߔͳ
CONV
ߔʹ
•••
Input Output
ߔ݇
Figure 2. Ghost module structure description.
The backbone of the benchmark network uses many traditional convolutional neural
networks, which are mainly used to extract image features. These networks contain a large
number of parameters that occupy a large amount of computational resources and memory.
Therefore, influenced by GhostNet idea, we use the Ghost convolutional network to replace
part of traditional convolutional networks in the backbone network.
3.3. Feature Information Extraction Module
In the actual border patrol environment, which contains multiple types of environ-
ments such as desert, snow, jungle, and grass, the use of UAV platforms or other reconnais-
sance equipment for detection can lead to low image quality, blurred object backgrounds,
and loss of feature information due to the harsh natural environment. The presence of these
factors greatly increases the detection difficulty of the network. Studies in recent years
have concluded that the use of attention mechanism modules can enhance the network’s
ability to extract image feature information. Therefore, to improve the model’s ability to
extract effective feature information and not to increase the model’s excessive number of
parameters and computational effort, we designed the BP-Sim and PDOEM modules in
the network.
The improvement steps for the backbone network are: Considering that the backbone
network is not sufficient for processing image information with different dimensions of
feature semantic information, especially in the case of border patrol image data, which are
mostly blurred images, top view captured images and diverse scales. We first optimized
the feature extraction structure. Considering that the direct use of the lightweight network
in the optimization process of the benchmark network would lead to a reduction in the
detection accuracy of the model, and that the original bottleneck connection network con-
tained a large number of parameters, we redesigned the bottleneck structure of the model
by modifying the bottleneck network on the basis of the original C3 structure, removing
part of the regular convolutional network from this structure and the BP-Sim network
is obtained by replacing the regular convolutional module with a lighter convolutional
module and embedding the SimAM [43,44] attention mechanism. The network exploits the
sensitivity of the attention mechanism with useful information to improve the network’s
ability to mine feature information. The BP-Sim bottleneck structure feature extraction
structure is shown in Figure 3.
466
Electronics 2022, 11, 3828
Concat
PDOEM
Output
Input CBS
CBS SimAMM
CBS
Figure 3. BP-Sim bottleneck structure feature extraction structure.
In Figure 3, the feature image first goes through traditional convolution to obtain
one input edge of concat operation; in the other input, the feature map is extracted using
traditional convolution, and while going through PDOEM for dimensionality reduction
and enhancement, difficult feature information mining is performed with the help of the
attention mechanism in this module, and the obtained feature information is connected
with another edge of the feature extraction; finally, the connected feature map is extracted
and information is mined again.
The existing attention module is commonly used to improve the output results of
each layer. This kind of operation usually generates one-dimensional or two-dimensional
weights along the channel or spatial dimension and treats the positions in the space or
channel equally, which will lead to the limitation of the model’s cue discrimination ability.
In order to realize the effect brought by the attention mechanism to the model, SimAM
referred to the idea of spatial inhibition in neuroscience and gave higher priority to the
neurons with obvious spatial inhibition effects.
2 M −1
2
et (wt , bt , y, xi ) = yt − t̂ + 1
M −1 ∑ (y0 − x̂i ) (1)
i −1
where t and xi denote the object neuron and the input feature X ∈ RC× H ×W other neurons
in the same channel t̂ = wt t + bt , respectively, x̂i = wt xi + bi is t and xi linear transformation.
wt and bt are linearly varying weights and biases, i is the spatial dimension index, M is the
number of channel neurons, and y0 and yt are two different values. For the convenience of
use and operation, the binary label is used for the above, and a regularization term is added
to the energy function formula to obtain the final energy function formula. According to
the principle that each channel has M energy functions, the analytical solution Formula (4)
is obtained:
M −1
2 2
et (wt , bt , y, xi ) = 1
M −1 ∑ (−1 − (wt xi + bt )) + (1 − (wt t + bt )) + λwt 2 (2)
i =1
2( t − u t )
wt = (3)
(t − ut )2 + 2σt2 + 2λ
1
bt = − ( t + μ t ) w t (4)
2
−1 M −1
Including the μt = M1−1 ∑iM =1 xi and σt = M−1 ∑i
2 1
( xi − μt )2 is the mean and
variance of all neurons except t. The minimum energy Equation (5) is obtained:
467
Electronics 2022, 11, 3828
4 σ̂2 + λ
et∗ = (5)
(t − μ̂)2 + 2σ̂2 + 2λ
According to Equation (5), the lower the energy, the more different the neuron is
from the surrounding neurons. Therefore, the importance of each neuron can be obtained
by 1/(et∗ ). SimAM uses the operation of scaling instead of adding the feature refinement,
and the refinement process of the whole module is shown in Equation (6).
! "
X = sigmoid 1 (6)
E
3.4. Improvement of Feature Fusion Module
As the baseline network uses more common convolutional modules, and the tradi-
tional convolutional modules are large in size and have a large number of parameters.
Therefore, we modified the backbone part of the baseline model and replaced the general
convolutional module in the backbone with the GhostConv module, which reduces the
number of parameters of the model with little reduction in accuracy. Inspired by this idea,
we also replaced the basic convolutional module in the neck network with GhostConv, but
the training results were not very good. In response to the experimental results, we consid-
ered that the model also needs to capture useful feature information and suppress noise
information when performing feature fusion, so we kept part of the general convolution in
the Neck network and replaced the original convolution module with the depth separable
convolution, and connected SimAM after the DBS convolution module, and finally built
the PDOEM feature fusion module, as shown in Figure 4 We use the PDOEM module to
replace some of the normal convolutional modules in the Neck part in order to improve
the situation of the inadequate extraction of high-level feature information and waste of
computational resources when the network is fused with features, and because the addition
of the attention module does not use too many computational resources, it is important for
the model compression design and overall performance improvement.
Input
DBS
YES
Stride=2
Concat
Output
NO
GhostConv PDOEM
Conv Conv
PDOEM
Conv
DBS
Concat
CBS SimAMM
GhostConv
Figure 4. Structure design of the PDOEM feature information extraction module.
468
Electronics 2022, 11, 3828
3.5. Loss Function Improvement
The loss function in the YOLO family of models is mainly composed of three parts:
Bounding Box loss function, object confidence loss function and class loss function. In the
YOLOv5 model, CIOU open is used to calculate the loss of the bounding box by default.
CIOU is based on DIOU [45] with the addition of the influence factor αv. Where α denotes
the weight parameter and v is used to measure the consistency of the aspect ratio, taking
the αv influence factor into account can further consider the relationship between the
prediction frame and the real frame, improve the regression accuracy when the real frame
and the prediction frame IOU are larger or even included, and enhance the suppression of
the model loss function. The effect improves the suppression of the model loss function,
and finally improves the model convergence accuracy.
ρ2 b, b gt
LCIOU = 1 − IOU + + αv (7)
c2
v
α= (8)
1 − IOU + v
! "2
4 w gt w
v= arctan gt − arctan (9)
π h h
However, as reflected by v in Equations (8) and (9), the aspect ratio difference of the
CIOU loss function cannot reflect the real aspect difference and confidence value, which
hinders the similarity optimization of the model and reduces the convergence speed of the
model. Therefore, in the study by Zhang et al., based on the CIOU loss function, the aspect
ratio of the model was decomposed and the EIOU [46] loss was refined. The EIOU loss
function is defined, as shown in Equation (10):
ρ2 b, b gt ρ2 w, w gt ρ2 h, h gt
L EIOU = L IOU + Ldis + L asp = 1 − IOU + + + (10)
c2 Cw2 Ch2
L Focal − EIOU = IOUγL EIOU (11)
This loss function consists of three parts: Overlap loss, center distance loss, width and
height loss. Where Cw and Ch represent the width and height of the minimum bounding
box. The EIOU loss function retains the advantages of CIOU loss function, and at the
same time, considering the situation that the gradient is too large to affect the training
accuracy caused by the imbalance problem of the Bounding box samples, the idea of
Focal loss is introduced on the basis of the EIOU loss function, and the Focal EIOU loss
function is proposed after the combination. The definition is shown in Equation (11). The
IOU = | A ∩ B|/| A ∪ B| and γ in the formula represent the coefficients that control the
degree of outlier suppression. Focal EIOU loss function separates the low quality and
high-quality anchor boxes from classifying the training samples.
4. Experiment Preparation
In this section, the border patrol dataset BDP used in the experiments, the experimental
environment configuration, and the model performance evaluation metrics are introduced.
4.1. Introduction to the Dataset
Due to the confidentiality of the information involved in the field, the image infor-
mation related to border patrol is relatively scarce, so this paper creates the BDP dataset
by offline collection, online collection of public video information, and network images.
The BDP dataset has a total of more than 2600 samples, containing a total number of
11,000 labeled boxes, involving different tasks, different natural scenes of pedestrians, sol-
diers on duty, vehicles, camouflage vehicles, trucks and other common objects at the border.
Some of the sample images of the dataset are shown in Figure 5. Due to the various methods
469
Electronics 2022, 11, 3828
of data collection, involving aerial photography, overhead cameras and some portable
photographic devices, the dataset has various scales and complex image backgrounds, and
some of the model objects are obscured, blurred, and individual features are difficult to
be extracted completely. We normalized the dataset and then used the image annotation
software LabelImg for annotation. The dataset is divided into the training set, test set and
validation set in the ratio of 8:1: 1 for training and performance testing of the model.
Figure 5. Sample images from the BDP dataset.
4.2. Introduction to Experimental Environment
The experimental platform for the experiments in this paper were performed on a
workstation on Ubuntu20.04. The GPU is NVIDIA TITAN V 12 G. The neural network is
built with Pytorch1.10 as the basic framework and programmed with Python language,
and the specific parameters are shown in Table 1.
Table 1. Experimental parameter configuration.
Parameter Disposition
CPU Intel(R) Xeon(R) Gold 5118 × 2 CPU @2.29 GHz
GPU NVIDIA TITAN V 12 G
Systems Ubuntu 20.04
CUDA 11.3
4.3. Evaluation Indicators
In order to verify the comprehensive performance of the TP-ODA algorithm, this
paper mainly selects [email protected] (the average AP of all categories when the IOU is set to
0.5), [email protected]:0.95 (the average mAP under different IOU thresholds), FPS, GFLOPs, the
number of parameters and the model size to evaluate the model performance.
The mAP value is the average value of all AP values, which can be used to evaluate
the detection effect of the algorithm for multi-class objects. AP represents the result of
evaluating the detection results of each class, which is related to the precision value and
recall value of the model. The specific definition is as follows
2 1
AP = PdR (12)
0
470
Electronics 2022, 11, 3828
1 N
N ∑ i =O
mAP = APi (13)
TP, FP, and FN represent the number of correct detections, false detections, and missed
detections, respectively. TP represents the number of instances that themselves belong to
this class of objects and can be accurately detected by the model. In contrast, FP represents
the number of instances that do not belong to this class of objects themselves, but are
misjudged as such objects due to insufficient model performance. Here, true positive (TP)
is the number of positive samples predicted to be positive, false positive (FP) is the number
of samples predicted to be positive but is actually negative, and false negative (FN) is the
number of samples predicted to be negative but is actually positive.
TP
Precision = × 100% (14)
TP + FP
TP
Recall = × 100% (15)
TP + FN
The size of the model is the size of the model stored after the final model training.
The detection speed of the detection model is measured by the number of images per
second (FPS) denoting the number of images that can be processed per second, and T
denoting the time it takes to process an image. The average FPS detection time includes the
inference time of the model, the average detection processing time, and the non-maximum
suppression processing time.
1
FPS = (16)
T
5. Experimental Process
For the application scenario of the UAV border patrol detection, which is the focus
of the paper, improving the detection speed of the model, reducing the parameters and
computation of the model, and reducing the consumption of memory resources of the
model are the main requirements for model selection while maintaining the detection
accuracy of the model.
5.1. Implementation Details
Model training process: To prevent overfitting and skipping the optimal solution, the
momentum factor is set to 0.937, and the stochastic gradient descent method is used to
adjust the parameters. The batchsize is set to 32. Epochs were trained for 300 rounds, with
an initial learning rate of 0.01 for the first 200 rounds and a weight decay of 0.0005 for the
last 100 rounds. The overlap coefficient of the Mixup was set to 0.7. When the loss function
and accuracy are gradually stable, the optimal weight of the algorithm is obtained. In the
image preprocessing process, the image size is resized to 640×640 before being input into
the network for training.
The YOLOv5 model includes a variety of different structures depending on the depth
and width of the network. In this paper, some YOLOv5 models with different depths and
widths are selected for experiments. As the detection objects in the VisDrone2019 [47]
dataset involve common objects, such as vehicles and pedestrians, and the characteristics
of small and dense objects are similar to the characteristics of a part of the objects on patrol,
we first use the Visdrone2019 dataset to carry out the baseline model selection experiment.
The training process does not load the pre-training weights, a batchsize of 16, epochs
are iterated 300 times, and the other parameters are selected as the default parameters
of the algorithm for training. The model after training is tested on the test dataset in the
Visdrone2019 dataset, and the relevant parameters are shown in Table 2.
471
Electronics 2022, 11, 3828
Table 2. Baseline training results for different structures (Visdrone-2019 dataset).
Method P R [email protected] [email protected]:0.95 FPS GFLOPs Model Size (MB) Parameter (M)
YOLOv5s 0.368 0.314 0.269 0.139 79 15.9 14.4 7.03
YOLOv5m 0.434 0.332 0.311 0.169 74 48.1 42.2 20.9
YOLOv5l 0.44 0.355 0.325 0.181 60 107.9 92.9 46.2
YOLOv5x 0.459 0.37 0.341 0.193 48 204.2 173.2 86.2
As can be seen from Table 2, the YOLOv5x model has the highest detection accuracy,
but the slowest detection speed, the largest amount of model calculation and parameters,
and the largest memory occupation. The YOLOv5s model has the smallest memory, the
smallest amount of calculation and the smallest number of parameters, but the detection
accuracy and the detection accuracy are low. The accuracy difference between the YOLOv5x
model and YOLOv5x model is 7.2%, but the model occupies a large amount of memory,
calculation and the number of parameters, and the model detection speed is increased
by 64.58%. Therefore, the YOLOv5 model has the advantages of fast detection speed,
small overall model size and high detection accuracy, which meets the needs of the patrol
duty object detection studied in this paper. At the same time, considering the real-time
requirements of the task and the limited computing resources of the edge devices to be
carried out in the future. Therefore, this paper chooses the YOLOv5s model as the baseline
model, analyzes the existing and possible future problems of the actual task, makes objected
improvements to the baseline model, and proposes a detection algorithm TP-ODA that is
more suitable for patrol duty detection tasks.
5.2. Ablation Experiments
We use the model after improving the loss function for training and detection on the
BDP dataset. Table 3 represents the improved experimental results. From the experimental
results, we know that the detection performance of the baseline detection algorithm on
the BDP dataset is good. Compared to the baseline model, the mAP of the improved loss
function detection algorithm is improved by 2.1% and the FPS is improved by 8.3%. From
the experimental results, it is clear that the improvement in the loss function has more
practical significance for the border patrol detection task proposed in this paper.
Table 3. Loss function improvement case parameters on the BDP dataset (batch = 32).
Baseline Method All FPS GFLOPs Model Size (MB) Parameter (M)
L 0.559 78 107.8 92.9 46.1
L + EIOU 0.571 81 107.8 92.9 46.1
S 0.532 108 15.8 14.1 7.0
S + EIOU 0.553 117 15.8 14.1 7.0
To verify the effectiveness of the other improvement modules used in this paper for the
algorithm, we conducted ablation experiments on the BDP dataset. To ensure the fairness
of the model evaluation, we set the same parameters for each variable.
The experimental procedure and the resulting relevant parameters are shown in
Tables 4–6. To test the performance of the algorithm for detecting images of different scale
sizes, the detected images are adjusted to the sizes of 640 and 1024 in this thesis and input
to the model for detection. However, according to the actual computational capacity of the
edge devices, the number of images input to the network in a single pass is adjusted in the
experiments, and the batchsize is set to 1, which means that only 1 image is input to the
model for detection at a time, so as to mimic the situation that the UAV platform or other
patrol reconnaissance devices have a limited number of images to process in a single pass
due to less computational resources. The comprehensive experimental results show that
the TP-ODA proposed in this chapter has better performance for the UAV border patrol
object detection task. The specific experimental detection results are as follows.
472
Electronics 2022, 11, 3828
Table 4. The results of ablation experiments performed by the improved module. Batchsize = 32,
image size = 640.
Loss Ghost mAP mAP@ Model Parameter
Method BP-Sim PDOEM FPS GFLOPs
Function Module @0.5/ 0.5:0.95 Size/MB (M)
Baseline √ 0.532 0.227 108 14.1 7.01 15.8
Model 1 √ √ 0.553 0.231 117 14.1 7.01 15.8
Model 2 √ √ √ 0.528 0.223 118 7.6 3.6 8.1
Model 3 √ √ √ √ 0.554 0.245 121 6.1 2.9 6.6
Model 4 0.561 0.249 118 5.1 2.4 5.5
Table 5. Batchsize = 1, image size = 640.
Loss Ghost mAP mAP@ Model Parameter
Method BP-Sim PDOEM FPS GFLOPs
Function Module @0.5/ 0.5:0.95 Size/MB (M)
Baseline √ 0.531 0.23 72 14.1 7.01 15.8
Model 1 √ √ 0.554 0.221 50 14.1 7.01 15.8
Model 2 √ √ √ 0.538 0.223 58 7.6 3.6 8.1
Model 3 √ √ √ √ 0.558 0.247 71 6.1 2.9 6.6
Model 4 0.566 0.251 82 5.1 2.4 5.5
Table 6. Batchsize = 1, image size = 1024.
Loss Ghost mAP mAP@ Model Parameter
Method BP-Sim PDOEM FPS GFLOPs
Function Module @0.5/ 0.5:0.95 Size/MB (M)
Baseline √ 0.476 0.189 103 14.1 7.01 15.8
Model 1 √ √ 0.505 0.202 120 14.1 7.01 15.8
Model 2 √ √ √ 0.467 0.186 117 7.6 3.6 8.1
Model 3 √ √ √ √ 0.48 0.187 120 6.1 2.9 6.6
Model 4 0.514 0.211 116 5.1 2.4 5.5
Model 1 mainly improves the imbalance problem of the detection box sample of the
model. As can be seen from the three groups of experimental data in Tables 4–6, the detec-
tion accuracy and detection speed of the model are improved. Based on Model 1, Model 2
is designed for lightweight, and inspired by the idea of GhostNet, the ordinary convolu-
tional neural network is optimized. The experimental results show that, after Model 2 was
replaced with a module that consumes less computational resources, the detection accuracy
in the three sets of experiments was reduced by 2.5%, 1.6% and 2.8%, respectively, but the
number of model parameters and computational effort were reduced substantially, includ-
ing a 46.1% reduction in model volume, a 48.64% reduction in the number of parameters, a
48.73% reduction in GFLPOS, and a 3.7% increase in detection speed.
Considering the patrol task that the improved algorithm will use, and aiming at the
complex and diverse detection background, we build Model 3 based on Model 2, mainly
by adding a lightweight feature information extraction module BP-Sim in the network.
The purpose is to enhance the effective information expression ability of the detection
object in the complex patrol task environment, and to have better sensitivity to the useful
features of each dimension of the border patrol image. The experimental results show that
the detection accuracy of Model 3 is improved by 1.8%, 2.0% and 1.3%, the model size is
reduced by 19.74%, the number of parameters is reduced by 19.44%, and the GFLOPs is
reduced by 18.52%. In the comparison of detection speed, Model 3 is increased by 2.54%,
22.41% and 2.56%, respectively.
To address the impact of noise information when fusing features and the large size
of the neck network of the benchmark model, this study adds the feature fusion module
PDOEM to the neck network on the basis of Model 3. From the results of the three sets
473
Electronics 2022, 11, 3828
of experiments, it can be seen that the detection accuracy of the model was improved by
0.7%, 0.8%, and 3.4%, respectively, and the model volume was reduced by 16.39%, the
parameter volume is reduced by 17.24%, and the GFLOPs was reduced by 16.67%. In terms
of detection speed, except for the 2nd group of experiments in which the detection speed
of the model increased by 15.49%, the other two groups of experiments decreased by 2.57%
and 3.33%, but still belonged to the model with high detection efficiency.
5.3. Model Comparison Experiment
In order to illustrate the performance of the improved algorithm in this paper, we
selected some images from the border patrol detection dataset for detection. The main
characteristics of the selected graphics are: Highly similar detection environment, blurred
object background, diverse number of objects, etc. The selected objects are mainly vehicle
objects and soldiers on duty commonly found in border patrol. In addition, this section
selects representative detection models from various types of detection models for com-
parison experiments. The experimental comparison results are shown in Figures 6–8 and
Table 7.
Ground Truth TP-ODA YOLOv3-Tiny
baseline+MobileNetV3(small) Baseline Model Cascade R-CNN
Figure 6. Snow scene visualization detection results.
474
Electronics 2022, 11, 3828
Ground Truth TP-ODA YOLOv3-Tiny
baseline+MobileNetV3(small) Baseline Model Cascade R-CNN
(a)
Ground Truth TP-ODA YOLOv3-Tiny
baseline+MobileNet V3(small) Baseline Model Cascade R-CNN
(b)
Figure 7. Desert background visualization detection results. (a) Low-altitude horizontal view.
(b) Overhead view.
475
Electronics 2022, 11, 3828
Ground Truth TP-ODA YOLOv3-Tiny
baseline+MobileNetV3 (small) Baseline Model Cascade R-CNN
Figure 8. Jungle background visualization detection results.
Table 7. The TP-ODA model was compared to the other models.
mAP mAP Model
Method Baseline FPS Parameter (M) GFLOPs
@0.5 @0.5:0.95 Size/(MB)
TP-ODA 0.561 0.249 117 5.1 2.4 5.5
Baseline 0.532 0.227 108 14.1 7.01 15.8
+MobileNeV3(small) 0.53 0.221 121 7.2 3.5 6.1
+EfficientNet 0.517 0.218 112 7.7 3.7 7.6
+ShuffleNet v2 0.497 0.21 133 6.1 3.5 3.1
YOLOv3-tiny 0.505 0.205 100 16.6 8.6 12.9
Cascade R-CNN 0.585 0.255 11 165.0 68.9 234.4
The detected environment in Figure 6 is a snowy scene, and the detected objects have
a high similarity to the detection background, which is very challenging for the model.
From the results, it can be seen that all the detections have missed and false detections. The
Cascade R-CNN algorithm and the TP-ODA algorithm both detect three objects, and the
benchmark model detects two objects, but also three object false detections, and the Cascade
R-CNN only has one object. The experimental results show that the improved algorithm in
this chapter is slightly less accurate than the Cascade R-CNN and better than the benchmark
algorithm and other detection algorithms on this class of object detection task.
Figure 7 shows two sets of detected objects against a desert background, involving
detection categories of soldiers and vehicles on duty. The main characteristics of this group
of images are the large number of objects and the small size of the objects. From the results of
the two sets of experiments, it can be concluded that all the detection algorithms can detect
the vehicle objects and the algorithms have good overall performance, but when detecting
pedestrian objects in this type of scene, the YOLOv3-Tiny and Baseline+MobileNetV3
detection algorithms show different degrees of missed detection, and the baseline model
476
Electronics 2022, 11, 3828
and TP-ODA show false detection, with the baseline. The Cascade R-CNN detection
algorithm does not show false detections or missed detections, but the TP-ODA algorithm
has a higher confidence value in the detection results, which is closer to the real frame.
Figure 8 shows the detected objects in the jungle environment, which are mainly
characterized by the different scales of the objects to be detected, and the fuzzy and complex
detection backgrounds. All five sets of experimental results failed to detect all the objects,
among which the YOLOv3-Tiny detection algorithm had more missed detections, and only
two objects were detected in both sets of data. the Baseline model and TP-ODA detected
three objects, which was better than the other models. While the TP-ODA algorithm
showed one false detection case, the detection results were closer to the true value.
Table 6 indicates that the results of the TP-ODA model with other models for com-
parison experiments. In the experimental results, the detection algorithm in this paper
guarantees the detection speed and detection accuracy, and the number of parameters and
computation volume of the model are significantly reduced, and the accuracy is improved
by 2.9%, the model parameter volume is reduced by 65.76%, the model volume is reduced
by 63.83%, and the computation volume is reduced by 65.19% compared to the benchmark
model. In the detection speed comparison experiments, the model with ShuffleNet v2
for light processing has the fastest inference speed with a FPS of 133, which exceeds the
detection speed of the benchmark model by 23.14% and that of TP-ODA by 13.67%, but the
model computation and the number of parameters are higher than those of the TP-ODA
algorithm by more than two-fifths and the model volume is larger. In terms of detection
accuracy, the two-stage network shows a stronger advantage, with the accuracy value
exceeding that of the TP-ODA algorithm by 2.24%, but the comprehensive performance of
the algorithm in this paper is more advantageous in completing the border patrol detection
task in terms of the comprehensive model size, detection accuracy and detection speed.
6. Conclusions
In this study, we designed a lightweight detection network for detecting border patrol
objects for use with the UAV platforms and portable reconnaissance equipment often
used by border patrols. In order to be better used on edge devices, we used the YOLOv5
detection algorithm as the benchmark model and took the reduction of network size and the
consumption of computational resources as the starting point. We proposed the TP-ODA
detection network in three aspects: Volume compression of the model, improving the
semantic information representation of object features and optimizing the loss function of
the model, and verify through experiments that the improvement module has a positive
effect on the improvement of the model. Synthesizing the improvement work in this paper,
the following conclusions can be drawn: We used stacking to reconstruct the backbone
network using the lightweight module, reducing the resource consumption by nearly
one-third, while using BP-Sim to further optimize the feature extraction function of the
network and enhance the detection capability of the model for border patrol hard-to-detect
images. Then, we used the EIOU loss function to improve the problem of the detection
frame sample imbalance leading to accuracy degradation and convergence slowdown;
finally, we designed the feature fusion module PDOEM for the problem of the large size
of the neck network feature fusion structure, which further compresses the model while
reducing the impact of noise information on the model feature fusion and further enhances
the difficult sample feature information mining capability.
This paper verifies, through ablation experiments, that the introduced method and
designed module have good effects on algorithm performance improvement, and further
verifies that the TP-ODA detection algorithm has better detection performance in the border
patrol detection task by comparing it with other lightweight algorithms and common
detection algorithms and meets the requirements of the border patrol detection task for
real-time and accuracy.
Combining the experimental results and conclusions of this paper, the next research
directions are also clarified as follows.
477
Electronics 2022, 11, 3828
1. The border patrol detection task is an all-weather task, and the next step of the
model performance improvement needs to consider training in a richer and more diverse
task environment.
2. The improved model will be mounted into resource-constrained edge devices to test
the detection performance of the algorithm in reality, and to be able to find the problems
with the model in such a way to further improve the algorithm performance.
Author Contributions: Conceptualization, H.L. and L.Y.; methodology, L.Y. and L.B.; software, L.Y.;
validation, H.L. and J.Y.; formal analysis, L.B.; investigation, H.L.; resources, L.Y.; data curation,
L.Y., L.B.; writing—original draft preparation, L.Y.; writing—review and editing, H.L.; visualization,
L.B.; supervision H.L.; project administration, J.Y. All authors have read and agreed to the published
version of the manuscript.
Funding: This research was supported by the Military Graduate Student Fund (KYGYJWXX22XX).
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Informed consent was obtained from all subjects involved in the study.
Data Availability Statement: Not applicable.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Pedrozo, S. Swiss Military Drones and the Border Space: A Critical Study of the Surveillance Exercised by Border Guards. Geogr.
Helv. 2017, 72, 97–107. [CrossRef]
2. Abushahma, R.I.H.; Ali, M.A.M.; Rahman, N.A.A.; Al-Sanjary, O.I. Comparative Features of Unmanned Aerial Vehicle (UAV) for
Border Protection of Libya: A Review. In Proceedings of the IEEE 2019 IEEE 15th International Colloquium on Signal Processing
& Its Applications (CSPA), Penang, Malaysia, 8–9 March 2019; pp. 114–119.
3. Alom, M.Z.; Taha, T.M.; Yakopcic, C.; Westberg, S.; Sidike, P.; Nasrin, M.S.; Essen, B.C.V.; Awwal, A.A.S.; Asari, V.K. The History
Began from AlexNet: A Comprehensive Survey on Deep Learning Approaches. arXiv 2018, arXiv:1803.01164.
4. Peng, H.; Zhang, Y.; Yang, S.; Song, B. Battlefield Image Situational Awareness Application Based on Deep Learning. IEEE Intell.
Syst. 2020, 35, 36–43. [CrossRef]
5. Buch, N.; Velastin, S.A.; Orwell, J. A Review of Computer Vision Techniques for the Analysis of Urban Traffic. IEEE Trans. Intell.
Transp. Syst. 2011, 12, 20. [CrossRef]
6. Esteva, A.; Chou, K.; Yeung, S.; Naik, N.; Madani, A.; Mottaghi, A.; Liu, Y.; Topol, E.J.; Dean, J.; Socher, R. Deep Learning-Enabled
Medical Computer Vision. NPJ Digit. Med. 2021, 4, 5. [CrossRef] [PubMed]
7. Girshick, R.B.; Donahue, J.; Darrell, T.; Malik, J. Rich Feature Hierarchies for Accurate Object Detection and Semantic Segmentation.
In Proceedings of the 2014 IEEE Conference on Computer Vision and Pattern Recognition, Columbus, OH, USA, 23–28 June 2014;
pp. 580–587.
8. Jiang, G.; He, H.; Yan, J.; Xie, P. Multiscale Convolutional Neural Networks for Fault Diagnosis of Wind Turbine Gearbox. IEEE
Trans. Ind. Electron. 2019, 66, 3196–3207. [CrossRef]
9. Zhao, Q.; Sheng, T.; Wang, Y.; Tang, Z.; Chen, Y.; Cai, L.; Ling, H. M2Det: A Single-Shot Object Detector Based on Multi-Level
Feature Pyramid Network. arXiv 2019, arXiv:1811.04533. [CrossRef]
10. Tan, M.; Le, Q.V. EfficientNet: Rethinking Model Scaling for Convolutional Neural Networks. arXiv 2019, arXiv:1905.11946.
11. Ultralytics. YOLOv5. Available online: https://github.com/ultralytics/yolov5 (accessed on 5 December 2021).
12. Redmon, J.; Divvala, S.K.; Girshick, R.B.; Farhadi, A. You Only Look Once: Unified, Real-Time Object Detection. In Proceedings
of the 2016 IEEE Conference on Computer Vision and Pattern Recognition (CVPR), Las Vegas, NV, USA, 27–30 June 2016;
pp. 779–788.
13. Redmon, J.; Farhadi, A. YOLO9000: Better, Faster, Stronger. In Proceedings of the 2017 IEEE Conference on Computer Vision and
Pattern Recognition (CVPR), Honolulu, HI, USA, 21–27 July 2017; pp. 6517–6525.
14. Redmon, J.; Farhadi, A. YOLOv3: An Incremental Improvement. arXiv 2018, arXiv:1804.02767.
15. Bochkovskiy, A.; Wang, C.-Y.; Liao, H.-Y.M. YOLOv4: Optimal Speed and Accuracy of Object Detection. arXiv 2020,
arXiv:2004.10934.
16. Mohiyuddin, A.; Basharat, A.; Ghani, U.; Peter, V.; Abbas, S.; Naeem, O.B.; Rizwan, M. Breast Tumor Detection and Classification
in Mammogram Images Using Modified YOLOv5 Network. Comput. Math. Methods Med. 2022, 2022, 1–16. [CrossRef] [PubMed]
17. Walia, I.S.; Kumar, D.; Sharma, K.; Hemanth, J.D.; Popescu, D.E. An Integrated Approach for Monitoring Social Distancing and
Face Mask Detection Using Stacked ResNet-50 and YOLOv5. Electronics 2021, 10, 2996. [CrossRef]
18. Loey, M.; Manogaran, G.; Taha, M.H.N.; Khalifa, N.E.M. Fighting against COVID-19: A Novel Deep Learning Model Based on
YOLO-v2 with ResNet-50 for Medical Face Mask Detection. Sustain. Cities Soc. 2020, 65, 102600. [CrossRef] [PubMed]
478
Electronics 2022, 11, 3828
19. Liu, J.; Wang, X. Tomato Diseases and Pests Detection Based on Improved Yolo V3 Convolutional Neural Network. Front. Plant
Sci. 2020, 11, 898. [CrossRef]
20. Chen, W.; Lu, S.; Liu, B.; Chen, M.; Li, G.; Qian, T. CitrusYOLO: A Algorithm for Citrus Detection under Orchard Environment
Based on YOLOv4. Multim. Tools Appl. 2022, 81, 31363–31389. [CrossRef]
21. Kou, X.; Liu, S.; Cheng, K.I.-C.; Qian, Y. Development of a YOLO-V3-Based Model for Detecting Defects on Steel Strip Surface.
Measurement 2021, 182, 109454. [CrossRef]
22. Al-qaness, M.A.A.; Abbasi, A.A.; Fan, H.; Ibrahim, R.A.; Alsamhi, S.H.; Hawbani, A. An Improved YOLO-Based Road Traffic
Monitoring System. Computing 2021, 103, 211–230. [CrossRef]
23. Du, Y.; Pan, N.; Xu, Z.; Deng, F.; Shen, Y.; Kang, H. Pavement Distress Detection and Classification Based on YOLO Network. Int.
J. Pavement Eng. 2020, 22, 1659–1672. [CrossRef]
24. Liu, Y.; Wang, C.; Zhou, Y. Camouflaged People Detection Based on a Semi-Supervised Search Identification Network. Def.
Technol. 2021, in press. [CrossRef]
25. Fang, Z.; Zhang, X.; Deng, X.; Cao, T.; Zheng, C. Camouflage People Detection via Strong Semantic Dilation Network. In Proceed-
ings of the ACM TURC 2019: ACM Turing Celebration Conference—China, Chengdu China, 17–19 May 2019; pp. 1–7.
26. Zheng, G.; Wu, X.; Hu, Y.; Liu, X. Object Detection for Low-Resolution Infrared Image in Land Battlefield Based on Deep Learning.
In Proceedings of the IEEE 2019 Chinese Control Conference (CCC), Guangzhou, China, 27–30 July 2019; pp. 8649–8652.
27. Zhu, X.; Lyu, S.; Wang, X.; Zhao, Q. TPH-YOLOv5: Improved YOLOv5 Based on Transformer Prediction Head for Object
Detection on Drone-Captured Scenarios. In Proceedings of the 2021 IEEE/CVF International Conference on Computer Vision
Workshops (ICCVW), Montreal, BC, Canada, 11–17 October 2021; pp. 2778–2788.
28. Kristo, M.; Ivasic-Kos, M.; Pobar, M. Thermal Object Detection in Difficult Weather Conditions Using YOLO. IEEE Access
2020, 8, 125459–125476. [CrossRef]
29. Iandola, F.N.; Moskewicz, M.W.; Ashraf, K.; Han, S.; Dally, W.J.; Keutzer, K. SqueezeNet: AlexNet-Level Accuracy with 50x Fewer
Parameters and <1 MB Model Size. arXiv 2016, arXiv:1602.07360.
30. Sandler, M.; Howard, A.G.; Zhu, M.; Zhmoginov, A.; Chen, L.-C. MobileNetV2: Inverted Residuals and Linear Bottlenecks.
In Proceedings of the 2018 IEEE/CVF Conference on Computer Vision and Pattern Recognition, Salt Lake City, UT, USA,
18–23 June 2018; pp. 4510–4520.
31. Howard, A.G.; Zhu, M.; Chen, B.; Kalenichenko, D.; Wang, W.; Weyand, T.; Andreetto, M.; Adam, H. MobileNets: Efficient
Convolutional Neural Networks for Mobile Vision Applications. arXiv 2017, arXiv:1704.04861.
32. Zhang, X.; Zhou, X.; Lin, M.; Sun, J. ShuffleNet: An Extremely Efficient Convolutional Neural Network for Mobile Devices.
In Proceedings of the 2018 IEEE/CVF Conference on Computer Vision and Pattern Recognition, Salt Lake City, UT, USA, 18–23
June 2018; pp. 6848–6856.
33. Ma, N.; Zhang, X.; Zheng, H.; Sun, J. ShuffleNet V2: Practical Guidelines for Efficient CNN Architecture Design. In Proceedings
of the ECCV, Munich, Germany, 8–14 September 2018.
34. Chollet, F. Xception: Deep Learning with Depthwise Separable Convolutions. In Proceedings of the 2017 IEEE Conference on
Computer Vision and Pattern Recognition (CVPR), Honolulu, HI, USA, 21–27 July 2017; pp. 1800–1807.
35. Fan, Y.; Qiu, Q.; Hou, S.; Li, Y.; Xie, J.; Qin, M.; Chu, F. Application of Improved YOLOv5 in Aerial Photographing Infrared
Vehicle Detection. Electronics 2022, 20, 2344. [CrossRef]
36. Zhang, M.; Xu, S.; Song, W.; He, Q.; Wei, Q. Lightweight Underwater Object Detection Based on YOLO v4 and Multi-Scale
Attentional Feature Fusion. Remote. Sens. 2021, 13, 4706. [CrossRef]
37. Feng, J.H.; Yuan, H.; Hu, Y.Q.; Lin, J.; Liu, S.; Luo, X. Research on Deep Learning Method for Rail Surface Defect Detection. IET
Electr. Syst. Transp. 2020, 10, 436–442. [CrossRef]
38. Wu, T.-H.; Wang, T.-W.; Liu, Y.-Q. Real-Time Vehicle and Distance Detection Based on Improved Yolo v5 Network. In Proceedings
of the 2021 3rd World Symposium on Artificial Intelligence (WSAI), Guangzhou, China, 18–20 June 2021; pp. 24–28.
39. Lin, T.-Y.; Dollár, P.; Girshick, R.B.; He, K.; Hariharan, B.; Belongie, S.J. Feature Pyramid Networks for Object Detection. In Pro-
ceedings of the 2017 IEEE Conference on Computer Vision and Pattern Recognition (CVPR), Honolulu, HI, USA, 21–27 July 2017;
pp. 936–944.
40. Wang, K.; Liew, J.H.; Zou, Y.; Zhou, D.; Feng, J. PANet: Few-Shot Image Semantic Segmentation With Prototype Align-
ment. In Proceedings of the 2019 IEEE/CVF International Conference on Computer Vision (ICCV), Seoul, Republic of Korea,
27 October–2 November 2019; pp. 9196–9205.
41. Han, K.; Wang, Y.; Tian, Q.; Guo, J.; Xu, C.; Xu, C. GhostNet: More Features From Cheap Operations. In Proceedings of the 2020
IEEE/CVF Conference on Computer Vision and Pattern Recognition (CVPR), Seattle, WA, USA, 13–19 June 2020; pp. 1577–1586.
42. Kong, L.; Wang, J.; Zhao, P. YOLO-G: A Lightweight Network Model for Improving the Performance of Military Targets Detection.
IEEE Access 2022, 10, 55546–55564. [CrossRef]
43. Yang, L.; Zhang, R.-Y.; Li, L.; Xie, X. SimAM: A Simple, Parameter-Free Attention Module for Convolutional Neural Networks.
In Proceedings of the 38th International Conference on Machine Learning, Virtual, 18–24 July 2021; p. 12.
44. Zhu, D.; Qi, R.; Hu, P.; Su, Q.; Qin, X.; Li, Z. YOLO-Rip: A Modified Lightweight Network for Rip Currents Detection. Front. Mar.
Sci. 2022, 9. [CrossRef]
45. Zheng, Z.; Wang, P.; Liu, W.; Li, J.; Ye, R.; Ren, D. Distance-IoU Loss: Faster and Better Learning for Bounding Box Regression.
In Proceedings of the AAAI Conference on Artificial Intelligence, New York, NY, USA, 7–12 February 2020.
479
Electronics 2022, 11, 3828
46. Zhang, Y.-F.; Ren, W.; Zhang, Z.; Jia, Z.; Wang, L.; Tan, T. Focal and Efficient IOU Loss for Accurate Bounding Box Regression.
Neurocomputing 2022, 506, 146–157. [CrossRef]
47. Wen, L.; Zhu, P.F.; Du, D.; Bian, X.; Ling, H.; Hu, Q.; Liu, C.; Cheng, H.; Liu, X.; Ma, W.; et al. VisDrone-SOT2019: The Vision Meets
Drone Single Object Tracking Challenge Results. In Proceedings of the 2019 IEEE/CVF International Conference on Computer
Vision Workshop (ICCVW), Seoul, Republic of Korea, 27–28 October 2019; pp. 199–212.
480
electronics
Article
Innovative Hyperspectral Image Classification Approach Using
Optimized CNN and ELM
Ansheng Ye 1,2 , Xiangbing Zhou 3, * and Fang Miao 1
1 Key Lab of Earth Exploration & Information Techniques of Ministry Education, Chengdu University of
Technology, Chengdu 610059, China; [email protected] (A.Y.); [email protected] (F.M.)
2 School of Computer Science, Chengdu University, Chengdu 610106, China
3 School of Information and Engineering, Sichuan Tourism University, Chengdu 610100, China
* Correspondence: [email protected]
Abstract: In order to effectively extract features and improve classification accuracy for hyperspectral
remote sensing images (HRSIs), the advantages of enhanced particle swarm optimization (PSO)
algorithm, convolutional neural network (CNN), and extreme learning machine (ELM) are fully
utilized to propose an innovative classification method of HRSIs (IPCEHRIC) in this paper. In the
IPCEHRIC, an enhanced PSO algorithm (CWLPSO) is developed by improving learning factor and
inertia weight to improve the global optimization performance, which is employed to optimize the
parameters of the CNN in order to construct an optimized CNN model for effectively extracting the
deep features of HRSIs. Then, a feature matrix is constructed and the ELM with strong generalization
ability and fast learning ability is employed to realize the accurate classification of HRSIs. Pavia
University data and actual HRSIs after Jiuzhaigou M7.0 earthquake are applied to test and prove
the effectiveness of the IPCEHRIC. The experiment results show that the optimized CNN can
effectively extract the deep features from HRSIs, and the IPCEHRIC can accurately classify the
HRSIs after Jiuzhaigou M7.0 earthquake to obtain the villages, bareland, grassland, trees, water, and
rocks. Therefore, the IPCEHRIC takes on stronger generalization, faster learning ability, and higher
classification accuracy.
Citation: Ye, A.; Zhou, X.; Miao, F.
Innovative Hyperspectral Image Keywords: hyperspectral image classification; CNN; ELM; PSO; deep feature
Classification Approach Using
Optimized CNN and ELM.
Electronics 2022, 11, 775. https://
doi.org/10.3390/electronics11050775 1. Introduction
Academic Editor: Byung Cheol Song Remote sensing image (RSI) classification is to divide the image into several regions
by using specific rule or algorithm according to the spectral features, geometric texture
Received: 21 January 2022
features, or other features [1–3]. Each region is a set of ground and objects with the same
Accepted: 1 March 2022
characteristics, or a lot of RSIs are divided into several sets through some methods, and
Published: 2 March 2022
each set represents a kind of ground or object category. It is a very important basic problem
Publisher’s Note: MDPI stays neutral and plays a very important position in the field of RSIs [4–6]. Therefore, the research on
with regard to jurisdictional claims in remote sensing image classification method has become an important direction, which has
published maps and institutional affil- very important theoretical significance and practical application value.
iations. In recent years, many classification methods of RSIs have been proposed, which can
be divided into two categories of manual visual interpretation and computer classifica-
tion [7]. The manual visual interpretation is the most traditional classification method,
which has large workload, low efficiency, and requires rich professional knowledge and
Copyright: © 2022 by the authors.
interpretation experiences [8–10]. With the rapid development of computer techniques, the
Licensee MDPI, Basel, Switzerland.
This article is an open access article
automatic classification method of RSIs replaces the manual visual interpretation classifica-
distributed under the terms and
tion method. The more complex computer technology uses the spectral brightness value of
conditions of the Creative Commons pixels and the spatial relationship between pixels and their surrounding pixels to realize
Attribution (CC BY) license (https:// pixel classification. Tran et al. [11] presented a sub-pixel and per-pixel classification method
creativecommons.org/licenses/by/ to analyze the impact of land cover heterogeneity. Khodadadzadeh et al. [12] presented a
4.0/). new hyperspectral spectral-spatial classifier. Li et al. [13] presented a novel classification
Electronics 2022, 11, 775. https://doi.org/10.3390/electronics11050775 https://www.mdpi.com/journal/electronics
481
Electronics 2022, 11, 775
method of RSIs based on the probabilistic fusion of pixel-level and superpixel-level classi-
fiers. Li et al. [14] presented a novel pixel-pair method. Mei et al. [15] presented a novel
pixel-level perceptual subspace learning method. Pan et al. [16] presented a new central
pixel selection strategy based on gradient information to realize texture image classification.
Bey et al. [17] presented a new land cover assessment methodology. Yan et al. [18] pre-
sented a triple counter domain adaptation approach for learning domain invariant classifier.
Li et al. [19] presented a novel multi-view active learning approach based on sub-pixel and
super-pixel. Ma and Chang [20] presented a novel mixed pixel classification approach.
The single pixel spectral classification method can obtain the hyperspectral spectral-
spatial classification results, but they still exist at low classification accuracy and high
time complexity. The signal processing method on computer has the characteristics of
large amount of calculation and can obtain high classification accuracy. However, the
high-resolution RSIs have high spatial resolution and complexity. It is very difficult to
classify high-resolution RSIs by using traditional classification methods. Therefore, it
is urgent to deeply study a fast classification approach that can be effectively applied
to high-resolution RSIs [21,22]. As a field of artificial intelligence, deep learning has at-
tracted extensive attention, and has gradually become one of the important technologies
to promote the development of artificial intelligence. Therefore, many scholars have ap-
plied deep learning to remote sensing image classification and proposed many features
extraction and classification methods. Romero et al. [23] presented a sparse feature unsu-
pervised learning approach based on greedy hierarchical unsupervised pretraining method.
Sharma et al. [24] presented a new deep patch-based CNN. Maggiori et al. [25] presented
a dense pixel-level classification model. Wang et al. [26] presented a HRSI classification
method using principal component analysis (PCA) and guided filtering, deep learning
architecture. Ji et al. [27] presented a novel three-dimensional CNN to automatically classify
crops. Ben et al. [28] presented 3-D deep learning approach. Xu et al. [29] presented a novel
RSI classification model using generative adversarial network. Tao et al. [30] presented a
novel reinforced deep neural network (DNN) with depth and width. Liang et al. [31] pre-
sented a new RSI classification approach using stacked denoising autoencoder. Li et al. [32]
presented a novel region-wise depth feature extraction model. Li et al. [33] presented an
adaptive multiscale deep fusion residual network. Yuan et al. [34] presented a classifi-
cation approach based on rearranged local features. Zhang et al. [35] presented a new
dense network with multi-scales. Zhang et al. [36] presented a new feature aggregation
model based on 3-D CNN. Chen et al. [37] presented a novel deep Boltzmann machine
based on the conjugate gradient update algorithm. Xiong et al. [38] presented a novel
deep multi-feature fusion network based on two different deep architecture branches.
Tong et al. [39] presented a channel-attention-based DenseNet network. Zhu et al. [40]
presented a new deep network with dual-branch attention fusion. Raza et al. [41] presented
a four-layer classification network based on visual attention mechanisms. Li et al. [42]
presented a classification approach by combining generative adversarial network (GAN),
CNN with long short-term memory. Gu et al. [43] presented a pseudo labeled sample
generation method. Guo et al. [44] presented a novel self-supervised gated self-attention
GAN. Li et al. [45] presented a novel locally preserving deep cross embedded classifica-
tion network. Lei et al. [46] presented a novel deep convolutional capsule network using
spectral-spatial features. Cui et al. [47] presented a dual-channel deep learning recognition
model. Peng et al. [48] presented an efficient search framework to discover optimal network
architectures. Guo et al. [49] presented a novel semi-supervised scene classification method
using GAN. Dong et al. [50] presented a pixel cluster CNN. Li et al. [51] presented a new
RSI classification approach using error-tolerant deep learning. Li et al. [52] presented a
gated recursive neural network. Dong et al. [53] explored the potential of the reference-
based super-resolution method. Wu et al. [54] presented a self-paced dynamic infinite
mixture model. Karadal et al. [55] presented automated classification of remote sensing
images based on multileveled MobileNetV2 and DWT. Ma et al. [56] presented a novel
adaptive hybrid fusion network for multiresolution remote sensing images classification.
482
Electronics 2022, 11, 775
Cai et al. [57] presented a novel cross-attention mechanism and graph convolution in-
tegration algorithm. Zhang et al. [58] presented a convolutional neural architecture for
remote sensing image scene classification. Hilal et al. [59] presented a new deep transfer
learning-based fusion model for remote-sensing image classification. Li et al. [60] presented
a multi-scale fully convolutional network to exploit discriminative representations. In
addition, some new optimization algorithms are proposed [61–72], which can optimize the
parameters of classification models.
Because the CNN has good feature extraction ability, these classification methods based
on CNN have obtained better classification effects. It has attracted extensive attention
and has been widely applied in RSIs. However, the structure and parameter selection of
the CNN seriously affect its learning accuracy. Therefore, the enhanced PSO algorithm
with global optimization ability is employed to optimize and determine the parameters
of the CNN to obtain the optimized parameter values for constructing an optimized
CNN, which is applied to effectively extract the multi-layer features of HRSIs to form a
multi-feature fusion matrix. Then, the ELM is employed to realize the classification of
HRSIs. The effectiveness is verified by typical data set and actual HRSIs after Jiuzhaigou
M7.0 earthquake.
The main contributions of this paper are described as follows.
(1) For the slow convergence and low accuracy of the PSO, an enhanced PSO based
on fusing multi-strategy (CWLPSO) is proposed by adding new acceleration factor
strategy and inertia weight linear decreasing strategy.
(2) For the difficultly determining the parameters of the CNN, an optimized CNN model
using CWLPSO is developed to effectively extract the deep features of HRSIs.
(3) The ELM with strong generalization ability, fast learning ability, and the constructed
feature vector are combined to realize the accurate classification of HRSIs.
(4) An innovative classification method of HRSIs based on CWLPSO, CNN, and ELM,
namely, IPCEHRIC is proposed.
2. Basic Methods
2.1. CNN
The CNN is a feedforward neural network, which includes convolution calculation
and representative algorithm. It has the representation learning ability and can classify the
input information according to its hierarchical structure. The CNN includes input layer,
hidden layer, and output layer, which is shown in Figure 1.
Figure 1. The structure of the CNN.
The structure of the CNN is described in detail as follows.
Input layer. It can deal with multidimensional data, and the input features need to
be standardized.
Hidden layer. It includes convolution operation, pooling operation, and full connection
layer. The convolution layer is used to extract features from input data through the
convolution operation of multiple convolution cores to obtain and construct the feature
map. The pooling layer is to select features and filter information from the feature map
483
Electronics 2022, 11, 775
to retain important features, and preset the pooling function. The full connection layer is
equivalent to the hidden layer in the network. The output is obtained.
Convolution kernel. When the convolution kernel works, it will regularly scan input
features, multiply and sum the input features, and superimpose the deviation. The output
of the l + 1 layer is described as follow.
Kl f f
Z l +1 (i, j) = [ Z l ⊗ wl +1 ](i, j) + b = ∑ ∑ ∑ [ Zkl (s0 i + x, s0 j + y)wkl +1 ( x, y)] + b
k =1 x =1 y =1 (1)
Ll +2p− f
(i, j) ∈ {0, 1, . . . , Ll +1 } L l +1 = s0 +1
where, b is the offset, Z l and Z l +1 represents the convolution input and output of the
l + 1 layer, Ll +1 is the size of Zl +1 . In here, it is assumed that the length and width of the
characteristic graph are the same. Z (i, j) corresponds the pixels of the feature map, K is the
number of channels, f , s0 and p are the convolution layer parameters, which correspond
to the kernel size, convolution step size and number of filling layers. Especially, when
the kernel is f = 1, the step size is s0 = 1, and when a filled unit convolution kernel is not
included, the cross-correlation calculation is equivalent to matrix multiplication, and a fully
connected network is established between the convolution layers.
Kl L L
Z l +1 = ∑ ∑ ∑ (Zi,jl wkl+1 ) + b = wlT+1 Zl+1 + b, L l +1 = L (2)
k =1 x =1 y =1
Output layer. The output layer is the same, and the output result is obtained.
2.2. PSO
The PSO is an intelligent algorithm, which was proposed by Eberhart and Kennedy
in 1995 [73]. At first, it was to study the predation behavior of birds. Inspired by this, it
carried out modeling research on bird activities. In PSO, the update formula of the particle
velocity and position are described as follows.
vm+1 = ωvm + c1 r1 ( pbestm − xm ) + c2 r2 ( gbestm − xm ) (3)
x m +1 = x m + v m +1 (4)
where, vm+1 represents the velocity of particles, ω is the inertia weight factor, c1 and c2
are learning factors, ω, c1 , and c2 are usually preseted in advance. r1 and r2 represent a
random number, pbestm is the optimal value of individual, gbestm is the optimal value of
swarm. The function used to evaluate the fitness value of particles is called fitness function,
i.e., objective function. In most cases, the fitness value is smaller, the particle is better. The
optimal value of the individual and the optimal value of swarm are generally updated by
the following formula.
xm+1 , f ( xm+1 ) < f ( pbestm )
pbestm+1 = (5)
pbestm , otherwise
pbestm+1 , f ( pbestm+1 ) < f ( gbestm+1 )
gbestm+1 = (6)
gbestm+1 , otherwise
If the value of xm+1 is smaller than the value of the individual extreme value, then
pbestm+1 is equal to xm+1 . On the contrary, the individual extreme value is not updated.
If the value of gbestm+1 is greater than the value of the individual extreme value, then
gbestm+1 is equal to gbestm+1 .
484
Electronics 2022, 11, 775
2.3. ELM
The ELM is one of the commonly used neural network models in machine learning. Its
essence is a machine learning method based on single-hidden layer feed forward network
(SLFN). Compared with back propagation (BP) neural network model that uses gradient
descent algorithm to update the weight in the field of machine learning, the ELM can
randomly generate the threshold value. It has low computational complexity and less
time-consuming. In the classification and regression problems, the structure of the ELM
model is generally divided into the input layer, hidden and output layers. The specific
structure is shown in Figure 2.
Figure 2. The structure of ELM.
3. Improved Learning Factor and Inertia Weight
Although many researchers have proposed some effective researches and improve-
ments on the shortcomings of PSO, the PSO still has the problems of slow convergence, high
time complexity, and low accuracy. Therefore, the acceleration factor strategy and the iner-
tia weight linear decreasing strategy are introduced to propose an enhanced PSO(CWLPSO)
in this paper. That is, aiming at the slow convergence speed, a fast convergence strategy
with small deviation angle of particle speed and position is adopted to accelerate the
convergence of particles. Aiming at the poor search ability, a new improvement strategy of
learning factor is proposed in here. That is, different c1 and c2 values are selected in order
to improve the local search ability of particles in the early stage, enhance the optimization
ability of particle swarm and strengthen the overall search ability of particles in the later
stage. Aiming at the premature in the later stage, a new linear decreasing strategy of
inertia weight is adopted to linearly reduce the inertia weight from the maximum value to
the minimum value, so as to avoid the premature and the oscillation in the later stage of
the algorithm.
3.1. Improve Learning Factors
The learning factors c1 and c2 in the PSO represent the function of the particle itself
and the remaining particles removed from the particle itself on the motion route of moving
particles. At the same time, they also represent the information exchange between particles,
which result in different motion trajectories of particles. Therefore, an improvement strategy
of learning factor is designed to improve the local search ability of particles, enhance the
optimization ability of particle swarm and strengthen the overall search ability of particles
in here. That is, in the early stage of the algorithm, the c1 value is larger and the c2 value
is smaller, so that the particles can enhance the ability of self-cognition and weaken the
swarm cognition of the particles. However, in the later stage of the algorithm, the c1 value
decreases and the c2 value increases, it can improve the search ability by increasing the c1
value in the early stage, the proportion of particle swarm will be strengthened in the later
stage, so that more particles can learn from the swarm optimum. At the same time, the
fewer particles can learn from individual optimum, which is conducive to enhancing the
485
Electronics 2022, 11, 775
optimization ability, and strengthening the overall search ability of particles. The improved
strategy of learning factor is described as follows.
! "
i
c1 = c1max + (c1max − c1min ) ∗ (7)
k
! "
i
c2 = c2min + (c2max − c2min ) ∗ (8)
k
where, c1max and c1min represent the maximum and minimum values of learning factor
c1 .c2min and c2max represent the maximum and minimum values of learning factor c2 ,
i represents the current iterations, and k represents the maximum iterations.
3.2. Linear Decreasing of Inertia Weight
Inertia weight plays an important role in PSO. Generally, the inertia weight is generally
set to a fixed value between 0.6 and 0.9. The improper selection of inertia weight will cause
errors. If the inertia weight is larger, on the one hand, it will help to jump out from the local
minimum point and facilitate the global search, on the other hand, it will weaken the local
search ability. Therefore, for the premature in the later stage of the algorithm, a new linear
decreasing strategy of inertia weight is developed. That is, the inertia weight is linearly
reduced from ωmax to ωmin , which is described as follows.
! "
i ∗ (ωmax − ωmin )
ω = ωmax − (9)
k
where, ω is inertia weight, ωmax is maximum value of inertia weight, ωmin is minimum
value of inertia weight, i is current iteration, and k is maximum iterations.
4. Optimize CNN Using CWLPSO
4.1. Optimized Idea for CNN
The CNN with combining weight sharing and local area connection reduces the
complexity of the model and the values of parameters. However, the selection of the
number of filters, activation function, and learning rate of the CNN seriously affects the
learning accuracy. The parameters of the CNN are trained by the steepest gradient descent
method, which has a great impact on the learning performance. The proposed CWLPSO
has the characteristics of global search ability, population diversity, and fast convergence.
Therefore, the CWLPSO is employed to optimize the parameters of the CNN, and an
optimized CNN model based on the CWLPSO algorithm is developed in this paper. That is,
each particle is a network structure of the CNN. After the CNN calculates the error between
the expected value and the actual value, each particle considered the number of filters,
activation function learning rate, initial weight, and initial offset of the CNN as particle
dimensions. The obtained test error is taken as the fitness function value, the optimal CNN
model is selected through the iteration of the CWLPSO.
4.2. Model of Optimized CNN
The optimization process of the CNN using CWLPSO is shown in Figure 3.
The specific optimization process of the CNN using CWLPSO are described as follows.
Step 1. Initialize the parameters of the CNN, which include the number of nodes in
hidden layer, the learning rate, and so on.
Step 2. Initialize the parameters of the CWLPSO, which include the number of the
population, the maximum number of iterations, and the initial learning factor and inertia
weight, and so on.
Step 3. Construct the optimization objective function.
Step 4. Calculate the individual fitness values in the population in order to obtain the
initial fitness values of the population.
486
Electronics 2022, 11, 775
Step 5. Determine whether the end condition is met. If the end condition is met, then
the optimal individual is regarded as the optimal parameter value of the CNN and loop
Step 7. Otherwise execute Step 6.
Step 6. The velocity and position are updated, then the learning factor and the weight
factor is updated. Then return to Step 4.
Step 7. Obtain the optimal parameter values of the CNN and an optimized CNN
model is output.
Figure 3. The optimization process of the CNN using CWLPSO.
5. An Innovative Classification Method of HRSIs Using Optimized CNN and ELM
Classification accuracy is important indicators to evaluate the classification model for
HRSIs. Therefore, the effective feature extraction of HRSIs is the key factor for affecting
classification accuracy. As a deep learning method, the CNN can effectively mine the multi-
layer representation feature information. Different levels of representation correspond to
different feature attributes of the recognition object. For example, the shallow network
mainly represents the texture, edge and other local information of the recognition object,
while the deep network represents the more abstract semantics, structure, and other global
information. This feature matrix composes of the multi-layer feature attributes of the HRSIs.
As a fast machine learning algorithm, the weight parameters of the ELM and the offset
parameters on the hidden layer do not need to be adjusted repeatedly through iteration,
which can reduce the amount of calculation and shorten the training time. Therefore,
in order to make full use of the feature extraction ability of the optimized CNN, the
comprehensiveness of multi-layer features and the fast-training speed of the ELM, an
innovative classification model of HRSIs based on combining the optimized CNN and
ELM, namely IPCEHRIC is developed to improve the robustness and classification effect of
the model. The classification process of HRSIs is shown in Figure 4.
487
Electronics 2022, 11, 775
Figure 4. The innovative classification model of HRSIs.
The classification process of the IPCEHRIC is described as follows.
(1) Preprocess HRSIs
Some preprocessed methods, such as whitening processing, normalization processing,
gray transformation, image smoothing, interpolation method, and so on are used to elim-
inate irrelevant information in hyperspectral remote sensing images, restore useful real
information, enhance the detectability of relevant information, and simplify the data to the
greatest extent, including image denoising, enhancement, smoothing, and sharpening, so
as to improve the reliability of feature extraction, image matching, and so on.
(2) Optimize parameters of CNN
The CWLPSO with global optimization capability is employed to optimize and de-
termine the parameters of the CNN, including the number of filters, activation function,
learning rate, initial weight, and initial bias as particle dimension. The optimized parameter
values are obtained, and an optimized CNN model is constructed.
(3) Extract features
The optimized CNN is essentially a multi-layer perceptron, which is mainly character-
ized by its local connection and weight sharing mode. When the input data are images, the
alternated convolution layer and maximum pool layer by layer are used to automatically
complete the feature extraction.
(4) Construct feature matrix
The extracted local features are input into the full connection layer of the first layer
in order to form the global features. These images are taken from different feature ranges.
Then these extracted features are selected to construct a feature matrix in order to provide
feature matrix for the classifier.
(5) Establish ELM classifier
The feature matrix is taken as the input of the ELM, elmtrain( ) function and training
sets are created to train the ELM. Then, the trained parameters and elmpredict( ) function
are used to test the test set, and finally the classification results are obtained.
6. Experiment Verification and Result Analysis
6.1. Experimental Environment and Parameter Setting
The experimental environment is Intel i7-11700 HQ_CPU_@ _ 2.5GHz, 16G RAM with
Windows 10, and the programming language is Matlab 2018b. The IPCEHRIC network
structure consists of two convolution layers, two pooling layers and an ELM classifier. The
nonlinear activation function of CNN is RELU function, and the ELM classifier uses Sigmoid
function. The initial parameters of CWLPSO are c1max = 2.0, c1min = 0.5, ωmax = 0.9, ⊗,
maximum number of iterations K = 200. The initial parameters of the CNN are the number
of convolution kernels (6), and the size of convolution kernels (1 * 3). The initial parameters
of the ELM are σ = 0.1, regularity coefficient C = 0.5.
488
Electronics 2022, 11, 775
6.2. Pavia University Data
6.2.1. Data Description
Pavia University data set is a hyperspectral remote sensing image data set collected
from the University of Pavia in northern Italy by using the airborne reflection optical
spectrum imager of Germany. The size of image is 610 × 340, including 42,776 pixels and
9 types of features through excluding a large number of backgrounds. Basic information
of Pavia University data is shown in Table 1. A total of 20% of the samples are randomly
selected as the training set and 80% of the samples are used as the test set. The number of
samples for training and test is shown in Table 2, and the describing of the HRSIs is shown
in Figure 5.
Table 1. Basic information of Pavia University data.
Data Pavia University
Collection location Northern Italy
Acquisition equipment ROSIS
Spectral coverage (μm) 0.43–0.86
Data size (pixel) 610 × 340
Spatial resolution (m) 1.3
Number of bands 115
Number of bands after denoising 103
Sample size 42,776
Number of categories 9
Table 2. The number of samples in Pavia University.
Types Class Training Samples Test Samples Samples
1 Asphalt 1326 5305 6631
2 Meadows 3722 14,927 18,649
3 Gravel 418 1681 2099
4 Trees 612 2452 3064
5 Painted metal sheets 268 1077 1345
6 Bare Soil 1004 4025 5029
7 Bitumen 266 1064 1330
8 Self-Blocking Bricks 736 2946 3682
9 Shadows 188 759 947
Total 8540 34,236 42,776
Figure 5. The HRSIs of Pavia University. (a) False color composite of HRSI. (b) Surface observations.
489
Electronics 2022, 11, 775
6.2.2. Experimental Results and Analysis
To verify the effectiveness of the IPCEHRIC, the CNN, local binary pattern (LBP) and
CNN (LBP-CNN), CNN and ELM (CNN-ELM), LBP, CNN and ELM (LBP-CNN-ELM), LBP,
PCA, CNN and ELM (LBP-PCA-CNN-ELM) are selected in here. The experiment results
of the Pavia university data are shown in Table 3. The overall accuracy (OA), average
accuracy (AA), and standard deviation (STD) of classification results are calculated for each
algorithm.
Table 3. The experiment results of the Pavia University data (%).
Types Class CNN LBP-CNN CNN-ELM LBP-CNN-ELM LBP-PCA-CNN-ELM IPCEHRIC
1 Asphalt 90.00 89.64 94.72 95.72 99.92 99.96
2 Meadows 89.99 89.79 93.00 95.00 99.12 99.67
3 Gravel 89.70 91.63 99.94 99.94 100.00 100.00
4 Trees 88.90 87.10 89.15 94.17 96.88 99.84
5 Painted metal sheets 86.00 89.91 92.26 96.68 99.72 100.00
6 Bare Soil 88.15 89.90 95.00 96.27 100.00 100.00
7 Bitumen 90.45 92.00 94.15 96.15 99.15 99.82
8 Self-Blocking Bricks 89.83 91.86 93.25 95.01 99.66 100.00
9 Shadows 87.50 93.87 90.90 97.74 97.94 99.15
OA (%) 85.67 88.75 92.63 95.64 98.95 99.21
AA (%) 88.95 90.63 93.60 96.30 99.15 99.83
STD 1.467 1.939 3.022 1.722 1.075 0.279
It can be seen from Table 3 that the IPCEHRIC method obtains the classification
accuracies of OA and AA are 99.21 and 99.83%, which are best classification results among
the CNN, LBP-CNN, CNN-ELM, LBP-CNN-ELM, LBP-PCA-CNN-ELM, and IPCEHRIC
methods. The STD of the IPCEHRIC is 0.279, which is also the least STD among these
methods. Among other comparison methods, the LBP-PCA-CNN-ELM method obtains the
classification accuracies of OA and AA as 98.95 and 99.15%. While the CNN-ELM method
obtains the classification accuracies for OA and AA of 92.63 and 93.60%. Compared with
the CNN-ELM, the classification accuracies of OA and AA of the IPCEHRIC are improved
by 6.58 and 6.23% than those of the CNN-ELM. This shows that the feature extraction
ability of the optimized CNN is better than that of the CNN, which explains the global
optimization ability of the CWLPSO algorithm. Therefore, the classification performance
of the IPCEHRIC method is significantly better than those of the CNN, LBP-CNN, CNN-
ELM, LBP-CNN-ELM, and LBP-PCA-CNN-ELM. The experiment results show that the
IPCEHRIC method has higher classification accuracy than other comparison methods. The
IPCEHRIC is an effective classification method for HRSIs.
6.3. Actual HRSI after Jiuzhaigou M7.0 Earthquake
6.3.1. Description of HRSI after Jiuzhaigou 7.0 Earthquake
Jiuzhaigou is located in Zhangzha Town, Jiuzhaigou County, Sichuan Province. It is
located in the transition zone. It is more than 400 km away from Chengdu. It is a mountain
valley with a depth of more than 50 km, with a total area of 64,297 hm2 and a forest coverage
rate of more than 80%. The hyperspectral remote sensing image after Jiuzhaigou M7.0
earthquake on 8 August 2017 is shown in Figure 6.
The HRSI after Jiuzhaigou M7.0 earthquake is saved as *. mat file, which determined
the coordinates of different areas by manual frame drawing. Then a matrix consistent
with the size of the picture is constructed. The corresponding positions of the matrix with
different numbers is marked according to the coordinates of different areas, so as to mark
different labels on different areas of the picture, save and generate *.mat file with labels. A
data set containing four types of samples is made, which include villages, water, grassland,
and trees in the HRSIs after Jiuzhaigou M7.0 earthquake. The number of samples and four
types are shown in Table 4.
490
Electronics 2022, 11, 775
Figure 6. The HRSI after Jiuzhaigou M7.0 earthquake.
Table 4. The number of samples and four types.
Types Class Samples
1 Villages 12,575
2 Water 14,953
3 Grassland 38,790
4 Trees 39,159
Total 105,477
According to the gray value of pixels, the color function is used to set the threshold.
The different areas of HRSIs after Jiuzhaigou M7.0 earthquake are marked by different
colors. A matrix consistent with the image size is constructed, and the different areas are
marked with color. A data set with six types of samples is made, which include the villages,
bareland, grassland, trees, water, and rocks in the HRSIs after Jiuzhaigou M7.0 earthquake.
The number of samples and six types are shown in Table 5.
Table 5. The number of samples and six types.
Types Class Samples
1 Villages 1608
2 Bareland 25
3 Grassland 376,651
4 Trees 110,409
5 Water 5558
6 Rocks 2469
Total 495,087
6.3.2. Experimental Results and Analysis
To prove the ability of the IPCEHRIC to solve practical engineering problems, the
hyperspectral remote sensing images after Jiuzhaigou M7.0 earthquake is used for the
experimental comparison and analysis. Similarly, the CNN, LBP-CNN, CNN-ELM, LBP-
CNN-ELM, and LBP-PCA-CNN-ELM are selected to compare in here. Each algorithm is
executed ten times independently. The classification results of HRSI after Jiuzhaigou 7.0
491
Electronics 2022, 11, 775
earthquake for four types are shown in Tables 6 and 7. The classification results of HRSI
after Jiuzhaigou M7.0 earthquake for six types are shown in Tables 8 and 9.
Table 6. The classification results of HRSIs for 10 times for four types (%).
Times CNN LBP-CNN CNN-ELM LBP-CNN-ELM LBP-PCA-CNN-ELM IPCEHRIC
1 41.47 36.68 69.80 64.38 65.67 89.76
2 41.80 36.68 75.84 64.25 65.16 88.96
3 41.75 36.68 75.98 64.16 65.33 89.99
4 41.73 36.68 75.38 64.40 65.14 89.26
5 41.85 37.02 61.45 64.47 65.47 89.76
6 41.70 37.02 75.80 64.12 65.56 90.58
7 41.86 37.02 74.04 63.83 65.40 91.64
8 41.77 37.02 60.02 64.44 65.19 92.12
9 41.78 36.68 74.80 64.38 65.49 90.99
10 41.76 37.02 75.46 64.10 65.81 89.94
AA (%) 41.75 36.85 71.86 64.25 65.42 90.30
STD 0.109 0.179 6.145 0.201 0.223 1.019
Table 7. The classification results of HRSIs for four types (%).
Types Class CNN LBP-CNN CNN-ELM LBP-CNN-ELM LBP-PCA-CNN-ELM IPCEHRIC
1 Villages 50.47 46.76 79.16 74.64 75.70 92.46
2 Water 41.80 35.43 78.37 70.47 73.28 90.73
3 Grassland 39.26 33.58 73.78 63.19 72.45 89.15
4 Trees 40.73 36.29 76.12 69.24 75.42 91.48
OA (%) 41.75 36.85 71.86 64.25 65.42 90.30
AA (%) 43.07 38.02 76.86 69.39 74.21 90.96
STD 5.046 5.939 2.422 4.733 1.597 1.396
Table 8. The classification results of HRSIs for 10 times for six types (%).
Times CNN LBP-CNN CNN-ELM LBP-CNN-ELM LBP-PCA-CNN-ELM IPCEHRIC
1 79.77 79.83 99.21 85.12 85.12 99.99
2 79.78 79.85 99.78 84.80 84.14 100.0
3 79.84 79.84 99.99 84.14 84.01 99.98
4 79.78 79.86 99.26 84.80 84.22 99.78
5 79.86 79.84 99.99 85.12 85.46 100.0
6 79.87 79.81 99.21 84.76 86.13 99.77
7 79.88 79.59 99.98 85.46 84.57 100.0
8 79.87 79.59 99.27 86.08 85.12 99.98
9 79.86 79.80 99.98 85.46 86.02 100.0
10 79.86 79.84 99.77 86.43 84.80 99.99
AA (%) 79.84 79.79 99.64 85.22 84.96 99.95
STD 0.043 0.104 0.360 0.672 0.753 0.092
Table 9. The classification results of HRSIs for six types (%).
Types Class CNN LBP-CNN CNN-ELM LBP-CNN-ELM LBP-PCA-CNN-ELM IPCEHRIC
1 Villages 82.34 85.46 99.46 87.45 90.35 99.98
2 Bareland 86.05 86.04 99.64 89.62 93.46 100.0
3 Grassland 79.98 85.32 99.06 87.17 90.67 100.0
4 Trees 78.46 84.14 99.31 86.43 89.86 99.81
5 Water 83.49 87.25 99.78 87.69 90.34 100.0
6 Rocks 82.16 85.68 99.34 88.03 92.05 99.85
OA (%) 79.84 79.79 99.64 85.22 84.96 99.95
AA (%) 82.08 85.65 99.43 87.73 91.12 99.94
STD 2.658 1.013 0.256 1.072 1.367 0.086
As can be seen from Tables 6–9 that the IPCEHRIC obtains the classification accuracies
of AA are 90.30% for four types and 99.95% for six types, respectively, which are best
classification results among the CNN, LBP-CNN, CNN-ELM, LBP-CNN-ELM, LBP-PCA-
CNN-ELM, and IPCEHRIC methods. The STD of the IPCEHRIC is 1.396 for four types
and 0.086 for six types, which are also the least STD among these methods. Among other
comparison methods, for four types of the samples, the overall classification effect of these
methods is not ideal. Especially, the classification accuracies of the CNN and LBP-CNN are
very unsatisfactory. For six types of the samples, the overall classification effect of these
methods is better. Especially, the classification accuracies of the CNN-ELM are ideal among
CNN, LBP-CNN, CNN-ELM, LBP-CNN-ELM, and LBP-PCA-CNN-ELM. Compared with
the CNN-ELM, the classification accuracy of AA of the IPCEHRIC method are improved by
18.44 and 0.31%, which indicate that the optimized CNN has better feature extraction ability
492
Electronics 2022, 11, 775
and classification performance, and the CWLPSO has better global optimization ability.
Therefore, the experiment results show that the classification accuracy of the IPCEHRIC is
better than that of other comparison methods. The CWLPSO can optimize and determine
the parameters of the CNN in order to construct an optimized CNN model, which can
effectively extract the deep features of HRSIs after Jiuzhaigou 7.0 earthquake, so as to
obtain a better classification result. It can effectively classify the HRSIs after Jiuzhaigou
7.0 earthquake to obtain the villages, bareland, grassland, trees, water, and rocks in HRSIs
after Jiuzhaigou 7.0 earthquake.
The HRSIs after Jiuzhaigou 7.0 earthquake are divided into four types and six types.
The classification effects of HRSIs are shown in Figure 7.
Figure 7. The classification effects of HRSIs after Jiuzhaigou M7.0 earthquake. (a) Four types. (b) Six types.
As can be seen from Figure 7, the classification effects of six types by using the
IPCEHRIC for the HRSIs after Jiuzhaigou M7.0 earthquake is ideal. For actual HRSIs, the
IPCEHRIC method has higher classification accuracy, and it is an effective classification
method for actual HRSIs.
7. Conclusions
In this paper, an innovative hyperspectral remote sensing image classification method
based on combining CWLPSO, CNN, and ELM, namely IPCEHRIC is proposed to obtain
the accurate classification results. The CWLPSO with fusing multi-strategy is proposed
to optimize the parameters of the CNN. Then the deep features are extracted from HRSIs,
which are input into the ELM to realize the accurate classification of HRSIs. Pavia University
data and actual HRSIs after Jiuzhaigou 7.0 earthquake are selected to verify the effectiveness
of the IPCEHRIC. The experiment results show that the IPCEHRIC obtains the classification
accuracies of 99.21% for Pavia University data, 90.30 and 99.95% for actual HRSIs after
Jiuzhaigou 7.0 earthquake. The classification results of the IPCEHRIC are better than those
of the CNN, LBP-CNN, CNN-ELM, LBP-CNN-ELM, and LBP-PCA-CNN-ELM methods.
Compared with the CNN-ELM, the classification accuracies of the IPCEHRIC are improved
by 6.58, 21.44, and 0.31%, respectively. This shows that the CWLPSO algorithm can
effectively optimize the parameters and obtain reasonable parameter values for CNN to
improve the feature extraction ability. Therefore, the IPCEHRIC has certain advantages on
classification effect of the HRSIs. Especially, the IPCEHRIC can obtain accurate classification
accuracy for actual HRSIs after Jiuzhaigou M7.0 earthquake. It can effectively classify the
villages, bareland, grassland, trees, water, and rocks in the HRSIs after Jiuzhaigou M7.0
earthquake and achieve good classification result.
Author Contributions: Conceptualization, A.Y. and X.Z.; Methodology, A.Y.; Software, X.Z.; Valida-
tion, F.M. and X.Z.; Resources, F.M.; Writing—original draft preparation, A.Y.; Writing—review and
editing, X.Z.; Visualization, X.Z.; Project administration, F.M.; Funding acquisition, X.Z. All authors
have read and agreed to the published version of the manuscript.
493
Electronics 2022, 11, 775
Funding: This research was funded by the Sichuan Science and Technology Program, grant number
2019ZYZF0169, 2019YFG0307, 2021YFS0407; the A Ba Achievements Transformation Program, grant
number R21CGZH0001; the Chengdu Science and technology planning project, grant number 2021-
YF05-00933-SN.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: Not applicable.
Acknowledgments: The authors would like to acknowledge the UCI Machine Learning Repository.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Dumke, I.; Ludvigsen, M.; Ellefmo, S.L. Underwater hyperspectral imaging using a stationary platform in the Trans-Atlantic
Geotraverse hydrothermal field. IEEE Trans. Geosci. Remote Sens. 2019, 57, 2947–2962. [CrossRef]
2. Chen, H.; Miao, F.; Chen, Y.; Xiong, Y.; Chen, T. A hyperspectral image classification method using multifeature vectors and
optimized KELM. IEEE J. Sel. Top. Appl. Earth Observ. Remote Sens. 2021, 14, 2781–2795. [CrossRef]
3. Ma, K.Y.; Chang, C.I. Iterative training sampling coupled with active learning for semisupervised spectral–spatial hyperspectral
image classification. IEEE Trans. Geosci. Remote Sens. 2021, 59, 8672–8692. [CrossRef]
4. Chen, Y.; Xiao, Z.; Chen, G. Detection of oasis soil composition and analysis of environmental parameters based on hyperspectral
image and GIS. Arab. J. Geosci. 2021, 14, 1050. [CrossRef]
5. Shimoni, M.; Haelterman, R.; Perneel, C. Hypersectral imaging for military and security applications: Combining myriad
processing and sensing techniques. IEEE Geosci. Remote Sens. Mag. 2019, 7, 101–117. [CrossRef]
6. Luo, X.; Shen, Z.; Xue, R. Unsupervised band selection method based on importance-assisted column subset selection. IEEE
Access 2018, 7, 517–527. [CrossRef]
7. Chang, C.I.; Kuo, Y.M.; Chen, S. Self-mutual information-based band selection for hyperspectral image classification. IEEE Trans.
Geosci. Remote Sens. 2021, 59, 5979–5997. [CrossRef]
8. Lin, Z.; Yan, L. A support vector machine classifier based on a new kernel function model for hyperspectral data. Mapp. Sci.
Remote Sens. 2015, 53, 85–101. [CrossRef]
9. Kang, X.; Xiang, X.; Li, S. PCA-based edge-preserving features for hyperspectral image classification. IEEE Trans. Geosci. Remote
Sens. 2017, 55, 7140–7151. [CrossRef]
10. Yuan, H.; Tang, Y.Y.; Lu, Y. Spectral-spatial classification of hyperspectral image based on discriminant analysis. IEEE J. Sel. Top.
Appl. Earth Observ. Remote Sens. 2014, 7, 2035–2043. [CrossRef]
11. Tran, T.V.; Julian, J.P.; Beurs, K.M. Land cover heterogeneity effects on sub-pixel and per-pixel classifications. ISPRS Int. J. Geo-Inf.
2014, 3, 540–553. [CrossRef]
12. Khodadadzadeh, M.; Li, J.; Plaza, A.; Ghassemian, H.; Bioucas-Dias, J.M.; Li, X. Spectral-spatial classification of hyperspectral
data using local and global probabilities for mixed pixel characterization. IEEE Trans. Geosci. Remote Sens. 2014, 52, 6298–6314.
[CrossRef]
13. Li, S.T.; Lu, T.; Fang, L.Y.; Jia, X.P.; Benediktsson, J.A. Probabilistic fusion of pixel-level and superpixel-level hyperspectral image
classification. IEEE Trans. Geosci. Remote Sens. 2016, 54, 7416–7430. [CrossRef]
14. Li, W.; Wu, G.D.; Zhang, F.; Du, Q.; Hyperspectral, A. Image classification using deep pixel-pair features. IEEE Trans. Geosci.
Remote Sens. 2017, 55, 844–853. [CrossRef]
15. Mei, J.; Wang, Y.B.; Zhang, L.Q.; Zhang, B.; Liu, S.H.; Zhu, P.P.; Ren, Y.C. PSASL: Pixel-level and superpixel-level aware subspace
learning for hyperspectral image classification. IEEE Trans. Geosci. Remote Sens. 2019, 57, 4278–4293. [CrossRef]
16. Pan, Z.B.; Wu, X.Q.; Li, Z.Y. Central pixel selection strategy based on local gray-value distribution by using gradient information
to enhance LBP for texture classification. Expert Syst. Appl. 2019, 120, 319–334. [CrossRef]
17. Bey, A.; Jetimane, J.; Lisboa, S.N.; Ribeiro, N.; Sitoe, A.; Meyfroidt, P. Mapping smallholder and large-scale cropland dynamics
with a flexible classification system and pixel-based composites in an emerging frontier of Mozambique. Remote Sens. Environ.
2020, 239, 111611. [CrossRef]
18. Yan, L.; Fan, B.; Liu, H.M.; Huo, C.L.; Xiang, S.M.; Pan, C.H. Triplet adversarial domain adaptation for pixel-level classification of
VHR remote sensing images. IEEE Trans. Geosci. Remote Sens. 2020, 58, 3558–3573. [CrossRef]
19. Li, Y.; Lu, T.; Li, S.T. Subpixel-pixel-superpixel-based multiview active learning for hyperspectral images classification. IEEE
Trans. Geosci. Remote Sens. 2020, 58, 4976–4988. [CrossRef]
20. Ma, K.Y.; Chang, C.I. Kernel-based constrained energy minimization for hyperspectral mixed pixel classification. IEEE Trans.
Geosci. Remote Sens. 2021, 60, 5510723. [CrossRef]
21. Chen, Y.; Lin, Z.; Zhao, X. Deep learning-based classification of hyperspectral data. IEEE J. Sel. Top. Appl. Earth Observ. Remote
Sens. 2014, 7, 2094–2107. [CrossRef]
494
Electronics 2022, 11, 775
22. Liu, L.; Wang, Y.; Peng, J. Latent relationship guided stacked sparse autoencoder for hyperspectral imagery classification. IEEE
Trans. Geosci. Remote Sens. 2020, 58, 3711–3725. [CrossRef]
23. Romero, A.; Gatta, C.; Camps-Valls, G. Unsupervised deep feature extraction for remote sensing image classification. IEEE Trans.
Geosci. Remote Sens. 2016, 54, 1349–1362. [CrossRef]
24. Sharma, A.; Liu, X.W.; Yang, X.J.; Shi, D. A patch-based convolutional neural network for remote sensing image classification.
Neural Netw. 2017, 95, 19–28. [CrossRef] [PubMed]
25. Maggiori, E.; Tarabalka, Y.; Charpiat, G.; Alliez, P. Convolutional neural networks for large-scale remote-sensing image classifica-
tion. IEEE Trans. Geosci. Remote Sens. 2017, 55, 645–657. [CrossRef]
26. Wang, L.Z.; Zhang, J.B.; Liu, P.; Choo, K.K.; Huang, F. Spectral-spatial multi-feature-based deep learning for hyperspectral remote
sensing image classification. Appl. Soft Comput. 2017, 21, 213–221. [CrossRef]
27. Ji, S.P.; Zhang, C.; Xu, A.J.; Shi, Y.; Duan, Y.L. 3D convolutional neural networks for crop classification with multi-temporal remote
sensing images. Remote Sens. 2018, 10, 75. [CrossRef]
28. Ben, H.A.; Benoit, A.; Lambert, P.; Ben, A.C. 3-D deep learning approach for remote sensing image classification. IEEE Trans.
Geosci. Remote Sens. 2018, 56, 4420–4434.
29. Xu, S.H.; Mu, X.D.; Chai, D.; Zhang, X.M. Remote sensing image scene classification based on generative adversarial networks.
Remote Sens. Lett. 2018, 9, 617–626. [CrossRef]
30. Tao, Y.T.; Xu, M.Z.; Lu, Z.Y.; Zhong, Y.F. DenseNet-based depth-width double reinforced deep learning neural network for
high-resolution remote sensing image per-pixel classification. Remote Sens. 2018, 10, 779. [CrossRef]
31. Liang, P.; Shi, W.Z.; Zhang, X.K. Remote sensing image classification based on stacked denoising autoencoder. Remote Sens. 2018,
10, 16. [CrossRef]
32. Li, P.; Ren, P.; Zhang, X.Y.; Wang, Q.; Zhu, X.B.; Wang, L. Region-wise deep feature representation for remote sensing images.
Remote Sens. 2018, 10, 871. [CrossRef]
33. Li, G.; Li, L.L.; Zhu, H.; Liu, X.; Jiao, L.C. Adaptive multiscale deep fusion residual network for remote sensing image classification.
IEEE Trans. Geosci. Remote Sens. 2019, 57, 8506–8521. [CrossRef]
34. Yuan, Y.; Fang, J.; Lu, X.Q.; Feng, Y.C. Remote sensing image scene classification using rearranged local features. IEEE Trans.
Geosci. Remote Sens. 2019, 57, 1779–1792. [CrossRef]
35. Zhang, C.J.; Li, G.D.; Du, S.H. Multi-scale dense networks for hyperspectral remote sensing image classification. IEEE Trans.
Geosci. Remote Sens. 2019, 57, 9201–9222. [CrossRef]
36. Zhang, C.J.; Li, G.D.; Lei, R.M.; Du, S.H.; Zhang, X.Y.; Zheng, H.; Wu, Z.F. Deep feature aggregation network for hyperspectral
remote sensing image classification. IEEE J. Sel. Top. Appl. Earth Observ. Remote Sens. 2020, 13, 5314–5325. [CrossRef]
37. Chen, C.; Ma, Y.; Ren, G.B. Hyperspectral classification using deep belief networks based on conjugate gradient update and
pixel-centric spectral block features. IEEE J. Sel. Top. Appl. Earth Observ. Remote Sens. 2020, 13, 4060–4069. [CrossRef]
38. Xiong, W.; Xiong, Z.Y.; Cui, Y.Q.; Lv, Y.F. Deep multi-feature fusion network for remote sensing images. Remote Sens. Lett. 2020,
11, 563–571. [CrossRef]
39. Tong, W.; Chen, W.T.; Han, W.; Li, X.J.; Wang, L.Z. Channel-attention-based densenet network for remote sensing image scene
classification. IEEE J. Sel. Top. Appl. Earth Observ. Remote Sens. 2020, 13, 4121–4132. [CrossRef]
40. Zhu, H.; Ma, W.P.; Li, L.L.; Jiao, L.C.; Yang, S.Y.; Hou, B. A dual-branch attention fusion deep network for multiresolution
remote-sensing image classification. Inf. Fusion 2020, 58, 116–131. [CrossRef]
41. Raza, A.; Huo, H.; Sirajuddin, S.; Fang, T. Diverse capsules network combining multiconvolutional layers for remote sensing
image scene classification. IEEE J. Sel. Top. Appl. Earth Observ. Remote Sens. 2020, 13, 5297–5313. [CrossRef]
42. Li, J.T.; Shen, Y.L.; Yang, C. An adversarial generative network for crop classification from remote sensing timeseries images.
Remote Sens. 2021, 13, 65. [CrossRef]
43. Gu, S.W.; Zhang, R.; Luo, H.X.; Li, M.Y.; Feng, H.M.; Tang, X.G. Improved SinGAN integrated with an attentional mechanism for
remote sensing image classification. Remote Sens. 2021, 13, 1713. [CrossRef]
44. Guo, D.E.; Xia, Y.; Luo, X.B. Self-supervised GANs with similarity loss for remote sensing image scene classification. IEEE J. Sel.
Top. Appl. Earth Observ. Remote Sens. 2021, 14, 2508–2521. [CrossRef]
45. Li, Y.S.; Zhu, Z.H.; Yu, J.G.; Zhang, Y.J. Learning deep cross-modal embedding networks for zero-shot remote sensing image
scene classification. IEEE Trans. Geosci. Remote Sens. 2021, 59, 10590–10603. [CrossRef]
46. Lei, R.M.; Zhang, C.J.; Liu, W.C.; Zhang, L.; Zhang, X.Y.; Yang, Y.C.; Huang, J.W.; Li, Z.X.; Zhou, Z.Y. Hyperspectral remote
sensing image classification using deep convolutional capsule network. IEEE J. Sel. Top. Appl. Earth Observ. Remote Sens. 2021,
14, 8297–8315. [CrossRef]
47. Cui, X.P.; Zou, C.; Wang, Z.S. Remote sensing image recognition based on dual-channel deep learning network. Multimed. Tools
Appl. 2021, 80, 27683–27699. [CrossRef]
48. Peng, C.; Li, Y.Y.; Jiao, L.C.; Shang, R.H. Efficient convolutional neural architecture search for remote sensing image scene
classification. IEEE Trans. Geosci. Remote Sens. 2021, 59, 6092–6105. [CrossRef]
49. Guo, D.G.; Xia, Y.; Luo, X.B. GAN-based semisupervised scene classification of remote sensing image. IEEE Geosci. Remote Sens.
Lett. 2021, 18, 2067–2071. [CrossRef]
495
Electronics 2022, 11, 775
50. Dong, S.X.; Quan, Y.H.; Feng, W.; Dauphin, G.; Gao, L.R.; Xing, M.D. A pixel cluster CNN and spectral-spatial fusion algorithm
for hyperspectral image classification with small-size training samples. IEEE J. Sel. Top. Appl. Earth Observ. Remote Sens. 2021,
14, 4101–4114. [CrossRef]
51. Li, Y.S.; Zhang, Y.J.; Zhu, Z.H. Error-tolerant deep learning for remote sensing image scene classification. IEEE Trans. Cybern.
2021, 51, 1756–1768. [CrossRef] [PubMed]
52. Li, B.Y.; Guo, Y.L.; Yang, J.G.; Wang, L.G.; Wang, Y.Q.; An, W. Gated recurrent multiattention network for VHR remote sensing
image classification. IEEE Trans. Geosci. Remote Sens. 2021, 60, 5606113. [CrossRef]
53. Dong, R.M.; Zhang, L.X.; Fu, H.H. RRSGAN: Reference-based super-resolution for remote sensing image. IEEE Trans. Geosci.
Remote Sens. 2022, 60, 5601117. [CrossRef]
54. Wu, E.Q.; Zhou, M.; Hu, D.; Zhu, L.; Tang, Z.; Qiu, X.Y.; Deng, P.Y.; Zhu, L.M.; Ren, H. Self-paced dynamic infinite mixture model
for fatigue evaluation of pilots’ brains. IEEE Trans. Cybern. 2021. [CrossRef] [PubMed]
55. Karadal, C.H.; Kaya, M.C.; Tuncer, T.; Dogan, S.; Acharya, U.R. Automated classification of remote sensing images using
multileveled MobileNetV2 and DWT techniques. Expert Syst. Appl. 2021, 185, 115659. [CrossRef]
56. Ma, W.P.; Shen, J.C.; Zhu, H.; Zhang, J.; Zhao, J.L.; Hou, B.; Jiao, L.C. A novel adaptive hybrid fusion network for multiresolution
remote sensing images classification. IEEE Trans. Geosci. Remote Sens. 2022, 60, 5400617. [CrossRef]
57. Cai, W.W.; Wei, Z.G. Remote sensing image classification based on a cross-attention mechanism and graph convolution. IEEE
Geosci. Remote Sens. Lett. 2022, 19, 80002005. [CrossRef]
58. Zhang, Z.; Liu, S.H.; Zhang, Y.; Chen, W.B. RS-DARTS: A convolutional neural architecture search for remote sensing image scene
classification. Remote Sens. 2022, 14, 141. [CrossRef]
59. Hilal, A.M.; Al-Wesabi, F.N.; Alzahrani, K.J.; Al Duhayyim, M.; Hamza, M.A.; Rizwanullah, M.; Diaz, V.G. Deep transfer learning
based fusion model for environmental remote sensing image classification model. J. Remote Sens. 2022. [CrossRef]
60. Li, R.; Zheng, S.Y.; Duan, C.X.; Wang, L.B.; Zhang, C. Land cover classification from remote sensing images based on multi-scale
fully convolutional network. GEO Spat. Inf. Sci. 2022. [CrossRef]
61. Wei, Y.Y.; Zhou, Y.Q.; Luo, Q.F.; Deng, W. Optimal reactive power dispatch using an improved slime mould algorithm. Energy
Rep. 2021, 7, 8742–8759. [CrossRef]
62. Deng, W.; Zhang, X.; Zhou, Y.; Liu, Y.; Zhou, X.; Chen, H.; Zhao, H. An enhanced fast non-dominated solution sorting genetic
algorithm for multi-objective problems. Inf. Sci. 2022, 585, 441–453. [CrossRef]
63. Li, T.; Qian, Z.; Deng, W.; Zhang, D.; Lu, H.; Wang, S. Forecasting crude oil prices based on variational mode decomposition and
random sparse Bayesian learning. Appl. Soft Comput. 2021, 113, 108032. [CrossRef]
64. Deng, W.; Xu, J.; Zhao, H.; Song, Y. A novel gate resource allocation method using improved PSO-based QEA. IEEE Trans. Intell.
Transp. Syst. 2020. [CrossRef]
65. Cui, H.; Guan, Y.; Chen, H. Rolling element fault diagnosis based on VMD and sensitivity MCKD. IEEE Access 2021,
9, 120297–120308. [CrossRef]
66. Wang, X.; Wang, H.; Du, C.; Fan, X.; Cui, L.; Chen, H.; Deng, F.; Tong, Q.; He, M.; Yang, M.; et al. Custom-molded offloading
footwear effectively prevents recurrence and amputation, and lowers mortality rates in high-risk diabetic foot patients: A
multicenter, prospective observational study. Diabetes Metab. Syndr. Obes. 2022, 15, 103–109.
67. Deng, W.; Shang, S.; Cai, X.; Zhao, H.; Zhou, Y.; Chen, H.; Deng, W. Quantum differential evolution with cooperative coevolution
framework and hybrid mutation strategy for large scale optimization. Knowl. Based Syst. 2021, 224, 107080. [CrossRef]
68. Deng, W.; Xu, J.; Gao, X.; Zhao, H. An enhanced MSIQDE algorithm with novel multiple strategies for global optimization
problems. IEEE Trans. Syst. Man Cybern. Syst. 2020, 52, 1578–1587. [CrossRef]
69. Zhang, Z.H.; Min, F.; Chen, G.S.; Shen, S.P.; Wen, Z.C.; Zhou, X.B. Tri-partition state alphabet-based sequential pattern for
multivariate time series. Cogn. Comput. 2021. [CrossRef]
70. Ran, X.; Zhou, X.; Lei, M.; Tepsan, W.; Deng, W. A novel k-means clustering algorithm with a noise algorithm for capturing urban
hotspots. Appl. Sci. 2021, 11, 11202. [CrossRef]
71. Chen, H.; Zhang, Q.; Luo, J. An enhanced Bacterial Foraging Optimization and its application for training kernel extreme learning
machine. Appl. Soft Comput. 2020, 86, 105884. [CrossRef]
72. Cui, H.; Guan, Y.; Chen, H.; Deng, W. A novel advancing signal processing method based on coupled multi-stable stochastic
resonance for fault detection. Appl. Sci. 2021, 11, 5385. [CrossRef]
73. Kennedy, J.; Eberhart, R. Particle swarm optimization. IEEE Int. Conf. Neural Netw. Perth 1995, 4, 1942–1948.
496
electronics
Article
A Novel Color Image Encryption Algorithm Using Coupled
Map Lattice with Polymorphic Mapping
Penghe Huang 1 , Dongyan Li 1 , Yu Wang 2 , Huimin Zhao 3,4, * and Wu Deng 3, *
1 Software Technology Institute, Dalian Jiaotong University, Dalian 116028, China
2 School of Cyber Science and Engineering, Southeast University, Nanjing 211189, China
3 School of Electronic Information and Automation, Civil Aviation University of China, Tianjin 300300, China
4 Traction Power State Key Laboratory, Southwest Jiaotong University, Chengdu 610032, China
* Correspondence: [email protected] (H.Z.); [email protected] (W.D.)
Abstract: Some typical security algorithms such as SHA, MD4, MD5, etc. have been cracked in
recent years. However, these algorithms have some shortcomings. Therefore, the traditional one-
dimensional-mapping coupled lattice is improved by using the idea of polymorphism in this paper,
and a polymorphic mapping–coupled map lattice with information entropy is developed for en-
crypting color images. Firstly, we extend a diffusion matrix with the original 4 × 4 matrix into an
n × n matrix. Then, the Huffman idea is employed to propose a new pixel-level substitution method,
which is applied to replace the grey degree value. We employ the idea of polymorphism and select
f(x) in the spatiotemporal chaotic system. The pseudo-random sequence is more diversified and the
sequence is homogenized. Finally, three plaintext color images of 256 × 256 × 3, “Lena”, “Peppers”
and “Mandrill”, are selected in order to prove the effectiveness of the proposed algorithm. The
experimental results show that the proposed algorithm has a large key space, better sensitivity to
keys and plaintext images, and a better encryption effect.
Keywords: coupled map lattice; polymorphic mapping; color image; hash function; pixel level
Citation: Huang, P.; Li, D.; Wang, Y.;
Zhao, H.; Deng, W. A Novel Color
Image Encryption Algorithm Using
Coupled Map Lattice with 1. Introduction
Polymorphic Mapping. Electronics In recent years, with the popularity of computers, multimedia messages have been
2022, 11, 3436. https://doi.org/
transported through the network, causing more attention to be paid to information security.
10.3390/electronics11213436
The hash algorithm is a traditional method used to encrypt passwords. When a password is
Academic Editor: Stefanos Kollias created in clear text, it is run through a hash algorithm to produce the password text stored
in the file system. The U.S. standard of a hash function is SHA-1 (Secure Hash Algorithm 1)
Received: 13 September 2022
with 160 bits of output length [1]. It is difficult to be sure of the security of a hash function
Accepted: 20 October 2022
with 160 bits of output length, and it was cracked in 2017. Additionally, other hash
Published: 24 October 2022
algorithms such as MD5 (Message-Digest Algorithm 5), MD4, and RIPEMD (RACE Integrity
Publisher’s Note: MDPI stays neutral Primitives Evaluation Message Digest) have also been cracked [2]. Recently, encryption
with regard to jurisdictional claims in algorithms with higher security have become a research hotspot. Chaos encryption is a
published maps and institutional affil- relatively new encryption idea developed in recent years, and spatiotemporal chaos is the
iations. best among them. Chaos in nonlinear science refers to a deterministic but unpredictable
motion state [3–6]. Chaos has the characteristics of sensitivity to initial conditions, pseudo-
randomness, and ergodicity, which makes chaos closely related to cryptography. In recent
years, the security, complexity, and speed of image encryption algorithms based on chaos
Copyright: © 2022 by the authors.
theory have become a research hotspot [7–15]. In addition, some algorithms are also
Licensee MDPI, Basel, Switzerland.
This article is an open access article
proposed for image processing, image encryption, model optimization, function solutions,
distributed under the terms and
fault diagnosis, data security, etc. [16–28].
conditions of the Creative Commons The spatiotemporal chaos model derives from the classical natural fluid-mechanics
Attribution (CC BY) license (https:// model, and the spatiotemporal chaos model has many advantages. For example, the effect
creativecommons.org/licenses/by/ of the pseudo-random sequence generated by the coupled lattice is better than the low-
4.0/). dimensional chaotic model, and the coupled lattice’s iterative efficiency is better than that
Electronics 2022, 11, 3436. https://doi.org/10.3390/electronics11213436 https://www.mdpi.com/journal/electronics
497
Electronics 2022, 11, 3436
of the low-dimensional chaotic model. However, it is found in this study that the local
chaotic mapping in the previous method of coupled lattice mapping only chooses a kind
of chaotic mapping, and in order to avoid the periodic window and other problems, the
local chaotic mapping parameter range is also smaller. In 2004, a new encryption theory,
the idea of the Polymorphic Cipher (PMC), was proposed by Roelgen, and the sequence
cipher was able to generate a new dynamic [29]. Because polymorphic cryptography
belongs to the self-compiled class of encryption algorithms, when an attacker attacks the
system [30–32], the parameters produced by the attacker can be started from the compiler.
Because most self-compiled systems are composed of unidirectional functions and are
unreadable, they can be reassembled according to attack parameters and unidirectional
functions. They can resist differential attacks and brute force attacks. Therefore, based on
the idea of polymorphism proposed by Roelgen, this paper increases the local chaotic map
to 4, and achieves the goal of polymorphism. Experiments show that the polymorphic
coupled lattice map generates better pseudo-random sequences. The keystream generator
is the key to the sequence cipher.
On the other hand, there are two typical links in the chaotic cryptosystem, namely
scrambling and diffusion. The combination of scrambling and diffusion improves the secu-
rity of cryptosystems [30,32], but there are still some drawbacks, and some cryptosystems
that conform to this rule have been cracked. The main reason is that the chaotic dynamic
performance is not fully considered when designing the algorithm. Coupled mapping
lattice (CML)-based spatiotemporal chaotic systems are applied to chaotic cryptography to
overcome these shortcomings. Coupled lattices have better chaotic dynamics, including
more parameters, larger key spaces, and longer periods. Some encryption algorithms
based on coupled lattices are not related to plaintext images [33–35]. The output ciphertext
image relies only on the key, which has been shown to be insecure and not resistant to
chosen plaintext/ciphertext attacks [36]. In this paper, we use the idea of polymorphism
to improve the traditional one-dimensional-mapping coupled lattice, and construct a se-
lective chaotic map. It can make one-dimensional coupled map lattices produce various
pseudo-random sequences based on different chaotic maps. Additionally, the key space is
larger than the traditional one-dimensional coupled map lattices. Moreover, the uneven
distribution of chaotic sequences in one-dimensional coupled lattices is rearranged to
produce homogeneous sequences, and the encryption effect is better.
The experimental results and security analysis showed that the algorithm based
on the CML with polymorphic mapping can achieve the goal of polymorphism, im-
prove the traditional one-dimensional-mapping coupled lattice, and construct a selective
chaotic map.
The structure of this paper is as follows. In Section 2, we briefly discuss some basic
knowledge of polymorphic spatiotemporal chaotic systems and random ergodicity, includ-
ing extension of the T diffusion matrix, the polymorphic CML, and the replacement of
the pixel value. In Section 3, the algorithm proposed in this paper is described in detail,
including key generation, and the encryption and decryption processes of the algorithm.
Section 4 shows the experimental results. A detailed security analysis of the algorithm
is given in Section 5. Finally, the characteristics and shortcomings of the algorithm are
summarized.
2. Polymorphic Spatiotemporal Chaotic Systems and Random Ergodicity
2.1. Extension of T Diffusion Matrix
The reversible matrix T is only in a 4 × 4 format in Ref. [37], but the diffusion effect is
significant in matrix T. Therefore, this paper extends the matrix T to the N × N effect, and
the effect of the original matrix is the same. Furthermore, when the matrix T is extended to
a new reversible diffusion matrix, it maintains the reversible property and good diffusion
effect of the original matrix.
498
Electronics 2022, 11, 3436
Suppose P is the clear matrix, and the diffusion formula is
T × P = P . (1)
P is a plaintext matrix after diffusion.
The original matrix is
⎡ ⎤
n 1 1 1
⎢n + 1 1 2 2⎥
T=⎢ ⎣n + 2
⎥, (2)
1 2 3⎦
n+3 1 2 3
where n is an arbitrary value for the control variable.
After extension matrix T:
⎡ ⎤
n 1 1 1 ... 1
⎢n + 1 1 2 2 ... 2 ⎥
⎢ ⎥
⎢ ⎥
T = ⎢n + 2 1 2 3 ... 3 ⎥ (3)
⎢ . .. .. .. . . .. ⎥
⎣ .. . . . . . ⎦
n+i 1 2 3 ... i−1
where i (i > 3) is the size of the number of rows generated. n can take any value for the
control variable, which guarantees the invertibility of the matrix. To ensure the effectiveness
of the implementation, a format of 4 × 4 and above is recommended.
2.2. Polymorphic CML
Only one kind of chaotic mapping is selected in the one-dimensional coupled image
lattice; the result is very good, but the chaotic sequence is not uniform, and the number of
iterations needs to be abandoned. Moreover, if the parameter selection of the chaotic map
is not good, it will easily lead to the phenomenon of the periodic window. So, this paper
multiplies the pseudorandom sequence and the matrix T mentioned in the previous paper,
and diffuses a coupled image lattice to the uniform state because of the reversible property
of the matrix T. So, in this paper, we add four chaotic maps to the traditional chaotic map.
A coupled image lattice is a simple model that can describe the complex dynamics of
closed systems and is defined as Equation (4).
ε
xn+1 (i ) = (1 − ε) f ( xn ) + [ f ( xn (i + 1) + f ( xn (i − 1))], ε ∈ (0, 1) (4)
2
when i = 1, 2, ..., L, L represents the size of the lattice. In this paper, when the CML system
is used at the pixel level, it is set to 10; n represents the evolution time, ε ∈ (0, 1) is the
coupling coefficient, and the xn ( L) = xn (0) edge conditions are satisfied. ε and x0 (1) and
x0 (2) are used as keys. When f ( x ) is a chaotic map, the dynamical characteristics of the
system are also chaotic. In the course of the study, f ( x ) = 4x ( x − 1) and ε = 0.5, and
10 grids were selected and iterated 10,000 times. There was a phenomenon of two-level
differentiation. When different coefficients were selected, the histogram data showed
different degrees of two-level differentiation. As shown in Figure 1.
499
Electronics 2022, 11, 3436
ȱ
(a)ȱ (b)ȱ
Figure 1. Pseudorandom sequence distribution. (a) The original CML chaotic sequence is distributed.
(b) After the T matrix is completed, the CML chaotic sequence is distributed.
Chaotic maps are used to generate chaotic sequences, which are random sequences
generated by simple deterministic systems. Therefore, using the idea of polymorphism, let
f ( x ) choose between them to increase the diversity of random sequences and increase the
security of the algorithm. The chaotic map f ( x ) is defined as
f ( x ) = a0 [μxn (1 − xn )] + a1 [bxn − axn3 ] + a2 [ xn /α] + a3 [(1 − xn )/(1 − α)]mod1 (5)
The chaotic mappings and their corresponding parameter ranges are shown in Table 1.
In this paper, when designing f ( x ), we use a simple chaotic map to design 15 alter-
native mappings that can increase the change in the pseudo-random sequence. When
a0 a1 a2 a3 = 1111 represents all the chaotic maps, it is all selected and discarded as the state
of a0 a1 a2 a3 = 0000.
Table 1. Chaotic mappings and parameter ranges.
f(x) Parameter Range
xn+1 = μxn (1 − xn ) μ ∈ (0, 4), xn+1 ∈ [0, 1]
xn+1 = bxn − axn3 b ∈ [0, 3], xn ∈ [−c, c]
xn+1 = xn /α 0 ≤ xn ≤ 0.5, α ∈ (0, 1)
x n +1 = (1 − x n ) / (1 − α ) 0.5 ≤ xn ≤ 1, α ∈ (0, 1)
2.3. Use of the Probability Replacement of the Pixel Value
Suppose that for a plaintext image P of size M × N, M is the number of rows and N is
the number of columns. If we divide them evenly into n parts, calculate the frequency of
every pixel value in every small image and sort them, and then, use the generated pixel
values to replace the others, the pixel values can be replaced [38]. Additionally, because the
pixel value is 8 bit, the higher pixel values have more information than the originals. When
filling 0 to expand the digit, we need to fill 0 on the left side [39–41]. However, considering
the complexity of key management, we recommend n ≤ 16 as follows:
Step 1: Judge the parity property of the M × N image; if it is an odd number, i chooses
1; if it is even, i chooses 2; the number of part n should satisfy
M×N
n= , i ∈ {1, 2}. (6)
(2i )2 × (2i − 1)2
Step 2: Calculate the frequency of the pixel value in every plaintext image, and
construct a Huffman tree based on the frequency of the pixel value by using the Huffman
encoding rule.
Step 3: Because the obtained Huffman code does not satisfy 8 bits, it needs to be
extended. Because the information of high pixel values is more than that of low pixel
500
Electronics 2022, 11, 3436
values, it needs to fill in 0 on the left when the number 0 is extended, but not on the right
side. The effects are shown in Figures 2 and 3.
ȱ ȱ ȱ
(a)ȱ (b)ȱ (c)ȱ
Figure 2. RGB-channel image of Lena: (a) original plaintext, R-channel image; (b) original plaintext,
G-channel image; (c) plaintext, B-channel image.
ȱ ȱ ȱ
(a)ȱ (b)ȱ (c)ȱ
Figure 3. RGB-channel image after the replacement of Lena pixel value: (a) replacement, after
R-channel image; (b) replacement, G-channel image; (c) replacement, B-channel image.
3. Image Encryption Algorithm Based on CML with Polymorphic Mapping
3.1. Key Generation
The key parts of the cryptosystem include the control parameter ε of the CML system;
the initial values x0 (1) and x0 (2) ; the selected a0 a1 a2 a3 ; the initial parameters of the
chaotic mapping x0 , x1 ; the n, i; and the RSA 1024-bit keys in the diffusion matrix T.
3.2. Encryption Algorithm Process
For a plaintext image P of size M × N, the encryption process is as follows:
Step 1: Given the initial key, the SHA-256 algorithm is used to transform the sequence
into binary encoding. After the sequence Hash = [ h1 , h2 , h3 , . . . , h256 ], the first 8 bits is
selected, the first 4 bits are judged and the latter 4 bits are selected.
Step 2: According to the initial key, Hash = [ h1 , h2 , h3 , . . . , h256 ] is obtained,
H1 = [ h9 , h10 , h11 , h12 , h13 ] is selected to obtain the selection sequence of a0 a1 a2 a3 , and
the specific f ( x ) is selected.
Step 3: From the key H2 = [ h9 , h10 , h11 , h12 , h13 ], the sequence is transformed into the
CML’s initial parameter and coupling coefficient. i is any value and the coupling coefficient
is calculated by Equation (7).
ε = [( H × n × 10−2 )modi ]mod1 (7)
Step 4: The initial values generated by x0 (1) and x0 (2) are replaced by pixel values.
The formula is as follows.
501
Electronics 2022, 11, 3436
x0 (1) = [Haffman(i1 ) × 0.123]mod1
(8)
x0 (2) = [Haffman(i2 ) × 0.234]mod1
Step 5: Disposal. The scrambling processing is performed using the function sort(·). If
A is the vector to be sorted, [ B, index ] = sort( A), where B is the sorted vector A, and index
is the index of each item in B corresponding to vector A.
Step 6: The n,i of the diffusion matrix T is selected from the rule of probability
substitution.
Step 7: The two value sequences seqi are determined; the formula is as follows:
1, xi > 0.5
seqi = (9)
0, xi ≤ 0.5
Step 8: The bit-OR operation is performed at the end of this pixel level encryption process.
Figure 4 describes the process of the encryption algorithm.
Figure 4. Flowchart of the image encryption algorithm based on CML with polymorphic mapping.
3.3. Decryption Process of Algorithm
The Huffman code used in the encryption process is irreversible. In the process of
encryption, the probability of each pixel value in the image is completely destroyed. So, in
the process of decryption, the Huffman code is processed separately. This paper uses the
traditional RSA scheme to deal with the problem. The other steps are the inverse of the
encryption process [42,43].
4. Experimental Results
Here, we choose three plaintext color images of 256 × 256 × 3, “Lena”, “Peppers”
and “Mandrill”, to simulate the algorithm in this paper. We choose the initial key (hash,
diffusion matrix) to verify the effect, and the selected matrix size is 8 × 8 sequences, where
n = 2; the local parameters are related to the initial key. The experimental results are the
same as the expected experimental results. All three plaintext images of 256 × 256 × 3
can be encrypted, and intuitively, no clear plaintext information appears in the image.
Figures 5–7 are the simulation results.
502
Electronics 2022, 11, 3436
ȱ ȱ ȱ
(a)ȱ (b)ȱ (c)ȱ
Figure 5. Lena encryption process. (a) Original image Lena; (b) encrypted image Lena; (c) decrypted
image Lena.
ȱ ȱ ȱ
(a)ȱ (b)ȱ (c)ȱ
Figure 6. Mandrill encryption process. (a) Original image Mandrill; (b) encrypted image Mandrill;
(c) decrypted image Mandrill.
ȱ ȱ ȱ
(a)ȱ (b)ȱ (c)ȱ
Figure 7. Peppers encryption process. (a) Original image Peppers; (b) encrypted image Peppers; (c)
decrypted image Peppers.
5. Security Analysis
In this section, we will conduct a theoretical analysis and numerical simulations of
a violent attack, statistical attack, differential attack, chosen plaintext attack, etc., and
compare the results with Refs. [31,32,44].
5.1. Key-Space Analysis
A large enough key space can resist violent attacks and improve the security of
encryption algorithms. The key space includes all keys used in the scrambling and diffusion
processes. Valid keys for this algorithm are as follows:
The initial key is:
Hash = [5312 f b609 f 60384731 f c f cb95dee f 3602239b f 61 f 865a07bd8e08d818d22e9 f a].
Since the initial key used in this paper is generated by the hash function of the
SHA-256 algorithm, there are a total of 256 bits, and there are 256 cases of probability
replacement of the pixel values in this paper, as well as the n, i part of the diffusion
503
Electronics 2022, 11, 3436
matrix T and the public key, plus the secret 1024 bits in the RSA algorithm. So, if the
computing precision of the computer is 10−14 , the algorithm key space designed in this
paper is 2256 × 256 × 4 × 210 ≈ 2276 , far greater than that of the password system; thus, this
algorithm can resist the a violent attack.
5.2. Statistical Analysis
Image histogram analysis and adjacent-pixel correlation are two very important statis-
tical properties of image encryption algorithms, and can reflect the algorithm’s ability to
resist statistical attacks.
5.2.1. Histogram Analysis
Figures 8 and 9 give the histograms of the RGB channels of the plaintext and ciphertext
images of “Lena”. Comparing their histograms, it can be found that the histogram distribu-
tion of encrypted plaintext images is more uniform than before encryption. Therefore, an
image encrypted by this algorithm makes a statistical analysis attack difficult.
ȱ ȱ ȱ
(a)ȱ (b)ȱ (c)ȱ
Figure 8. RGB histogram of Lena. (a) Lena R-channel pixel histogram; (b) Lena G-channel pixel
histogram; (c) Lena B-channel pixel histogram.
ȱ ȱ ȱ
(a)ȱ (b)ȱ (c)ȱ
Figure 9. RGB histogram of Lena after encryption. (a) encrypted, Lena’s R-channel pixel histogram;
(b) encrypted, G-channel pixel histogram; (c) encrypted, B-channel pixel histogram.
504
Electronics 2022, 11, 3436
5.2.2. Adjacent Pixel Correlation
To resist statistical attacks, the correlation between adjacent pixels must be effectively
reduced [31,32,44]. Using Equation (10) to calculate the correlation between the adjacent
pixels of the plaintext and the ciphertext images, we randomly select 10,000 pairs of pixels
in the plaintext and the ciphertext images of the “Lena” R channel, as shown in Figure 10.
The correlations between the adjacent pixels of the horizontal, vertical, and diagonal lines
of these pixels are also tested, as shown in Table 2.
cov( x, y)
r xy = % % (10)
D(x) D (y)
when,
1 N 1 N 1 N
cov( x, y) = ∑
N i =1
( xi − E( x ))(yi − E(y)), D ( x ) = ∑ ( xi − E( x ))2 , E( x ) = ∑ xi .
N i =1 N i =1
(11)
Table 2. Correlation between adjacent pixels of plaintext and ciphertext images.
Plaintext Ciphertext
Lena
R G B R G B
Horizontal 0.988 0.983 0.955 0.002 0.009 0.001
Vertical 0.974 0.951 0.935 0.032 −0.002 0.052
Diagonal 0.974 0.950 0.921 0.002 0.019 0.025
ȱ ȱ
(a)ȱ (b)ȱ
ȱ ȱ
(c)ȱ (d)ȱ
Figure 10. Cont.
505
Electronics 2022, 11, 3436
ȱ
(e)ȱ (f)ȱ
Figure 10. The level of adjacent-pixel correlation. (a) Lena plaintext; (b) Lena ciphertext horizontal
correlation; (c) Lena plaintext vertical correlation; (d) Lena clear text vertical correlation; (e) Lena
plaintext diagonal correlation; (f) Lena plaintext diagonal correlation.
5.2.3. Information Entropy
Entropy is an index used to measure uncertainty [31,32,44], that is, the probability of
discrete random events. The more chaotic the system is, the higher the information entropy,
and vice versa. The value can be calculated by Equation (12).
2 L −1
1
H (s) = ∑ p(si ) log2
p ( si )
(12)
i =0
Here p(si ) is the probability that si occurs. The information entropy of the encrypted
ciphertext image should be closer to 8. The results in Table 3 show that the encrypted infor-
mation of the ciphertext image is not easy to leak, and it can better resist statistical attacks.
Table 3. Information entropy of clear and ciphertext images.
Information Entropy of Information Entropy of
Lena Plaintext Image Ciphertext Image
R G B R G B
Our paper 7.253 7.594 6.688 7.990 7.925 7.904
Ref. [31] - - - 7.883 7.875 7.570
Ref. [32] - - - 7.880 7.854 7.953
Ref. [44] - - - 7.950 7.968 7.882
5.2.4. Resistance to Differential Attacks
A differential attack analyzes the data of the image based on the ciphertext before
modification and after modification, and obtains the key by making small changes to
the text. Here, the number-of-pixels change rate (NPCR) and the unified mean change
intensity (UACI) are calculated [31,45]. The larger the value of NPCR, the more sensitive
the encryption algorithm is to changes in the original plaintext. The larger the UACI value,
the greater of the average change intensity. The number-of-pixels change rate is calculated
as follows:
∑i,j D (i, j)
NPCR = × 100 (13)
W×H
1 |c1 (i, j) − c2 (i, j)|
W×H ∑
U ACI = [ ] × 100 (14)
i,j
255
506
Electronics 2022, 11, 3436
where W and H denote the width and height of the image, respectively. Additionally, c1
and c2 denote two ciphertext images after the original plaintext is changed by one pixel. If
c1 (i, j) = c2 (i, j), then D (i, j) = 1; otherwise, D (i, j) = 0. The experimental results in Table 4
show that, in general, NPCR is close to 99.6049% and UACI is close to 33.4635% [32,46].
The results show the advantages of the algorithm in resisting differential attacks.
Table 4. NPCR and UACI values for ciphertext images.
NPCR/% UACI/%
Lena
R G B R G B
Ref. [31] 41.96 41.96 41.96 33.25 33.25 33.25
Ref. [32] 86.68 86.68 86.68 32.51 32.43 32.43
Ref. [44] 94.68 95.68 98.68 33.46 34.50 35.49
Our paper 98.44 98.42 98.44 33.38 33.28 33.38
5.2.5. Robustness Analysis
We use a noise attack and block attack to test the robustness of the algorithm [32,44].
Compared with other common noise types, salt-and-pepper noise has a greater direct
impact on the ciphertext image. Therefore, this experiment considers the effect on the
plaintext image after adding salt-and-pepper noise to the algorithm. We add different
strengths of salt-and-pepper noise to the plaintext and use the same key for encryption and
decryption. Figure 11 shows the encrypted image with three noise values of 0.02, 0.12, and
0.2, respectively.
ȱ ȱ
(a)ȱ (b)ȱ
ȱ ȱ
(c)ȱ (d)ȱ
ȱ ȱ
(e)ȱ (f)ȱ
Figure 11. Noise experiment adding noise intensity of (a) 0.02, (b) 0.12, and (c) 0.2 after the encrypted
image, and (d–f) is their corresponding decryption image.
507
Electronics 2022, 11, 3436
5.2.6. Sensitivity Analysis
The main part of this article contains the initial key part, the n, i parameter in the matrix
T, and the cryptographic part of the RSA algorithm. The RSA algorithm is a traditional
encryption method, so it has not been tested in sensitivity tests. This paper only changed
the initial key
Hash = [5312 f b609 f 60384731 f c f cb95dee f 3602239b f 61 f 865a07bd8e08d818d22e9 f b],
and the n,i parameters in the matrix T, and the n,i of the replacement of the pixel values
under the premise that the RSA was not cracked. The experimental results in Figure 12
show that the encryption scheme of the CML color image based on the polymorphism
principle designed in this paper has good sensitivity to keys.
ȱ ȱ
(a)ȱ (b)ȱ
ȱ ȱ
(c)ȱ (d)ȱ
Figure 12. Sensitivity experiment. (a) Changes the hash value; (b) changes the n of the T matrix and
decrypts the image of the n,i; (c) changes the decryption image of the Huffman replacement rule; and
(d) the correct key decryption.
5.2.7. Complexity Analysis
The time-consuming nature of the calculation of floating-point data in an encryption
algorithm was considered in this section. In generating the chaotic sequence using the
CML system, Θ( L × M × N ) iterations of floating-point data were performed. When using
the T matrix to perform the diffusion of pixel values, the corresponding computational
complexity was Θ(n × M × N ) operations of floating-point data. It is less efficient when
using Matlab R2016b to calculate and select CML sequences, but it can still meet the needs
of real cryptosystems. This article mainly considers the security of the image encryption
algorithm, so this does not violate the original intention of this article.
The running environment of this algorithm is 8.00 GB RAM, Intel(R) Core(TM) Intel(R)
Xeon(R) CPU at 2.67 GHz, the operating system is Windows 8, and the simulation software
is Matlab R2016b. We know that Matlab is an excellent piece of simulation software, but its
efficiency is low; the algorithm’s running speed and programming language, CPU, memory
size, operating system, etc. have certain purposes. It is less efficient when using Matlab to
calculate and select CML sequences, but it can still meet the needs of real cryptosystems.
The purpose of this article is to propose a more secure image encryption algorithm, so this
is not contrary to the original intention of this article.
508
Electronics 2022, 11, 3436
6. Conclusions
A new polymorphic coupled map lattice based on information entropy is developed
for encrypting color images in this paper. Firstly, we extend a diffusion matrix with the
original 4 × 4 matrix into an n × n matrix. Then, the Huffman idea is employed to propose
a new pixel-level substitution method, which is applied to replace the grey degree value.
We employ the idea of polymorphism and select f(x) in the spatiotemporal chaotic system.
The pseudo-random sequence is more diversified and the sequence is homogenized. Three
plaintext color images of 256 × 256 × 3, “Lena”, “Peppers” and “Mandrill”, are selected in
order to prove the effectiveness of the proposed algorithm. The results show the advantages
of the algorithm in resisting differential attacks. An encrypted image with three noise values
of 0.02, 0.12, and 0.2 is obtained. The security of the image encryption algorithm does not
violate our original intention. Therefore, the results of brute-force attacks, statistical attacks,
and plaintext attacks show that the algorithm has good security. In addition, in our study,
the mixed model gradually replaced the single CML model, and showed better results in
resisting various typical attacks [47]. Therefore, the hybrid model of the genetic algorithm
and CML will be further studied.
Author Contributions: Conceptualization, P.H. and D.L.; methodology, P.H. and Y.W.; software, Y.W.
and D.L.; validation, D.L.; formal analysis, P.H.; investigation, P.H. and H.Z.; resources, D.L. and H.Z.;
data curation, D.L.; writing—original draft preparation, P.H.; writing—review and editing, W.D.;
visualization, W.D.; supervision, D.L.; project administration, W.D.; funding acquisition, W.D. All
authors have read and agreed to the published version of the manuscript.
Funding: This research was funded by the National Natural Science Foundation of China under
grant number 61771087, and the Research Foundation for the Civil Aviation University of China
under grant numbers 3122022PT02 and 2020KYQD123.
Informed Consent Statement: Not applicable.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Stinson, D. Cryptography: Theory and Practice, 2nd ed.; CRC Press Public House of Electronic Industry: Boca Raton, FL, USA, 2002.
2. Long, S. A comparative analysis of the application of hashing encryption algorithms for MD5, SHA-1, and SHA-512. J. Phys. Conf.
Ser. 2019, 1314, 012210. [CrossRef]
3. Wang X, Y.; Zhang, H.L. A novel image encryption algorithm based on genetic recombination and hyper-chaotic systems.
Nonlinear Dyn. 2016, 83, 333–346. [CrossRef]
4. Wang, X.; Zhang, M. An image encryption algorithm based on new chaos and diffusion values of a truth table. Inf. Sci. 2021, 579,
128–149. [CrossRef]
5. Li, Z.; Peng, C.; Tan, W.; Li, L. A novel chaos-based color image encryption scheme using bit-level permutation. Symmetry 2020,
12, 1497. [CrossRef]
6. Zarebnia, M.; Parvaz, R. Image encryption algorithm by fractional based chaotic system and framelet transform. Chaos Solitons
Fractals 2021, 152, 111402. [CrossRef]
7. Wu, D.; Wu, C. Research on the time-dependent split delivery green vehicle routing problem for fresh agricultural products with
multiple time windows. Agriculture 2022, 12, 793. [CrossRef]
8. Li, X.; Zhao, H.; Yu, L.; Chen, H.; Deng, W.; Deng, W. Feature extraction using parameterized multisynchrosqueezing transform.
IEEE Sens. J. 2022, 2, 14263–14272. [CrossRef]
9. Zhou, X.B.; Ma, H.J.; Gu, J.G.; Chen, H.L.; Deng, W. Parameter adaptation-based ant colony optimization with dynamic hybrid
mechanism. Eng. Appl. Artif. Intell. 2022, 114, 105139. [CrossRef]
10. Li, T.Y.; Shi, J.Y.; Deng, W.; Hu, Z.D. Pyramid particle swarm optimization with novel strategies of competition and cooperation.
Appl. Soft Comput. 2022, 121, 108731. [CrossRef]
11. Chen, H.Y.; Miao, F.; Chen, Y.J.; Xiong, Y.J.; Chen, T. A hyperspectral image classification method using multifeature vectors and
optimized KELM. IEEE J. Sel. Top. Appl. Earth Obs. Remote Sens. 2021, 14, 2781–2795. [CrossRef]
12. Yao, R.; Guo, C.; Deng, W.; Zhao, H.M. A novel mathematical morphology spectrum entropy based on scale-adaptive techniques.
ISA Trans. 2022, 126, 691–702. [CrossRef] [PubMed]
13. Zhao, H.M.; Liu, J.; Chen, H.Y.; Chen, J.; Li, Y.; Xu, J.J.; Deng, W. Intelligent diagnosis using continuous wavelet transform and
gauss convolutional deep belief network. IEEE Trans. Reliab. 2022, 1–11. [CrossRef]
14. Wei, Y.Y.; Zhou, Y.Q.; Luo, Q.F.; Deng, W. Optimal reactive power dispatch using an improved slime Mould algorithm. Energy
Rep. 2021, 7, 8742–8759. [CrossRef]
509
Electronics 2022, 11, 3436
15. Deng, W.; Ni, H.C.; Liu, Y.; Chen, H.L.; Zhao, H.M. An adaptive differential evolution algorithm based on belief space and
generalized opposition-based learning for resource allocation. Appl. Soft Comput. 2022, 127, 109419. [CrossRef]
16. Chen, H.Y.; Fang, M.; Xu, S. Hyperspectral remote sensing image classification with CNN based on quantum genetic-optimized
sparse representation. IEEE Access 2020, 8, 99900–99909. [CrossRef]
17. Deng, W.; Zhang, L.; Zhou, X.; Zhou, Y.; Sun, Y.; Zhu, W.; Chen, H.; Deng, W.; Chen, H.; Zhao, H. Multi-strategy particle swarm
and ant colony hybrid optimization for airport taxiway planning problem. Inf. Sci. 2022, 612, 576–593. [CrossRef]
18. Song, Y.; Cai, X.; Zhou, X.; Zhang, B.; Chen, H.; Li, Y.; Deng, W.; Deng, W. Dynamic hybrid mechanism-based differential
evolution algorithm and its application. Expert Syst. Appl. 2023, 213, 118834. [CrossRef]
19. Zhang, Z.; Huang, W.G.; Liao, Y.; Song, Z.; Shi, J.; Jiang, X.; Shen, C.; Zhu, Z. Bearing fault diagnosis via generalized logarithm
sparse regularization. Mech. Syst. Signal Process. 2022, 167, 108576. [CrossRef]
20. Li, N.; Huang, W.G.; Guo, W.J.; Gao, G.Q.; Zhu, Z. Multiple enhanced sparse decomposition for gearbox compound fault
diagnosis. IEEE Trans. Instrum. Meas. 2020, 69, 770–781. [CrossRef]
21. Xu, G.; Bai, H.; Xing, J.; Luo, T.; Xiong, N.N. SG-PBFT: A secure and highly efficient distributed blockchain PBFT consensus
algorithm for intelligent Internet of vehicles. J. Parallel Distrib. Comput. 2022, 164, 1–11. [CrossRef]
22. Zheng, J.J.; Yuan, Y.; Zou, L.; Deng, W.; Guo, C.; Zhao, H. Study on a novel fault diagnosis method based on VMD and BLM.
Symmetry 2019, 11, 747. [CrossRef]
23. Wu, X.; Wang, Z.C.; Wu, T.H.; Bao, X.G. Solving the family traveling salesperson problem in the adleman–lipton model based on
DNA computing. IEEE Trans. NanoBioscience 2021, 21, 75–85. [CrossRef] [PubMed]
24. Cao, H.; Shao, H.; Zhong, X.; Deng, Q.; Yang, X.; Xuan, J. Unsupervised domain-share CNN for machine fault transfer diagnosis
from steady speeds to time-varying speeds. J. Manuf. Syst. 2022, 62, 186–198. [CrossRef]
25. Zhou, Y.; Zhang, J.; Yang, X.; Ling, Y. Optimal reactive power dispatch using water wave optimization algorithm. Oper. Res. 2020,
20, 2537–2553. [CrossRef]
26. Xu, G.; Dong, W.; Xing, J.; Lei, W.; Liu, J. Delay-CJ: A novel cryptojacking covert attack method based on delayed strategy and its
detection. Digit. Commun. Netw. 2022, in press. [CrossRef]
27. Li, X.; Shao, H.; Lu, S.; Xiang, J.; Cai, B. Highly-efficient fault diagnosis of rotating machinery under time-varying speeds using
LSISMM and small infrared thermal images. IEEE Trans. Syst. Man Cybern. Syst. 2022, 30, 135–142. [CrossRef]
28. Ren, Z.; Han, X.; Yu, X.; Skjetne, R.; Johan, B.; Leira, S.; Zhu, M. Data-driven simultaneous identification of the 6DOF dynamic
model and wave load for a ship in waves. Mech. Syst. Signal Process. 2023, 184, 109422. [CrossRef]
29. Roellgen, C.B. Polymorphic cipher theory. 2004. Available online: http://www.ciphers.de/products/polymorphic_cipher_theory.
html (accessed on 12 September 2022).
30. Mackowski, D.W.; Mishchenko, M.I. Calculation of the T matrix and the scattering matrix for ensembles of spheres. J. Opt. Soc.
Am. A 1996, 13, 2266–2278. [CrossRef]
31. Behnia, S.; Akhshani, A.; Mahmodi, H.; Akhavan, A.J.C.S. A novel algorithm for image encryption based on mixture of chaotic
maps. Chaos Soliton & Fract. 2008, 35, 408–419.
32. Hussain, I.; Shah, T.; Gondal, M.A. Image encryption algorithm based on PGL(2,GF(28)) S-boxes and TD-ERCS chaotic sequence.
Nonlinear Dynam. 2012, 70, 181–187. [CrossRef]
33. Hussain, I.; Shah, T.; Gondal, M.A. An efficient image encryption algorithm based on S8 S-box transformation and NCA map.
Opt. Commun. 2012, 285, 4887–4890. [CrossRef]
34. Zhu, Z.L.; Zhang, W.; Wong, K.W.; Yu, H. A chaos-based symmetric image encryption scheme using a bit-level permutation. Inf.
Sci. Int. J. 2011, 181, 1171–1186. [CrossRef]
35. Hussain, I.; Gondal, M.A. An extended image encryption using chaotic coupled map and S-box transformation. Nonlinear Dynam.
2014, 76, 1355–1363. [CrossRef]
36. Baptista, M.S. Cryptography with chaos. Phys. Lett. A 1998, 240, 50–54. [CrossRef]
37. Jain, A.; Rajpal, N. A robust image encryption algorithm resistant to attacks using DNA and chaotic logistic maps. Multimed.
Tools Appl. 2016, 75, 5455–5472. [CrossRef]
38. Rehman, A.U.; Liao, X.; Kulsoom, A.; Abbas, S. Selective encryption for gray images based on chaos and DNA complementary
rules. Multimed. Tools Appl. 2015, 74, 4655–4677. [CrossRef]
39. Huang, X.; Ye, G. An image encryption algorithm based on hyper-chaos and DNA sequence. Multimed. Tools Appl. 2014, 72, 57–70.
[CrossRef]
40. Bakhshandeh, A.; Eslami, Z. An authenticated image encryption scheme based on chaotic maps and memory cellular automata.
Opt. Lasers Eng. 2013, 51, 665–673. [CrossRef]
41. Xu, L.; Li, Z.; Li, J.; Hua, W. A novel bit-level image encryption algorithm based on chaotic maps. Opt. Lasers Eng. 2016, 78, 17–25.
[CrossRef]
42. Zhang, Q.; Guo, L.; Wei, X. Image encryption using DNA addition combining with chaotic maps. Math. Comput. Model. 2010, 52,
2028–2035. [CrossRef]
43. Liu, H.; Wang, X.Y.; Kadir, A. Image encryption using DNA complementary rule and chaotic maps. Appl. Soft Comput. 2012, 12,
1457–1466. [CrossRef]
44. Rhouma, R.; Belghith, S. Cryptanalysis of a spatiotemporal chaotic image/video cryptosystem. Phys. Lett. A 2008, 372, 5790–5794.
[CrossRef]
510
Electronics 2022, 11, 3436
45. Akhshani, A.; Behnia, S.; Akhavan, A.; AbuHassana, H.; Hassana, H. A novel scheme for image encryption based on 2D piecewise
chaotic maps. Opt. Commun. 2010, 283, 3259–3266. [CrossRef]
46. Hussain, I.; Shah, T.; Gondal, M.A. Image encryption algorithm based on total shuffling scheme and chaotic S-box transformation.
J. Vib. Control. 2014, 20, 2133–2136. [CrossRef]
47. Nematzadeh, H.; Enayatifar, R.; Motameni, H. Medical image encryption using a hybrid model of modified genetic algorithm
and coupled map lattices. Opt. Lasers Eng. 2018, 110, 24–32. [CrossRef]
511
electronics
Article
One-Dimensional Quadratic Chaotic System and Splicing
Model for Image Encryption
Chen Chen 1 , Donglin Zhu 2 , Xiao Wang 3, * and Lijun Zeng 1
1 Nanhang Jincheng College, Nanjing 211156, China
2 College of Mathematics and Computer Science, Zhejiang Normal University, Jinhua 321004, China
3 Xingzhi College, Zhejiang Normal University, Jinhua 321000, China
* Correspondence: [email protected]
Abstract: Digital image transmission plays a very significant role in information transmission, so
it is very important to protect the security of image transmission. Based on the analysis of existing
image encryption algorithms, this article proposes a new digital image encryption algorithm based
on the splicing model and 1D secondary chaotic system. Step one is the algorithm of this article
divides the plain image into four sub-parts by using quaternary coding, and these four sub-parts
can be coded separately. Only by acquiring all the sub-parts at one time can the attacker recover the
useful plain image. Therefore, the algorithm has high security. Additionally, the image encryption
scheme in this article used a 1D quadratic chaotic system, which makes the key space big enough to
resist exhaustive attacks. The experimental data show that the image encryption algorithm has high
security and a good encryption effect.
Keywords: 1D quadratic chaotic system; image encryption; splicing model; DNA coding
1. Introduction
With the development of technologies such as artificial intelligence and 5G and the
internet of things, we have entered the times of big data information. However, due to the
sharing and openness of computer networks, information security is facing great challenges.
Citation: Chen, C.; Zhu, D.; Wang, X.;
Most of the information in the network is carried by images, so it is very necessary to protect
Zeng, L. One-Dimensional Quadratic
information security. Meanwhile, researchers have adopted a series of digital image encryp-
Chaotic System and Splicing Model tion schemes [1–5]. Some researchers put forward the image encryption algorithm based on
for Image Encryption. Electronics DNA computing and chaotic system, which protects its safe transmission of images in the
2023, 12, 1325. https://doi.org/ network to some extent [6–14]. Reference [1] put forward an image encryption algorithm
10.3390/electronics12061325 based on a one-dimensional composite chaotic mapping system, which is composed of
logistic mapping and tent mapping. The algorithm has high complexity and insufficient
Academic Editor: Gwanggil Jeon
key space. Reference [2] put forward an image encryption method based on diffusion (JPD)
Received: 13 February 2023 and joint permutation, which determines which pixels will be permuted and diffused by
Revised: 1 March 2023 hyperchaotic sequence. Reference [7] put forward an image encryption algorithm based on
Accepted: 9 March 2023 one-dimensional fractional chaotic mapping, which uses chaotic mapping to design parallel
Published: 10 March 2023 DNA coding to encrypt images. The algorithm has a greater key space. References [15,16]
put forward image encryption algorithms based on a logistic chaotic system and a sine
mapping system, respectively. Although its scheme is simple, it adopts a low-dimensional
logical chaotic system, and the number of parameters is small, which leads to less key space.
Copyright: © 2023 by the authors.
In addition, the mapping is easy to predict, and the ability to resist exhaustive attacks is
Licensee MDPI, Basel, Switzerland.
This article is an open access article
poor. The author of reference [17] proposed an encryption algorithm based on quaternary
distributed under the terms and
separation of the original image and hyperchaotic system, which has a good anti-attack
conditions of the Creative Commons ability, but the calculation speed is not fast enough, and the key space is not large enough.
Attribution (CC BY) license (https:// Reference [18] encrypts the image by generating chaotic sequence and bit cross-diffusion
creativecommons.org/licenses/by/ through iterative logical mapping, which has a larger key space. Therefore, the choice of
4.0/). a chaotic system is very significant, which will affect the whole image encryption scheme.
Electronics 2023, 12, 1325. https://doi.org/10.3390/electronics12061325 https://www.mdpi.com/journal/electronics
513
Electronics 2023, 12, 1325
In order to ensure that its key space is exceptionally large and the calculation time is appro-
priate, the paper uses 1D quadratic chaotic mapping to encrypt digital images. Because 1D
quadratic mapping has three adjustable parameters, it will obtain a larger key space, and
its calculation speed is faster than that of a high-dimensional chaotic system.
According to different digital image encryption methods, encryption technologies of
the image are roughly split into image encryption technology based on matrix transforma-
tion, chaos, frequency domain, SCAN language and DNA computing, etc. At present, the
most popular encryption technology is based on DNA computing, which has the character-
istics of low embodied energy, high concurrency, and high storage density and can meet
the space and speed requirements of DNA sequences. Therefore, encryption methods are
widely used in the field of information hiding, which is based on DNA computing [8–12].
Reference [8] put forward an encryption algorithm of DNA coding and sequence based
on constructing short DNA chains and long DNA chains. Reference [18] put forward
a way to modify the pixels of original images by DNA encoding. Reference [9] put forward
a novel image encryption algorithm, which is based on an intertwining logistic map and
DNA coding. However, these experiments only use DNA bases as operating objects and
require harsh laboratory environments and expensive experimental equipment. At present,
the laboratory cannot always meet such requirements. Therefore, the image encryption
methods which combine DNA computing with a chaotic system were introduced by count-
less researchers. In recent years, some researchers have abandoned the disadvantages
of traditional DNA encryption algorithms using complex biological operations and used
the idea of DNA subsequence operations to scramble and spread pixel values. However,
there is no perfect encryption algorithm for image information encryption, which has its
advantages and disadvantages. Decryption technology is also constantly improving, so
digital image encryption needs further research.
According to the existing digital image encryption algorithm, this paper puts forward
the following improvement measures:
1. Based on the quaternary coding theory, the plaintext image is edited into four sub-
parts, and each sub-part can be coded by different coding rules, which makes it more
difficult for attackers to crack the original image.
2. There are three key parameters of a 1D quadratic chaotic map, which are significantly
expanded compared with the traditional 1D chaotic map in parameter space. This
algorithm uses a 1D quadratic chaotic map to encrypt the original image. Large key
space makes the encryption algorithm more robust.
3. Using DNA sequence XOR operation to diffuse the pixel value of the digital image. In
the process of digital image encryption, the mosaic model is introduced, which makes
it difficult for image attackers to recover the original image.
2. Relevant Knowledge
2.1. D Quadratic Chaotic Map
The general 1D quadratic chaotic formula is defined as follows f ( x ) = mx2 + nx + k
when m = 0 and
2a − a2 + n2 − 2n
k= (1)
4m
where a ∈ (3.5699, 4] this map will be chaotic. Equation (1) can be solved in reverse, and its
solution is: ⎧ &
⎨ a = 1 − (n − 1)2 − 4mk
1 & (2)
⎩ a = 1 + (n − 1)2 − 4mk
2
For a2 , we should make:
3.5699 < a2 ≤ 4 (3)
514
Electronics 2023, 12, 1325
By Equation (3), can obtain:
6.6 < (n − 1)2 − 4mk ≤ 9 (4)
If (n − 1)2 − 4mk = 9, map p will be full. p( x ) = mx2 + nx + k is chaotic when
condition (4) holds; the 1D quadratic function is chaotic because it is topologically conjugate
with logical chaotic mapping [19]. The 1D quadratic function is chaotic because it is
topologically conjugate with logical chaotic mapping [19]. The values of three adjustable
parameters k, n and m of a 1D quadratic chaotic map need to meet the limitations of
Equation (4). In the implementation of the encryption algorithm, we usually determine the
values of n and k at random first and then determine the value range of the third parameter,
m, by Formula (4).
Generally, the low-dimensional chaotic map having a lesser key space will lead to
difficulty in resisting exhaustive attacks, while 1D quadratic map contains three adjustable
parameters, so the encryption algorithm using the 1D quadratic map has a larger key space.
2.2. The Splicing Model
The splicing model was proposed by Tom Head [20]. The basic theory of splicing
model details as below:
Suppose there is an abstract alphabet M and two strings x = x1 k1 k2 x2 , y = y1 k3 k4 y2 ,
which is composed of symbols of M. The primary splicing operation refers to the conversion
of (x1 k1 k2 x2 ,y1 k3 k4 y2 ) to (x1 k1 k4 y2 ,y1 k3 k2 x2 ) under the premise of rule r = k1 #k2 $k3 #k4 .
Figure 1 shows the conversion process.
Figure 1. The splicing operation.
2.3. DNA Computing
2.3.1. DNA Encoding and Decoding
In the realm of number theory, a positive integer W can be replaced by H integers
smaller than it. Defined as follows:
⎧
⎪
⎪ m1 = Wmodh;
⎪
⎪
⎨ m2 = (W/h)modh;
m3 = (W/h2 )modh; (5)
⎪
⎪
⎪ ...
⎪
⎩
m N = (W/h H −1 )modh
where h is a positive integer smaller than W. These performed calculations are reversible,
and the value of W can be found according to Equation (6).
W = ((((W/h H ) × h + m H ) × h + m H −1 ) . . .) × h + m1 (6)
We divide the plaintext image into four sub-parts by using the quaternary principle;
each sub-part is coded separately, and each sub-part is transformed independently on the
internet, so the encrypted image of no sub-part is incomplete. Therefore, the information
interceptor cannot obtain the original image without any DNA sequence matrix, which
increases the difficulty for attackers to crack the original image information and improves
the security of the original image information.
515
Electronics 2023, 12, 1325
For example, let us assume that the first W of the original image, according to
Formula (6), is 125, and we choose h = 4. In this way, after four modular operations,
the value of W is zero. Four position integers m1 = 1, m2 = 3, m3 = 3, m4 = 1
are the results of expression (5), so the value of each sub-section is m1 , m2 , m3 , m4 in-
dividually, and the value of W can be found in reverse according to Formula (6) that
W = 125 = (((0 × 4 + 1) × 4 + 3) × 4 + 3) × 4 + 1.
Through the calculation of Formula (5), a grayscale image can get four sub-segments
with pixel values of 0, 1, 2 and 3. These four sub-fragments can be expressed by four nucleic
acid bases, which are adenine, cytosine, guanine, and thymine, respectively. Among them,
adenine is represented by A, cytosine by C, guanine by G and thymine by T. In this paper,
Table 1 provides 24 coding schemes. Therefore, by using quaternary and DNA coding, the
plaintext image can be divided into four sub-parts, and the grayscale image can be turned
into four DNA sequence matrices. These four DNA sequence matrices are got by DNA
coding using DNA coding rules. Therefore, using the quaternary image encryption method
changes the statistical characteristic of the plain image information.
Table 1. Maping rules.
0 1 2 3
(1) C G T A
(2) C T G A
(3) G C T A
(4) G T C A
(5) T G C A
(6) T C G A
(7) A G T C
(8) T G A C
(9) G T A C
(10) G A T C
(11) T A G C
(12) A T G C
(13) C T A G
(14) C A T G
(15) T A C G
(16) A C T G
(17) A T C G
(18) T C A G
(19) G A C T
(20) G C A T
(21) C G A T
(22) C A G T
(23) A C G T
(24) A G C T
Figure 2 shows the DNA coding. The DNA coding process is as follows:
A sub-image with a size of 5 × 5 is obtained from the pixel values of the plaintext
image from (208.1) to (212.5).
The second step is to perform four modulo-4 operations on the pixel values, respec-
tively, with the result of the first operation as the pixel value of the first sub-image, the
result of the second operation as the pixel value of the second sub-image, and so on until all
four sub-images are generated. Finally, according to the coding method, the four sub-image
matrices are coded to obtain four DNA sequence matrices. Similarly, the gray values of
other parts of the original image can be coded in the same way [17].
In the process of encryption, four DNA sequence matrices are encoded by different
rules, so in the process of decoding, four DNA matrices should be decoded by specific
rules. Therefore, in order to obtain the original image information, the attacker needs to
have four matrix sequences at the same time, all of which are indispensable.
516
Electronics 2023, 12, 1325
Figure 2. DNA encoding.
2.3.2. XOR Operation for DNA Sequence
Traditional digital calculation methods cannot meet the requirements of calculation.
Researchers have put forward some biological calculation methods, such as DNA sequence
XOR operation, DNA sequence subtraction operation, and DNA sequence addition opera-
tion. The exclusive-or operation of DNA sequence is adopted, which is put forward on the
basis of traditional modulo-two operation. In Table 2, the operation rules of DNA sequence
XOR operation are listed.
Table 2. XOR rules.
XOR G T C A
G C A G T
C G T C A
T A C T G
A T G A C
3. Image Encryption Scheme
There are three stages in the encryption process: (1) transforming a plaintext image
into four DNA sequence matrices; (2) generating a 1D quadratic chaotic sequence and
diffusing four matrix pixel values through DNA XOR operation; and (3) a mosaic model is
introduced and the four matrices are combined into an image matrix.
3.1. The Basic Theory Introduction
This subsection will introduce the concrete flow of the image encryption scheme based
on a 1D quadratic chaotic system and splicing model. First of all, the plain image is encoded
into four sub-regions with pixel values of 0, 1, 2, and 3 by using quaternary. Then, the
replaced four sub-images are coded into four DNA sequence matrices by DNA coding
rules. During the second step, we use the XOR operation of DNA sequences and chaotic
sequences produced by the 1D secondary chaotic system to diffuse pixel values. Ultimately,
the pixel values are diffused again through the splicing model, these matrices are combined
into one image matrix by using the quaternary system, and in the final stages of the image
encryption scheme, the encrypted digital holograph is obtained. Figure 3 displays the
process and steps of the encryption scheme described above.
517
Electronics 2023, 12, 1325
Figure 3. Encryption Process.
3.2. The Generation of Secret Key
By the following operations, the key can be obtained:
1. Read the original image M, which size is M × H.
2. The statistical data can be obtained by the following calculation:
M H
p = 10 × ∑ ∑ ai j /MHmod1 (7)
i =1 j =1
3. Set k = −9/8, n = 1, and assign values to four parameters m1 , m2 , m3 , and m4 . Ran-
domly select the parameters m1 , m2 , and m3 in the chaotic region, and
m4 = (m1 + m2 + m3 + m4 )/4 in which m4 is randomly picked out in the chaotic region.
4. Additionally, four chaotic sequences are generated { xi }, {yi }, {si }, and {ti }, according to
xi+1 = f ( xi ) = mxi 2 + xi − 9/8 (8)
through using four initial conditions and four sets of parameters x0 + p/10, y0 + p/10,
s0 + p/10, and ( x0 + y0 + s0 + t0 )/4 + p/10, where x0 , y0 , s0 , and t0 all these parame-
ters are randomly selected in the chaotic region.
We selected the parameters m1 , m2 , m3 , and m4 , initial keys x0 , y0 , s0 , and t0 as the
secret keys.
3.3. Encryption Process
From Figure 3 above, the specific encryption algorithm process is as follows:
1. Divide the plain image M(m, h) into four sub-images according to the operation
Formula (5), and convert them into four sub-matrices H A, HB, HC, HD of size (m, h).
2. According to the coding rules of DNA sequence rules (2), (8), (13), and (19) in
Table 1, encode the matrices H A, HB, HC, HD into four DNA sequence matrices
FA, FB, FC, FD, respectively.
3. Generate four chaotic sequences { xi }, {yi }, {si }, and {ti }, which are the consequences
of the 1D quadratic chaotic system under the condition that initial values are x0 + p/10,
y0 + p/10, s0 + p/10, and ( x0 + y0 + s0 + t0 )/4 + p/10.
4. Scrambling the DNA sequence matrices FA, FB, FC, FD is based on the following
formula:
FA(v, k) = FA( f x (v), f y(k));
FB(v, k) = FB( f y(v), f z(k));
(9)
FC (v, k ) = FC ( f z(v), f q(k ));
FD (v, k) = FD ( f q(v), f x (k ));
518
Electronics 2023, 12, 1325
In which v = 1, 2, . . . m, k = 1, 2, . . . h, FA(v, k ), FB(v, k), FC (v, k ), and FD (v, k ) are
DNA sequence matrices. The values at the (v, k ) positions of FA, FB, FC, FD can be
scrambled to obtain a new DNA sequence matrix N A, NB, NC, ND.
5. Diffuse the pixel values via chaotic sequences and DNA sequence XOR operation. In
addition, we obtain SA, SB, SC, SD, which are the DNA sequence matrices.
6. Taking a column of DNA sequence matrix SA, SB, SC, SD as a subsequence, four one-
dimensional arrays QA, QB, QC, QD can be obtained, and then the arrays QA, QB, QC, QD
are scrambled by using the idea of the splicing model, following these steps:
If x (v) + y(v) < 1, implement the following formula:
QA{v} ↔ QB{v} (10)
If z(v) + q(v) < 1, implement the following formula:
QC {v} ↔ QD {v} (11)
The value range of v is an integer from 1 to m; the value of k is an integer from 1 to n.
7. Decoding the DNA sequence matrices QA, QB, QC, QD according to the second
DNA decoding rule (6), (11), (18), and (24) in Table 1 can obtain four matrices
OA, OB, OC, OD.
8. The matrices of these values are reorganized using Equation (6). Lastly, we got the
encrypted digital holograph.
The procedure of decrypt image is the reserve order of encrypt image. In the other
words, the encrypted image is complemented as the contrary operations of encryption
algorithm, and the only change is that the secret image is used in Step 2 among the
decryption algorithm.
4. Experiment and Analysis
4.1. Exhaustive Attacks
4.1.1. Analysis of Key Space
It is very significant for the robustness of the image encryption scheme that the capac-
ity of key space. If the capacity of the key space is small, it cannot resist the exhaustive
attack. The key space represents the total number of selectable keys in the image password.
In the image encryption algorithm, eight adjustable parameters, including the param-
eters m1 , m2 , m3 , m4 and initial key x0 , y0 , s0 , t0 are chosen as secret keys. Presume that
the maximum calculation accuracy is 10− x . According to the value ranges of the eight
adjustable parameters, the image encryption algorithm's key space is calculated as follows
4 4
(10x−1 × 0.53) × (10x−1 × 0.85) = 108x−10 × 4.12. If the operational precision x = 14, the
capacity of the key space is 4.12 × 10102 ≈ 2340 . The calculation results turn out that the key
space of the scheme is big enough to effectively resist exhaustive attacks. In Table 3, the
key space size of our scheme is compared with that of other documents.
Table 3. Key space.
Our Method In Ref. [1] In Ref. [17] In Ref. [19] In Ref. [21]
Key space 2340 2209 2100 2340 2261
4.1.2. Key Sensitivity
Obviously, the encryption method using a 1D quadratic chaotic system put forward in
the dissertation is sensitive to all initial keys, under the condition that we cannot obtain the
plain image result from a small modification to input conditions. Figure 4 demonstrates
the conclusions of the key sensitivity test, and decrypted digital holography under only
10−14 inappreciable difference in its secret keys m1 , m2 , m3 , m4 , s0 , t0 x0 , and y0 , respectively.
519
Electronics 2023, 12, 1325
We can sum up that the original image information can be extracted only if the secret keys
are consistent. The decrypted digital holograph cannot reflect the true information of the
plaintext image if any small change in the primary key values. Therefore, our scheme has
a greater level of security and can withstand exhaustive attack efficiency.
(a) (b) (c) (d)
(e) (f) (g) (h)
(i) (j) (k)
Figure 4. (a) ”Lena” image; (b) cipher image (initial encryption key); (c) decrypted image (initial
encryption key); (d) m1 + 10−14 ; (e) m2 + 10−14 ; (f) m3 + 10−14 ; (g) m4 + 10−14 ; (h) x0 + 10−14 ;
(i) y0 + 10−14 ; (j) s0 + 10−14 ; (k) t0 + 10−14 . Key sensitivity test: (d–k) Decrypted image with the
wrong key.
4.2. Statistical Attacks
4.2.1. Gray Histogram
A gray histogram describes each pixel value's frequency in a gray image. Typically,
original image pixel values are concentrated on some specific gray values, and encrypted
pixel values of the image are evenly distributed on all gray values. The gray histogram of
the original image and encrypted digital holograph are demonstrated in Figure 5. From the
figure, the distribution of pixel values in the original image is uneven, mainly concentrated
on several gray values. However, the pixel values of the encrypted digital holograph are
relatively evenly distributed on all gray values. The image encryption system has influenced
and changed the distribution of pixel values. The algorithm with a high sense of resisting
statistical attacks, which ensures the security of images in the process of transmission.
520
Electronics 2023, 12, 1325
(a) The gray histogram (original image)
(b) The gray histogram (encrypted holograph)
Figure 5. Gray histogram analysis.
521
Electronics 2023, 12, 1325
4.2.2. Correlation Coefficient Analysis
The quality of scrambling and diffusion of the image encryption system can be ex-
pressed by calculating the relationship between adjacent pixels of the encrypted digital
holograph. The greater the degree of encryption scrambling and diffusion, the smaller
the correlation coefficient of the neighboring pixels of the encrypted digital holograph,
indicating that the relationship of the adjacent pixels of the encrypted digital holograph is
weaker. If the calculated values of neighboring pixels in the original image show a linear
distribution, the correlation between neighboring pixels will be strong. The distribution of
neighboring pixel values of the encrypted image should be irregular, and the correlation be-
tween neighboring pixels should be weak. When the correlation coefficient of the encrypted
digital holograph is close to zero, it shows that the encryption scheme has good robustness.
The correlation coefficient rst of neighboring pixels of the image may be calculated by
the subsequent formula.
1 H
H k∑
P(s) = sk (12)
=1
1 H
H k∑
Q(s) = (sk − E(s))2 (13)
=1
1 H
H k∑
cov(s, t) = (sk − E(s))(tk − E(t)) (14)
=1
cov(s, t)
rst = % (15)
Q(s) × Q(t)
The pixel values of two adjacent pixels in the image are denoted by s and t, respectively,
and cov(s, t) is covariance, P(s) is mean, Q(s) is variance.
First, 1000 pairs of adjacent pixels were selected from the original image, and the cor-
relation was calculated in horizontal, vertical, and diagonal directions. Similarly, 1000 pairs
of adjacent pixels were selected in the same position in the encrypted image, and the
correlation was calculated in horizontal, vertical, and diagonal directions again. Figure 6
correlation coefficient analysis demonstrates the relationship between the two horizontally
adjacent pixels in the original image and in the encrypted digital holograph is very different.
From Figure 6a, the pertinence of two horizontally adjacent pixels is strong. From Figure 6b,
the pertinence of two horizontally adjacent pixels is weak.
From Table 4 below, it can be concluded that the correlation coefficient between
two neighboring pixels of the encrypted image with the original image of “lenna.bmp” is
close to 0, and the relationship between neighboring pixels of the image is weak. By com-
paring the correlation between neighboring pixels of the original image and the encrypted
image, the following conclusions can be drawn. In the encryption algorithm, a 1D quadratic
chaotic system was used to generate the key and scramble the image, and the mosaic model
was introduced to participate in scrambling the image. The correlation between adjacent
pixel values of the scrambled image was very low. It showed that the encryption algorithm
can effectively resist statistical attacks.
Table 4. Correlations coefficients.
Cipher In Ref. In Ref. In Ref. In Ref.
Direction Lenna
Image [1] [5] [13] [17]
Horizontal 0.9277 0.0015 −0.0062 −0.0020 −0.0119 0.0015
Vertical 0.9168 −0.0021 −0.0001 −0.0065 −0.0087 0.0018
Diagonal 0.8871 −0.0020 0.0018 0.0087 −0.0045 0.0018
522
Electronics 2023, 12, 1325
(a) lenna.bmp
(b) Cipher image
Figure 6. Correlation coefficient analysis.
4.3. Differential Attacks
The calculation results of the following formula can measure the ability of the encryp-
tion algorithm to resist differential cryptanalysis. The change rate of image pixel number
(the number of pixels change rate, NPCR) is calculated by the Formula (16), and the even
average change intensity of the image (the unified average changing intensity, UACI) is
calculated by the Formula (17). The magnitude of these values reflects the ability of the
523
Electronics 2023, 12, 1325
encryption algorithm to resist differential cryptanalysis. The larger these two values are,
the more sensitive the image encryption algorithm is to small changes in gray images.
H U
∑ ∑ C (s, t)
s =1 t =1
NPCR = × 100% (16)
H×U
H U
∑ ∑ | T1 (s, t) − T2 (s, t)|
s =1 t =1
U ACI = × 100% (17)
H × U × 255
where H, U are the size of cipher image, T1 (s, t) represents the pixel value of one ciphertext
image at (s,t) position, and T2 (s, t) represents the pixel value of another ciphertext image at
the same position. C (s, t) is determined as
⎧
⎪
⎪ T1 (s, t) = T2 (s, t);
⎨ 0, if
C (s, t) = (18)
⎪
⎪
⎩ 1, if T1 (s, t) = T2 (s, t);
NPCR and UACI analysis of the 256 × 256 Lena image and Baboon image were carried
out by existing methods. The values in Table 5 show the approximate theoretical values. It
can be concluded that the image encryption algorithm based on the 1D quadratic chaotic
system and splicing model excellent in resisting differential cryptanalysis.
Table 5. UACI and NPCR of our innovate algorithm and other algorithms.
UACI NPCR
Lena 33.4685% 99.6092%
Baboon 33.4687% 99.6089%
In Ref. [1] (Lena) 33.48% 99.61%
In Ref. [5] (Lena) 33.4477% 99.6063%
In Ref. [14] (Lena) 33.4645% 99.6096%
In Ref. [17] (Lena) 33.505% 99.571%
In Ref. [21] (Lena) 34.61% 99.65%
4.4. Information Entropy
In information theory, information entropy refers to the average amount of infor-
mation received, and it can also represent the unpredictability and uncertainty of image
information. Information entropy is also an index to measure the quality of the image
encryption scheme. If the information entropy is close to 8, it indicates that the image
encryption algorithm is excellent. If the entropy of an image encryption algorithm is far
less than 8, the encryption scheme has certain security problems. The information entropy
of an encrypted digital hologram can be calculated according to the Formula (19).
m
P( X ) = − ∑ Q( xi ) log2 Q( xi ) (19)
i =0
xi is the value of the ith position of the grayscale image, the Q( xi ) is the frequency of
xi s appearance, and m is the size of the grayscale [22]. The following Table 6 shows the
information entropy values of the encrypted digital holograph in this thesis and those of
encrypted images under other algorithms.
524
Electronics 2023, 12, 1325
Table 6. The entropy analysis.
Images In Ref. [1] In Ref. [8] In Ref. [17] In Ref. [21] Our Method
Lena 7.9978 7.9971 7.9971 7.9975 7.9994
Baboon 7.9974 7.9973 / / 7.9991
By comparing the values in Table 6, indicated that the encryption algorithm proposed
in this thesis is very competitive. According to our encryption algorithm, the information
entropy of encrypted digital holography is 7.9994 and 7.9991, respectively, which shows
that the algorithm is excellent because the value is infinite and close to the theoretical value
of 8.
4.5. Encryption Speed Test
In the proposed algorithm, the plaintext image is divided into four matrices, which can
be encrypted at the same time, and four cycles are parallel, so the total number of cycles is
1/4( M + N ), and this algorithm's time complexity is chiefly expressed as O(1/4( M + N )).
The number of cycles of the traditional image encryption algorithm with a single pixel as
the processing unit is equal to the number of pixels, and the number of cycles is ( M × N ).
Therefore, the time complexity of this kind of encryption algorithm is O( M × N ). This
algorithm significantly improves the encryption speed compared with the encryption
algorithm in references. In this thesis, the experimental diagram Lena was decrypted in the
experimental environment, and its running time is shown in Table 7. The actual running
efficiency of the encryption algorithm was influenced by many factors, such as running
environment and programming skills, so the specific running time of the algorithm was
not compared, but the time complexity of the algorithm was compared.
Table 7. Encryption speed test.
In Ref. [2] In Ref. [14] Our Method
Time complexity O(6N 2 ) O( M × N ) O(1/4( M + N ))
5. Conclusions
This article presents the digital image encryption system based on a 1D quadratic
chaotic system and splicing model. Firstly, the plaintext image was divided into four
sub-parts by using the quaternary principle, and each sub-part was coded separately. If
an attacker wants to obtain the original image, he must have all the sub-parts at the same
time, which increases the difficulty for the attacker to crack the image. In addition, the
encryption system encrypted the image using 1D quadratic chaotic mapping, which not
only increased the key space of the algorithm but also improved the randomness. Finally,
the mosaic model was introduced in the process of digital image encryption to ensure
the security of the algorithm. Security analysis and experimental results show that the
encryption scheme is not only highly secure, but also resistant to various attacks from
the outside world, for instance, statistical attacks, exhaustive attacks, and score-checking
attacks and has good robustness.
Author Contributions: Data curation, formal analysis, C.C.; software, validation, C.C. and L.Z.;
supervision, D.Z.; writing—review and editing, C.C. and X.W. All authors have read and agreed to
the published version of the manuscript.
Funding: This work was supported in part by the National Natural Science Foundation of China
under Grant numbers 62272418 and 62002046.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: Dataset used in this study may be available on demand.
525
Electronics 2023, 12, 1325
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Zhu, S.; Deng, X.; Zhang, W. A New One-Dimensional Compound Chaotic System and Its Application in High-Speed Image
Encryption. Appl. Sci. 2021, 11, 11206. [CrossRef]
2. Li, T.Y.; Shi, J.Y.; Zhang, D.H. Color image encryption based on joint permutation and diffusion. J. Electron. Imaging 2021, 30,
013008. Available online: https://www.spiedigitallibrary.org/journals/journal-of-electronic-imaging/volume-30/issue-1/01
3008/Color-image-encryption-based-on-joint-permutation-and-diffusion/10.1117/1.JEI.30.1.013008.full?SSO=1 (accessed on 12
January 2022). [CrossRef]
3. Zhu, D.; Huang, Z.; Liao, S. Improved Bare Bones Particle Swarm Optimiztion for DNA Squence Dsign. IEEE Trans. NanoBiosci.
2022, 35. Available online: https://ieeexplore.ieee.org/document/9943286 (accessed on 9 December 2022).
4. Li, Z.; Peng, C.; Tan, W.; Li, L. A novel chaos-based color image encryption scheme using bit-level permutation. Symmetry 2020,
12, 1497. Available online: https://www.mdpi.com/2073-8994/12/9/1497 (accessed on 9 February 2022). [CrossRef]
5. Geng, S.T.; Tao, W.; Wang, S.D. A novel image encryption algorithm based on chaotic sequences and cross-diffusion of bits. IEEE
Photon. 2021, 13, 6276–6281. Available online: https://ieeexplore.ieee.org/stamp/stamp.jsp?arnumber=9291442 (accessed on
9 February 2022).
6. Li, T.; Yang, M.; Wu, J.; Jing, X. A Novel Image Encryption Algorithm Based on a Fractional-order Hyperchaotic Sysetem and DNA
Computing. Complexity 2017, 2017, 9010251. Available online: https://www.hindawi.com/journals/complexity/2017/9010251/
(accessed on 13 February 2022).
7. Zhu, S.; Deng, X.; Zhang, W.; Zhu, C. Image Encryption Scheme Based on Newly Designed Chaotic Map and Parallel DNA
Coding. Mathematics 2023, 11, 231. Available online: https://www.mdpi.com/2227-7390/11/1/231 (accessed on 1 February 2023).
[CrossRef]
8. Zou, C.; Wang, X.; Zhou, C. A novel image encryption algorithm based on DNA strand exchange and diffusion. Elsevier Appl.
Math. Comput. 2022, 430, 127291. Available online: https://www.sciencedirect.com/science/article/abs/pii/S0096300322003654
(accessed on 13 December 2022). [CrossRef]
9. Dua, M.; Wesanekar, A.; Gupta, V. Differential evolution optimization of intertwining logistic map-DNA based image encryption
technique. J. Amb. Intell. Human. Comput. 2020, 11, 3771–3786. Available online: http://link.springer.com/article/10.1007/12652-
019-01580-z (accessed on 9 February 2022). [CrossRef]
10. Soni, R.; Johar, A.; Soni, V. An Encryption and Decryption Algorithm for Image Based on DNA. In Proceedings of the 2013
International Conference on Communication Systems and Network Technologies, Gwalior, India, 6–8 April 2013; Volume 12,
pp. 478–481. Available online: https://ieeexplore.ieee.org/abstract/document/6524442 (accessed on 9 February 2022).
11. Gupta, S.; Jain, A. Efficient Image Encryption Algorithm Using DNA Approach. In Proceedings of the 2015 2nd International
Conference on Computing for Sustainable Global Development, INDIACom, New Delhi, India, 11–13 March 2015; Volume 8,
pp. 726–731. Available online: https://ieeexplore.ieee.org/abstract/document/7100345 (accessed on 13 February 2022).
12. Som, S.; Kotal, A.; Chatterjee, A.; Dey, S.; Palit, S. A Colour Image Encryption Based on DNA Coding and Chaotic Sequences.
ICETACS 2013, 112, 108–114. Available online: https://ieeexplore.ieee.org/document/6691405 (accessed on 13 February 2022).
13. Liu, Q.; Liu, L.F. Color image encryption algorithm based on DNA coding and double chaos system. IEEE Access 2020, 35,
3581–3596. Available online: https://ieeexplore.ieee.org/document/9082588 (accessed on 6 March 2022). [CrossRef]
14. Zhang, Q.Y.; Han, J.T.; Ye, Y.T. Multi-image encryption algorithm based on image hash, bit-plane decomposition and dynamic
DNA coding. IET Image Proc. 2020, 68, 726–731. Available online: https://ietresearch.onlinelibrary.wiley.com/doi/full/10.1049/
ipr2.12069 (accessed on 6 March 2022). [CrossRef]
15. Matthews, R. On the derivation of a Chaotic encryption algorithm. Cryptologia 1989, 13, 29–42. Available online: https://www.
tandfonline.com/doi/abs/10.1080/0161-11899186374 (accessed on 13 February 2022). [CrossRef]
16. Belazi, A.; El-Latif, A. A simple yet efficient S-box method based on chaotic sine map. Optik 2017, 130, 1438–1444. Available
online: https://www.sciencedirect.com/science/article/abs/pii/S0030402616314887 (accessed on 6 March 2022). [CrossRef]
17. Niu, H.; Zhou, C.; Wang, B.; Zheng, X.; Zhou, S. Splicing Model and Hyper- Chaotic System for Image Encryption. J. Electr. Eng.
2016, 67, 78–86. Available online: https://sciendo.com/article/10.1515/jee-2016-0012 (accessed on 13 February 2022). [CrossRef]
18. Zhu, X.S.; Liu, H.; Liang, Y.R. Image encryption based on Kronecker product over fifinite fifields and DNA operation. Optik 2020,
224, 164725. Available online: https://www.sciencedirect.com/science/article/abs/pii/S0030402620305611 (accessed on 6 March
2022). [CrossRef]
19. Liu, L.F.; Wang, J. A cluster of 1D quadratic chaotic map and its applications in image Encryption. Math. Comput. Simul. 2022, 204,
89–114. Available online: https://www.sciencedirect.com/science/article/abs/pii/S0378475422003329 (accessed on 6 March
2022). [CrossRef]
20. Tom, H. Splicing and Regularity. Bull. Math. Biol. 1987, 49, 737. Available online: https://www.sciencedirect.com/science/
article/abs/pii/S0092824087900188 (accessed on 13 February 2022). [CrossRef]
526
Electronics 2023, 12, 1325
21. Zheng, J.; Hu, H.P. A symmetric image encryption scheme based on hybrid analog-digital chaotic system and parameter selection
mechanism. Multimed. Tools Appl. 2021, 27, 176–191. Available online: https://link.springer.com/article/10.1007/s11042-021-107
51-0 (accessed on 13 February 2022). [CrossRef]
22. Kamarposhti, M.S.; Mohammad, D.; Rahim, M.; Yaghobi, M.I. Using 3-cell chaotic map for image encryption based on biological
operations. Nonlinear Dyn. 2014, 7, 407–416. Available online: https://link.springer.com/article/10.1007/s11071-013-0819-6
(accessed on 13 February 2022). [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
527
electronics
Article
Design Science Research Framework for Performance Analysis
Using Machine Learning Techniques
Mihaela Muntean * and Florin Daniel Militaru
Business Information Systems Department, Faculty of Economics and Business Administration, West University
of Timisoara, 300223 Timisoara, Romania
* Correspondence: [email protected]
Abstract: We propose a methodological framework based on design science research for the design
and development of data and information artifacts in data analysis projects, particularly managerial
performance analysis. Design science research methodology is an artifact-centric creation and
evaluation approach. Artifacts are used to solve real-life business problems. These are key elements
of the proposed approach. Starting from the main current approaches of design science research,
we propose a framework that contains artifact engineering aspects for a class of problems, namely
data analysis using machine learning techniques. Several classification algorithms were applied to
previously labelled datasets through clustering. The datasets contain values for eight competencies
that define a manager’s profile. These values were obtained through a 360 feedback evaluation.
A set of metrics for evaluating the performance of the classifiers was introduced, and a general
algorithm was described. Our initiative has a predominant practical relevance but also ensures a
theoretical contribution to the domain of study. The proposed framework can be applied to any
problem involving data analysis using machine learning techniques.
Keywords: design science research; performance analysis; machine learning; classification algorithms;
clustering algorithms
Citation: Muntean, M.; Militaru, F.D.
Design Science Research Framework
for Performance Analysis Using
Machine Learning Techniques.
1. Introduction
Electronics 2022, 11, 2504. https://
doi.org/10.3390/electronics11162504 Design science research is a research paradigm with well-established conceptualiza-
tions applicable in engineering and, more recently, in the field of information systems.
Academic Editors: Taiyong Li,
According to Pfeffers et al. [1], design science research (DSR) is important in disciplines
Wu Deng and Jiang Wu
oriented towards the creation of successful artifacts. In data analysis, key artifacts are
Received: 20 July 2022 the “useful data artifacts” (UDA) and data-related information artifacts [2]. UDAs are
Accepted: 8 August 2022 “nonrandom subsets or derivative digital products of a data source, created by an intelligent
Published: 11 August 2022 agent (human or software) after performing a task on the data source”, e.g., a labelled
dataset or train and test dataset, while information artifacts refer to the objectives of the
Publisher’s Note: MDPI stays neutral
solution and requirements for final data visualizations or data specifications. Based on
with regard to jurisdictional claims in
published maps and institutional affil-
the importance of data/information artifacts in data analysis, we propose the design and
iations.
development of a DSR process in this field of investigation.
Performance measurement is “the process of collecting, analyzing, and/or reporting
information regarding the performance of an individual, group, organization, system, or
component” [3]. According to Stroet [4], performance measuring is influenced by the usage
Copyright: © 2022 by the authors. of machine learning (ML) techniques “in a way that it becomes more accurate through the
Licensee MDPI, Basel, Switzerland. use of more current and accurately collected data, performance data are gathered easier, is
This article is an open access article done more continuous, is less biased and done with a more proactive attitude than before
distributed under the terms and ML was implemented in the process”. Managers and employees are frequently evaluated
conditions of the Creative Commons using 360-degree feedback. In general, 360 feedback focuses on behaviors and competencies
Attribution (CC BY) license (https:// more than basic skills, job requirements, and performance objectives. Therefore, the
creativecommons.org/licenses/by/ 360 feedback is incorporated into a larger performance management process and it is
4.0/).
Electronics 2022, 11, 2504. https://doi.org/10.3390/electronics11162504 https://www.mdpi.com/journal/electronics
529
Electronics 2022, 11, 2504
clearly “communicated on how the 360 feedback will be used”. Because 360-feedback is
time-consuming, the use of machine learning techniques for analyzing performance data
determines the fluidization of the entire process, and the evaluation results are obtained in
real time [4,5].
The process is a priori reviewed with staff members, and is started by collecting
confidential information from managers’ colleagues and sending the evaluation form to
be completed by the employees [6]. Data are automatically collected and integrated into a
single dataset. Further, mean values for each competence for all evaluated managers are
calculated. The resulting dataset is subjected to analysis using machine learning algorithms.
The paper develops a theoretical applied research discourse based on:
- a methodological framework using design science research (DSR) for data analysis
with machine learning techniques, such as classification algorithms;
- a theoretical approach to classification evaluation metrics;
- a set of competencies for evaluating the managers’ performance using 360 feedback;
- an approach to apply the methodological framework to a performance related dataset.
2. Materials and Methods
2.1. Machine Learning Techniques—Clustering and Classification
The study of machine learning (ML) led to the development of many methods de-
pending on the purpose, data representation, and learning strategy. Depending on the
experience gained during the learning, we distinguish supervised, unsupervised, or semi-
supervised learning methods. In addition, learning can occur through reinforcement or
through “learning” [7]. According to El Bouchefry and De Souza [8], “ML algorithms are
programs of data-driven inference tools that offer an automated means of recognizing
patterns in high-dimensional data”. Supervised algorithms search for inherited structures
in a dataset, whereas unsupervised algorithms provide the correct labels or function values.
Both clustering and classification algorithms are proven to be successful in different
analyses [9]. Classification algorithms require labelled datasets to perform the learning
process. We proposed applying classification algorithms to datasets that were previously
subjected to a clustering process. According to Alapati and Sindhu [10], the accuracy
of a classifier can be improved by applying a classification algorithm to clustered data.
We propose the following phases for the prediction analysis and performance prediction
(Figure 1).
Figure 1. Prediction analysis phases.
To evaluate the quality of the classification, the performance of the classifier was ana-
lyzed, regardless of whether it may be, with the help of the following measures: sensitivity,
specificity, accuracy, and F1 score [11,12].
2.1.1. Feature Selection
Not all attributes or features are important for a specific learning task. The challenging
task in feature selection is to obtain an optimal subset of relevant and non-redundant
features, which will provide an optimal solution without increasing the complexity of the
modelling task [13]. According to Dash and Koot [14], for clustering tasks, it is not so
obvious which features are to be selected: some of the features may be redundant, some
530
Electronics 2022, 11, 2504
are irrelevant, and others may be “weakly relevant”. In the context of classification, feature
selection techniques can be categorized as filter methods (ANOVA, Pearson correlation,
and variance thresholding), wrapper methods (forward, backward, and stepwise selection),
embedded methods (LASSO, RIDGE, and decision tree), and hybrid methods [15]. All
feature selection methods help reduce the dimensionality of the data and the number of
variables, while preserving the variance of the data.
2.1.2. Clustering
Clustering is an unsupervised learning problem that involves finding a structure in a
collection of unlabelled data. A cluster is “a collection of objects that are similar between
them and dissimilar to objects belonging to other clusters” [16]. Clustering algorithms
can be classified as hierarchical, partitioning, density, grid, or model-based (Figure 2).
According to Witten, Frank, Hall, and Pal [17], a cluster contains instances that bear a
stronger resemblance to each other than to other instances.
Figure 2. Clustering algorithms [18].
Partitional clustering algorithms divide datasets into mutually disjointed partitions.
Data points are assigned to K clusters using an iterative process [19]. The partitional clus-
tering techniques start with randomly chosen clustering, and then optimize the clustering
according to the accuracy measurements. Owing to its simplicity and low time complexity,
the K-means algorithm is commonly used for mining data and labeling them with cluster
labels [20]. This requires pre-defining the number of clusters K, and the optimal K value
is determined a priori [21]. Determining the optimal number of clusters is fundamental
for clustering. According to Loukas [22], the optimal number of clusters depends on the
method used for measuring similarities and the parameters used for partitioning (the elbow
method, silhouette analysis, and gap statistics method).
Hierarchical clustering can be divided into two types: agglomerative (bottom-up)
and divisive (top-down) clustering. Data objects (instances) are organized into a tree of
clusters called a dendrogram. Each intermediate level can be viewed as combining two
clusters from the next lower level (bottom-up) or splitting a cluster from the next higher
level (top-down) [23]. Frequently applied in the construction of taxonomies, hierarchical
clustering requires considerable computational and storage resources for deploying the
dendrogram. Unfortunately, once a merge or split step is performed, it cannot be undone.
Therefore, it is recommended to integrate hierarchical clustering with other techniques for
multi-phase clustering.
Density-based clustering algorithms identify distinctive clusters in the data based
on the idea that “a cluster in a data space is a contiguous region of high point density”,
separated from other such clusters by contiguous regions of low point density [24]. The
531
Electronics 2022, 11, 2504
algorithms detect areas where points are concentrated, and where they are separated by
areas that are empty or sparse.
Grid-based approaches are popular for mining clusters in large multidimensional
spaces, in which clusters are regarded as denser regions than their surroundings. Such
an algorithm is concerned not with data points but with the value space that surrounds
them [25].
Finally, model-based clustering assumes that data are generated by a model, and
attempts to recover the original model from the data.
2.1.3. Classification
Classification algorithms are supervised learning techniques that are used to identify
the category (class) of new data. The classification involves the following processing phases
(Figure 3).
Figure 3. Classification process.
Among the most well-known models (methods) used for classification, we can mention
the following [26]: decision trees, Bayesian classifiers, neural networks, k-nearest neighbor
classifiers, statistical analysis, genetic algorithms, rough sets, rule-based classifiers, memory-
based reasoning, support vector machines (SVMs), and boosting algorithms.
Binary classification (Figure 4) refers to classification tasks that have only two class labels
(k-nearest neighbors, decision trees, support vector machines, and naive Bayes), whereas
multiclass classification refers to classification tasks that have more than two class labels (k-
nearest neighbors, decision trees, naive Bayes, random forest, and gradient boosting).
Figure 4. Classification algorithms.
A multi-label classifier can predict one or more labels for each data instance (multi-label
decision trees, multi-label random forests, and multi-label gradient boosting). Unbalanced
classification processes determine the classification of an unequal number of instances into
classes (cost-sensitive logistic regression, cost-sensitive decision trees, and cost-sensitive
support vector machines).
According to [27], it is necessary to first identify business needs and then map them
to the corresponding machine learning tasks (Figure 5). After establishing the business
requirements, the requirements for the machine learning algorithm were established. Char-
acteristics, such as the accuracy of the algorithm, training time, linearity, number of param-
532
Electronics 2022, 11, 2504
eters, and number of features influence the classifier selection [5]. The accuracy reflects the
effectiveness of a model, that is, the proportion of true results in all cases. The training time
varies from one classifier to another. Many machine learning algorithms use linearity. The
parameters are the values that determine the algorithm behavior, and a large number of
features substantially influence the training time [28]. Classification performance can be
improved by mixed approaches [29].
Figure 5. Criteria for selecting machine learning algorithms [28].
2.2. Design Science Research
According to Nunamaker et al. [30], research is “represented by its objectives and
methods, whereby the objectives require a methodological approach to integrate theory
building, system development, and experimentation”. On a theoretical scale (Figure 6), the
degree of theoretical importance is represented on one side versus the practical relevance
on the other side [31].
Figure 6. Research paradigm [30].
Research in information systems and data science implies an interdisciplinary research
process that fits more than one paradigm [31].
Design science research (DSR) is a paradigm that is accepted in disciplines, such
as engineering. This research paradigm is extended to information systems and data
science [32]. As asserted by Hevner et al. [32], guidelines for design science research
include methodological choices for the DSR process.
Several research methodologies were developed to support the DSR process [33]. The
main methodologies are the systems development research methodology (SDRM) [30],
DSR process model (DSRPM) [34], design science research methodology (DSRM) [7], action
design research (ASR) [35], soft design science methodology (SDSM) [36], and participatory
action design research (PADR) [37].
According to Nunamaker et al. [33], SDRM is a five-step research process that includes
the following steps: constructing a conceptual framework, developing a system architecture,
analyzing and designing the system, building the (prototype) system, and observing and
evaluating the system.
In their “Design Research in Information Systems”, Vaishnavi and Kuechler [34]
explain the process steps of design research. By pointing out the importance of artifacts,
the DSR process includes the following steps: awareness of the problem, suggestion,
development, evaluation, and conclusion.
533
Electronics 2022, 11, 2504
Peffers et al. [1] proposed a six-step design science research methodology: identifying
the problem and motivation, defining the objectives of a solution, design and development,
demonstration, evaluation, and communication. DSR methodology is “an artifact-centric
creation and evaluation approach” [1,34]. The research methodology implies the design cycle
of “artifacts of practical value to either the research or professional audience” [38,39]. Artifacts
are systems, applications, methods, data models, data sets, and others “that could contribute
to the efficacy of information systems and business analysis in organizations” [40].
ADR methodology combines action research with DSR [33]. It includes four phases:
problem formulation, building intervention and evaluation, reflection and learning, and
formalization of learning [35].
The eight activities of SDSM are: learning about a specific problem, inspiring and
creating the general problem and general requirements, intuiting the general solution,
general evaluation, designing specific solution for specific problem, specific evaluation,
constructing specific solution, and post evaluation [33,36].
The PADR methodology is recommended for developing solutions to problems in-
volving large heterogeneous groups of stakeholders [33,37]. It consists of the following
steps: diagnosis and problem formulation, action planning, action taking: design, impact
evaluation, and reflection and learning.
Based on the DSRM and DSRPM, we recommend the methodological framework
shown in Figure 7 for performing data analysis.
Figure 7. Design science research framework.
The activities shown in Figure 7 indicate the design and development of the artifacts.
Furthermore, the artifacts are evaluated, and after validation, they are e communicated and
processed in the next phase [41]. Artifact evaluation provides a better interpretation of the
problem and feedback to improve the quality of designed artifacts [42].
Owing to its focus on developing information artifacts, DSR is a research approach
with a predominant practical relevance. Artifacts are designed and developed in order
to improve business activities, processes, or to support decisions. Therefore, the targeted
business beneficiaries of the artifacts are involved in their testing and validation [31].
3. Methods
3.1. Artifacts Development in Design Science Research
“Current design science research method does not have a systematic methodological
process to follow in order to produce artifacts” [43]. In general, the following research
methods, techniques and tools are used for artifact design and development (Table 1).
534
Electronics 2022, 11, 2504
Table 1. DSR process. Research methods, techniques and tools.
Phase Activity Research Methods, Techniques and Tools
Problem identification and Motivation Brainstorming, systems review and analysis, literature study,
Phase 0
Objectives establishment interviews, focus group
Literature review, system analysis, field and case study.
Activities
artifacts engineering
Phase 1 Simulation, informed argument, controlled experiment, case
Phase n Validation
study, field study
Communication Communication framework
We propose an approach to prediction analysis (Figure 1) in a DSR framework (Figure 7)
using appropriate research methods, techniques and tools (Table 1).
Artifact engineering using machine learning techniques implies a set of activities and
tasks that are highlighted in Table 2. The initial, intermediate, and final artifacts were
established for each phase.
Table 2. DSR process. Using machine learning techniques.
Phase Activity/Task Artifact (Output)
O01. Objectives of the solution
A01. Problem identification and Motivation
Ph0. Phase 0 O02. Requirements for final
A02. Objectives establishment
data visualizations
A11. Understanding the data
Task1. Establishing the data that are necessary for the
business analysis,
Ph1. Phase 1 O11. Data specifications
Task2. Identifying the issues that affect the data quality
A12. Validation of the information artifacts
A13. Communicating the result
A21. Data set design and development
Task1. Accessing data sources and retrieving data
Task2. Features selection
Ph2. Phase 2 Task3. Data cleaning O21. Dataset
Task4. Data transforming
A22. Validation of the information artifact
A23. Communication of the result
A31. Data modelling through clustering
Task1. Choosing the clustering algorithm depending on analysis
objectives, type of data, size of the dataset, cleanliness of the data
Ph3. Phase 3 O31. Labelled dataset
Task2. Performing the clustering
A32. Validation of the information artifact
A33. Communication of the result
A41. Data modelling through classification
Task1. Establishing the training (80%) and test dataset (20%)
O41. Training dataset
Task2. Train the model for different classification algorithms
O42. Test dataset
Task3. Test the models
Ph4. Phase 4 O43. Classification data models
Task4. Evaluate each model and select the best
O44. Results of the testing process
classification algorithm
O45. Evaluation metrics results
A42. Validation of the information artefacts
A43. Communication of the result
O51. Class labels and scores for
Ph5. Phase 5 A51. Prediction with the best classification algorithm
the new dataset
Our proposal establishes all necessary processing to perform data analysis in general,
and performance analysis in particular.
535
Electronics 2022, 11, 2504
Data analysis is part of a larger business process, such as the process of evaluating
performance, and is meant to add value to a business [7]. Data analysis takes primary
information from the information flows and returns the information artifacts to the in-
formation flows in the corporate environment. As part of the performance management
process, the proposed framework is closely linked to process elements downstream and
upstream. This implies a scalable deployment approach containing the following stages:
top management involvement, proper planning and scoping, introducing the data analysis
in terms of a business case, implementing the DSR process, and maintaining a solid data
governance program.
3.2. Metrics for Evaluating Classification Models
Classification algorithms are widely used to make predictions and meaningful deci-
sions [42]. Once a classification algorithm produces a model, it is evaluated with respect to
certain criteria such as accuracy, ROC curve, or F1 score [44].
According to the prediction approach (Figure 1), classification represents the third
phase after feature selection and clustering [11]. A classification model is constructed by
applying a classifier to the training dataset (80% of the data). Furthermore, classification
accuracy was verified using a test set (20% of the data) by comparing the forecasted output
(class label) with the observed output (cluster label provided by the clustering algorithm).
Building acceptable classification models implies, despite accuracy and justifiability, that
the model should be in line with the existing domain knowledge [45].
According to Choi et al. [46], six evaluation metrics are recommended to evaluate
multilevel classification: accuracy, precision, recall, F1-score, receiver operating characteris-
tic curve, and AUC. A greater number of indicators are used in specific contexts, such as
software fault predictions [47]. In addition, the classification performance was measured
using G-mean, J-coefficient, error rate, and balance. A review of evaluation metrics for data
classification evaluations presented a set of suitable indicators for obtaining the optimal
classifier: accuracy, error rate, sensitivity, specificity, precision, recall, F-score, geometric
mean, average accuracy, average error rate, average precision, average recall, and average
F-score [48].
In all approaches, the basic metrics are true positive (TP), true negative (TN), false
positive (FP), and false negative (FN) [49]. A true positive is a predicted outcome that is
similar to the actual class (cluster label). A false positive result occurs when the classifier
labels (or categorizes) a data instance that it should not contain. A true negative result
occurs when the classifier does not correctly label (or categorize) the output. A false negative
result occurs when the classifier does not label a data instance but should have. Based on
these considerations, we introduced the following metrics to evaluate the classification
performance (Table 3).
Table 3. Classification model evaluation metrics (adapted from [49]).
No. Metric Name Metric Description
0 true positive (TP), true negative (TN), false positive (FP), false negative (FN)
is a summary of the prediction results; the
number of correct and incorrect predictions
1 Confusion matrix (CM)
is summarized with count values and
broken down by class
536
Electronics 2022, 11, 2504
Table 3. Cont.
No. Metric Name Metric Description
is the number of correct classes returned by
2 Precision (P) Precision = TP
TP+ FP
the classification model.
is the ability of a model to find all relevant
cases within a dataset, and is the number of
3 Recall (R) true positives divided by the number of Recall = TP
TP+ FN
true positives plus the number of
false negatives
F1 = 2 × Precision × Recall
is the harmonic mean of precision Precision+ Recall
4 F1 score
and recall F1 = 2TP+2TP
FP+ FN
the ROC curve shows how the recall vs.
Receiver operating precision relationship changes as we vary
5
characteristic (ROC) curve the threshold for identifying a positive data
point in our model
is the measure of the ability of a classifier to
6 Area under the ROC curve (AOC) distinguish between classes and is
(AOC) used as a summary of the ROC curve.
the number of correct predictions made as TP+ TN
7 Accuracy (A) Accuracy = TP+ FP+ FN + TN
a ratio of all predictions made.
is used to measure the quality of
predictions from a classification algorithm;
8 Classification report
the following measures are displayed:
precision, recall, F1, and support scores.
Accuracy is widely used to evaluate the classification performance. Additionally,
in the case of imbalanced datasets, the F1-score and metrics presented in Table 3 were
used [49].
3.3. General Algorithm for Determining the Classification Model Evaluation Metrics
Let DS be a labelled dataset with N instances and different NC class labels. During the
training phase, a classification model was generated, and predicted class labels were added
during the testing phase (1).
' (
YClass( j) , YPredictedClass( j) ∈ classlabel (i) , i = 1, NC; j = 1, N (1)
Metrics TP(i), TN(i), FP(i), FN(i), Precision(i), Recall(i), Accuracy(i) and f1(i) were
calculated for each class_label(i) according to Pseudocode 1.
The classification report was assembled, and the global metrics of precision, recall, accu-
racy, and F1 for the classification algorithm were determined, as indicated in Pseudocodes 2.
We recommend using MS Power BI to perform the data analysis. It is used in business
and industry sectors as an integral part of the technological and information systems
framework. In a self-service manner, business users can integrate data from a variety
of sources, perform advanced analysis, and design dashboards for process tracking and
decision support. Automated machine learning (AutoML) for dataflows enables business
analysts to train, validate, and invoke machine learning models directly in MS Power BI.
Pycaret, an open source, low-code machine learning library in Python, accessible from MS
Power BI offers support for automated machine learning workflow.
537
Electronics 2022, 11, 2504
Pseudocode 1
FOR i IN 1..NC DO
FOR j IN 1..N DO
IF Y_Predicted_Class(j) = Y_Class(j) AND Y_Predicted_Class(j) =class_label(i)
TP(i) = TP(i) + 1;
IF Y_Predicted_Class(j)<>Y_Class(j) AND Y_Class(j)<>class_label(i)
FN(i) = FN(i) + 1;
IF Y_Predicted_Class(j)<>class_label(i) AND Y_Class(j)<>class_label(i)
TN(i) = TN(i) + 1;
IF Y_Predicted_Class(j) = class_label(i) AND Y_Class(j)<>class_label(i)
FP(i) = FP(i) + 1;
IF TP(i) + FP(i)<>0
Precision(i) = TP(i)/((TP(i) + FP(i)));
ELSE
Precision(i) = 0;
IF TP(i) + FN(i)<>0
Recall(i) = TP(i)/((TP(i) + FN(i)));
ELSE
Recall(i) = 0;
IF TP(i) + TN(i) + FP(i) + FN(i)<>0
Accuracy(i) = ((TP(i) + TN(i)))/((TP(i) + TN(i) + FP(i) + FN(i)));
ELSE
Accuracy(i) = 0;
IF Precision(i) + Recall(i)<>0
f1(i) = 2*(Precision(i)*Recall(i))/((Precision(i) + Recall(i)));
ELSE
f1(i) = 0;
Pseudocode 2
FOR i IN 1..NC DO
classification_report(i,1) = Precision(i);
classification_report(i,2) = Recall(i);
classification_report(i,3) = Accuracy(i);
classification_report(i,4) = f1(i);
Global_precision = Global_precision + Precision(i);
Global_recall = Global_recall + Recall(i);
Global_accuracy = Global_accuracy + Accuracy(i);
Global_f1 = Global_f1 + f1(i);
Global_precision = Global_precision/NC;
Global_recall = Global_recall/NC;
Global_accuracy = Global_accuracy/NC;
Global_f1 = Global_f1/NC;
4. Analysis and Results
Right from the beginning, the objectives of our theoretical applied discourse were
established. Objective one aims to the introduction of a methodological framework using
design science research for data analysis. Based on relevant references on DSR [1,2,31–37],
we propose a multi-phase framework (Figure 7). Further, the development of artifacts
538
Electronics 2022, 11, 2504
was systematized by establishing activities and tasks specific to each phase within the
DSR framework (Table 2). Concrete specifications regarding the use of machine learning
algorithms are formulated.
The second objective refers to the unitary approach of metrics for evaluating the
performance of classification algorithms. The main evaluation metrics were briefly pre-
sented (Table 3) and a general algorithm for determining the classification model evaluation
metrics was proposed (Pseudocodes 1 and 2).
The next two objectives, mentioned in the introductory chapter, aim at the application
of the theoretical considerations for performance analysis.
The analysis regarding the “managerial capacity” of decision makers was performed
using the DSR framework, in compliance with the phases listed in Table 2. A 360-degree
evaluation form was chosen as the investigation tool and means of data collection [50]. The
following competencies are evaluated: decision making ability, conflict management, rela-
tionship management, employee motivation, influence and negotiation, strategic thinking,
results orientation, and last but not least planning and organization. Each competence was
based on four statements, each of which was assessed by assigning a score on a scale of one
to five. The resulting competency scores are in a range from 4 to 20 points (Appendix A).
The dataset centralizes the scores obtained by various managers and contains 195 final
instances (Figure 8). Eight competencies (decision making ability, conflict management,
relationship management, employee motivation, influence and negotiation, strategic think-
ing, result orientation, planning, and organization) were selected for data analysis using
machine learning techniques, such as clustering and classification.
Figure 8. O21. Dataset. Partial data.
The dataset contained unlabeled data and required further annotation. This was
achieved by modelling the data through clustering. PyCaret’s clustering module is an
unsupervised machine learning module that groups of a set of objects such that those in the
same group (called a cluster) are more similar to each other than to those in other groups.
Clustering was performed using the K-means algorithm (Script 1, Figure 9).
Script 1
from pycaret.clustering import *
dataset = get_clusters(dataset, num_clusters = 4, ignore_features = [‘ID_Manager’,
‘Industry_sector’, ‘Region’])
The classification module is “a supervised machine learning module that is used for
classifying elements into groups. The goal is to predict discrete and unordered categorical
class labels” [26]. We used various classification algorithms (Table 2) and calculated
evaluation metrics for each algorithm. The models were saved as pkl files. (Script 2).
539
Electronics 2022, 11, 2504
Figure 9. O31. Labelled dataset. Partial data.
Script 2
clf1 = setup(df, target = ‘Cluster’, silent = True, ignore_features = [‘ID_Manager’,
‘Industry_sector’,’Region’])
# train multiple models
algorithms = [‘knn’,’dt’,’catboost’,’nb’,’rbfsvm’,’lr’,’gpc’,’mlp’,’rf’,’qda’,’ada’,’gbc’,’lda’,’et’,
‘xgboost’,’lightgbm’,’svm’,’ridge’]
models = [create_model(i) for i in algorithms]
final_models = [finalize_model(models[i]) for i in range(len(algorithms))]
for x in range(len(algorithms)):
save_model(final_models[x], ‘D:/’+ algorithms [x])
After training different classification algorithms, the models were tested (Script 3).
The predicted class labels are associated with each instance of the test dataset (Figure 10).
Script 3
algorithms = [‘knn’,’dt’,’catboost’,’nb’,’rbfsvm’,’lr’,’gpc’,’mlp’,’rf’,’qda’,’ada’,’gbc’,’lda’,’et’,
‘xgboost’,’lightgbm’,’svm’,’ridge’]
from pycaret.classification import *
for i in range(len(algorithms)):
clasificator = load_model(‘D:/’ + algorithms[i])
dataset = predict_model(clasificator, data = dataset)
dataset.rename(columns = {‘Label’:’Label_’ + algorithms[i],’Score’: ‘Score_’ + algorithms[i]},
inplace = True)
The evaluation metrics were calculated for each classification model according to the
previously described “general algorithm for determining the classification model evaluation
metrics” (Pseudocodes 1 and 2).
We created, trained, and deployed a machine leaning model for each classification
algorithm available in PyCaret library. The following algorithms, which are listed in
alphabetical order, were applied: adaboost (ada), cat booster classifier (catboost), decision
tree (dt), extra tree classifier (et), extreme gradient boosting (xgboost), gaussian process
classifier (gpc), gradient boosting classifier (gbc), light gradient boosting (lightgbm), linear
disc analysis (lda), logistic regression (lr), k nearest neighbor (knn), multi level perceptron
(mlp), naives bayes (nb), random forest (rf), ridge classifier (ridge), support vector machine
(svm and rbfsvm), and quadratic disc analysis (qda) [26]. They are representative for all
classification algorithm categories (Figure 4).
540
Electronics 2022, 11, 2504
Figure 10. O44. Results of the testing process.
The automated machine learning (AutoML) workflow implemented by Scripts 2 and
3 generated the data artifacts specified in Table 2.
Further, the evaluation metrics for each algorithm were processed, namely precision,
recall, accuracy, and f1 metric (Figure 11). Script 4 is part of the Auto ML approach.
Script 4
algorithms = [‘knn’,’dt’,’catboost’,’nb’,’rbfsvm’,’lr’,’gpc’,’mlp’,’rf’,’qda’,’ada’,’gbc’,’lda’,’et’,
‘xgboost’,’lightgbm’,’svm’,’ridge’]
final_models = [finalize_model(models[i]) for i in range(len(al))]
for x in range(len(al)):
save_model(final_models[x], ‘D:/[x])
best = compare_models(include = al)
results = pull()
print(results)
Figure 11. O45. Evaluation metrics synthesis.
541
Electronics 2022, 11, 2504
According to the values obtained for accuracy, as well as for the other metrics, the
CatBoost algorithm proved to be the best performant classification algorithm in our analysis.
Therefore, this will be investigated further (Figure 12). CatBoost is an algorithm for gradient
boosting of decision trees. According to Pramoditha [51], CatBoost is one of the best
machine learning models for tabular heterogeneous datasets.
Figure 12. CatBoost algorithm. Evaluation metrics.
The confusion matrix contains the values of true positive (TP), true negative (TN), false
positive (FP), and false negative (FN) calculated for each class (Figure 12a). We observed
that most instances were correctly labelled. Most instances that were incorrectly labelled
belonged to class 0 (cluster 0).
The classification report presents the main classification matrices, namely, precision,
recall, and F1 score for each class (Figure 12b). We can notice that:
- The algorithm has a significant ability to label instances correctly, particularly in
classes 1 and 2.
- For classes 0, 1, and 3, the algorithm had a high capacity to find all instances; however,
it correctly labelled only half of the instances in class 2.
- The values of f1 for classes 0, 1, and 3 are appropriate and approximately equal to
an average of 0.9; however, for class 2, f1 is only 0.667. Although the precision of the
classification of the instances in class 2 was 1, the algorithm identified only three out
of the six instances of class 2.
The graph of the ROC curve shows that the classification model can place the instances
in a single class (Figure 12c). The graph shows that the instances of classes 0, 1, and 3
are approximately equal to the algorithm average of 0.93, indicating that these classes are
well-separated. The only class for which a lower score was obtained was class 2, which
had a score of 0.83. However, even for this class, the model provides a good measure of
the separability.
The learning curve for the CatBoost classifier indicated that increasing the number
of instances in the training set led to an increase in the validation score (Figure 12d). The
542
Electronics 2022, 11, 2504
training score maintains a value of one, which indicates that the model perfectly integrates
each newly added instance.
According to Huilgol [52], accuracy is used when true positives and true negatives are
decisive in the analysis, whereas the F1-score is used when false negatives and false positives
are the most important. Furthermore, the accuracy can be used when the class distribution is
similar, whereas the F1-score is a better metric when dealing with imbalanced classes.
The use of machine learning techniques for performance analysis makes a significant
contribution when operating with large datasets [27]. We identified concrete applications
of our proposal, namely: the application of the procedure within a multinational company
or in statistical research studies on companies.
The Power BI application integrates the data obtained through 360-feeback and performs
the analysis. The results are available to the management boards and research coordinators.
DSR is applied in various business and industrial engineering areas [53]. The literature
indicates different approaches to designing artifacts [31–41]. Our proposal comes to offer a
framework for data analysis using machine learning techniques. The theoretical discourse
was applied to a performance analysis.
5. Conclusions
DSR opens new research perspectives in information systems and data analysis. We
managed to complete an artifact design-centric approach adapted for data analysis. The pro-
posed DSR framework describes a multi-phase process containing activities and tasks that
allow the design, development, testing, validation, and communication of the considered
data and information artifacts.
Artifacts engineering is performed using machine learning techniques. We recommend
the use of AutoML to automate the iterative tasks of machine learning model development.
Mainly based on classification algorithms, the workflow also provides for the evaluation of
the applied algorithms.
The proposed design science research was applied in a managerial performance evalu-
ation project. Further steps are necessary to define a secure connection to the operational
HR database, where performance data are stored. In this sense, we are concerned to respect
all internal regulations and data governance prescriptions.
Author Contributions: Conceptualization, M.M.; methodology, M.M.; software, F.D.M.; validation,
M.M. and F.D.M.; writing—review and editing, M.M. and F.D.M. All authors have read and agreed
to the published version of the manuscript.
Funding: This research received no external funding.
Acknowledgments: This study was conducted by Muntean Mihaela, associate member of the East
European Center for Research in Economics and Business (ECREB) at the Faculty of Economics and
Business Administration, West University of Timisoara. Florin Daniel Militaru, contributed to the
completion of the paper, with the results of research undertaken within the Business Information
Systems Department.
Conflicts of Interest: The authors declare no conflict of interest.
543
Electronics 2022, 11, 2504
Appendix A
Table A1. The 360 feedback form for measuring a manager’s performance [51].
Competence Statements Evaluation Scale
Assess the implications of a strategic or potentially risky decision
1 2 3 4 5
and the impact it may have on the organization
Make good decisions based on a mix of analysis, intuition,
1 2 3 4 5
experience and logic.
Decision making Most of the solutions and suggestions offered by him/her prove
capacity 1 2 3 4 5
to be correct and precise in time.
It takes less popular measures when the situation demands it or
implements decisions even if it does not have the consent of all 1 2 3 4 5
its subordinates.
Manage issues firmly, directly and in a timely manner. 1 2 3 4 5
He/she is an active listener, able to understand the source of
1 2 3 4 5
conflicts and to suggest proper solutions.
Conflict management It easily reaches armistices and agreements, with the involvement
1 2 3 4 5
of a minimum number of third parties.
He/she finds ways out of difficult situations and manages to
1 2 3 4 5
value the disputes.
It relates well to all categories of people, regardless of the
1 2 3 4 5
hierarchical level, both inside and outside the company.
Relationships Communication with colleagues is clear and efficient. 1 2 3 4 5
management Provides current, direct, complete, actionable, positive and/or
1 2 3 4 5
corrective feedback to others.
Encourages open dialogue within the team. 1 2 3 4 5
Maintains a constant dialogue with the team members for whom
1 2 3 4 5
he is responsible for the quality and quantity of work and results
Appreciate the extra effort and communicate its recognition 1 2 3 4 5
Employee motivation He/she is actively concerned with the development of the staff for
1 2 3 4 5
whose performance he/she is responsible
Request input from each person in the team, support visibility
1 2 3 4 5
and invest in the right people with authority
He convinces others and gains their support 1 2 3 4 5
Influence and Use convincing arguments and ideas 1 2 3 4 5
negotiation He/she tends to negotiate whenever he/she has the opportunity 1 2 3 4 5
It is not discouraged by arguments against its objectives 1 2 3 4 5
Is capable to formulate new strategies and competitive plans. 1 2 3 4 5
Can accurately anticipate future consequences and trends. 1 2 3 4 5
Strategic thinking Can draw up a realistic and motivating strategic plan. 1 2 3 4 5
Think long-term, corroborating information and market trends,
1 2 3 4 5
anticipating possible developments and alternative action plans.
He focuses his efforts on priority tasks, reserving time for other
1 2 3 4 5
activities as well.
Shows a passion for business, reflected in a “can-do” attitude 1 2 3 4 5
Results orientation Helps others manage priorities by focusing on critical activities
1 2 3 4 5
for success.
Do not get lost in irrelevant details by quickly finding the shortest
1 2 3 4 5
path to the result.
Can organize people, activities and resources to finish
1 2 3 4 5
projects successfully.
Planning and Can coordinate multiple activities at once to accomplish one goal. 1 2 3 4 5
organization He plans his activity ahead of time and sets realistic deadlines. 1 2 3 4 5
He is a systematic and well-organized person who sets
1 2 3 4 5
clear priorities.
544
Electronics 2022, 11, 2504
References
1. Peffers, K.; Tuunanen, T.; Rothenberger, M.A.; Chatterjee, S. A design science research methodology for information systems
research. J. Manag. Inf. Syst. 2007, 24, 45–77. [CrossRef]
2. Paquette, J. A Brief Introduction to Useful Data Artifacts—And the Next Generation of Data Analysis Systems. Medium, 2021.
Available online: https://medium.com/tag-bio/a-brief-introduction-to-useful-data-artifacts-and-the-next-generation-of-data-
analysis-systems-1f42ef91ce92 (accessed on 30 December 2021).
3. Behn, R.D. Why measure performance? different purposes require different measures. Public Adm. Rev. 2003, 63, 586–606.
[CrossRef]
4. Stroet, H. AI in Performance Management: What Are the Effects for Line Managers? Bachelor’s Thesis, University of Twente,
Enschede, The Netherlands, 2020.
5. Bhardwaj, G.; Singh, S.V.; Kumar, V. An empirical study of artificial intelligence and its impact on human resource functions. In
Proceedings of the 2020 International Conference on Computation, Automation and Knowledge Management (ICCAKM), Dubai,
United Arab Emirates, 9–10 January 2020. [CrossRef]
6. Eight-Step Guide to Performance Evaluations for Managers—The Management Center. 2021. Available online: https://www.
managementcenter.org/article/eight-step-guide-to-performance-evaluations-for-managers/ (accessed on 30 December 2021).
7. Attaran, M.; Deb, P. Machine learning: The new ‘big thing’ for competitive advantage. Int. J. Knowl. Eng. Data Min. 2018, 5,
277–305. [CrossRef]
8. El Bouchefry, K.; de Souza, R.S. Learning in big data: Introduction to machine learning. In Knowledge Discovery in Big Data from
Astronomy and Earth Observation; Elsevier: Amsterdam, The Netherlands, 2020; pp. 225–249. [CrossRef]
9. Chakraborty, T. EC3: Combining clustering and classification for Ensemble Learning. In Proceedings of the 2017 IEEE International
Conference on Data Mining (ICDM), New Orleans, LA, USA, 18–21 November 2017. [CrossRef]
10. Alapati, Y.K.; Sindhu, K. Combining Clustering with Classification: A Technique to Improve Classification Accuracy. Int. J.
Comput. Sci. Eng. 2016, 5, 336–338.
11. Bertsimas, D.; Dunn, J. Optimal classification trees. Mach. Learn. 2017, 106, 1039–1082. [CrossRef]
12. Durcevic, S. 10 Top Business Intelligence and Analytics Trends for 2020. Information Management. 2019. Available online:
https://www.information-management.com/opinion/10-top-business-intelligence-and-analytics-trends-for-2020 (accessed on
20 March 2022).
13. Walowe Mwadulo, M. A review on feature selection methods for classification tasks. Int. J. Comput. Appl. Technol. Res. 2016, 5,
395–402. [CrossRef]
14. Dash, M.; Koot, P.W. Feature selection for clustering. In Encyclopedia of Database Systems; Springer: Boston, MA, USA, 2009;
pp. 1119–1125. [CrossRef]
15. Rong, M.; Gong, D.; Gao, X. Feature selection and its use in big data: Challenges, methods, and Trends. IEEE Access 2019, 7,
19709–19725. [CrossRef]
16. Madhulatha, T.S. An overview on clustering methods. IOSR J. Eng. 2012, 2, 719–725. [CrossRef]
17. Witten, I.H.; Frank, E.; Hall, M.A. Data Mining: Practical Machine Learning Tools and Techniques; Elsevier: Amsterdam,
The Netherlands, 2011.
18. Ghosal, A.; Nandy, A.; Das, A.K.; Goswami, S.; Panday, M. A short review on different clustering techniques and their applications.
In Advances in Intelligent Systems and Computing; Springer: Singapore, 2019; Volume 937, pp. 69–83. [CrossRef]
19. Celebi, M.E.; Kingravi, H.A. Linear, deterministic, and order-invariant initialization methods for the K-means clustering algorithm.
In Partitional Clustering Algorithms; Springer: Cham, Switzerland, 2014; pp. 79–98. [CrossRef]
20. Sinaga, K.P.; Yang, M.-S. Unsupervised K-means clustering algorithm. IEEE Access 2020, 8, 80716–80727. [CrossRef]
21. Papas, D.; Tjortjis, C. Combining clustering and classification for Software Quality Evaluation. In Artificial Intelligence: Methods
and Applications; Springer: Cham, Switzerland, 2014; pp. 273–286. [CrossRef]
22. Loukas, S. K-Means Clustering: How It Works & Finding the Optimum Number of Clusters in the Data. Medium, 2020. Available
online: https://towardsdatascience.com/k-means-clustering-how-it-works-finding-the-optimum-number-of-clusters-in-the-
data-13d18739255c (accessed on 30 December 2021).
23. Rani, Y.; Harish, R. A study of hierarchical clustering algorithm. Int. J. Inf. Comput. Technol. 2013, 3, 1115–1122.
24. Webb, G.I.; Fürnkranz, J.; Fürnkranz, J.; Fürnkranz, J.; Hinton, G.; Sammut, C.; Sander, J.; Vlachos, M.; Teh, Y.W.; Yang, Y.; et al.
Density-based clustering. In Encyclopedia of Machine Learning; Springer: Boston, MA, USA, 2011; pp. 270–273. [CrossRef]
25. Grabusts, P.; Borisov, A. Using grid-clustering methods in data classification. In Proceedings of the International Conference on
Parallel Computing in Electrical Engineering, Warsaw, Poland, 25 September 2002. [CrossRef]
26. Duda, R.O.; Hart, P.E. Pattern Classification and Scene Analysis; Wiley: New York, NY, USA, 1973; Volume 3.
27. Narula, G. Machine Learning Algorithms for Business Applications—Complete Guide. Emerj, 2021. Available online: https:
//emerj.com/ai-sector-overviews/machine-learning-algorithms-for-business-applications-complete-guide/ (accessed on 30
December 2021).
28. How to Select a Machine Learning Algorithm—Azure Machine Learning. 2021. Available online: https://docs.microsoft.com/
en-us/azure/machine-learning/how-to-select-algorithms (accessed on 30 December 2021).
29. Zhao, L.; Lee, S.; Jeong, S.P. Decision tree application to classification problems with boosting algorithm. Electronics 2021, 10, 1903.
[CrossRef]
545
Electronics 2022, 11, 2504
30. Nunamaker, J.F.; Chen, M.; Purdin, T.D.M. Systems development in information systems research. J. Manag. Inf. Syst. 1990, 7,
89–106. [CrossRef]
31. Weber, S. Design Science Research: Paradigm or Approach? AMCIS 2010 Proceedings. 2010. Available online: https://aisel.
aisnet.org/amcis2010/214/ (accessed on 2 March 2022).
32. Hevner, A.; March, S.; Park, J.; Ram, S. Design science in information systems research. MIS Q. Manag. Inf. Syst. 2004, 28, 75–105.
[CrossRef]
33. Venable, J.R.; Heje, J.P.; Baskerville, R.L. Choosing a Desing Science Research Methodology. ACIS 2017 Proceedings. 2017.
Available online: https://aisel.aisnet.org/acis2017/112 (accessed on 2 March 2022).
34. Vaishnavi, V.; Kuechler, W.; Petter, S. (Eds.) Design Science Research in Information Systems; Association for Information Systems:
Atlanta, GA, USA, 2004. Available online: http://www.desrist.org/design-research-in-information-systems/ (accessed on
2 March 2022).
35. Sein, M.K.; Henfridsson, O.; Purao, S.; Rossi, M.; Lindgren, R. Action design research. MIS Q. Manag. Inf. Syst. 2011, 35, 37–56.
[CrossRef]
36. Baskerville, R.; Pries-Heje, J.; Venable, J. Soft design science methodology. In Proceedings of the 4th International Conference on
Design Science Research in Information Systems and Technology—DESRIST’09, Philadelphia, PA, USA, 6–8 May 2009. [CrossRef]
37. Bilandzic, M.; Venable, J. Towards participatory action design research: Adapting Action Research and Design Science Research
Methods for Urban Informatics. J. Community Inform. 2011, 7. [CrossRef]
38. Ahmed, M.; Sundaram, D. Design Science Research Methodology: An Artefact-Centric Creation and Evaluation Approach. In
Proceedings of the Australasian Conference on Information Systems (ACIS), Sydney, Australia, 30 November–2 December 2011.
39. Herselman, M.; Botha, A. Evaluating an artifact in Design Science Research. In Proceedings of the 2015 Annual Research
Conference on South African Institute of Computer Scientists and Information Technologists—SAICSIT’15, Stellenbosch, South
Africa, 28–30 September 2015. [CrossRef]
40. Peffers, K.; Tuunanen, T.; Niehaves, B. Design science research genres: Introduction to the special issue on exemplars and criteria
for applicable Design Science Research. Eur. J. Inf. Syst. 2018, 27, 129–139. [CrossRef]
41. Muntean, M.; Dănăiaţă, D.; Hurbean, L.; Jude, C. A Business Intelligence & Analytics framework for clean and affordable energy
data analysis. Sustainability 2021, 13, 638. [CrossRef]
42. Elragal, A.; Haddara, M. Design science research: Evaluation in the lens of Big Data Analytics. Systems 2019, 7, 27. [CrossRef]
43. Achampong, E.K.; Dzidonu, C. Methodological Framework for Artefact Design and Development in Design Science Research. J.
Adv. Sci. Technol. Res. 2017, 4, 1–8. Available online: https://www.researchgate.net/publication/329775397_Methodological_
Framework_for_Artefact_Design_and_Development_in_Design_Science_Research (accessed on 30 December 2021).
44. Chicco, D.; Jurman, G. The advantages of the Matthews correlation coefficient (MCC) over F1 score and accuracy in binary
classification evaluation. BMC Genom. 2020, 21, 6. [CrossRef]
45. Martens, D.; Baesens, B. Building acceptable classification models. In Annals of Information Systems; Springer: Boston, MA, USA,
2009; pp. 53–74. [CrossRef]
46. Choi, J.-G.; Ko, I.; Kim, J.; Jeon, Y.; Han, S. Machine Learning Framework for multi-level classification of company revenue. IEEE
Access 2021, 9, 96739–96750. [CrossRef]
47. Muhammad, R.; Nadeem, A.; Azam Sindhu, M. Vovel metrics—Novel coupling metrics for improved software fault prediction.
PeerJ Comput. Sci. 2021, 7, e590. [CrossRef] [PubMed]
48. Hossin, M.; Sulaiman, M.N. A review on evaluation metrics for Data Classification Evaluations. Int. J. Data Min. Knowl. Manag.
Process 2015, 5, 2. [CrossRef]
49. Vujovic, Ž.Ð. Classification Model Evaluation Metrics. Int. J. Adv. Comput. Sci. Appl. 2021, 12, 6. [CrossRef]
50. Apt360. Chestionar Pentru Evaluarea Managerilor Din Prima Linie. 2019. Available online: https://www.evaluare360.ro/wp-
content/uploads/2019/01/Chestionar-angajati-Manageri-prima-line2019.pdf (accessed on 30 December 2021).
51. Pramoditha, R. 5 Cute Features of CatBoost. Towardsdatascience, 2021. Available online: https://towardsdatascience.com/5-
cute-features-of-catboost-61532c260f69 (accessed on 30 December 2021).
52. Huilgol, P. Accuracy vs. F1-Score. Medium, 2021. Available online: https://medium.com/analytics-vidhya/accuracy-vs-f1
-score-6258237beca2 (accessed on 30 December 2021).
53. Goecks, L.S.; De Souza, M.; Librelato, T.P.; Trento, L.R. Design Science Research in practice: Review of applications in Industrial
Engineering. Gest. Prod. 2021, 28, e5811. [CrossRef]
546
electronics
Article
KNN-Based Consensus Algorithm for Better Service Level
Agreement in Blockchain as a Service (BaaS) Systems
Qingxiao Zheng 1 , Lingfeng Wang 1 , Jin He 1, * and Taiyong Li 2, *
1 Industry College of Blockchain, Chengdu University of Information Technology, Chengdu 610225, China
2 School of Computing and Artificial Intelligence, Southwestern University of Finance and Economics,
Chengdu 611130, China
* Correspondence: [email protected] (J.H.); [email protected] (T.L.)
Abstract: With services in cloud manufacturing expanding, cloud manufacturers increasingly use
service level agreements (SLAs) to guarantee business processing cooperation between CSPs and
CSCs (cloud service providers and cloud service consumers). Although blockchain and smart contract
technologies are critical innovations in cloud computing, consensus algorithms in Blockchain as a
Service (BaaS) systems often overlook the importance of SLAs. In fact, SLAs play a crucial role in
establishing clear commitments between a service provider and a customer. There are currently
no effective consensus algorithms that can monitor the SLA and provide service level priority. To
address this issue, we propose a novel KNN-based consensus algorithm that classifies transactions
based on their priority. Any factor that impacts the priority of the transaction can be used to calculate
the distance in the KNN algorithm, including the SLA definition, the smart contract type, the CSC
type, and the account type. This paper demonstrates the full functionality of the enhanced consensus
algorithm. With this new method, the CSP in BaaS systems can provide improved services to the
CSC. Experimental results obtained by adopting the enhanced consensus algorithm show that the
SLA is better satisfied in the BaaS systems.
Keywords: BaaS system; blockchain consensus algorithm; KNN; service level agreement; transaction priority
Citation: Zheng, Q.; Wang, L.; He, J.;
Li, T. KNN-Based Consensus 1. Introduction
Algorithm for Better Service Level Blockchain, business analytics, and the Internet of Things (IoT) are the emerging in-
Agreement in Blockchain as a Service dustry trends to which scholars and practitioners have paid much attention in recent years.
(BaaS) Systems. Electronics 2023, 12, The state-of-the-art research related to these technologies has been summarized by Zhang
1429. https://doi.org/10.3390/ and Chen [1]. Blockchain as a Service (BaaS) is a new technology that combines cloud
electronics12061429
computing and blockchain technology. As a third-party service, BaaS provides customers
Academic Editor: Ping-Feng Pai with the ability to create and manage blockchain-based networks through cloud technol-
ogy. It is a relatively new technology trend that provides third-party services within the
Received: 4 February 2023
blockchain technology domain. Blockchain applications are more than just cryptocurrency
Revised: 28 February 2023
transactions. They have expanded to encompass all types of secure transactions. As a
Accepted: 14 March 2023
result, hosting services are increasingly in demand. Blockchain technology has been used
Published: 16 March 2023
to provide services to more customers as a service model through the cloud. This model
works similarly to SaaS, PaaS, and IaaS models, which support the usage of cloud-based
applications and storage. Blockchain technology is complex, and much effort is required
Copyright: © 2023 by the authors. to build, maintain, and monitor a blockchain system when applied. In order to increase
Licensee MDPI, Basel, Switzerland. the accessibility of the blockchain and distributed ledgers, we need to leverage blockchain
This article is an open access article with lower costs and less overhead, especially for businesses. BaaS is a promising technical
distributed under the terms and option that can meet these goals [2]. However, critical issues in current public blockchain
conditions of the Creative Commons systems prevent them from being used as a generic platform for different services and
Attribution (CC BY) license (https:// applications. Bitcoin can handle about 5.5 transactions per second (TPS), and Ethereum
creativecommons.org/licenses/by/ can process about 20 TPS, which is far below the mainstream payment systems. There is
4.0/).
Electronics 2023, 12, 1429. https://doi.org/10.3390/electronics12061429 https://www.mdpi.com/journal/electronics
547
Electronics 2023, 12, 1429
no silver bullet that solves all of these problems due to the Trilemma, as mentioned by the
founder of Ethereum, Vitalik Buterin: public blockchain systems can have only two of the
following three properties: decentralization, scalability, and security [3].
Most previous studies have not solved the scalability issue well. It is difficult for cloud
service providers (CSPs) to guarantee effective SLA with cloud service consumers (CSCs).
There are some studies that achieve better data query/sharing services based on blockchain
service, such as BlockShare [4], Verifiable Query Layer (VQL) [5], and vChain+ [6], but these
services cannot solve the SLA issue. To address the SLA issue in the BaaS environment, this
paper proposes a novel KNN-based consensus algorithm by classifying the transactions
with priority. Any factor that impacts the priority of the transaction can be used to calculate
the distance in the KNN algorithm. Such factors include the SLA definition, the smart
contract type, the CSC type, and the account type.
This paper has three main contributions: (1) A simple supervised learning method,
KNN, is used to build a consensus algorithm for the first time. (2) With the realization of
the full functionality of the enhanced consensus algorithm, the CSP in the BaaS systems
can provide improved services to the CSC. (3) Experimental results demonstrate that the
SLA is better satisfied in the BaaS systems. The transaction with higher priority that arrives
later is executed early.
We have organized the rest of the paper as follows. Section 2 provides a review of
related work. Section 3 depicts the problem studied in this paper. Section 4 describes prelim-
inaries, such as BaaS, cloud computing SLA in BaaS, and the KNN algorithm. The proposed
KNN-based consensus algorithm is detailed in Section 5. Section 6 reports and analyzes
the experimental results. Section 7 concludes this paper.
2. Related Work
2.1. Evolution of Consensus Algorithms
In decentralization, any node in a blockchain can submit a transaction to be stored in
the system, so it is important that there are processes that can ensure that each node reaches
a consensus to accept or reject the submitted transactions. These processes are essentially
considered consensus algorithms.
PoW is the first consensus protocol used in blockchain. It works with Bitcoin and
Ethereum, among others. In each round of consensus, PoW uses computational power
competition to decide which node can pack recent transactions into a new block. PoW guar-
antees eventual consistency based on the major distributed nodes with high computational
power in reaching a consensus. It is a probabilistic-finality consensus protocol [7].
PoS was created to overcome shortages that occur when PoW consumes too much com-
putational power. In each round of consensus, PoS considers not only the computational
power but also the stake held when deciding which node can pack recent transactions into
a new block. The difference between PoS and PoW is the importance of the amount of stake
(coins) and of how many times the nonce is adjusted. PoS is also a probabilistic-finality
consensus protocol [7].
Raft reaches a consensus by an elected leader. A node in a blockchain system with
Raft is either a leader or a follower and can be a candidate in an election scenario when a
current leader is unavailable. The Raft leader has the responsibility of logging replications
to the followers, and it periodically notifies the followers of its alive state by sending a
heartbeat message. Raft implements a consensus based on the leader schema. The whole
blockchain system has only one elected leader, which has full responsibility for managing
logged replications to followers.
PBFT provides a practical Byzantine state machine replication that tolerates the
Byzantine Generals’ Problem caused by malicious nodes. It assumes that these malicious
nodes have independent failures and send manipulated messages. Distributed nodes in a
blockchain system with PBFT are appointed as leaders, in turn, and others are appointed as
backup nodes. All nodes in the blockchain system assume that all honest nodes will make
an agreement by using predefined rules when communicating with each other.
548
Electronics 2023, 12, 1429
The above consensus algorithms are the main types of consensus algorithms used in
the blockchain system. They have different decentralization and transaction throughput
capabilities, and these consensus algorithms have their own application scenarios based on
the requirement of decentralization and performance grades.
The data structure of the transaction in most blockchains is simple. It includes a receiver
address, transaction amount, etc. In a typical blockchain system, such as Bitcoin, the receiver ad-
dress is located in the “Locking-Script” field of a transaction output, and the transaction amount
is located in the “Amount” field of a transaction, as shown in Tables 1 and 2. The blockchain
node verifies the validity and effectiveness of the transaction, while transactions are not classified
or processed with priority in the consensus procedure since there is no field in the transaction
data structure to describe the transaction priority or type [8]. There is an opportunity for opti-
mization by classifying and processing transactions with priority. The method introduced in
this paper uses a strategy that ensures that transactions with higher priority can be processed in
a timely manner.
Table 1. The structure of a transaction in Bitcoin.
Size Field Description
4 bytes Version Specifies which rules this transaction follows
1–9 bytes (VarInt) Input Counter How many inputs are included
Variable Inputs One or more transaction inputs
1–9 bytes (VarInt) Output Counter How many outputs are included
Variable Outputs One or more transaction outputs
4 bytes Locktime A Unix timestamp or block number
Table 2. The structure of a transaction output in Bitcoin.
Size Field Description
8 bytes Amount Bitcoin value in satoshis
Locking-
1–9 bytes (VarInt) Script Locking-Script length in bytes, to follow
Size
Locking-
Variable A script defining the conditions needed to spend the output
Script
2.2. QoS Assurance
Previous studies show that most of the recently developed public blockchain systems
focus on increasing transaction throughput to improve scalability. Even if the existing
consortium blockchain TPS is improved compared with public blockchains, the efficiency
of the consensus algorithm is still low, and its fault tolerance is still poor [9].
Blockchain technology plays an important role in supporting Service Level Agreements
(SLAs) that guarantee quality of service (QoS) standards for various service providers.
Meanwhile, although smart contracts are applied in traditional cloud providers, SLAs are
rarely used to provide improved service [10].
The blockchain data are used in the BaaS system to provide a range of operational
services, such as search queries and task submission on the blockchain [11]. Driven by
BaaS, the content of a cloud service becomes more abundant, and the CSC increases its
requirements for QoS [12,13]. In order to solve the QoS assurance problem between the CSP
and CSC, one method is proposed to support the cloud computing service level agreement.
The purpose of this agreement is to create a healthy environment for operations on the
network so that the CSC can enjoy not only the service promised verbally by the CSP
but also a service that is regulated and fully protected [14].
Existing research recognizes the critical role played by the service provider [15], but it
lacks a valid method that enhances the consensus algorithm with improved QoS assurance.
Since smart contracts stand on the application layer, providing QoS assurance for smart
549
Electronics 2023, 12, 1429
contracts is relatively inefficient and is not the best choice; it is better to put this assurance
in the kernel module of the BaaS system for all transactions.
According to the above studies, the existing consensus algorithms cannot provide
effective support for SLAs between a CSP and a CSC. It is important to provide QoS
assurance in a consensus algorithm, and how various transactions are classified is key in
supporting QoS. As the KNN is one of the simplest classification methods, it was chosen
here for classifying transactions. The main aim of a KNN is to find k training samples
that are closest to the new sample and assign the majority label of the k samples to the
new sample. Despite its simplicity, the KNN has been successful in solving a wide range
of regression and classification problems, including handwritten characters and image
recognition scenarios. As a non-parametric approach, it often succeeds in classification
situations where the decision boundary is highly irregular [16].
In this paper, we introduce a KNN-based consensus algorithm for improved service
level agreements in BaaS systems. Even with the efficiency or poor fault tolerance in BaaS
systems, the QoS assurance between the CSC and the CSP is better achieved with the
enhanced consensus algorithm.
3. Problem Definition
Performance and scalability are always key non-functional requirements in appli-
cation systems, and such application systems generally achieve extremely high transac-
tion throughput. China’s central bank digital currency, DCEP, for example, has about
220,000 TPS. While blockchain systems or BaaS achieve a lower transaction throughput,
Bitcoin has 5.5 TPS, and Ethereum has 20 TPS on average. The CSP in BaaS can only provide
a similar transaction throughput performance; it cannot meet the requirements of the CSC
in the SLA due to the limitation of throughput [17].
The two major challenges of blockchain, scalability and throughput issues, have been
studied and improved extensively as the below methods.
Consortium blockchain does not use high-power consensus algorithms such as PoW.
They consume much effort and have a complicated consensus process. Hyperledger Fabric
is a typical consortium blockchain that uses a Raft or PBFT consensus algorithm [18] to
reach a consensus faster than a public blockchain that uses PoW or PoS. It can achieve
higher throughput than a public blockchain, and its throughput is 3500 TPS on average [17].
The Ethereum community scheduled a scaling method that performs sharding to im-
prove Ethereum’s scalability and capacity. It splits Ethereum data horizontally to spread the
load. After Ethereum upgrades to 2.0 with sharding, it is expected to reach 100,000 TPS [17].
NeuChain utilized an ordering-free consensus that makes ordering implicit through
deterministic execution to markedly improve the throughput of the blockchain system.
The distributed experimental results show that NeuChain can achieve 47.2–64.1X through-
put improvement over HyperLedger Fabric [19].
Some hardware methods to improve blockchain performance have been proposed.
For instance, a FPGA-based NoSQL caching system with high performance was proposed
to improve the throughput and scalability of the blockchain system, and this can increase
the throughput to about 10,000 TPS when a cache hit occurs [20].
Except for the above performance optimization for consensus algorithms, some pro-
posals for the optimization of other aspects related to the blockchain system and the
blockchain-based framework have also been researched. For some special scenarios, such
as confidential transactions, the SymmeProof method, used to reduce the transmission
cost, was proposed, and it can improve communication efficiency and indirectly improve
the transaction throughput for special types of transactions [21]. A mechanism where full
nodes can be compensated fairly for their full blockchain data storage and where clients
can query blockchain data effectively was constructed [22]. LineageChain provides an
innovative method to support efficient provenance and history data query processing [23].
The secure performance of the blockchain-based federated learning framework has been
proposed to be optimized [24].
550
Electronics 2023, 12, 1429
Due to the need to establish trust between completely anonymous entities, a time-
consuming mining-based consensus mechanism was used. Thus, it takes a long time to
achieve transaction finality and results in much lower transaction throughput. The limi-
tation of throughput can be increased by using the methods mentioned above. However,
compared to traditional e-business application systems that do not adopt blockchain tech-
nology, the optimized blockchain still presents a gap between throughput performance and
the requirements of e-business scenarios. Although some of the methods mentioned above
can improve the throughput of the blockchain system to different degrees, they generally
cannot be applied for most scenarios.
Considering the existing studies on blockchain performance optimization, the through-
put of a blockchain system cannot reach the same magnitude as traditional e-business
application systems. Therefore, another approach where the CSP of BaaS provides an SLA
that meets the CSC’s requirements is needed.
4. Preliminaries
4.1. BaaS
Blockchain as a Service (BaaS) is a service provided by third parties that create and
manage cloud-based networks for customers building their own blockchain applications.
The decentralization of blockchain, the pervasiveness of IoT, and the high computing power
of cloud computing are combined in BaaS, while the transparency and openness of the
system are ensured. The main functional behaviors of blockchain, such as off-chain and
on-chain synchronization, node validity, consensus, and forking, are managed by BaaS.
The CSC can fully outsource the technical overhead to the CSP [25].
BaaS inherits blockchain’s challenges, synchronization mechanism, transaction through-
put, storage space, network congestion, accessibility, and cost issues, among others. As dis-
cussed in Section 3, the transaction throughput of the blockchain system cannot be im-
proved to match the magnitude of traditional e-business application systems. BaaS also
has a transaction throughput issue that cannot be completely resolved. This paper depicts
a method to optimize SLAs for key transactions when transaction throughput cannot be
further promoted in BaaS.
4.2. Cloud Computing SLAs in BaaS
BaaS is introduced as an important part of the cloud service platform of several
giant enterprises that can provide a trustworthy decentralization service, such as the
Alibaba-built BaaS system on Kubernetes, the IBM-built BaaS system on Bluemix, and the
Microsoft-built BaaS system on the Microsoft Azure cloud platform [2].
An SLA formally defines the relationship between two or more parties in BaaS, one of
which is the CSC and one of which is the CSP. It specifies what CSCs can be served by a
CSP, the obligations that both the CSC and the CSP shall fulfill, the objectives of the service
related to performance, availability, and security, and the processes that guarantee compli-
ance with SLAs. In general, an SLA includes the following typical components: the type of
service to be provided; the desired performance level of the service; the reporting process
that occurs when the service is unstable or unavailable; the time frame for responding and
issuing a problem resolution; the schema for monitoring and reporting the service level;
the consequences that result when the CSP does not fulfill its promises; termination clauses;
and constraints of service. The SLA is used to evaluate the QoS provided by the CSP in
BaaS, as in IaaS, PaaS, and SaaS.
4.3. KNN
As a typical supervised learning method in machine learning, the k-nearest neighbors
algorithm (KNN) has shown its advantages for both classification and prediction [26–28].
It is a supervised learning classifier and is used to classify or predict the grouping of an
individual data point according to the distance between different feature vectors. KNN has
two main phases: (1) the training phase, in which feature vectors are stored and labels of
551
Electronics 2023, 12, 1429
the training samples are classified, and (2) the classification phase, in which an unlabeled
vector is classified by assigning the most frequent label among the k training samples that
are nearest to that vector. Although it can be used in either regression or classification, it is
typically used as a classification algorithm, as in this paper.
The parameter k of the KNN has an extraordinary impact on the classification result,
and the data impact the best choice of k. In general, a larger k reduces the effect of noise on
classification, but it is then less distinct among class boundaries. Cross-validation is used
when assigning different k values to different test samples in previous solutions. A kTree
method that learns different optimal k values for different tests of individual data points is
proposed in the training stage during kNN classification [29].
Although KNN was developed by Joseph Hodges and Evelyn Fix in 1951 [30], due to
its simple implementation and relatively excellent performance, it, along with its improved
methods, has been widely used in the applications of several industries in the last three
years, including cancer diagnosis in medicine [31], gas-bearing reservoir prediction in
geophysics [32], and antenna optimization and design in the electronic industry [33]. This
paper applies the KNN to classify the priority of the transaction in BaaS, and transactions
are executed with different priorities based on priority classification. It should be noted
that the KNN can be replaced by other classification models in practice.
5. KNN-Based Consensus Algorithm
We propose a KNN-based consensus algorithm in this paper, and we describe this
algorithm in three subsections: the Priority-Queue-Enabled Transaction Pool, Attribute Se-
lection in the KNN-Based Consensus Algorithm, and Transactions Classified to a Different
Priority Queue by Adopting the KNN-Based Consensus Algorithm. The first subsection
introduces how the existing consensus algorithm puts newly received transactions into
the transaction pool and points out that our optimization aim is to classify newly received
transactions and determine their priority according to the classification results. The second
subsection explains how classification attributes are selected, and the third subsection
introduces how transactions are classified and how the transaction pool is filled according
to the classified priority queue.
5.1. The Priority-Queue-Enabled Transaction Pool
The blockchain system only allows a limited number of transactions since a block can
only contain a limited number of transactions. Transactions that exceed the limit of arrival
should not be included in the block. For example, in a four-node consortium blockchain
system, a Practical Byzantine Fault Tolerance algorithm [34] (also known as PBFT) is
applied, where multiple clients connect to the blockchain system, and the transaction count
limit of the transaction pool is set to 1000. As the leader node, Node4 picks the transactions
to be sent to the Transaction Pool. However, once it reaches the pool limit, the transactions
that arrive later will not be sent to the transaction pool. The existing PBFT consensus
protocol can be illustrated in Figure 1.
A new priority-queue-enabled transaction pool is introduced in this paper. Based on
the attributes, received transactions should be classified into queues of different priorities,
and each queue is a first-in first-out queue. The transactions that arrive later are cached
once the queue is full. The details on how the attributes are selected and how the incoming
transactions are classified will be presented in the following subsections.
552
Electronics 2023, 12, 1429
Figure 1. The PBFT consensus protocol.
5.2. Attribute Selection in the KNN-Based Consensus Algorithm
The account type, the CSC (cloud service consumer) type, and the contract type i
chosen as the attributes to be used in the KNN algorithm to calculate the distance.
(1) Account type. There are different kinds of roles in the blockchain system. Roles
based on access control should usually be defined in the system, such as chain ad-
ministrators, system administrators, and ordinary accounts. Chain administrators
have access control permissions, that is, grant permissions. System administrators
need to manage permissions related to system functions, and each permission should
be granted independently, including contract deployment, user table creation, node
management, and system parameter modification. Chain administrators can autho-
rize other accounts to be chain administrators or system administrators or authorize
ordinary accounts to write table lists. Table 3 lists the permissions related to the roles.
Table 3. Permissions related to the roles.
Permission Type
Permission of chain administrators
Permission of system administrators
Permission to deploy contracts
Permission to create user tables
Permission to manage nodes
Permission to modify system parameters
Permission to write user tables
(2) CSC type. Transactions from different CSCs have varying priorities. Since CSC
clients run similar CSCs, they should have similar priorities. However, if a CSC client
experiences limitations in terms of CPU, memory, storage, or network resources, it
may need to adjust the CSC priority accordingly.
(3) Contract type. Besides contracts relating to chain management, there are many smart
contracts. Some of them handle time-critical applications, some of them handle
applications that are not so critical but are urgent, and some of them do not care about
the timing. In the consortium Blockchain FISCO BCOS [35], for example, there are
many contract types in the consortium Blockchain system, as shown in Tables 4 and 5.
553
Electronics 2023, 12, 1429
Table 4. Address range in FISCO BCOS [35].
Address Use Address Range
Ethereum precompiled 0x0001–0x0008
Reserve 0x0008–0x0fff
Precompiled contracts in FISCO BCOS 0x1000–0x1006
Reserved in FISCO BCOS 0x1007–0x5000
Interval assigned by user 0x5001–0xffff
Reserved for CRUD 0x10000+
Used by Solidity Other address
Table 5. Precompiled contracts in FISCO BCOS [35].
Address Feature
0x1000 managing system parameters
0x1001 contract of the table factory
0x1002 implementing CRUD operations
0x1003 managing consensus nodes
0x1004 Contract Name Services
0x1005 managing storage table authorities
0x1006 configuring parallel contracts
The chain management contracts have higher priority when we send transactions to the
Tx pool. For those fundamental contracts, such as the table factory and CRUD operations,
we cannot determine the priority that depends on the CSC’s request. The contract type can
be used to calculate the priority.
5.3. Transactions Classified to a Different Priority Queue by Adopting the KNN-Based
Consensus Algorithm
A KNN-based consensus algorithm is proposed to select the transactions for the queue.
When a CSC is registered, we can obtain the key properties of the transactions in this
CSC, which may impact its transaction priority, such as the SLA type, the contract type,
the account type, the CSC type, the CPU type, the memory size, the storage type, and the
network bandwidth.
Classification is an important task in machine learning. The KNN algorithm is simple
and accurate and is used for regression models and pattern classification [36]. The term
“non-parametric” is used when there are no parameters, or there is a fixed number of
parameters, regardless of data size. The size of the training dataset determines the param-
eters, although no assumptions need to be made about the underlying data distribution.
Therefore, KNN is probably the best choice for any classification study that involves little
or no prior knowledge of the data distribution. KNN is also a lazy learning method,
which means it stores all training data and waits to generate test data without creating a
learning model [37]. This is the reason why the KNN algorithm was chosen to optimize the
consensus algorithm.
The KNN algorithm classifies as follows: there is an existing set of sample data or a
training set. All of these data have been labeled, and we know the class of each piece of
data. When a new piece of data has no label, we compare that new piece of data with
every existing piece of data. We then take the nearest neighbors and check their labels. We
look at the k data that are most similar to the known dataset, which is what k represents.
Finally, we perform a majority vote on the similar k data, and the label of the winning vote
is selected as the new class to be assigned to the new piece of data. The detailed steps to
calculate distance and determine the k value are listed below:
554
Electronics 2023, 12, 1429
(1) The distance calculation and normalization procedure is as follows: We can use
n
d( p, q) = ∑ ( p i − q i )2
i =0
to calculate the Euclidean Distance between input data and existing data. Which term
in the above equation makes the most difference? It must be the one with the largest
magnitude. To reduce the impacts of the magnitude, we need to normalize the sample
data to give all factors an equivalent weight. In this paper, every attribute is scaled
from 0 to 1, which can be formulated as
newValue = (oldValue − min)/(max − min).
(2) The KNN algorithm does not need a training procedure. However, the selection of
k is important for accuracy. Basically, k should be an integer between 1 and 20. We
divided the sample data into two portions: 90% of them was used for the known set,
while the remaining 10% was for testing. We increase k successively and calculate the
accuracy. The k value that achieves the highest accuracy is chosen for classifying the
transactions from the incoming client in the final algorithm. Algorithm 1 describes
the procedure by which the incoming transaction is classified into different priority
queues, while Algorithm 2 details how transactions are collected and sent to Tx Pool.
In the system, there are N queues starting from Q1 to Q N , where Q N and Q1 have the
highest and lowest priority, respectively. n is in 1..N, and Qn . size denotes the number
of transactions in Qn .
Algorithm 1 Transaction classification.
Input: Tx : The incoming transaction; Q1 . . . Q N : The priority Q list from Q1 to Q N ; sample:
The sample dataset;
Output: updated Qn
1: Initial trainingData = prepareLabeledDataset(sample); Prepare training dataset
2: n = classify(Tx ,trainingData,k) Classify Tx with given training data and k value,n
means which Qn it belongs to
3: if (Qn . size < MAX_SIZE) then
4: PUSH Tx to Qn ; PUSH Tx to corresponding Qn once the Q isn’t full
5: else
6: Save Tx to memory pool; Otherwise temporarily save the Tx to memory pool
7: end if
8: return Qn
Algorithm 2 Prepare the Tx Pool.
Input: Q1 . . . Q N : The priority queue list from Q1 to Q N ; POOL_LI MIT: The limit on the
number of transactions that can be accommodated in the Tx _Pool;
Output: Tx _Pool
1: Set Tx _Pool to empty, j = N; j = N −→ start to pick up priority queue item from Q N
to Q1
2: while (Tx _Pool. size < POOL_LI MIT) and (j > 0) do Keep filling the pool in order
of priority of the queue items until j ≤ 0 or Tx _Pool is full
3: Fill Tx _Pool with Q j
4: j−− Move to the next lower priority queue item
5: end while
6: Save remaining queue items to memory pool if the Tx _Pool is full;
7: return Tx _Pool
555
Electronics 2023, 12, 1429
With the KNN algorithm, the consensus algorithm can be optimized with SLA as-
surance. Any transaction that is classified with higher priority can be handled earlier.
Figure 2 shows the data flow through which transactions are selected and sent to the
transaction pool.
Figure 2. Data flow through which transactions are selected and sent to the transaction pool.
Figure 3 provides the overall framework of the enhanced KNN-enabled consensus
algorithm. As shown in the figure, the newly added KNN-enabled transaction classification
module is a new concept in the BaaS system. Any CSP can integrate this module into
its BaaS framework when it wants to provide a guaranteed SLA to the CSC. Some minor
changes are required when preparing the transaction pool, which picks up transactions
in the order of priority. If the SLA of one transaction is 1 s, 2000 transactions come in
within 1 s, the TPS of the BaaS system is 1000, and the CSP receives this transaction with
a sequence number 1100. Only transactions with a sequence number smaller than 1000
can be handled, so this transaction cannot meet the requirements of the SLA. With this
KNN-enabled consensus algorithm, since it has a higher priority, it can be sent to the
transaction pool with a smaller sequence number (e.g., 100), and it can be handled earlier
within the SLA.
Figure 3. The KNN-enabled PBFT consensus algorithm.
6. Simulation Experiments and Analysis
6.1. TPS Limit Measured from the Existing BaaS System
To evaluate the proposed consensus algorithm, we ran a performance test on the
well-known FISCO-BCOS Consortium Blockchain system. The flowchart of the test process
is shown in Figure 4.
556
Electronics 2023, 12, 1429
Figure 4. Performance test flow chart.
We deployed a Cloud Virtual Machine standard type S3 on the Tencent Cloud to
simulate the BaaS system. Tables 6 and 7 list the details of the hardware and software
environment, respectively.
Table 6. Virtual machine hardware configuration.
Hardware Type Hardware Configuration
CPU Intel Xeon Cascade Lake 8255C (2.5 GHz)
vCPU 4 Core
Memory (GB) 4 GB
System disk type High-performance cloud disk
System disk size (GB) 50 GB
Bandwidth 100 Mbps
Table 7. Virtual machine software configuration.
Software Type Software Version
FISCO BCOS V2.7.2
OS CentOS 7.6 64 bit
WeBase V1.5.1
JAVA jdk1.8.0
IDE IntelliJ IDEA 2022.2.2 (Ultimate Edition)
A JAVA performance testing application [38] was used to measure the TPS on the BaaS
simulation system. It started at 1000 transactions and set the TPS limit from 10 to 100 with
a step of 10. Figure 5 shows the Actual TPS/TPS Limit results. The TPS limit setting is the
maximum number of transactions that the testing application is allowed to send, and the
actual TPS is the actual number of transactions that the testing application sends. If the
actual TPS is smaller than the TPS limit setting, then the testing application has reached the
maximum TPS supported by the BaaS system.
557
Electronics 2023, 12, 1429
Figure 5. TPS limit of the performance evaluation system.
6.2. Simulation Experiments with the Existing Consensus Algorithm
We considered transaction type, account type, and CSC type as the input features of
the KNN. The normalized values are from 0 to 1, where 0 is the highest priority and 1 is the
lowest priority.
Without a KNN-based consensus algorithm, the transactions should be handled in
a FIFO way. In this way, the transaction that arrived early will be served early. We
generated 1000 transactions with different transaction types, account types, CSC types,
and arrival times. Table 8 shows part of the transaction data. Algorithm 3 illustrates how
the transaction pool picks up the transactions in a FIFO way. Correspondingly, Figure 6
shows a scatter diagram of the handled transactions.
Table 8. Samples of transactions.
Transaction Type Account Type CSC Type Arriving Time (ms)
0.503 0.536 0.592 506
0.014 0.399 0.454 539
0.655 0.547 0.991 52
0.328 0.095 0.579 152
0.271 0.810 0.502 822
0.734 0.675 0.667 391
... ... ... ...
0.608 0.726 0.806 84
0.472 0.610 0.017 935
0.410 0.239 0.538 257
0.870 0.715 0.617 23
Algorithm 3 Transactions selected with the FIFO method.
Input: Tx _Table: A 2D array as the transaction table, one row presents one Tx ;
Output: Q: An FIFO Q with all transactions;
1: Set Q to empty;
2: while (Q. size < Tx _MAX) and (Tx _Table has unused transaction) do Keep picking
up Tx fromTx _Table until Q is full or Tx _Table has no unused transaction
3: Get a new Tx from Tx _Table
4: Insert Tx to Q
5: end while
6: return Q
Figure 6 shows that, with the FIFO method, transactions that arrive earlier will be
handled earlier, even if it has a lower priority classified by their attributes. The transac-
tion start time is irrelevant to its priority, and the higher priority transaction will not be
handled earlier.
558
Electronics 2023, 12, 1429
Figure 6. FIFO way transaction scatter diagram.
6.3. Simulation Experiments with the KNN-Enabled Enhanced Consensus Algorithm
6.3.1. First Round of k Value Selection
In this paper, Algorithms 1 and 2 are used to classify 1000 transactions into 5 priority
queues using the KNN algorithm, in which the number of nearest neighbors, k is an
important parameter. First, we apply Algorithm 4 to the selection of the best k value. It
adopts the KNN classification using Scikit-learn in python. Generally, the dataset is split
into a training set and a testing set. We then run the KNN classifier with different k values.
The accuracy score is used to check the accuracy of our KNN model and the k value. The k
value with the highest accuracy score should be selected as the best k value for handling
unknown incoming transactions and checking its target priority.
Algorithm 4 KNN k value selection with a single training/test set split.
Input: Training_Data: The prepared transaction training data; Training_Target: The target
priority of the prepared transaction training data; k: The k value used in KNeigh-
borsClassifier function;
Output: accuracy_score: The accuracy score of the given k value;
1: Xtrain, Xtest, ytrain, ytest=train_test_split ( Training_Data, Training_Target, test_size =
0.3); The dataset is split into a training set and a testing set, and the testing set size is
30 percent
2: knn = neighbors.KNeighborsClassifier(k, weights = “distance”) Prepare the KNN
classifier by using the Scikit-learn module with the specified k value
3: knn.fit(Xtrain, ytrain) Fit the KNN classifier with the split training set
4: yprediction = knn.predict(Xtest) Predict the target priority of the split testing set
5: accuracy_score = accuracy_score ( ytest, yprediction ) Check the accuracy of the target
priority of the testing set
6: return accuracy_score
We plotted the accuracy of different k values ranging from 1 to 20 in Figure 7. It
demonstrates that k = 12 can achieve the highest accuracy among all k values. Therefore,
we used k = 12 for KNN in all remaining experiments. A flowchart for classifying all
1000 transactions into the 5 priority queues once k is fixed is shown in Figure 8.
559
Electronics 2023, 12, 1429
Figure 7. k value selection.
Figure 8. Transaction classification.
6.3.2. Choose a k Value in K-Fold cross-Validation
In Section 6.3.1, we presented the initial method for selecting the best value of k.
However, is this the optimal k value? In the first round’s KNN k value, we only use a
single training/test set split. The test set will only include a small portion of randomly
selected data. In this scenario, the test set may not accurately represent “new unseen data”,
which could lead to an overestimation of performance if it is used alone (due to potentially
significant variability in the test results). By using cross-validation, all available data can be
used for testing purposes, thereby ensuring that “bad” observations also play a role during
the testing process. The train–test split and k-fold cross-validation are both examples of
resampling methods in statistics. Resampling methods involve taking a sample from a
dataset and using it to estimate unknown quantities. These techniques are particularly
useful in machine learning and data analysis when a limited amount of data is available
for model training and evaluation. The k value generated by using only one training/test
set split will change due to the selection of the training/test set. We must use k-fold
cross-validation to eliminate this effect, so we use the following algorithm to ensure that
we consider all of the elements in the dataset. We finally obtain a k value of 4, as shown in
Figure 9 below.
560
Electronics 2023, 12, 1429
Figure 9. Cross-validated accuracy score scatter diagram.
6.3.3. Performance Optimization and Evaluation
When we obtain an optimal k value, we use 1000 transactions as the training set,
and their layout is shown in Figure 10. In the figure, different categories of data in the
training set data sometimes overlap (meaning that the categories of this part of the data are
blurred). This part of the data will cause some model overfitting. Based on the learning
curve in Figure 11, we know that there are still opportunities to optimize performance.
One idea is to directly remove this part of the overlapping data, which is referred to as a
clipping method.
Figure 10. Original training set scatter diagram.
561
Electronics 2023, 12, 1429
Figure 11. Original training set learning curve scatter diagram.
The clipping method randomly divides the training set, D, into two parts. One part
is used as a new training set, and the other part is used as a test set. Based on the new
training set, the KNN method is used to classify the test set, and the misclassified samples
are removed from the entire training set. Since the division of the training set D is randomly
divided, it is difficult to ensure that the samples in the overlapping part of the data will be
eliminated in the first clip. After obtaining the new training set, the above operations can
be repeated, and clearer class boundaries can be obtained. We can obtain its layout image
(Figure 12) and learning curve (Figure 13), as shown below. Compared with the original
training set, we achieved improved performance with a smaller size.
Figure 12. Clipping training set scatter diagram.
By observing the learning curve optimized by the clipping method, it can be seen
that when the number of samples is around 300, it already has a good fitting performance.
At the same time, as shown by the layout of samples in Figure 12, there are a large number
of samples in the center of each class, indicating that we can reduce the size of the training
set by compressing the KNN training set. The compressing method is used when a large
number of samples of the same type are concentrated in the center of the cluster, and these
concentrated samples have little effect on classification, so these samples can be discarded.
The training set is divided into two parts in this method. The first part is a store that contains
a portion of the samples, and the second part is a grab bag that contains the remaining
samples. The store is used for the training set of the KNN model, and the grabbag is
562
Electronics 2023, 12, 1429
used for the test set. The misclassified samples are moved from the grab bag to the store.
The store continues to be used with increased samples, and the grab bag with decreased
samples is used to train and test the KNN model again until all samples in the grab bag are
correctly classified or until the number of samples in the grab bag is 0. After compression,
the store keeps a portion of the randomly selected samples at initialization as well as the
misclassified samples in each subsequent cycle. Since the clipping method removes all
outliers, these selected misclassified samples are concentrated at the edge of the cluster and
are considered correct samples with a large classification effect. The final training set is
smaller. We can see its layout in Figure 14. The learning curve in Figure 15 shows that the
training set still has a similar accuracy to that of the clipping training set.
Each transaction will be executed with its priority, and arrival time is only used
when the transactions have the same priority. If two transactions have the same priority,
the transaction that arrived earlier will be executed earlier. Table 9 describes the priority
and new start time of each transaction based on its attributes.
Figure 13. Clipping training set learning curve scatter diagram.
Figure 14. Compressing training set scatter diagram.
563
Electronics 2023, 12, 1429
Figure 15. Compressing training set learning curve scatter diagram.
Table 9. Transactions with priority and new start time.
Arrival Time Start Time
Transaction Type Account Type CSC Type Priority
(ms) (ms)
0.077 0.132 0.058 396 1 1
0.133 0.029 0.226 330 1 2
0.031 0.007 0.213 500 1 3
0.208 0.017 0.174 132 1 4
0.116 0.069 0.007 326 1 5
... ... ... ... ... ...
0.067 0.306 0.009 499 1 12
0.034 0.143 0.545 331 2 13
0.496 0.066 0.171 393 2 14
0.248 0.371 0.122 788 2 15
... ... ... ... ... ...
With the proposed KNN consensus algorithm, the scatter diagram of the transactions
is shown in Figure 16, where 1 is the highest priority, and 5 is the lowest priority. Differently
from the start time that only relates to the arrival time in the FIFO method, as shown in
Figure 6, the start time with the KNN-based consensus algorithm relates to the priority of
the transaction, which introduces the QoS method to the consensus algorithm and helps to
better achieve SLA requirements and provide BaaS users an improved experience.
Figure 16. Prioritized transaction scatter diagram.
When a new transaction needs to be added to the transaction pool, it needs to be
classified by the KNN algorithm. The prediction is only determined by the number of
sample points in the training set, which is a constant value once the training set is finalized.
The time complexity of this algorithm is O(1), and the space complexity is also O(1), which
564
Electronics 2023, 12, 1429
is irrelevant to the number of transactions in the transaction pool. After adopting the
clipping and compressing algorithms, the number of samples in the training set is greatly
reduced while ensuring a good fitting performance. The given example reduces the number
of samples from 1000 to 200+. Algorithm 5 describes how a new transaction is added to the
priority queue with the new compressed training set.
Algorithm 5 New transaction classification.
Input: Tx : The new transaction; Q1 . . . Q N : The priority Q list from Q1 to Q N ; k: The best k
in K-fold Cross-Validation Traning_data: The compressed training data; Traning_target:
The compressed training target;
Output: Updated Qn
1: Initial KNN_cl f = neighbors.KNeighborsClassi f ier ( n_neighbors = k ); Prepare
KNeighborsClassifier with the best k value
2: KNN_cl f . f it ( Traning_data, Traning_target ) Fit the compressed training data and
target to the KNeighborsClassifier
3: predict = KNN_cl f .predict ( Tx ) Predict the class of new incoming Tx
4: if (predict == n) and (Qn . size < MAX_SIZE) then
5: PUSH Tx to Qn ; PUSH Tx to Qn once the Q isn’t full
6: else
7: Save Tx to memory pool; Otherwise temporarily save the Tx to memory pool
8: end if
9: return Qn
Compared with existing blockchain consensus algorithms, the proposed KNN-based
consensus algorithm guarantees that higher priority transactions are executed earlier.
Table 9 shows that the CSC type is important for calculating the priority. If a CSC has a
short SLA requirement, its CSC type should be assigned with a high priority. This helps to
deliver services to the CSCs within the SLA limitation in the BaaS system. Considering the
transaction with attributes {0.034, 0.143, 0.545} in Table 9 as an example, its arrival time is 331.
Without the proposed KNN-based optimization consensus algorithm, the transaction pool
assigns it with a sequence number of 331. If the SLA of this transaction has a short duration,
the transaction may miss the SLA. With the KNN-based consensus algorithm, however, it
should be classified into a higher target priority queue. In this way, the transaction pool
assigns it with a sequence number of 13 and, therefore, is more likely to satisfy the SLA.
7. Conclusions
Most existing consensus algorithms do not consider the priority. If a high-priority
transaction comes late, it needs to wait until other, lower-priority transactions are handled.
Due to the TPS limitation, it is difficult to meet SLA requirements in the BaaS system. This
paper proposes a KNN-based consensus algorithm to enhance the SLA handling in the
BaaS system. With the KNN-based consensus algorithm, each transaction is handled based
on its priority. The transactions that arrive late but have high priority can be handled
early. In this way, the BaaS system can better satisfy the SLA between the CSP and the
CSC. The proposed KNN-based blockchain consensus algorithm is a common solution,
and we only choose three attributes for classification. The experimental results illustrate
the advantages of the proposed algorithm. In the future, we will consider more attributes
for classification and try using other classification methods that can outperform the KNN.
Author Contributions: Conceptualization, Q.Z., L.W. and J.H.; formal analysis, Q.Z., L.W. and J.H.;
investigation, Q.Z. and L.W.; methodology, Q.Z., L.W. and T.L.; project administration, L.W. and
J.H.; resources, J.H. and T.L.; software, Q.Z., T.L. and L.W.; supervision, J.H.; validation, Q.Z. and
T.L.; writing—original draft preparation, Q.Z., L.W. and J.H.; writing—review and editing, Q.Z., L.W.
and T.L. All authors have read and agreed to the published version of the manuscript.
Funding: This work was supported by the Ministry of Education of Humanities and Social Science
Project (grant no. 19YJAZH047), the Ministry of Science and Technology Innovation Method Work
565
Electronics 2023, 12, 1429
Special Project (grant no.2017IM030100), Sichuan Provincial Higher Education Talent Training Quality
and Teaching Reform Project (grant no. JG2021-995), Sichuan Provincial Higher Education Talent
Training Quality and Teaching Reform Project (grant no. JG2021-1016), and the Social Practice
Research for Teachers of Southwestern University of Finance and Economics (grant no. 2022JSSHSJ11).
Data Availability Statement: All the data in this paper are publicly available. Please contact the
corresponding author to obtain them.
Conflicts of Interest: The authors declare that they have no conflict of interest.
References
1. Zhang, C.; Chen, Y. A review of research relevant to the emerging industry trends: Industry 4.0, IoT, blockchain, and business
analytics. J. Ind. Integr. Manag. 2020, 5, 165–180. [CrossRef]
2. Song, J.; Zhang, P.; Alkubati, M.; Bao, Y.; Yu, G. Research advances on blockchain-as-a-service: Architectures, applications and
challenges. Digit. Commun. Netw. 2021, 8, 466–475. [CrossRef]
3. Buterin, V. A next-generation smart contract and decentralized application platform. White Pap. 2014, 3, 1–36. Available online:
https://ethereum.org/en/whitepaper/#a-next-generation-smart-contract-and-decentralized-application-platform (accessed on
28 January 2023).
4. Peng, Z.; Xu, J.; Hu, H.; Chen, L. BlockShare: A Blockchain Empowered System for Privacy-Preserving Verifiable Data Sharing.
IEEE Data Eng. Bull. 2022, 45, 14–24.
5. Wu, H.; Peng, Z.; Guo, S.; Yang, Y.; Xiao, B. VQL: Efficient and Verifiable Cloud Query Services for Blockchain Systems. IEEE
Trans. Parallel Distrib. Syst. 2022, 33, 1393–1406. [CrossRef]
6. Wang, H.; Xu, C.; Zhang, C.; Xu, J.; Peng, Z.; Pei, J. vChain+: Optimizing Verifiable Blockchain Boolean Range Queries. In
Proceedings of the 2022 IEEE 38th International Conference on Data Engineering (ICDE), Kuala Lumpur, Malaysia, 9–12 May
2022; pp. 1927–1940. [CrossRef]
7. Sayeed, S.; Marco-Gisbert, H. Assessing Blockchain Consensus and Security Mechanisms against the 51% Attack. Appl. Sci. 2019,
9, 1788. [CrossRef]
8. Akcora, C.G.; Gel, Y.R.; Kantarcioglu, M. Blockchain networks: Data structures of Bitcoin, Monero, Zcash, Ethereum, Ripple, and
Iota. Wiley Interdiscip. Rev. Data Min. Knowl. Discov. 2022, 12, e1436. [CrossRef] [PubMed]
9. Du, M.; Chen, Q.; Ma, X. MBFT: A New Consensus Algorithm for Consortium Blockchain. IEEE Access 2020, 8, 87665–87675.
[CrossRef]
10. Li, D.; Deng, L.; Cai, Z.; Souri, A. Blockchain as a service models in the Internet of Things management: Systematic review. Trans.
Emerg. Telecommun. Technol. 2022, 33, e4139. [CrossRef]
11. Samaniego, M.; Jamsrandorj, U.; Deters, R. Blockchain as a Service for IoT. In Proceedings of the 2016 IEEE International
Conference on Internet of Things (iThings) and IEEE Green Computing and Communications (GreenCom) and IEEE Cyber,
Physical and Social Computing (CPSCom) and IEEE Smart Data (SmartData), Chengdu, China, 15–18 December 2016; pp. 433–436.
[CrossRef]
12. Ardagna, D.; Casale, G.; Ciavotta, M.; Pérez, J.F.; Wang, W. Quality-of-service in cloud computing: Modeling techniques and their
applications. J. Internet Serv. Appl. 2014, 5, 1–17. [CrossRef]
13. Viriyasitavat, W.; Da Xu, L.; Bi, Z.; Hoonsopon, D.; Charoenruk, N. Managing qos of internet-of-things services using blockchain.
IEEE Trans. Comput. Soc. Syst. 2019, 6, 1357–1368. [CrossRef]
14. Tan, W.; Zhu, H.; Tan, J.; Zhao, Y.; Xu, L.D.; Guo, K. A novel service level agreement model using blockchain and smart contract
for cloud manufacturing in industry 4.0. Enterp. Inf. Syst. 2022, 16, 1939426. [CrossRef]
15. Rashid, A.; Chaturvedi, A. Cloud computing characteristics and services: A brief review. Int. J. Comput. Sci. Eng. 2019, 7, 421–426.
[CrossRef]
16. Pedregosa, F.; Varoquaux, G.; Gramfort, A.; Michel, V.; Thirion, B.; Grisel, O.; Blondel, M.; Prettenhofer, P.; Weiss, R.; Dubourg, V.;
et al. Scikit-learn: Machine Learning in Python. J. Mach. Learn. Res. 2011, 12, 2825–2830.
17. Kshetri, N. The Economics of Central Bank Digital Currency [Computing’s Economics]. Computer 2021, 54, 53–58. [CrossRef]
18. Yang, G.; Lee, K.; Lee, K.; Yoo, Y.; Lee, H.; Yoo, C. Resource Analysis of Blockchain Consensus Algorithms in Hyperledger Fabric.
IEEE Access 2022, 10, 74902–74920. [CrossRef]
19. Peng, Z.; Zhang, Y.; Xu, Q.; Liu, H.; Gao, Y.; Li, X.; Yu, G. NeuChain: A Fast Permissioned Blockchain System with Deterministic
Ordering. Proc. VLDB Endow. 2022, 15, 2585–2598. [CrossRef]
20. Sanka, A.I.; Cheung, R.C. Efficient High Performance FPGA based NoSQL Caching System for Blockchain Scalability and
Throughput Improvement. In Proceedings of the 2018 26th International Conference on Systems Engineering (ICSEng), Sydney,
NSW, Australia, 18–20 December 2018; pp. 1–8. [CrossRef]
21. Gao, S.; Peng, Z.; Tan, F.; Zheng, Y.; Xiao, B. SymmeProof: Compact Zero-Knowledge Argument for Blockchain Confidential
Transactions. IEEE Trans. Dependable Secur. Comput. 2022, 1. [CrossRef]
22. Cai, C.; Xu, L.; Zhou, A.; Wang, C. Toward a Secure, Rich, and Fair Query Service for Light Clients on Public Blockchains. IEEE
Trans. Dependable Secur. Comput. 2022, 19, 3640–3655. [CrossRef]
566
Electronics 2023, 12, 1429
23. Ruan, P.; Chen, G.; Dinh, T.T.A.; Lin, Q.; Ooi, B.C.; Zhang, M. Fine-Grained, Secure and Efficient Data Provenance on Blockchain
Systems. Proc. VLDB Endow. 2019, 12, 975–988. [CrossRef]
24. Peng, Z.; Xu, J.; Chu, X.; Gao, S.; Yao, Y.; Gu, R.; Tang, Y. Vfchain: Enabling verifiable and auditable federated learning via
blockchain systems. IEEE Trans. Netw. Sci. Eng. 2021, 9, 173–186. [CrossRef]
25. Onik, M.M.H.; Miraz, M.H. Performance Analytical Comparison of Blockchain-as-a-Service (BaaS) Platforms. In Emerging
Technologies in Computing; Miraz, M.H., Excell, P.S., Ware, A., Soomro, S., Ali, M., Eds.; Springer International Publishing: Cham,
Switzerland, 2019; pp. 3–18.
26. Samet, H. K-nearest neighbor finding using MaxNearestDist. IEEE Trans. Pattern Anal. Mach. Intell. 2007, 30, 243–252. [CrossRef]
27. Martínez, F.; Frías, M.P.; Pérez-Godoy, M.D.; Rivera, A.J. Dealing with seasonality by narrowing the training set in time series
forecasting with kNN. Expert Syst. Appl. 2018, 103, 38–48. [CrossRef]
28. Li, T.; Qian, Z.; Deng, W.; Zhang, D.; Lu, H.; Wang, S. Forecasting crude oil prices based on variational mode decomposition and
random sparse Bayesian learning. Appl. Soft Comput. 2021, 113, 108032. [CrossRef]
29. Zhang, S.; Li, X.; Zong, M.; Zhu, X.; Wang, R. Efficient kNN Classification With Different Numbers of Nearest Neighbors. IEEE
Trans. Neural Netw. Learn. Syst. 2018, 29, 1774–1785. [CrossRef] [PubMed]
30. Fix, E. Discriminatory Analysis: Nonparametric Discrimination, Consistency Properties; USAF School of Aviation Medicine: Dayton,
OH, USA, 1985; Volume 1.
31. Mahfouz, M.A.; Shoukry, A.; Ismail, M.A. EKNN: Ensemble classifier incorporating connectivity and density into kNN with
application to cancer diagnosis. Artif. Intell. Med. 2021, 111, 101985. [CrossRef] [PubMed]
32. Song, Z.H.; Sang, W.J.; Yuan, S.Y.; Wang, S.X. Gas-Bearing Reservoir Prediction Using k-nearest neighbor Based on Nonlinear
Directional Dimension Reduction. Appl. Geophys. 2022, 1–11. [CrossRef]
33. Cui, L.; Zhang, Y.; Zhang, R.; Liu, Q.H. A Modified Efficient KNN Method for Antenna Optimization and Design. IEEE Trans.
Antennas Propag. 2020, 68, 6858–6866. [CrossRef]
34. Castro, M.; Liskov, B. Practical byzantine fault tolerance. In Proceedings of the Third Symposium on Operating Systems Design
and Implementation, New Orleans, LA, USA, 22–25 February 1999; Volume 99, pp. 173–186.
35. FISCO BCOS Platform. Available online: https://github.com/fisco-bcos (accessed on 28 January 2023).
36. Abu Alfeilat, H.A.; Hassanat, A.B.; Lasassmeh, O.; Tarawneh, A.S.; Alhasanat, M.B.; Eyal Salman, H.S.; Prasath, V.S. Effects of
distance measure choice on k-nearest neighbor classifier performance: A review. Big Data 2019, 7, 221–248. [CrossRef]
37. Wettschereck, D.; Aha, D.W.; Mohri, T. A review and empirical evaluation of feature weighting methods for a class of lazy
learning algorithms. Artif. Intell. Rev. 1997, 11, 273–314. [CrossRef]
38. FISCO BCOS Performance Demo Program. Available online: https://github.com/FISCO-BCOS/java-sdk-demo/blob/main/
src/main/java/org/fisco/bcos/sdk/demo/perf/PerformanceOk.java (accessed on 28 January 2023).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
567
electronics
Article
Peak Shaving and Frequency Regulation Coordinated Output
Optimization Based on Improving Economy of Energy Storage
Daobing Liu 1,2 , Zitong Jin 1,2 , Huayue Chen 3, *, Hongji Cao 1,2 , Ye Yuan 1,2 , Yu Fan 1,2 and Yingjie Song 4
1 College of Electrical Engineering and New Energy, China Three Gorges University, Yichang 443002, China;
[email protected] (D.L.); [email protected] (Z.J.); [email protected] (H.C.);
[email protected] (Y.Y.); [email protected] (Y.F.)
2 Hubei Provincial Key Laboratory for Operation and Control of Cascade Hydropower Station,
China Three Gorges University, Yichang 443002, China
3 School of Computer Science, China West Normal University, Nanchong 637002, China
4 College of Computer Science and Technology, Shandong Technology and Business University,
Yantai 264005, China; [email protected]
* Correspondence: [email protected]
Abstract: In this paper, a peak shaving and frequency regulation coordinated output strategy based
on the existing energy storage is proposed to improve the economic problem of energy storage
development and increase the economic benefits of energy storage in industrial parks. In the proposed
strategy, the profit and cost models of peak shaving and frequency regulation are first established.
Second, the benefits brought by the output of energy storage, degradation cost and operation and
maintenance costs are considered to establish an economic optimization model, which is used to
realize the division of peak shaving and frequency regulation capacity of energy storage based on
peak shaving and frequency regulation output optimization. Finally, the intra-day model predictive
control method is employed for rolling optimization. An intra-day peak shaving and frequency
regulation coordinated output optimization strategy of energy storage is proposed. Through the
Citation: Liu, D.; Jin, Z.; Chen, H.;
example simulation, the experiment results show that the electricity cost of the whole day is reduced
Cao, H.; Yuan, Y.; Fan, Y.; Song, Y. by 10.96% by using the coordinated output strategy of peak shaving and frequency regulation. The
Peak Shaving and Frequency obtained further comparative analysis results and the life cycle economic analysis show that the profit
Regulation Coordinated Output brought by the proposed coordinated output optimization strategy is greater than that for separate
Optimization Based on Improving peak shaving or frequency modulation of energy storage under the same capacity.
Economy of Energy Storage.
Electronics 2022, 11, 29. https:// Keywords: energy storage; model predictive control; peak shaving and frequency regulation; output
doi.org/10.3390/electronics11010029 optimization
Academic Editor: Jonghoon Kim
Received: 23 November 2021
Accepted: 21 December 2021 1. Introduction
Published: 22 December 2021
Under the goal of “carbon neutralization”, energy storage has become the focus of
Publisher’s Note: MDPI stays neutral development because of its rapid charging and discharging characteristics. On the power
with regard to jurisdictional claims in generation side, energy storage can be connected to make the power grid more “friendly”
published maps and institutional affil- towards new energy sources such as wind power and photovoltaic [1–4]. On the user side,
iations. energy storage can cut the peaks and fill the valleys, improving users’ power consumption
habits and reducing peak power consumption. According to the “14th five-year plan”,
China’s energy storage will reach more than 30 million kilowatts in 2025. Compared with
2020, the scale of the energy storage market will expand nearly tenfold, and local policies
Copyright: © 2021 by the authors.
and market mechanisms will be better, which means that the application of energy storage
Licensee MDPI, Basel, Switzerland.
This article is an open access article
in various scenarios needs to be further improved. With the increase in energy storage
distributed under the terms and
reserve capacity on the user side, making good use of this energy storage capacity can
conditions of the Creative Commons increase the system stability and the economy of energy storage on the user side [5–9].
Attribution (CC BY) license (https:// At present, China mainly implements two-part electricity price and timeshare electrova-
creativecommons.org/licenses/by/ lence policies for industrial users, hoping that industrial users can change their electricity
4.0/). consumption habits, but industrial production habits are difficult to change [10–13]. Therefore,
Electronics 2022, 11, 29. https://doi.org/10.3390/electronics11010029 https://www.mdpi.com/journal/electronics
569
Electronics 2022, 11, 29
the industrial users can be equipped with energy storage systems to reduce the maximum
demand of users, according to the policy, and adopt the strategy of low charge and high
discharge according to the time-of-use electricity pricing to charge during low electricity price
periods, discharging in the high electricity price periods and peak load periods. This method
not only improves the power consumption habits of users, but also obtains economic benefits
by using the peak valley electricity price difference and the maximum demand electricity
charge difference [14–18]. However, the energy storage battery needs more deep discharge
when participating in the peak shaving on the user side, which will produce a large battery
degradation effect, limiting the economy of peak shaving.
Therefore, the economic benefits of user-side energy storage participating in frequency
regulation can improve the economy of user equipped energy storage. At present, China’s
small capacity energy storage power stations cannot be allowed to compete for frequency
regulation services, but the establishment of auxiliary service markets such as frequency
regulation and standby is conducive to guiding investment to improve the flexibility of
power systems [19–25]. With the improvement of energy storage service market mecha-
nisms, the future frequency regulation service market will certainly expand to individual
participation, so the energy storage on the user side can not only achieve low absorption
and high amplification, but it can also participate in the frequency regulation service market
to obtain revenue [26–29], which will encourage industrial users to actively equip energy
storage batteries and reduce peak power consumption.
In other countries, the frequency regulation market such as Pennsylvania–New Jersey–
Maryland (PJM) in the United States is relatively mature. In this market, the energy
storage devices represented by batteries and aircraft turbines has been introduced into the
frequency regulation service market [30]. Salles et al. [31] used the battery energy storage
systems in an Italian shopping mall to shave the peak consumption and get benefit from
it. It has been proven that the strategy including peak shaving can increase the economy
on the user side. However, this ignores that energy storage can also generate benefits
by participating in frequency regulation services. The energy on the user side is used to
participate in the frequency regulation service in the power market to obtain income [32–36].
They make the energy on the user side follow the frequency regulation signals in the PJM
market for equivalent output, similar to energy storage. Shi et al. [37] used the battery
storage system for peak shaving and frequency regulation through the joint optimization
framework on the user side. Based on the degradation effect of energy storage batteries, it
was found that the joint optimization has super linear gain compared with energy storage
for frequency regulation or peak shaving alone, but this method is only used in the day-
ahead planning stage, and simply follows the frequency regulation signal during the day’s
frequency regulation real-time output. It fails to achieve real-time optimization, and the
peak shaving model only considers the peak cost in the electricity price, not the difference
of timeshare electrovalence. Based on the prediction model, Liu et al. [38] proposed a
model predictive control (MPC) intra-day rolling optimization frequency regulation model.
The model considers the degradation effect, but it does not consider the operation and
maintenance cost of the battery, and while it achieves intra-day optimization, it does not
consider the day-ahead bidding capacity of the energy storage.
On the basis of this research, this paper puts forward a strategy for day-ahead peak
shaving and frequency regulation planning and a frequency regulation rolling optimization
output strategy for user-side intra-day energy storage. The strategy considers the degrada-
tion cost and operation and maintenance cost of energy storage. By solving the economic
optimal model of peak shaving and frequency regulation coordinated output a day ahead,
the division of peak shaving and frequency regulation capacity of energy storage is ob-
tained, and a real-time output strategy of energy storage is obtained by MPC intra-day
rolling optimization. Finally, through the 24-h economic analysis of the strategy proposed
in this paper and the economic analysis of the whole life cycle, it can be concluded that the
economic benefit of energy storage participating in peak shaving and frequency regulation
coordinated output is much higher than that of energy storage batteries participating in
570
Electronics 2022, 11, 29
peak shaving or frequency regulation under the same capacity. Through simulation, it is
demonstrated that energy storage participating in peak shaving can reduce the battery
degradation cost when energy storage is used for frequency regulation by reducing the
number of battery cycles, thereby increasing the service life of energy storage batteries.
The main contributions of this work are described as follows:
• A peak shaving and frequency regulation coordinated output strategy based on the
existing energy storage participating is proposed to improve the economic problem of
energy storage development and increase the economic benefits of energy storage on
the industrial park.
• The profit and cost models of peak shaving and frequency regulation are established.
• The benefits brought by the output of energy storage, degradation cost and operation
and maintenance costs are considered to establish an economic optimization model.
• The intra-day model predictive control method is employed for rolling optimization.
2. Establishment of the Peak Shaving Model
In order to promote staggered peak power consumption, the industrial peak valley
electricity price of a city in China is shown in Table 1. For industrial parks with two-
part electricity pricing, the electricity charge includes the electricity charge and the basic
electricity charge [39]. The electricity charge is calculated according to the amount of
electricity consumption, and the basic electricity charge is calculated according to the
maximum demand. For convenience of expression, function f 1 (x, y) is defined as follows.
x−y ( x > y)
f 1 ( x, y) = (1)
0 ( x ≤ y)
where, x and y are mathematical variables.
Table 1. The peak valley price.
Type Time Interval Electricity Price/(Yuan/kW h) −1
Valley 23:00–07:00 0.414
Normal 07:00–08:00; 11:00–18:00 0.782
Peak 08:00–11:00; 18:00–23:00 1.149
On this basis, the total electricity charge for industrial users is calculated as follows.
T
Melec = Cx · So + Cx1 · f 1 (max(s), So ) + ∑ Celec (t) · s(t) · ts (2)
t =1
where, Cx is the demand price when the actual maximum demand is within the maximum
contract limit, So is the maximum contract limit, and Cx1 is the demand price of the excess
part when the actual maximum demand exceeds the maximum contract limit. According
to the regulations, Cx1 /Cx = 2. Let s = [s(1), s(2), . . . , s(T)] be the vector of power demand.
Celec (t) is the hourly electricity price, s(t) is the power demand of the industrial park, ts is
the data time step, and T is the amount of data.
Typical daily load curve of industrial park is shown in Figure 1.
According to the daily load curve and electricity price table, the power demand of the
industrial park is large when the electricity price is high, but the power demand is small
when the electricity price is low, so the power consumption cost is high.
571
Electronics 2022, 11, 29
3RZHU.:
7LPHK
Figure 1. Daily load curve of industrial park.
2.1. Income from Energy Storage Participating in Peak Shaving
By providing energy storage to reduce the maximum demand by charging in the low
electricity price period and discharging in the peak electricity price period users can reduce
the total electricity charge. The difference between the electricity charge without energy
storage and peak shaving by energy storage is the income from participating in user side
peak shaving, which is expressed as follows:
Mpeak.1 = Cx1 · [ f 1 (max(s), So ) − f 1 (max(s − b), So )]+
T T (3)
∑ Celec (t) · s(t) · ts − ∑ Celec (t) · [s(t) − b(t)] · ts
t =1 t =1
where, b(t) is the output of energy storage at each time. b = [b(1), b(2), . . . , b(T)] is the
vector of energy storage actions. This formula expresses the saving of electricity cost after
energy storage participates in peak shaving, but the energy storage itself will deteriorate
during charging, and daily maintenance is required to ensure the normal operation of
energy storage.
2.2. Energy Storage Output Cost
In the operation of battery energy storage, the operation cost is a key problem that
must be considered, and the degradation cost comes from the degradation of the battery
under repeated charge and discharge cycles [40–42]. Different batteries show different
degradation characteristics. Lithium-ion batteries are a widely used form of battery energy
storage. Therefore, the degradation cost model in this paper is mainly based on lithium-
ion batteries.
In this paper, the rain flow cycle counting method is used to calculate the degradation
cost of the energy storage battery. According to paper [43], the relationship between
the depth of discharge (DOD) of an energy storage battery and its cycle life is described
as follows:
Nmax = −1302DOD 5
+ 4427DOD
3
− 8925DOD + 10, 500 (4)
where, Nmax is the cycle life (Times) of the battery, and DOD is the discharge depth of the
energy storage battery.
Using the rain flow counting method, the SOC change of the energy storage battery
can be obtained according to the energy storage output b(t) of each cycle, and then the cycle
output times and output depth of the energy storage in each output cycle can be obtained.
In a certain cycle, the energy storage has conducted n cycle output, and the corresponding
572
Electronics 2022, 11, 29
discharge cycle depth is set as DOD (1), DOD (2), . . . , DOD (n). Then, the battery life decay
rate in a certain energy storage output cycle is given as follows [40]:
n
1
γ= ∑ Nmax ( DOD (i)) · 100% (5)
i =1
where γ is the decay rate of battery life, and Nmax (DOD (i)) is the maximum number of
discharge cycles corresponding to DOD (i). Therefore, the degradation cost generated after
one cycle of output of the energy storage battery is expressed as follows.
f (b) = γ · (CS Pr + CB Er ) (6)
where CS is the unit power cost of the PCS, that is, the unit power cost of the energy storage
converter; Pr is the rated configuration power of the energy storage; CB is the unit capacity
cost and Er is the energy storage capacity.
Energy storage operation and maintenance cost refers to a series of costs such as battery
maintenance, repair and inspection to ensure the normal use of energy storage battery
within the specified service life [44], which is related to the charging and discharging power
and battery capacity of energy storage.
T T
g(b(t)) = CPOM ∑ b(t) + CBOM ∑ b(t) · ts (7)
t =1 t =1
where CPOM is the unit power operation and maintenance cost; CBOM is the operation and
maintenance cost per unit capacity, that is the operation and maintenance cost correspond-
ing to absorbing/releasing 1 MWh of energy.
2.3. Model Establishment
According to the benefits and costs described above, the daily energy storage output
planning model aiming at the lowest total electricity charge in the industrial park is
established as follows:
T T T
Mpeak = minCx1 · f 1 (max(s − b1 ), So ) +
b1 (t)
∑ f (b1 (t)) + ∑ g(b1 (t)) + ∑ Celec (t) · [s(t) − b1 (t)] · ts (8)
t =1 t =1 t =1
where b1 (t) is the variable, meaning the output of energy storage for peak shaving at each
time, b1 = [b1 (1), b1 (2), . . . , b1 (T)] is the vector of battery actions for peak shaving.
The constraints are:
(1) SOC constraint of energy storage battery
∑tτ =1 b1 (τ ) · ts
SOCmin − SOC1 ≤ ≤ SOCmax − SOC1 (9)
E1
where SOCmax and SOCmin respectively represent the maximum and minimum state
of charge in the discharge area of the energy storage battery, SOC1 represents the SOC
of the energy storage battery at the initial time, and E1 represents the peak shaving
capacity of energy storage.
(2) Same constraint as initial state
T
∑ b1 (t) =0 (10)
t =1
Each optimization process is a cycle. During this cycle, the SOC of the energy
storage battery shall be consistent, so as to facilitate the optimization and output of
multiple cycles.
573
Electronics 2022, 11, 29
(3) Maximum power constraint of energy storage charge and discharge
0 ≤ bi1 (t) ≤ Pr (11)
0 ≤ bo1 (t) ≤ Pr (12)
where bi1 (t) represents the charging power of the battery during peak shaving, and
bo1 (t) represents the discharge power of the battery during peak shaving.
3. Optimization Model of Energy Storage Battery Participating in Frequency Regulation
The energy storage battery has good response speed and climbing ability, so it can
adapt to flexible frequency regulation signals. In this paper, the Reg_D frequency regulation
signal of the American PJM market is used as the frequency regulation action instruction
of energy storage battery. Figure 2 shows a one-hour Reg_D frequency regulation signal,
which is expressed in normalized form and ranges from [−1,1]. In this frequency regulation
market, each energy storage power station willing to participate in frequency regulation
service needs to submit bidding application and bidding capacity the day before the
frequency regulation day. After winning the bid, the energy storage battery needs to output
according to the frequency regulation signal. At the same time, the frequency regulation
market will compensate the capacity of the winning energy storage. However, the energy
storage unit that fails to comply with the regulations will also be adjusted and punished.
1RUPDOL]HGIUHTXHQF\PRGXODWLRQVLJQDO
7LPHK
Figure 2. The signal of the Reg_D.
The power that battery energy storage needs to respond to in the process of frequency
regulation Pneed is described as follows.
Pneed = r (t) · C J (13)
where r(t) is the Rrg_D frequency regulation real-time signal and CJ is the bid-marked capacity.
When participating in the frequency regulation service market, the mileage of the
energy storage battery following the frequency regulation signal determines the benefits
brought by the energy storage. Deeper following of the signal will give more frequency
regulation mileage benefits and reduce the penalty caused by insufficient output. However,
deeper following means a larger span of energy storage output, which will also bring
more degradation, operation and maintenance costs. Therefore, a frequency regulation
optimization model with the most economical energy storage battery is established.
(1) Traditional objective function
T T T
Mr = min
C,b (t)
∑ f (b2 (t)) + ∑ g(b2 (t)) + cmis · ∑ |b2 (t) − C · r(t)| − ct · T · C − Rb (14)
2 t =1 t =1 t =1
574
Electronics 2022, 11, 29
where C and b2 (t) are the variables, C is the bidding capacity, b2 (t) is output of energy
storage for frequency regulation at each time. cmis is the penalty coefficient, which
represents the penalty amount required for every 1 MW·h of deviation between the
energy storage output and the frequency regulation signal and ct is the frequency
regulation compensation coefficient, which represents the compensation amount for
each 1 MW energy storage successfully bid by the grid service market every hour. Rb
is mileage compensation, and its calculation method is described as follow.
Rb = K · cbp · rb (15)
where, K is the frequency regulation performance index, cbp is the frequency regulation
mileage price, rb is the frequency regulation mileage in a certain frequency regulation
stage. The calculation method was according to reference [45,46].
(2) Constraints
C≥0 (16)
C < P2max (17)
∑tτ =1 b1 (τ ) · ts
SOCmin − SOC1 ≤ ≤ SOCmax − SOC1 (18)
E1
T
∑ b2 (t) =0 (19)
t =1
0 ≤ max(bi2 (t)) ≤ P2max (20)
0 ≤ max(bo2 (t)) ≤ P2max (21)
where, P2 max
is the maximum power of frequency regulation of energy storage.
(3) Improve the objective function
In the constraint condition (18), the sum of the energy storage battery’s output for
frequency regulation in an optimization cycle is 0. Therefore, in a frequency regulation
optimization cycle, the output of the energy storage battery cannot impact the electricity
charge, but it will have an impact on the basic electricity charge. This will fluctuate the
total electricity charge after the energy storage battery participates in frequency regulation,
so the objective function is improved as follows:
T T
Mr = min
c,b (t)
∑ f (b2 (t)) + Cx1 · f1 (max(s − b2 ), So ) + ∑ g(b2 (t)) + cmis · |b2 (t) − C · r(t)| − ct · T · C − Rb (22)
2 t =1 t =1
where b2 = [b2 (1), b2 (2), . . . , b2 (T)] is the vector of battery actions for frequency regulation.
4. Energy Storage Frequency Regulation and Peak Shaving Output Planning
4.1. Joint Optimization of Frequency Regulation and Peak Shaving
Based on the storage battery’s fixed capacity, an optimization strategy is proposed for
the joint output of frequency regulation and peak shaving.
In this strategy, first the energy storage battery capacity is optimized by day ahead
allocation to obtain the optimal economic peak shaving and frequency regulation capacity
allocation, then the day ahead peak shaving planning and the optimal bidding capacity
of energy storage frequency regulation are obtained. The MPC model is used to optimize
the intra-day energy storage frequency regulation output, then the total intra-day energy
storage output is obtained.
By predicting the user’s required load and Reg_D of the next day, according to the
peak and valley electricity charge, the maximum contract limit and other parameters, we
take the energy storage output and peak shaving and frequency regulation capacity as
variables and optimize them with the goal of optimizing the economy of energy storage
575
Electronics 2022, 11, 29
and peak shaving output at the same time, so as to obtain the optimal allocation of energy
storage frequency regulation and peak shaving capacity. The model is as follows:
Objective function is described as follows.
T T
Mboth = minCx1 · f 1 (max(s − b1 − b2 ), So ) + ∑ Celec (t) · [s(t) − b1 (t)] · ts + ∑ f (b1 (t) + b2 (t))
C,b1 (t),b2 (t),E1 ,E2 t =1 t =1
(23)
T T
+ ∑ g(b1 (t) + b2 (t)) + cmis · ∑ |b2 (t) − C · r (t)| − Rb − ct · T · C
t =1 t =1
Constraints:
C≥0 (24)
C≤P max
− max(b1 (t)) (25)
∑tτ =1 b1 (τ ) · ts
SOCmin − SOC1 ≤ ≤ SOCmax − SOC1 (26)
E1
∑tτ =1 b2 (τ ) · ts
SOCmin − SOC1 ≤ ≤ SOCmax − SOC1 (27)
E2
E1 + E2 = Eo (28)
− Po ≤ b1 (t) + b2 (t) ≤ Po (29)
T
∑ b1 (t) =0 (30)
t =1
T
∑ b2 (t) =0 (31)
t =1
where E1 is the occupied capacity of peak shaving, E2 is the occupied capacity of frequency
regulation, Eo is the rated capacity of the energy storage battery and Po is the rated power
of energy storage battery. Using this model, the capacity E1 and E2 of peak shaving
and frequency regulation can be optimized. We can bring the obtained E1 and E2 into
the peak shaving and frequency regulation models to obtain the planned energy storage
peak shaving output b1 (t), the maximum peak shaving output max(b1 (t)), and the energy
storage frequency regulation bidding capacity C. These optimization results will affect the
parameter setting of intra-day frequency regulation optimization.
4.2. Intra-Day Optimization of Frequency Regulation and Peak Shaving
Since the frequency regulation signal changes according to the real-time state of
the system, the frequency regulation output needs to respond to the real-time signal. C,
obtained from the above optimization results, shall be used for bidding. If the bidding
is successful, intra-day rolling output optimization of energy storage shall be carried out
according to the actual Reg_D signal intra-day, and intra-day peak adjustment shall be
carried out according to the day-ahead planning. The flow chart of day ahead and day
ahead optimization is shown in Figure 3.
During intra-day frequency regulation optimization, rolling optimization is carried
out according to MPC framework to obtain real-time output. MPC can consider future
information, so it can solve the problem of short sightedness of model optimization [47].
In the output strategy of this paper, MPC is divided into the following steps: (1)At the
current time, t, of receiving frequency regulation signal, based on the current state of energy
storage battery, the prediction model is used to predict the frequency regulation signal in [t,
t + 1, ..., t + n]. (2) According to the predicted frequency regulation signals [r (t), r (t + 1), ...,
r (t + n)] into the frequency regulation optimization model, the economic optimal solution
[b2 (t), b2 (t + 1), . . . , b2 (t + n)] is obtained. (3) b2 (t) is used as the energy storage frequency
regulation output at time t, and the initial energy storage state at time t + 1 is obtained. (4)
Repeat the above steps at time t + 1. Finally, the optimal economic frequency regulation
576
Electronics 2022, 11, 29
output of the energy storage battery considering mileage income, degradation effect and
operation and maintenance cost is obtained.
Start
Import the forecast load data and Reg_D signal for
the next day
According to the day ahead joint optimization
model, the peak shaving and frequency regulation
capacity E1 and E2 are obtained
Bring E1 and E2 into the peak shaving and
frequency regulation model to obtain b1(t) and C
Participate in frequency regulation bidding to
obtain bidding capacity Cj
Received Reg_ D signal or not?
No
Yes
The output of energy storage is
Determine the real-
according to the peak shaving
time frequency
planning before the day
regulation time t0
b(t)=b1(t)
Predict the Reg_D signal from t0 to t0+T End
real-time output intra-day
The output planning at this stage is obtained by
using the frequency regulation optimization model
from t0 to t0 + t
Get the real-time frequency regulation output
b2(t0) of the energy storage battery
Real time output of energy storage battery
b(t0)=b1(t0)+b2(t0)
t0=t0+1θTake the battery state at t0 as the initial
state at t0 + 1
Figure 3. The output plan flow chart of peak shaving and frequency regulation.
577
Electronics 2022, 11, 29
5. Life Cycle Economic Analysis Model
5.1. Life Cycle Cost Calculation Model
The economics and investability of the strategy proposed in this paper can be seen
through the economic analysis of its whole lifetime. Therefore, the cost and benefit model of
energy storage participating in peak and frequency regulation on the user side is established
in this section. The life cycle cost of energy storage refers to all direct, indirect, derived or
non-derived costs that occur or may occur during the entire life cycle of energy storage
participating in peak and frequency regulation. The life cycle cost model of the energy
storage system in this paper includes its investment cost, operation and maintenance costs,
scrap processing cost, and penalties caused by frequency regulation. Since the degradation
cost is calculated from the investment cost of the energy storage battery, so the degradation
cost is not considered during the full life cycle. the present value method is used to convert
the cost of the entire life cycle into the present value of the investment cost at the initial
moment of investment as follows:
CT = C1 + C2 + C3 + C4 (32)
where CT is the present value of total cost, C1 is the present value of the initial investment
cost of energy storage throughout the life cycle, C2 is the present value of energy storage
operation and maintenance cost, C3 is the present value of energy storage disposal cost
and C4 is the present value of the penalty cost of energy storage participating in frequency
regulation. The expressions are as follows.
n
C1 = CS Pr + ∑ CB Er (1 + r)−[kTLCC /(n+1)] (33)
k =0
TLCC
C2 = CPOM Pr {[(1 + r ) TLCC − 1]/[r (1 + r ) TLCC ]} + ∑ CBOM W (1 + r )−t (34)
t =1
n +1
C3 = CPscr Pr (1 + r )−TLCC + ∑ CEscr Er (1 + r)−k·Tlife (35)
k =1
TLCC
C4 = ∑ Fc (1 + r )−t (36)
t =1
where n is number of replacements, TLCC is the number of years considered in the whole
life cycle and n = TLCC /Tlife . Tlife is the cycle life of the energy storage. r is the discount
rate, W is the annual charge and discharge capacity of energy storage, CPscr is the unit
power scrap disposal cost, CEscr is the disposal cost per unit capacity and Fc is the annual
frequency regulation penalty for energy storage.
5.2. Life Cycle Benefit Calculation Model
The benefits of energy storage participating in user-side peaking and frequency regu-
lation come from the electricity price difference of peaking, frequency regulation capacity
compensation and frequency regulation mileage compensation. It is expressed as the
following formula.
R T = R1 + R2 (37)
where R1 is the present value of peak shaving income and R2 is the frequency regulation
revenue present value.
TLCC
R1 = ∑ M p (1 + r ) − t (38)
t =1
TLCC
R2 = ∑ Mt ( 1 + r ) − t (39)
t =1
578
Electronics 2022, 11, 29
where Mp is the peak shaving annual revenue and Mt is the frequency regulation annual income.
6. Example Analysis
6.1. Parameter Setting
In order to verify the effectiveness of the scheme in improving the economy of energy
storage on the user side, the actual Reg_D signal and industrial park load are used to
simulate and verify. The experimental model is optimized by the CVX software package
in MATLAB, which is a general software package to solve convex optimization problems.
the parameters appearing in the model are assigned values as shown in Table 2. Because
the frequency regulation signal adopts the Reg_D of the PJM market in the United States,
the currency unit in this paper is the US dollar. The frequency tariff is converted from one
month to a single day price. Because the research focus of this paper is not to determine the
optimal value of the user’s maximum contract limit, and the optimal value of the contract
limit is a long-term fixed value and cannot be changed every day, so the maximum contract
limit is specified as the determined value in the experimental process of this paper.
Table 2. The numerical table of the parameters.
Parameter Name Numerical Value
Demand electricity price Cx ($/MW) 215
Maximum contractual limit So (MW) 0.185
Valley electricity price ($/MW·h) 59.14
Normal electricity price ($/MW·h) 111.71
Pick electricity price ($/MW·h) 164.14
Unit power cost CS ($/MW) 257,000
Energy storage battery unit capacity cost CB ($/MW·h) 384,000
Unit power operation and maintenance cost CPOM ($/MW) 10,000
Unit capacity operation and maintenance cost CBOM ($/MW·h) 10
The number of years considered in the whole life cycle TLCC (year) 20
Unit power scrap cost CPscr ($/MW) 1000
Unit capacity scrap cost CEscr ($/MW·h) 1000
Penalty coefficient cmis ($/MW) 500
Frequency regulation compensation coefficient ct ($/MW) 30
Mileage compensation coefficient cbp ($/MW) 4
Discount rate r (%) 6
The parameters of energy storage battery used in this paper are shown in Table 3.
Table 3. The parameters of the energy storage battery.
Parameter Name Numerical Value
Maximum charge/discharge power Pmax
(MW) 1
Upper limit of stored energy (MWH) 1
Initial value of state of charge 0.5
Maximum state of charge (Smax ) 0.8
Minimum state of charge (Smin ) 0.2
Lithium battery cycle life N 800
6.2. Peak Shaving and Frequency Regulation Day-Ahead Optimization
In this paper, a long short-term memory (LSTM) network is used to predict the load
and frequency regulation signal. Because the time steps of peak shaving and frequency
regulation are different, peak shaving needs to optimize the electricity price and load
demand of the whole day as a reference, so the optimization step is hour level, while the
step size of Reg_D signal is 2 s, which is too different from the peak shaving time step. If
they are optimized for 24 h, there will be up to 43,200 frequency regulation signals, which
undoubtedly increases the optimization complexity. Therefore, in the day-ahead capacity
579
Electronics 2022, 11, 29
planning stage in this paper, the load data is divided into 2 s from the original steps of
15 min, so four data in an hour are divided into 1800 data to match the frequency regulation
steps, so Equation (18) can be solved to get E1 and E2 . This process is repeated 24 times
to obtain 24 groups of E1 and E2 per day, and the average value is taken for the final peak
shaving and frequency regulation capacity allocation.
According to the capacity planning model of peak shaving and frequency regulation
and the parameters given above, an energy storage battery with a maximum power of
1 MW and capacity of 1 MW·h was used to carry out the day-ahead peak shaving and
frequency regulation planning on the user side. The obtained results are E1 = 0.8 MW·h
and E2 = 0.2 MW·h. Then, we bring E1 into the peak shaving model shown in Equation (8)
and so get the power curve required by the user after peak shaving is shown in Figure 4.
The energy storage output and SOC changes are shown in Figures 5 and 6. The maximum
output power of energy storage peak regulation is P1 max = 0.13 MW. According to Figure 4,
the energy storage battery charges in the night when the electricity price is low, and the
energy storage discharges in the morning and afternoon when the electricity price is high,
so as to reduce the power demand of users in the time when the electricity price is high.
Maximum demand from industrial users is reduced based on maximum contract quotas.
3RZHU
/RDGGHPDQG
/RDGGHPDQGDIWHUSHDNVKDYLQJ
7LPHK
Figure 4. The result of day-ahead peak shaving.
62&
7LPHK
Figure 5. The change curve of the battery’s peak-shaving SOC.
580
Electronics 2022, 11, 29
7KHRXWSXWRIHQHUJ\VWRUDJH
7LPHK
Figure 6. The change curve of the battery’s peak-shaving output.
According to the calculation rule of the user electricity charge, the 24 h electricity
charge without energy storage battery is $2487, of which the demand electricity charge is
$230. After adding the output of the energy storage battery, the electricity charge for 24 h is
$2446, including the demand electricity charge of $199 and degradation cost and operation
and maintenance cost of $52. Therefore, the energy storage power station is equipped with
energy storage battery for peak shaving, which has limited savings on electricity charges.
This is because if the energy storage output is small and the peak shaving is small, it has
little impact on electricity charges. When the energy storage output is large, although
the electricity charges are reduced, the degradation costs and operation and maintenance
costs of the energy storage will also increase, resulting in no significant savings in total
electricity charges.
Taking E2 = 0.2 MWH and P2 max = 0.87 MW into the frequency regulation model, the
optimal power C = 0.87 MW. The variation results of energy storage frequency regulation
output and SOC are shown in Figures 7 and 8.
WKHSRZHUWKDWHQHUJ\VWRUDJH
VKRXOGRXWSXW
$FWXDORXWSXWSRZHURIHQHUJ\
7KHRXWSXWRIHQHUJ\VWRUDJH0:
VWRUDJH
7LPHV
Figure 7. The output of day-ahead frequency regulation.
581
Electronics 2022, 11, 29
62&
7LPHV
Figure 8. The change curve of battery’s SOC of frequency regulation.
It can be seen from the Figure 7 that the energy storage battery tracks the Reg_D
signal and sends output most of the time. When large-scale output of the energy storage
is required, the model will take into account the degradation effect of the energy storage
battery, operation and maintenance costs and power demand at the user side, so that
the energy storage battery only responds to some frequency regulation commands and
reduces the output depth. In this hour, the electricity charge of the industrial park is
$57.37. Participating in the service market through frequency regulation, the optimized
electricity charge is $37.60, including degradation cost and operation and maintenance cost
of $9.12. Thus, the user-side energy storage battery can participate in the market frequency
regulation auxiliary service, which can effectively reduce the user’s electricity charge.
6.3. Intra-Day Real-Time Optimization
According to the LSTM that predicts the frequency regulation signal, the MPC model
described in Section 4 is used for rolling training on the frequency regulation day in which
the energy storage with power of 0.87 MW and capacity of 0.2 MWH is used. The 24-h
frequency regulation output is shown in Figure 9.
$FWXDORXWSXWRIIUHTXHQF\5HJXODWLRQ0:
7LPHK
Figure 9. The output of storage frequency regulation in real time during 24 h.
582
Electronics 2022, 11, 29
Since the total output of the energy storage battery in a day is equal to the sum of the
frequency regulation output and the peak shaving output, we can take any continuous
two hours in a day to observe, and the actual total output of energy storage is shown
in Figure 10.
$FWXDORXWSXWHQHUJ\VWRUDJH0:
$FWXDORXWSXWRIHQHUJ\VWRUDJH
IUHTXHQF\UHJXODWLRQ
3HDNVKDYLQJRXWSXW
3HDNVKDYLQJDQGIUHTXHQF\
UHJXODWLRQRXWSXW
7LPHK
Figure 10. The intra-day total output of the storage.
6.4. Economic Analysis
This section compares the coordinated output of peak shaving and frequency regula-
tion of energy storage with the economic benefits obtained by peak shaving or frequency
regulation alone for a whole day. As shown in Figure 11, the impact of using 1 MW and
1 MWH energy storage batteries for one day under different schemes on the electricity
charge of the industrial park is shown respectively.
)UHTXHQF\UHJXODWLRQSHQDOW\FKDUJHV
)UHTXHQF\UHJXODWLRQUHYHQXH
'HJUDGDWLRQRSHUDWLRQDQGPDLQWHQDQFHFRVWV
%DVLFHOHFWULFLW\FKDUJH
(OHFWULFLW\FKDUJH
&RVW
(QHUJ\VWRUDJH )UHTXHQF\UHJXODWLRQ 3HDNVKDYLQJ &RRGLQDWHGRXWSXW
GRHVQRWDFW RQO\ RQO\ RIIUHTXHQF\UHJXODWLRQ
DQGSHDNVKDYLQJ
Figure 11. The economy contrasts of different schemes.
It can be seen from the Figure 11 that the 24 h electricity charge of users obtained
through the strategy in this paper is reduced by 10.96% compared with the output without
energy storage, 5.8% compared with the output of peak shaving only for energy storage,
and 3.6% compared with the output of frequency regulation only for energy storage. The
benefit brought by the combined output of energy storage peak shaving and frequency
583
Electronics 2022, 11, 29
regulation is better than that of the frequency regulation service or peak shaving alone with
batteries of the same capacity and power.
This is due to the Reg_D frequency regulation signal frequently crossing the zero
value, and the SOC of the battery can be recovered by following the signal. Therefore, there
is little demand for capacity during energy storage frequency regulation. Although the
profit obtained by using 1 MW bidding capacity is greater than that obtained by using 0.87
MW capacity for frequency regulation, it will also increase the degradation cost of energy
storage battery each time following the signal. If 0.87 MW power is used for frequency
regulation and 0.13 MW power is used for peak shaving, the benefit of frequency regulation
is less than that of 1 MW power frequency regulation, but the cost of degradation benefit is
lower, and the benefit of peak shaving will be obtained. Therefore, the optimal economic
results of frequency regulation and peak shaving will be obtained. The degradation costs
incurred by adopting various schemes are shown in Table 4.
Table 4. Degradation costs of different schemes.
Scheme Degradation Cost
1 MW, 1 MW·h Frequency regulation $261
1 MW, 1 MW·h Peak shaving $51.4
0.87 MW, 0.2 MW·h Frequency regulation individually $200
0.13 MW, 0.8 MW·h Peak shaving individually $52
1 MW, 1 MW·h Combined output of frequency
$236
regulation and peak shaving
It can be seen from Table 4 that the sum of degradation cost generated by 0.87 MW,
0.2 MW·h frequency regulation and 0.13 MW, 0.8 MW·h peak shaving alone is $16 more
than that generated by 1 MW, 1 MW·h combined frequency regulation with peak shaving.
The reason for the cost reduction is that in the process of joint output, the frequency
regulation signal has quite a lot of time, which is contrary to the peak shaving of energy
storage, thus reducing the discharge depth of the storage battery and reducing the cost
of degradation.
6.5. Economic Analysis Based on Life Cycle
According to the 24 h energy storage peak shaving and frequency modulation output,
the SOC change of the energy storage battery during the day is shown in Figure 12.
62&
7LPHK
Figure 12. Change curve of SOC in 24 h.
584
Electronics 2022, 11, 29
According to the SOC change data over 24 h, the cycle times and cycle depth of peak
shaving and frequency regulation of energy storage in a day can be obtained by using the
rain flow counting method, as shown in the Figure 13. The discharge cycle is composed
of peak shaving deep cycle and several frequency regulation shallow cycles. A total of
109 cycles are carried out in 24 h, and the sum of cycle depths is 0.7171. According to the
average cycle life of lithium battery, the operation life under the strategy proposed in this
paper is 3 years.
62&
1XPEHURIF\FOHV
Figure 13. The result of rain flow.
In order to reflect the profitability of the strategy proposed, the rate of return on
investment is introduced for evaluation. The rate of return on investment can be calculated
by the ratio of the average annual net income over the entire life cycle of the system to the
total investment amount, and the greater the rate of return on investment, the better the
profitability of the project, which can be calculated as follows.
NB
Rinv = × 100% (40)
K
where, K is the annual average investment of the project, namely K = CT /TLCC . NB is the
average annual net income during the life cycle of the system.
According to the life of the energy storage battery, the economic analysis of the whole
life cycle is carried out, and the costs and benefits are shown in Table 5.
Table 5. Economic analysis result of life cycle.
Parameter Numerical Value
Present value of the initial investment cost C1 ($) 1.98 × 106
Present value of energy storage operation and maintenance cost C2 ($) 3.12 × 105
Present value of energy storage disposal cost C3 ($) 4.00 × 103
Present value of the penalty cost C4 ($) 1.31 × 106
Present value of peak shaving income R1 ($) 1.49 × 105
Present value of frequency regulation income R2 ($) 7.56 × 106
RT − CT ($) 4.09 × 106
Rate of return on investment Rinv (%) 5.66
585
Electronics 2022, 11, 29
For comparison, using the same method, frequency regulation of 1 MW, 1 MW·h
energy storage batteries and peak shaving of 1 MW, 1 MW·h energy storage batteries are
used to perform a full-life economic analysis. The results are shown in Tables 6 and 7.
Table 6. Life cycle analysis of 1 MW, 1 MW·h energy storage for peak shaving.
Parameter Numerical Value
Present value of the initial investment cost C1 ($) 8.55 × 105
Present value of energy storage operation and maintenance cost C2 ($) 7.31 × 104
Present value of energy storage disposal cost C3 ($) 1.33 × 103
The cycle life of the energy storage Tlife (year) 8
Present value of peak shaving income R1 ($) 3.57 × 105
RT − CT ($) −5.72 × 105
Rate of return on investment Rinv (%) −3.08
Table 7. Life cycle analysis of 1 MW, 1 MW·h energy storage for frequency regulation.
Parameter Numerical Value
Present value of the initial investment cost C1 ($) 5.15 × 106
Present value of energy storage operation and maintenance cost C2 ($) 3.37 × 105
Present value of energy storage disposal cost C3 ($) 1.21 × 104
Present value of the penalty cost C4 ($) 1.09 × 106
The cycle life of the energy storage Tlife (year) 1
Present value of frequency regulation income R2 ($) 9.61 × 106
RT − CT ($) 3.02 × 106
Rate of return on investment Rinv (%) 2.29
Available from Tables 5–7, the life cycle analysis results are different. For Tlife , peak
shaving only is the largest, followed by peak shaving and frequency regulation coordination
output, and only frequency regulation is the smallest. This is because the SOC changes
are different for different output strategies. When energy storage performs frequency
modulation only, it needs to constantly switch between the two states of charging and
discharging for tracking the Reg_D signal. Therefore, the corresponding number of energy
storage cycles per day will increase. The cycle life of the energy storage battery is fixed, and
when the number of cycles is reached, the battery needs to be replaced so greater battery
replacement costs will be incurred. Therefore, the C1 is the largest when the energy storage
battery only participates in frequency regulation service. Similarly, Tlife is the largest
when energy storage participates peak shaving only, so the number of battery replacement
required in the whole life cycle is the smallest. Therefore, C1 is the smallest when energy
storage only shaves the peaks, and the characteristics of C3 are the same as C1 . Although
the investment cost of energy storage only peak shaving is low, the income from energy
storage only peak shaving is too small, such that the net income in the whole life cycle
of energy storage only peak shaving is negative, and the rate of return on investment is
also negative. Although the frequency regulation gain of the energy storage battery is
very high when it is used only, the service life of the energy storage is too short due to
long-term multiple cycles. By comparison, under the operation of the strategy proposed in
this paper, the energy storage battery can reduce the output cycle required for participating
in frequency regulation through peak regulation output (as shown in the Figure 12). At the
same time, the problem of low peak shaving income is compensated by the high income of
frequency regulation services, so the income and life of energy storage batteries coexist,
which has a higher investment value.
7. Conclusions
In order to improve the economy and investability of energy storage on the user side,
this paper puts forward the peak shaving and frequency regulation coordinated output
586
Electronics 2022, 11, 29
strategy in which the industrial park energy storage battery participates in the system
frequency regulation service while peak shaving to obtain additional income.
The strategy divides the peak shaving and frequency regulation capacity of energy
storage and obtains the output of peak shaving plan day ahead. The real-time output
with optimal economy is obtained through MPC rolling optimization intra-day, and the
degradation effect and operation and maintenance cost are considered while the maximum
frequency regulation capacity compensation and mileage compensation are obtained, so as
to improve the total revenue of the industrial park energy storage intra-day. Finally, the
whole life cycle economic analysis of the strategy proposed in this paper shows that the
peak shaving and frequency regulation coordinated output on the user side has a larger
rate of return. When China’s frequency regulation service market is better in the future, this
strategy provides a new idea for industrial park energy storage to improve its economy.
Author Contributions: Methodology, Z.J.; software, Y.Y.; validation, Y.Y. and Y.F.; formal analysis, Y.S.
and Y.F.; investigation, Y.F.; resources, D.L.; writing—original draft preparation, Z.J.; writing—review
and editing, H.C. (Huayue Chen) and Y.S.; visualization, H.C. (Hongji Cao); funding acquisition, Y.S.
and D.L. All authors have read and agreed to the published version of the manuscript.
Funding: This research was jointly funded by the Yantai Key Research and Development Program,
grant number 2020YT06000970; the Wealth Management Characteristic Construction Project of
Shandong Technology and Business University, grant number 2019ZBKY019.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: Not applicable.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Sun, Z.; Tian, H.; Wang, W. Research on economy of echelon utilization battery energy storage system for user-side peak load
shifting. Acta Energ. Sol. Sin. 2021, 42, 95–100.
2. Ye, J. Research on Technical Adaptability and Benefit Evaluation of Energy Storage System in Typical Application Scenarios; North China
Electric Power University: Beijing, China, 2020.
3. Zhang, Z.H.; Min, F.; Chen, G.S.; Shen, S.P.; Wen, Z.C.; Zhou, X.B. Tri-partition state alphabet-based sequential pattern for
multivariate time series. Cogn. Comput. 2021. [CrossRef]
4. Ran, X.; Zhou, X.; Lei, M.; Tepsan, W.; Deng, W. A novel k-means clustering algorithm with a noise algorithm for capturing urban
hotspots. Appl. Sci. 2021, 11, 11202. [CrossRef]
5. Chen, H.; Zhang, Q.; Luo, J. An enhanced Bacterial Foraging Optimization and its application for training kernel extreme learning
machine. Appl. Soft Comput. 2020, 86, 105884. [CrossRef]
6. Cui, H.; Guan, Y.; Chen, H.; Deng, W. A novel advancing signal processing method based on coupled multi-stable stochastic
resonance for fault detection. Appl. Sci. 2021, 11, 5385. [CrossRef]
7. Zhao, H.; Li, D.; Deng, W.; Yang, X. Research on vibration suppression method of alternating current motor based on fractional
order control strategy. Proc. Inst. Mech. Eng. Part E J. Process. Mech. Eng. 2017, 231, 786–799. [CrossRef]
8. Salles, M.B.C.; Gadotti, T.N.; Aziz, M.J.; Hogan, W.W. Potential revenue and breakeven of energy storage systems in PJM energy
markets. Environ. Sci. Pollut. Res. Int. 2021, 28, 12357–12368. [CrossRef]
9. He, G.; Chen, Q.; Kang, C.; Pinson, P.; Xia, Q. Optimal bidding strategy of battery storage in power markets considering
performance-based regulation and battery cycle life. IEEE Trans. Smart Grid 2016, 7, 2359–2367. [CrossRef]
10. Zheng, J.; Yuan, Y.; Zou, L.; Deng, W.; Guo, C.; Zhao, H. Study on a novel fault diagnosis method based on VMD and BLM.
Symmetry 2019, 11, 747. [CrossRef]
11. Zhou, Y.; Zhang, J.; Yang, X.; Ling, Y. Optimal reactive power dispatch using water wave optimization algorithm. Oper. Res. 2020,
20, 2537–2553. [CrossRef]
12. Zhong, K.; Zhou, G.; Deng, W.; Zhou, Y.; Luo, Q. MOMPA: Multi-objective marine predator algorithm. Comput. Methods Appl.
Mech. Eng. 2021, 385, 114029. [CrossRef]
13. Wei, Y.Y.; Zhou, Y.Q.; Luo, Q.F.; Deng, W. Optimal reactive power dispatch using an improved slime mould algorithm. Energy
Rep. 2021, 7, 8742–8759. [CrossRef]
14. Deng, W.; Zhang, X.X.; Zhou, Y.Q.; Liu, Y.; Zhou, X.B.; Chen, H.L.; Zhao, H.M. An enhanced fast non-dominated solution sorting
genetic algorithm for multi-objective problems. Inform. Sci. 2022, 585, 441–453. [CrossRef]
587
Electronics 2022, 11, 29
15. Li, T.Y.; Qian, Z.J.; Deng, W.; Zhang, D.Z.; Lu, H.H.; Wang, S.H. Forecasting crude oil prices based on variational mode
decomposition and random sparse Bayesian learning. Appl. Soft Comput. 2021, 113, 108032. [CrossRef]
16. Kulpa, J.; Kamiński, P.; Stecuła, K.; Prostański, D.; Matusiak, P.; Kowol, D.; Kopacz, M.; Olczak, P. Technical and economic aspects
of electric energy storage in a mine shaft-budryk case study. Energies 2021, 14, 7337. [CrossRef]
17. Deng, W.; Xu, J.; Zhao, H.; Song, Y. A novel gate resource allocation method using improved PSO-based QEA. IEEE Tran. Intell.
Transp. Syst. 2020, 1–9. [CrossRef]
18. Xue, J.; Ye, J.; Xu, Q. Interactive package and diversified business mode of renewable energy accommodation-n with client
distributed energy storage. Power Syst. Technol. 2020, 44, 1310–1316.
19. Cui, H.; Guan, Y.; Chen, H. Rolling element fault diagnosis based on VMD and sensitivity MCKD. IEEE Access 2021, 9, 120297–120308.
[CrossRef]
20. Deng, W.; Shang, S.; Cai, X.; Zhao, H.; Zhou, Y.; Chen, H.; Deng, W. Quantum differential evolution with cooperative coevolution
framework and hybrid mutation strategy for large scale optimization. Knowl. -Based Syst. 2021, 224, 107080. [CrossRef]
21. Cheng, B.; Powell, W.B. Co-optimizing battery storage for the frequency regulation and energy arbitrage using multi-scale
dynamic programming. IEEE Trans. Smart Grid 2018, 9, 1997–2005. [CrossRef]
22. Senchilo, N.D.; Ustinov, D.A. Method for determining the optimal capacity of energy storage systems with a long-term forecast of
power consumption. Energies 2021, 14, 7098. [CrossRef]
23. Chau, T.K.; Yu, S.S.; Fernando, T.; Iu, H.H. Demand-side regulation provision from industrial loads integrated with solar pv
panels and energy storage system for ancillary services. IEEE Trans. Ind. Inform. 2018, 14, 5038–5049. [CrossRef]
24. Deng, W.; Xu, J.; Gao, X.; Zhao, H. An enhanced MSIQDE algorithm with novel multiple strategies for global optimization
problems. IEEE Trans. Syst. Man. Cybern. Syst. 2020. [CrossRef]
25. Meng, L.; Zafar, J.; Khadem, S.K.; Collinson, A.; Murchie, K.C.; Coffele, F.; Burt, G.M. Fast frequency response from energy storage
system a review of grid standards, projects and technical issues. IEEE Trans. Smart Grid 2020, 11, 1566–1581. [CrossRef]
26. Lepszy, S. Analysis of the storage capacity and charging and discharging power in energy storage systems based on historical
data on the day-ahead energy market in Poland. Energy 2020, 213, 118750. [CrossRef]
27. Liu, Z.; Feng, D.; Wu, F.; Zhou, Y.; Fang, C. Contract demand decision for electricity users with stochastic photovoltaic generation.
Proc. CSEE 2020, 40, 1865–1873.
28. Zhao, H.M.; Liu, H.D.; Jin, Y.; Dang, X.J.; Deng, W. Feature extraction for data-driven remaining useful life prediction of rolling
bearings. IEEE Trans. Instrum. Meas. 2021, 70, 3511910. [CrossRef]
29. Arias, N.B.; López, J.C.; Hashemi, S.; Franco, J.F.; Rider, M.J. Multi-objective sizing of battery energy storage systems for stackable
grid applications. IEEE Trans. Smart Grid 2021, 12, 2708–2721. [CrossRef]
30. Walawalkar, R.; Apt, J.; Mancini, R. Economics of electric energy storage for energy arbitrage and regulation in New York. Energy
Policy 2007, 35, 2558–2568. [CrossRef]
31. Salles, M.B.C.; Huang, J.; Aziz, M.J.; Hogan, W.W. Potential arbitrage revenue of energy storage systems in PJM. Energies 2017, 10,
1100. [CrossRef]
32. Barchi, G.; Pierro, M.; Moser, D. Predictive energy control strategy for peak shaving and shifting using BESS and PV generation
applied to the retail sector. Electronics 2019, 8, 526. [CrossRef]
33. Wang, Y.; Pei, C.; Li, Q.; Li, J.; Pan, D.; Gao, C. Flow shop providing frequency regulation service in electricity market. Energies
2020, 13, 1767. [CrossRef]
34. Karpilow, A.; Henze, G.; Beamer, W. Assessment of commercial building lighting as a frequency regulation resource. Energies
2020, 13, 613. [CrossRef]
35. Cai, J. Optimal Building Thermal Load Scheduling for Simultaneous Participation in Energy and Frequency Regulation Markets.
Energies 2021, 14, 1593. [CrossRef]
36. Vatandoust, B.; Ahmadian, A.; Golkar, M.A.; Elkamel, A.; Almansoori, A.; Ghaljehei, M. Risk-averse optimal bidding of electric
vehicles and energy storage aggregator in day-ahead frequency regulation market. IEEE Trans. Power Syst. 2019, 34, 2036–2047.
[CrossRef]
37. Shi, Y.; Xu, B.; Wang, D.; Zhang, B. Using battery storage for peak shaving and frequency regulation: Joint optimization for
superlinear gains. IEEE Trans. Power Syst. 2018, 33, 2882–2894. [CrossRef]
38. Liu, Q.; Liu, M.; Lu, W. Control method for battery energy storage participating in frequency regulation market considering
degradation cost. Power Syst. Technol. 2021, 45, 3043–3051.
39. Li, J.; Zhang, J.; Mu, G.; Ge, Y.; Yan, G.; Shi, S. Day ahead optimal scheduling strategy of peak regulation for energy storage
considering peak and valley characteristics of load. Electr. Power Autom. Equip. 2020, 40, 128–133.
40. Xu, B.; Zhao, J.; Zheng, T.; Litvinov, E.; Kirschen, D.S. Factoring the cycle aging cost of batteries participating in electricity markets.
IEEE Trans. Power Syst. 2018, 33, 2248–2259. [CrossRef]
41. Cao, J.; Harrold, D.; Fan, Z.; Morstyn, T.; Healey, D.; Li, K. Deep reinforcement learning-based energy storage arbitrage with
accurate lithium-ion battery degradation model. IEEE Trans. Smart Grid 2020, 11, 4513–4521. [CrossRef]
42. Li, X.; Ma, R.; Wang, S.; Zhang, S.; Li, P.; Fang, C. Operation control strategy for energy storage station after considering battery
life in commercial park. High Volt. Eng. 2020, 46, 62–70.
43. Li, W.C.; Tong, Y.B.; Zhang, W.G. Energy storage capacity allocation method of electric vehicle charging station considering
battery life. Adv. Technol. Electr. Eng. Energy 2019, 39, 55–63.
588
Electronics 2022, 11, 29
44. Huang, J.; Li, X.; Chang, M.; Li, S.; Liu, W. Capacity allocation method considering the energy storage battery participating in the
primary frequency modulation technology economic mode. Trans. China Electrotech. Soc. 2017, 32, 112–121.
45. Chen, Y.; Leonard, R.; Keyser, M.; Gardner, J. Development of performance-based two-part regulating reserve compensation on
miso energy and ancillary service market. IEEE Trans. Power Syst. 2015, 30, 142–155. [CrossRef]
46. Papalexopoulos, A.D.; Andrianesis, P.E. Performance-based pricing of frequency regulation in electricity markets. IEEE Trans.
Power Syst. 2014, 29, 441–449. [CrossRef]
47. Batiyah, S.; Zohrabi, N.; Abdelwahed, S.; Sharma, R. An MPC-based power management of a PV/battery system in an islanded
DC microgrid. In Proceedings of the 2018 IEEE Transportation Electrification Conference and Expo (ITEC), Long Beach, CA, USA,
13–15 June 2018; pp. 231–236.
589
electronics
Article
Machine Learning-Driven Approach for a COVID-19
Warning System
Mushtaq Hussain 1 , Akhtarul Islam 2 , Jamshid Ali Turi 3 , Said Nabi 1, *, Monia Hamdi 4 , Habib Hamam 5,6,7,8 ,
Muhammad Ibrahim 9,10, *, Mehmet Akif Cifci 11,12 and Tayyaba Sehar 1
1 Department of Computer Science and Information Technology, Virtual University of Pakistan,
Lahore 54000, Pakistan
2 Statistics Discipline, Science, Engineering and Technology (SET) School, Khulna University,
Khulna 9208, Bangladesh
3 Department of Management Information System, University of Tabuk, Tabuk 47512, Saudi Arabia
4 Department of Information Technology, College of Computer and Information Sciences, Princess Nourah bint
Abdulrahman University, P.O. Box 84428, Riyadh 11671, Saudi Arabia
5 Faculty of Engineering, Moncton University, Moncton, NB E1A3E9, Canada
6 International Institute of Technology and Management, Commune d’Akanda, BP, Libreville 1989, Gabon
7 Department of Electrical and Electronic Engineering Science, School of Electrical Engineering, University of
Johannesburg, Johannesburg 2006, South Africa
8 Spectrum of Knowledge Production & Skills Development, Sfax 3027, Tunisia
9 Department of Computer Engineering, Jeju National University, Jeju 63014, Republic of Korea
10 Department of Information Technology, University of Haripur, Haripur 22620, Pakistan
11 Department of Computer Engineering, Bandirma Onyedi Eylul University, Balikesir 10200, Turkey
12 Informatics, Klaipeda State University of Applied Sciences, LT-91274 Klaipeda, Lithuania
* Correspondence: [email protected] (S.N.); [email protected] (M.I.)
Abstract: The emergency of the pandemic and the absence of treatment have motivated researchers in
Citation: Hussain, M.; Islam, A.; Turi, all the fields to deal with the pandemic situation. In the field of computer science, major contributions
J.A.; Nabi, S.; Hamdi, M.; Hamam, H.; include the development of methods for the diagnosis, detection, and prediction of COVID-19 cases.
Ibrahim, M.; Cifci, M.A.; Sehar, T. Since the emergence of information technology, data science and machine learning have become
Machine Learning-Driven Approach the most widely used techniques to detect, diagnose, and predict the positive cases of COVID-19.
for a COVID-19 Warning System. This paper presents the prediction of confirmed cases of COVID-19 and its mortality rate and then
Electronics 2022, 11, 3875. https://
a COVID-19 warning system is proposed based on the machine learning time series model. We
doi.org/10.3390/electronics11233875
have used the date and country-wise confirmed, detected, recovered, and death cases features for
Academic Editors: Taiyong Li, training of the model based on the COVID-19 dataset. Finally, we compared the performance of time
Wu Deng, Jiang Wu and Juan series models on the current study dataset, and we observed that PROPHET and Auto-Regressive
M. Corchado (AR) models predicted the COVID-19 positive cases with a low error rate. Moreover, death cases
Received: 19 August 2022 are positively correlated with the confirmed detected cases, mainly based on different regions’
Accepted: 14 November 2022 populations. The proposed forecasting system, driven by machine learning approaches, will help the
Published: 23 November 2022 health departments of underdeveloped countries to monitor the deaths and confirm detected cases of
COVID-19. It will also help make futuristic decisions on testing and developing more health facilities,
Publisher’s Note: MDPI stays neutral
mostly to avoid spreading diseases.
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Keywords: time series; forecasting; COVID-19; machine learning; warning system; PROPHET; health
Copyright: © 2022 by the authors. 1. Introduction
Licensee MDPI, Basel, Switzerland. The introduction should briefly place the study in a broad context and highlight why
This article is an open access article it is important. Coronaviruses (termed as CoVs) are a group of viruses that infect birds
distributed under the terms and
and mammals. They also cause widespread diseases, such as Severe Acute Respiratory
conditions of the Creative Commons
Syndrome Coronavirus (SARS-CoV), Middle East Respiratory Syndrome, Coronavirus
Attribution (CC BY) license (https://
(MERS-CoV), and the 2019 Novel Coronavirus (2019-nCoV, also known as COVID-19) [1].
creativecommons.org/licenses/by/
The COVID-19 outbreak started in Wuhan Province, China, in late December 2019, and
4.0/).
Electronics 2022, 11, 3875. https://doi.org/10.3390/electronics11233875 https://www.mdpi.com/journal/electronics
591
Electronics 2022, 11, 3875
patients died due to organ dysfunction syndrome [2,3]. The Chinese government reported
that the causative pathogen was a coronavirus identified by genomic sequencing and
electron microscopy. The virus originated in bats and was eventually transmitted to
humans via an intermediate host (probably the raccoon dog) [4].
In many instances, the major symptoms of COVID-19, were fever, cough, and shortness
of breath, resembling those of seasonal influenza [5]. Since it was first recognized, COVID-
19 has spread exponentially across the world. According to world meters, as of the 5
October 2022, 11:13 GMT, the COVID-19 pandemic has affected 228 countries and territories
worldwide and two international conveyances with 624,430,759 confirmed 6,553,537 deaths,
604,462,445 recovered cases, and 13,414,777 active cases. Even after the substantial efforts
made by scientists and scholars worldwide, COVID-19 has no standard cure method
through vaccines [6]. Nonetheless, some of the patients of the COVID-19 pandemic are
recovering with the aid and the proper administration of antibiotic medications. Right now,
the world needs a speedy solution to tackle the further spread of COVID-19. The emergence
of COVID-19 infection has forced researchers from various disciplines to explore this novel
virus. Machine learning is a branch of AI that essentially focuses on the production
of systems that can learn from trained examples and improve without being explicitly
programmed [7]. Machine Learning has played a significant part in many fields, e.g.,
medical care [8], medical informatics [9], and agriculture [10]. Moreover, different ML
models have optimization problems and mathematical techniques [11] that can be used to
solve these problems. Similarly, ML algorithms have been used to understand and detect
COVID-19, which has alleviated the enormous strain on healthcare systems while offering
the most effective diagnostic and prognostic tools for COVID-19 pandemic patients.
The COVID-19 pandemic has seriously affected population health across the globe.
The forecasting of COVID-19 research efforts has become critical and, with the advancement
of computers and software technology, AI has played a vital role in the healthcare system in
the detection and clinical diagnosis of diseases. Much research has focused on the treatment,
prediction, as well as the formulation of COVID-19 [12].
A variety of ML techniques have been used to predict the mortality risk of COVID-19
patients. Pourhomayoun et al. [13] have used a support vector machine (SVM), artificial
neural network (ANN), random forest (RF), decision tree, logistic regression, and K-nearest
neighbor to detect the mortality risk of patients due to COVID-19 infection.
Researchers have also focused on modeling, predicting, and forecasting the spread of
COVID-19 based on the time-series recorded data of COVID-19. Sarkar et al. [14] proposed
the SARII mathematical model to forecast the dynamic transmission of COVID-19, which
was an extended version of the SEIR model. The proposed model is based on six dynamics
behaviors, i.e., susceptible, asymptomatic, recovered, infected, and quarantined. An alter-
native version of the SEIR model was proposed by Abbasi et al. [15], named SQEIAR, which
considered the two parameters, quarantined individuals and asymptomatic individuals, to
describe COVID-19. Similarly, Ribeiro et al. [16] used applied regression models ARIMA,
cubist regression, random forest, SVR, rigid regression, and stacking-ensemble learning for
the forecasting of COVID-19 cases in Brazil. According to the obtained results, researchers
observed that SVM regression and stacking-ensemble are better in forecasting. Apart from
linearity, many researchers have used nonlinearity structures to predict COVID-19 cases.
Peng et.al [17], used the SVR with a Gaussian kernel and claimed the better prediction of
COVID-19 cases.
Various ML algorithms and deep learning techniques have been utilized in the litera-
ture to compute COVID-19. Different methodologies, including long short-term memory
(LSTM), ARIMA, and JNARNN, were built using ML and deep learning [18,19]. However,
this research did not analyze the performance model’s link between positive cases and
input features. This study explores the performance time series of the ML model on the
COVID-19 dataset and identifies the characteristics most closely associated with positive
COVID-19 cases. The prognosis of death and verified detection cases (of COVID-19) is
a weekly concern for numerous nations. The current dataset displayed daily confirma-
592
Electronics 2022, 11, 3875
tions and death cases in various nations; however, such a dataset was not ordered weekly,
and not all the observations of the existing dataset were available (many attributes were
missing), which must be fixed.
For this research, we utilized the COVID-19 virus dataset which is available online for
research purposes. In this dataset, the COVID-19 observations, such as confirmed cases,
death cases, and recovery cases, are organized by date for many U.S. states. In addition,
the dataset comprises data from 10 March 2020–29 March 2020.
In the subsequent section, the relevant literature will be presented. Materials and meth-
ods will be discussed in the following section. Section 4 will next exhibit the experiment
described in this paper. The final section will present issues, difficulties, and conclusions.
Consequently, a new COVID-19 warning system can be constructed using an ML
technique, for instance, by comparing the performance of the “Time Series ML Algorithm”
to the “Statistical Time Series Model.” This would aid healthcare professionals and physi-
cians in diagnosing COVID-19 pandemic patients and recommending recent anti-bodies
medication (for recovery). Additionally, implementing the time series ML algorithm (to
avoid the pandemic) would limit the spread of the COVID-19 pandemic in situations where
human-to-human interaction is inevitable.
The main objective of this study is twofold. First, to estimate the weekly-confirmed
instances of COVID-19 and potential deaths using patient history data in different nations;
second, to create a warning system that can evaluate the performance of various ML time
series models with statistical time series models. Since the present pandemic data (of
COVID-19) is only available in abundance, the investigation of the following research
issues constitutes a significant contribution to the body of research.
1. What are the appropriate time series models for predicting patients infected with the
COVID-19 virus?
2. What will the number of death cases and possible confirmed detected cases in the
coming weeks be, based on various given features in the form of data at input, such
as date, country, detected cases, and deaths?
2. Related Work
False positives are often observed in research when the literature of papers and method-
ologies are considered. As a result, it is essential to develop methods that make becoming
faster and gaining more accurate results easier while simultaneously reducing human-
induced errors. This section of the study examines the procedures and methodologies of
the literature.
To help policymakers manage the disease and related emerging situations, the au-
thors [6] devised a COVID-19 pandemic prediction tool. This tool was based on data from
patients from India to keep track of infected cases. They assumed that control strategies,
such as quarantines and lockdowns, would prevail. Their results suggested that India could
experience the end of the pandemic by March 2021. The model was developed on the basis
of least-square fitting of the novel coronavirus behavior and is based on real-world data for
a particular time, but the least-square technique was unable to address the overfitting issue.
Ganiny et al. [19], based on the Indian perspective, employed an autoregressive
integrated moving average (ARIMA) model that utilizes the past trajectory and forecasts
the future evolution of COVID-19. Their model predicted the number of infected cases,
active cases, recoveries, and deaths due to the pandemic. They suggest some robust control
strategies to mitigate the spread of COVID-19.
Wadhwa et al. [20] predicted recovery, death, and active cases of COVID-19 patients
by applying a linear regression technique from Indian records. Their model predicted
the extension of lockdown based on empirical results. They applied graphical tools to
showcase the predicted results more comprehensively.
Saima et al. [21] studied the trends of COVID-19 in the eastern Mediterranean regions
using a statistical method. Their analysis revealed that Iran was the worst affected country,
followed by Saudi Arabia and Pakistan. The United Arab Emirates and Saudi Arabia
593
Electronics 2022, 11, 3875
had the lowest fatality rates, while Pakistan and Lebanon had moderate fatalities. They
suggest following strict recommendations, based on epidemiological principles, to reduce
COVID-19 cases.
Yadav et al. [22] utilized ML tools to analyze the transmission and growth rates of
COVID-19 patients across various countries. They further correlated the weather conditions
and the COVID-19 cases and predicted the pandemic’s end time frame. They exploited
support vector machine algorithms (SVM) for these tasks.
The model demonstrated a high accuracy of 98% and proved its efficacy compared to
recent forecasting models.
Ricardo, M. A. V., et al. [23] applied reduced-space Gaussian process regression, related
to chaotic dynamical systems, to forecast COVID-19-related deaths from 82 days’ data.
Empirical results asserted that Gaussian mean-field models were able to be employed to
gather information regarding the pandemic’s spread, recovery, and fatality rates. They also
devised a reduced-space Gaussian process regression model to estimate when saturation
would be achieved in the USA (regarding the pandemic).
Hamzah et al. [24] also introduced a predictive model based on the Corona Tracker
(an online platform for reliable analysis, and statistics, of COVID-19) to forecast COVID-
19-related cases, recoveries, and deaths. They exploited susceptible exposed infectious
recovered (SEIR) modeling to keep track and predict COVID-19 outbreaks.
Moreover, they classified and analyzed the queried news into positive and negative
categories based on the people’s sentiments. Furthermore, they tried to understand the
economic and political impacts of COVID-19. Overall, they observed that more negative
articles exist in the given domain than positive ones.
Mahajan et al. [25] utilized a compartmental epidemic model (SIPHERD) to predict
COVID-19 active, confirmed, and death cases in India. Their results show that social-
distancing measures, increasing daily tests, and strict lockdown significantly impacted the
reduction of COVID-19.
Moreover, the authors [26] employed the SEIR model to extract the epidemic curve
from the epidemiological data of COVID-19. They also applied an AI framework to
forecast the disease. Their model was trained using 2003 SARS data. They predicted that
the epidemic peak would gradually rise and then fall in China. Their dynamic model
demonstrated its efficacy in forecasting COVID-19 epidemic sizes and peaks.
Shahid et al. [27] also presented a COVID-19 time series prediction model by employ-
ing LSTM, bidirectional long short-term memory (Bi-LSTM), support vector regression
(SVR), and autoregressive integrated moving average model (ARIMA) techniques. They
evaluated their model using the R square score, root mean square error (RMSE), and
mean absolute error indices (MAEI). Their results suggest that the Bi-LSTM model is the
best-suited model for such pandemic predictions, especially for better management and
planning.
According to Xue et al. [28], in 2020, COVID-19 still needed to be completely under-
stood. The authors believe that scientists and doctors were struggling to find COVID-19
instances. COVID-19 tests include viral tests to determine whether the patients are infected
and antibody tests to determine if the patients have been infected before. The paper aims
to reduce the false positive rate.
Various ML algorithms and deep learning techniques have been utilized in the lit-
erature to compute COVID-19. Different methodologies, including LSTM, ARIMA, and
JNARNN, were built using ML and deep learning [29,30]. However, this research did not
analyze the performance model’s link between positive cases and input features. This
study explores the performance time series of the ML model on the COVID-19 dataset and
identifies the characteristics most closely associated with positive COVID-19 cases. The
prognosis of death and the verified detection cases (of COVID-19) is a weekly concern for
numerous nations.
Mansour et al. [17] provide a unique unsupervised DL-based variational autoen-
coder model for COVID-19 identification and classification. They utilized the Adagrad
594
Electronics 2022, 11, 3875
approach to modify the Inception v4 model hyperparameters to improve the classification
performance.
Accordingly, an intelligent COVID-19 positive cases detection system was developed
in this study using ML time series algorithms. The main task of the proposed architecture
is to provide an efficient method for predicting COVID-19 patient-positive cases. Based
on the performance of the proposed system, the health department can find daily positive
cases in different areas of the country.
3. Materials and Methods
We studied COVID-19 data from many countries across the globe, which are freely
accessible online for research purposes. The forecasting system of the current study, driven
by machine learning approaches, will help the health departments of underdeveloped
countries to monitor the death and confirmed cases of COVID-19. It will also help make
futuristic decisions on testing and developing more health facilities, mostly to avoid
spreading diseases. Using an ML technique, for instance, by comparing the performance
of the “Time Series ML Algorithm” to the “Statistical Time Series Model”, would aid
healthcare professionals and physicians in diagnosing COVID-19 pandemic patients and
recommending recent anti-bodies medication (for recovery).
The dataset contains information regarding the COVID-19 virus in various countries
and cities. In addition, the dataset contains daily record data for many countries/cities.
The dataset includes records for other countries and cities beginning on 11 March 2020 and
ending on 29 March 2020. Using the time series models depicted in Figure 1, we followed
the steps below to explore COVID-19 predictions for the subsequent week.
Figure 1. Proposed framework.
Figure 1 depicts the data collection process, followed by the feature extraction proce-
dure. If there are irrelevant characteristics, they are eliminated. Following this, we transfer
the data into the preprocessing procedures, eliminating null values and transforming the
data into a time series. The whole dataset is disseminated to the Week Wise section, where
the death and survival instances are verified. Either it is moved to time series forecasting to
be compared with several models or the prediction is moved to an expert.
Data description: Table 1 provides specifics on the features extracted from the dataset.
It describes how to exclude the pertinent features/attributes of the dataset to construct
time-series prediction models for the COVID-19 cases of different counties, including
laboratory-confirmed cases, recovered cases, and deaths in the following week or hours.
595
Electronics 2022, 11, 3875
Extracted features include date, state, country, confirmed cases, recovered cases, deaths,
and population.
Table 1. Attribute description of the COVID-19 dataset.
Attribute Description
Date The date on which the data was recorded
State State from where the COVID-19 patients belong
County Count y from where COVID-19 patients belong
Confirmed Number of confirmed COVID-19 patients
Recovered Number of recovered COVID-19 patients
Deaths Number of deceased COVID-19 patients
Population The total population in the state
Data preprocessing: Before applying time series forecasting models, we removed
missing values by applying the median imputation method. We checked the dataset’s
stationarity property, which is a relevant feature of time series and that confirms the data
suitability, specifically for the time series-related issues. Moreover, many time series models
only work on stationary data. Stationarity data has a constant up and down movement, and
it also has a constant mean and variance. Since the data used in this study is not stationary
because the status of the time series of COVID-19 dataset statistics and the properties that
changed over time, i.e., MSE and RMSE, we applied Python differencing techniques (to
convert the data into the stationary format). For that reason, we subtracted the current
value from the next value. Then we used a partial autocorrelation function (PACF) plot to
check for stationary properties in the dataset.
Machine learning techniques: In order to apply time series forecasting models to
predict next week and hours of confirmed detected and death cases (based on ML), there are
multiplication classification techniques for the datasets (such as PROPHET, auto regression,
ARIMA, and LSTM). The technique that we use (in this study) consists of different ways to
extract and classify features that help predict futuristic issues. The details of the current
study ML model are below.
3.1. PROPHET
Without a high level of expertise, the prediction is difficult for ML researchers because
it often needs more skills than they possess in terms of programming language. PROPHET
is the Facebook data ML technique, which is open source and available in Python and R
languages. Researchers can use this tool without any programming skills. It is an algorithm
that is used to build a forecasting model for time series data based on an additive approach.
The algorithm was first introduced in 2017, and unlike the traditional time series technique,
PROPHET tries to fit additive regression (called curve fitting) [31]. PROPHET is very robust
within missing data, handles outliers very well, and is best with time series, strong seasonal
effects, and several seasons of historical data [32].
3.2. Autoregressive Model (AR)
The automotive regressive (AR) model predicts the next timestamp value by applying
regression and previous values. The analysis of nature, economics, stock markets, and
other time series-based systems frequently employs the AR model. AR models provide
a number of advantages over other time series models, such as their ability to operate on
continuous variables. The AR model predicts the next timestamp value by regressing and
using previous values. The AR model is commonly used in analyzing nature, economics,
stock markets, and other time series-based processes. AR models have some advantages
over other time series models; for example, they work on continuous values.
596
Electronics 2022, 11, 3875
3.3. Auto Regressive Integrated Moving Average (ARIMA)
We used the auto regressive integrated moving average (ARIMA) model as our dataset
was non-stationary, whereas the integration part was “Stationized” the time series.
3.4. Long Short-Term Memory
LSTM is used to solve the learning models for recurrent neural networks to provide
promising results on many tasks, such as constructing prediction and language models [33].
It solves challenging tasks (large time-lags) that recurrent network algorithms [34] have
never solved. LSTM is used to solve the learning models for recurrent neural networks
to produce promising results on a variety of tasks, including building prediction and
language models [33]. It solves complex tasks (long time lags) that have never been solved
by recurrent network algorithms [34].
4. Results and Discussion
In this study, we used time-series ML models rather than other ML models with
no time dimension. The time series forecasting model is based on previously observed
values [35].
We discovered a positive but weak correlation (r = 0.032) between “Confirmed” and
“Recovered” cases in Table 2. Every day, COVID-19 confirmed and recovered patients
move in the same positive direction, while the increase in confirmed patients is very
high compared to recovered patients of COVID-19. The maximum number of COVID-19
patients is 21,873, whereas the maximum number of recovered patients with COVID-
19 is 10. Between deaths and confirmed cases, we found a strong positive correlation
(r = 0.796). As COVID-19 is confirmed and detected, the death rate of COVID-19 patients
also increased, with the maximum reported death of 281. The variables of “Population”
and “Confirmed” also showed a positive but weak correlation (r = 0.154), which means
that as the population increases, the confirmed patients also increase.
Table 2. Correlation analysis and descriptive statistics for different variables (descriptive statistics).
Std. Correlation with
N Minimum Maximum Mean p-Value
Deviation “Confirmed” (r)
Confirmed 16,585 0.00 21,873.00 22.79 323.776 1 <0.001 ***
Recovered 16,585 0.00 10 0.008 0.1625 0.032 <0.001 ***
Deaths 16,585 0.00 281 0.311 4.0454 0.796 <0.001 ***
Population 16,452 88 39,512,223.0 387,142.67 1,997,001.27 0.154 <0.001 ***
Note: *** p < 0.001.
Table 3 demonstrates that when the number of confirmed cases grows, the death
rate will increase by 0.010 times. We determined that a one-unit (100,000) increase in
population contributes 0.016 times to the death factor for the “Population” variable. Here,
R2 equals 0.640, which shows the amount of a dependent variable’s variance explained
by the independent variables in a regression model. The model’s inputs can explain
approximately 64 percent of the observed variation. We also benefited from the same-
day confirmed cases to predict death, though, for one day of COVID-19 cases, it can be
concluded that 2.2% died while 75.9% recovered and 21.9% were still in isolation or being
treated at the last follow-up.
597
Electronics 2022, 11, 3875
Table 3. Multiple linear regression estimation considering “Deaths” as a dependent variable.
Unstandardized Coefficients 95.0% Confidence Interval for B
p-Value
B Std. Error Lower Bound Upper Bound
(Constant) 0.032 0.019 0.094 −0.006 0.07
Confirmed 0.01 0.000 0.000 0.01 0.01
Population 0.016 0.001 0.000 0.014 0.018
Note: B (Biases) is a training parameter that needs to be optimized during the training process. p-value is the
probability value corresponding to the likelihood of gaining a data value.
Non-stationary data represent that the mean and the standard deviation are not
constant for given data during the time curve described by [35]. With the help of data
visualization, we can understand the pattern, trend, and correlation between the variables
for COVID-19 predictions, based on the time series-based ML approach.
Figure 2 shows how the confirmed COVID-19 patients and the dead COVID-19 pa-
tients, from 10 March 2020–28 March 2020. The figure also shows a sharp increase in both
confirmed and unconfirmed deaths of COVID-19 patients during this time. As the number
of confirmed COVID-19 patients rises, so does the death rate among these patients. The
disturbing fact is that the death toll on March 26 exceeded one thousand.
Figure 2. Bar diagram shows the daily confirmed cases of COVID-19 in current study dataset.
Figure 3 depicts the confirmed COVID-19 patients and deceased COVID-19 patients
between March 10, 2020, and March 28, 2020. The figure also shows a sharp increase in
confirmed and unconfirmed COVID-19 patient deaths over this period. The COVID-19
epidemic affects all sectors of the population but disproportionately negatively impacts the
most disadvantaged social groups.
598
Electronics 2022, 11, 3875
Figure 3. Bar diagram shows the daily death cases due to COVID-19 in current study dataset.
Figure 4 illustrates the daily confirmed cases during COVID-19. In addition, it implies
that the rate of confirmed patients jumped dramatically after 21 March 2020. From the
beginning of 11 March 2020–21 March 2020, as confirmed in Figure 4, the number of COVID-
19-confirmed cases increased gradually. From 21 March 2020, there was an alarming
increase in the number of confirmed COVID-19 cases. After 23 March 2020, the number
of confirmed COVID-19 cases surged. Globally, there was an increase in the world of
confirmed COVID-19 cases. Figures 3 and 4 demonstrate a quick decline in the amount of
confirmed and fatal cases due to the lack of data in some date-specific datasets.
4.1. Design of the Predictive Models and Experimental Setup
In this study, for the COVID-19 predictions, we used the available data for research
purposes online [36–41]. From different countries’ data from the date 11 March 2020–29
March 2020, we used different Python modules to visualize and describe the data and
then trained ML time series models with 80% of data and tested on 20% of data. The
PROPHET is a simple time-series algorithm that gives a quick result during the initial stage
of modeling. Therefore, we used a Python module to implement the PROPHET algorithm.
Nevertheless, to implement the PROPHET algorithm in Python, the dataset must have
NAN-values (or missing values) in the features column; therefore, we leave some NaN
values in the dataset. Next, we changed the date column into a date index. We trim the
current study dataset to keep only those rows that fall within the period from 10 March
2020–31 March 2020. Before running the model, we rename the dataset column into two
columns that are ds (Date) and y (confirmed cases). For LSTM, we also converted the data
into three dimensions because LSTM only works on three-dimensional data.
The LSTM model has been enhanced with four layers: the first two layers have
40 neurons each, the third layer has 25 neurons, and the final layer has one neuron. In
addition, the model is employed as an Adam optimizer, which utilizes square errors as
loss functions. Before applying the AR model, we checked the stationary properties of
599
Electronics 2022, 11, 3875
the dataset because the AR model only works on stationary data. Since the current study
dataset was non-stationary (in nature), we took severe differences and finally obtained the
stationary data. Nevertheless, the AR and ARIMA models were trained on default values.
Figure 4. Visualization of daily confirmed cases during COVID-19 disease.
4.2. Performance Measurements
To analyze the performance of time series ML models, we employed root mean square
error (RMSE) performance metrics. RMSE is the square root of the mean squared error
(MSE), which is converted to RMSE by taking its square root. MSE is measured in square
units of the target variable, whereas RMSE is measured in the same units. MSE penalizes
greater errors more harshly than the squared loss function from which it is derived, and
it penalizes greater errors more harshly due to its structure. It measures the deviation
between the value predicted by the ML model and the actual value. We predicted the
confirmed identified cases and deaths of individuals needing medical care. Consequently,
if the number of confirmed deaths is considerable (according to the provided country’s
statistics), the health agency can take the necessary instances to reduce COVID-19. This is a
time series ML-based problem, and the dataset is freely available for research purposes [36].
We investigated the performance of the AR, PROPHET, ARIMA, and LSTM time series
classifiers to identify the optimal ML time series models for forecasting the daily confirmed
detected cases in different countries during COVID-19. The input variables were daily
confirmed cases and death cases of the patient in different countries. The output variables
were next week’s confirmed and death cases of the patients.
The PROPHET time series model was trained using 80% COVID-19 training data.
Then we tested trained PROPHET classifiers on 20% test data. The model received an RMSE
value of 29.07, and the results are shown in Table 4. Whereas Figure 5 shows a comparison
between the actual confirmed cases and predicted confirmed cases of PROPHET algorithms.
In Figure 6, y-hat or y-hat represent the estimated or predicted values in predictive
models. In a regression or other predictive model, the estimated or anticipated values are
referred to as y-hat values.
600
Electronics 2022, 11, 3875
Table 4. ML time series models’ performance on COVID-19 test data.
Models RMSE (Root Mean Square Error)
PROPHET 29.07
LSTM 130.11
AR model 10.49
ARIMA Model 34.75
Figure 5. Daily predicted cases of COVID-19 using the PROPHET ML algorithm.
Figure 6. Comparison of actual and predicted cases of COVID-19 using Prophet. The X-axis shows
the number of COVID-19 confirmed cases.
Figure 7 depicts PROPHET’s forecasts based on test results. The date is represented
by ds, and the confirmed instances for the provided dates are represented by y.
601
Electronics 2022, 11, 3875
Figure 7. PROPHET forecasting on test data. The ds represents the date and y represents the
confirmed cases for the given dates.
Figure 8 shows the AR predicting outcomes. The AR is shown in the middle of the
graph, and residuals at various time steps are displayed beside each observation. Both the
proven and predicted instances are evident.
Figure 8. Comparison of the actual confirmed case and the predicted case of the PROPHET algo-
rithms.
Figure 9 represents the predicted value of the test data, whereas the blue line represents
the actual value.
Figure 9. The AR prediction on test data. The red line: predicted value; the blue line: the actual value.
Next, we built the AR and ARIMA models using Python. The Figure 9 shows predic-
tion results of AR model. The AR and ARIMA models (RMSE 10.49 and 34.75, respectively)
are shown in Table 4. Additionally, We tuned the AR and ARIMA model parameters using
Python because they affect the performance of AR models. Finally, we constructed the time
series model LSTM of deep learning using the Python KERAS framework. The performance
of LSTM could be better because LSTM requires a considerable amount of data.
602
Electronics 2022, 11, 3875
Finally, we compared the performance of time series ML models on COVID-19 datasets.
The experiment results indicate that developers can integrate the AR and PROPHET
time series model into the COVID-19 death warning system and predict confirmed and
fatal patient cases in the country (with high performance). Popular algorithms, e.g., the
LSTM and ARIMA models, perform well with various real-world issues. Nonetheless, the
outcome shows that the performance of these models is inadequate. We found that the
size of the confirmed COVID-19 is positively correlated with the level of death caused by
COVID-19. Furthermore, from the beginning, the confirmed cases and deaths increased.
Regression analysis shows a positive association between the “size of the total population”
and the “size of the infected population”, along with the number of deaths from COVID-19.
5. Strengths and Limitations
The strength of the study includes, but is not limited to, the performance of PROPHET
and AR Time Series algorithms, which is high and can easily integrate with health systems
because the PROPHET and AR algorithms are simple and can be easily implemented
without programming skills. Moreover, this study also, in the same way, carries certain
limitations, which need to be addressed in future research studies. The dataset was limited
only to country, state, confirmed cases, recovered cases, deaths, dates, and population as an
input related to the COVID-19 disease. At the same time, COVID-19 also depends on other
factors, such as age, weather, and even gender, whose inclusion may increase ML models’
performance. Similarly, in the current study, the number of patient records was limited and
the ML model performance may increase if we increase the number of documents in the
dataset.
6. Conclusions
Researchers have encountered various challenges when attempting to construct a
warning system that can predict the rapid development and spread of COVID-19. Some
issues are hardware resources, DL network architecture repair, and data availability. A
massive dataset is required to implement DL methods, such as LSTM, for prediction. The
absence of such datasets may result in inaccurate and improper conclusions—consequently,
the performance of deep learning architectures declines concerning these warning systems.
In addition, there is uncertainty associated with medical datasets. Another problem with
the datasets is the lack of phenotypic data, such as gender and age. Moreover, for the
prognosis of the disease using computer-assisted early warning systems, several elements
(such as infection of neighbor/friend/family member, climatic circumstances, policies to
prevent the spread of the disease by countries, and the average age of the community) come
into play. The nature of COVID-19 is still largely unclear, so the probability of mutation is a
formidable obstacle.
This study examined the performance of time series ML models for predicting patients’
confirmed, detected, and death cases over the following week (using a given dataset for
research purposes). After training the LSTM, AR, PROPHET, and ARIMA models, we
calculated the predictions of confirmed and detected death cases for the next week. The
findings predict that PROPHET and AR models have the lowest RMSE error for making
predictions concerning the confirmed, detected, and death cases. Furthermore, the present
research suggests that we can include PROPHET and AR models in the COVID-19 hospital
dashboard. Based on the time series ML technique, it can also predict the medical personnel
and government institutions’ ability to predict, detect, and confirm COVID-19 death cases
in the nation over the next week.
Governments across the globe have adopted various measures to contain the COVID-
19 epidemic. Among these measures are the closure of public education and leisure places,
such as schools, colleges, universities, movie theaters, retail malls, and parks, and the
restriction of face-to-face meetings via obligatory “social distancing”. The majority of
the global population must adhere to these extraordinary measures. As the number of
medical facilities restricted in many developing countries, the exponential development of
603
Electronics 2022, 11, 3875
COVID-19 cases places a tremendous strain on health professionals and services; it causes a
shortage of intensive care facilities in hospitals. The early prediction of this pandemic may
assist governments, planning officials, and physicians in addressing the health issue more
effectively. Thus, a COVID-19 warning system equipped with AI and ML may provide a
great source of assistance.
Author Contributions: M.H. (Mushtaq Hussain): conceptualization, methodology, writing, visualiza-
tion, and supervision; M.A.C. and A.I.: investigation, data curation, conceptualization, methodology,
and writing; J.A.T.: formal analysis, writing, review, and editing; S.N.: formal analysis, visualization,
writing, review, editing, and hand journal correspondence; M.H. (Monia Hamdi): formal analysis,
review, editing, funding; H.H.: validation, analysis, review, and editing; M.I.: review and editing;
and T.S.: writing, revising, and editing. All authors have read and agreed to the published version of
the manuscript.
Funding: This research was funded by Princess Nourah bint Abdulrahman University Researchers
Supporting Project number (PNURSP2022R125), Princess Nourah bint Abdulrahman University,
Riyadh, Saudi Arabia.
Data Availability Statement: The current study data are publicly available online. No participants’
personal information (e.g., name or address) was included in this study. The dataset used in the
current study is publicly available at: https://doi.org/10.7910/DVN/URHUOV (accessed on 25
September 2022), https://dataverse.harvard.edu/dataset.xhtml?persistentId=doi:10.7910/DVN/
URHUOV (accessed on 25 September 2022).
Conflicts of Interest: The authors declare no conflict of interest.
References
1. McIntosh, K.; Perlman, S. Coronaviruses, including severe acute respiratory syndrome (SARS) and Middle East respiratory
syndrome (MERS). In Mandell, Douglas, and Bennett’s Principles and Practice of Infectious Diseases; Bennett, J.E., Dolin, R., Blaser,
M.J., Eds.; Elsevier Health Sciences: Amsterdam, The Nederlands, 2015; pp. 1928–1936.e2.
2. Morens, D.M.; Daszak, P.; Taubenberger, J.K. Escaping Pandora’s box—Another novel coronavirus. N. Engl. J. Med. 2020, 382,
1293–1295. [CrossRef] [PubMed]
3. Tu, W.-J.; Cao, J.; Yu, L.; Hu, X.; Liu, Q. Clinicolaboratory study of 25 fatal cases of COVID-19 in Wuhan. Intensiv. Care Med. 2020,
46, 1117–1120. [CrossRef] [PubMed]
4. Bennett, J.E.; Dolin, R.; Blaser, M.J. Mandell, Douglas, and Bennett’s Principles and Practice of Infectious Diseases, 9th ed.; Elsevier
Health Sciences: Amsterdam, The Netherlands, 2014.
5. Gralinski, L.E.; Menachery, V.D. Return of the Coronavirus: 2019-nCoV. Viruses 2020, 12, 135. [CrossRef]
6. Sahoo, B.K.; Sapra, B.K. A data driven epidemic model to analyse the lockdown effect and predict the course of COVID-19
progress in India. Chaos Solitons Fractals 2020, 139, 110034. [CrossRef] [PubMed]
7. Shishvan, O.R.; Zois, D.; Soyata, T. Machine intelligence in healthcare and medical cyber physical systems: A survey. IEEE Access
2018, 6, 46419–46494. [CrossRef]
8. Chen, C. Ascent of machine learning in medicine. Nat. Mater. 2019, 18, 407.
9. Swapnarekha, H.; Behera, H.S.; Nayak, J.; Naik, B. Role of intelligent computing in COVID-19 prognosis: A state-of-the-art review.
Chaos Solitons Fractals 2020, 138, 109947. [CrossRef]
10. Deng, W.; Ni, H.; Liu, Y.; Chen, H.; Zhao, H. An adaptive differential evolution algorithm based on belief space and generalized
opposition-based learning for resource allocation. Appl. Soft Comput. 2022, 127, 109419. [CrossRef]
11. Yao, R.; Guo, C.; Deng, W.; Zhao, H. A novel mathematical morphology spectrum entropy based on scale-adaptive techniques.
ISA Trans. 2022, 126, 691–702. [CrossRef]
12. Lalmuanawma, S.; Hussain, J.; Chhakchhuak, L. Applications of machine learning and artificial intelligence for COVID-19
(SARS-CoV-2) pandemic: A review. Chaos Solitons Fractals 2020, 139, 110059. [CrossRef]
13. Wu, D.; Wu, C. Research on the Time-Dependent Split Delivery Green Vehicle Routing Problem for Fresh Agricultural Products
with Multiple Time Windows. Agriculture 2022, 12, 793. [CrossRef]
14. Sarkar, K.; Khajanchi, S.; Nieto, J.J. Modeling and forecasting the COVID-19 pandemic in India. Chaos Solitons Fractals 2020, 139,
110049. [CrossRef]
15. Ribeiro, M.H.D.M.; da Silva, R.G.; Mariani, V.C.; dos Santos Coelho, L. Short-term forecasting COVID-19 cumulative confirmed
cases: Perspectives for Brazil. Chaos Solitons Fractals 2020, 135, 109853. [CrossRef]
16. Xue, Y.; Onzo, B.M.; Mansour, R.F.; Su, S.B. Deep Convolutional Neural Network Approach for COVID-19 Detection. Comput.
Syst. Sci. Eng. 2022, 42, 201–211. [CrossRef]
17. Mansour, R.F.; Escorcia-Gutierrez, J.; Gamarra, M.; Gupta, D.; Castillo, O.; Kumar, S. Unsupervised Deep Learning based
Variational Autoencoder Model for COVID-19 Diagnosis and Classification. Pattern Recognit. Lett. 2021, 151, 267–274. [CrossRef]
604
Electronics 2022, 11, 3875
18. Yan, Z.; Wang, Y.; Yang, M.; Li, Z.; Gong, X.; Wu, D.; Zhang, W.; Wang, Y. Predictive and analysis of COVID-19 cases cumulative
total: ARIMA model based on machine learning. medRxiv 2022. [CrossRef]
19. Ganiny, S.; Nisar, O. Mathematical modeling and a month ahead forecast of the coronavirus disease 2019 (COVID-19) pandemic:
An Indian scenario. Model. Earth Syst. Environ. 2021, 7, 29–40. [CrossRef]
20. Wadhwa, P.; Aishwarya; Tripathi, A.; Singh, P.; Diwakar, M.; Kumar, N. Predicting the time period of extension of lockdown due
to increase in rate of COVID-19 cases in India using machine learning. Mater. Today Proc. 2020, 37, 2617–2622. [CrossRef]
21. Dil, S.; Dil, N.; Maken, Z.H. COVID-19 trends and forecast in the Eastern Mediterranean Region with a Particular Focus on
Pakistan. Cureus 2020, 12, e8582. [CrossRef]
22. Yadav, M.; Perumal, M.; Srinivas, M. Analysis on novel coronavirus (COVID-19) using machine learning methods. Chaos Solitons
Fractals 2020, 139, 110050. [CrossRef]
23. Velásquez, R.M.A.; Lara, J.V.M. Forecast and evaluation of COVID-19 spreading in USA with reduced-space Gaussian process
regression. Chaos Solitons Fractals 2020, 136, 109924. [CrossRef] [PubMed]
24. Hamzah, F.B.; Lau, C.; Nazri, H.; Ligot, D.V.; Lee, G.; Tan, C.L.; Bin Mohd Shaib, M.K.; Binti Zaidon, U.H.; Binti Abdullah, A.;
Chung, M.H.; et al. CoronaTracker: Worldwide COVID-19 outbreak data analysis and prediction. Bull. World Health Organ. 2020,
1, 1–32.
25. Mahajan, A.; A Sivadas, N.; Solanki, R. An epidemic model SIPHERD and its application for prediction of the spread of COVID-19
infection in India. Chaos Solitons Fractals 2020, 140, 110156. [CrossRef] [PubMed]
26. Yang, Z.; Zeng, Z.; Wang, K.; Wong, S.-S.; Liang, W.; Zanin, M.; Liu, P.; Cao, X.; Gao, Z.; Mai, Z.; et al. Modified SEIR and AI
prediction of the epidemics trend of COVID-19 in China under public health interventions. J. Thorac. Dis. 2020, 12, 165–174.
[CrossRef]
27. Shahid, F.; Zameer, A.; Muneeb, M. Predictions for COVID-19 with deep learning models of LSTM, GRU and Bi-LSTM. Chaos
Solitons Fractals 2020, 140, 110212. [CrossRef]
28. Cheikhrouhou, O.; Mahmud, R.; Zouari, R.; Ibrahim, M.; Zaguia, A.; Gia, T.N. One-Dimensional CNN Approach for ECG
Arrhythmia Analysis in Fog-Cloud Environments. IEEE Access 2021, 9, 103513–103523. [CrossRef]
29. Kırbaş, İ.; Sözen, A.; Tuncer, A.D.; Kazancıoğlu, F.Ş. Comparative analysis and forecasting of COVID-19 cases in various European
countries with ARIMA, NARNN and LSTM approaches. Chaos Solitons Fractals 2020, 138, 110015. [CrossRef]
30. Zeroual, A.; Harrou, F.; Dairi, A.; Sun, Y. Deep learning methods for forecasting COVID-19 time-Series data: A Comparative
study. Chaos Solitons Fractals 2020, 140, 110121. [CrossRef]
31. Jockers, M.L.; Thalken, R. Introduction to dplyr. In Text Analysis with R; Springer: Cham, Switzerland, 2020; pp. 121–132.
32. Liu, S.; Sweeney, C.; Srisarajivakul-Klein, N.; Klinger, A.; Dimitrova, I.; Schaye, V. Evolving oxygenation management reasoning
in COVID-19. Diagnosis 2020, 7, 381–383. [CrossRef]
33. Huang, Z.; Xu, W.; Yu, K. Bidirectional LSTM-CRF models for sequence tagging. arXiv 2015, arXiv:150801991. [CrossRef]
34. Hochreiter, S.; Schmidhuber, J. Long short-term memory. Neural Comput. 1997, 9, 1735–1780. [CrossRef]
35. Nguyen, D.H.D.; Tran, L.P.; Nguyen, V. Predicting Stock Prices Using Dynamic LSTM Models. In Applied Informatics; Florez, H.,
Leon, M., Diaz-Nafria, J., Belli, S., Eds.; Springer: Cham, Switzerland, 2019.
36. Center for Systems Science and Engineering (CSSE). Coronavirus COVID-19 Global Cases; Johns Hopkins University (JHU):
Baltimore, MD, USA, 2020.
37. Shoeibi, A.; Khodatars, M.; Alizadehsani, R.; Ghassemi, N.; Jafari, M.; Moridian, P.; Khadem, A.; Sadeghi, D.; Hussain, S.; Zare, A.;
et al. Automated detection and forecasting of COVID-19 using deep learning techniques: A review. arXiv 2020, arXiv:200710785.
[CrossRef]
38. Cifci, M.A. SegChaNet: A Novel Model for Lung Cancer Segmentation in CT scans. Appl. Bionics Biomech. 2022, 2022, 1139587.
[CrossRef]
39. Alizadehsani, R.; Roshanzamir, M.; Hussain, S.; Khosravi, A.; Koohestani, A.; Zangooei, M.H.; Abdar, M.; Beykikhoshk, A.;
Shoeibi, A.; Zare, A.; et al. Handling of uncertainty in medical data using machine learning and probability theory techniques: A
review of 30 years (1991–2020). Ann. Oper. Res. 2021, 1–42. [CrossRef]
40. Alizadehsani, R.; Sani, Z.A.; Behjati, M.; Roshanzamir, Z.; Hussain, S.; Abedini, N.; Hasanzadeh, F.; Khosravi, A.; Shoeibi, A.;
Roshanzamir, M.; et al. Risk Factors Prediction, Clinical Outcomes and Mortality of COVID-19 Patients. J. Med. Virol. 2020, 93,
2307–2320. [CrossRef]
41. Cifci, M.A. Derin Öğrenme Metodu ve Ayrık Dalgacık Dönüşümü Kullanarak BT Görüntülerinden Akciğer Kanseri Teşhisi.
Mühendislik Bilimleri Ve Araştırmaları Derg. 2022, 4, 141–154.
605
electronics
Article
An Effective Model of Confidentiality Management of Digital
Archives in a Cloud Environment
Jian Xie 1 , Shaolong Xuan 1, *, Weijun You 2, *, Zongda Wu 1, * and Huiling Chen 3
1 Deparment of Computer Science and Engineering, Shaoxing University, Shaoxing 312000, China
2 Department of Management, Office of Natural Science Foundation of Zhejiang Province,
Hangzhou 310006, China
3 College of Computer Science and Artificial Intelligence, Wenzhou University, Wenzhou 325035, China
* Correspondence: [email protected] (S.X.); [email protected] (W.Y.); [email protected] (Z.W.)
Abstract: Aiming at the problem of confidentiality management of digital archives on the cloud, this
paper presents an effective solution. The basic idea is to deploy a local server between the cloud and
each client of an archive system to run a confidentiality management model of digital archives on the
cloud, which includes an archive release model, and an archive search model. (1) The archive release
model is used to strictly encrypt each archive file and archive data released by an administrator and
generate feature data for the archive data, and then submit them to the cloud for storage to ensure
the security of archive-sensitive data. (2) The archive search model is used to transform each query
operation defined on the archive data submitted by a searcher, so that it can be correctly executed
on feature data on the cloud, to ensure the accuracy and efficiency of archive search. Finally, both
theoretical analysis and experimental evaluation demonstrate the good performance of the proposed
solution. The result shows that compared with others, our solution has better overall performance
in terms of confidentiality, accuracy, efficiency and availability, which can improve the security of
archive-sensitive data on the untrusted cloud without compromising the performance of an existing
archive management system.
Citation: Xie, J.; Xuan, S.; You, W.;
Wu, Z.; Chen, H. An Effective Model Keywords: cloud; digital archives; confidentiality management; information system
of Confidentiality Management of
Digital Archives in a Cloud
Environment. Electronics 2022, 11,
2831. https://doi.org/10.3390/ 1. Introduction
electronics11182831
In cloud computing, pay-per-use enables an organization to obtain the required sources
Academic Editor: Irene Moser from the shared pool of configurable computing resources anytime, anywhere and on-
demand [1–3], therefore, greatly reducing the organization’s expenditure on business
Received: 8 May 2022
operations and archive management and then improving the service efficiency of the
Accepted: 13 July 2022
organization. To this end, governments and enterprises in various countries have promoted
Published: 7 September 2022
the cloud-first strategy [4–6], i.e., the cloud computing model is given priority in the process
Publisher’s Note: MDPI stays neutral of institutional informatization, such that the proportion of archival documents formed
with regard to jurisdictional claims in and managed on the cloud is becoming higher and higher. Archive management on the
published maps and institutional affil- cloud has become the general trend [7–9]. However, although storing digital archives on
iations. the cloud can reduce the management cost and improve management efficiency, it also
results in some negative effects, the most prominent of which is the security of archives
on the cloud [10–12]. In a cloud computing environment, the archives of an organization
are not stored on a trusted local server but are stored and managed by the cloud server,
Copyright: © 2022 by the authors.
resulting in each archive and its owner being separated from each other, i.e., making each
Licensee MDPI, Basel, Switzerland.
This article is an open access article
archive in an uncontrollable area, and in turn posing a serious threat to the security of
distributed under the terms and
archival materials [13–15]. Such security threat mainly includes two aspects: (1) external
conditions of the Creative Commons threat, i.e., hackers’ attack on the cloud service provider (which has been verified by endless
Attribution (CC BY) license (https:// hacking incidents) [16]; and (2) internal threat, i.e., inside jobs from workers of the cloud
creativecommons.org/licenses/by/ service provider (driven by interests, it is possible for management workers to maliciously
4.0/). stealing sensitive archival information) [17]. In a word, the security issue of archives on the
Electronics 2022, 11, 2831. https://doi.org/10.3390/electronics11182831 https://www.mdpi.com/journal/electronics
607
Electronics 2022, 11, 2831
cloud (i.e., how to ensure the security of sensitive archival data on the untrusted cloud) has
become one of the main obstacles to restricting the management of archives on the cloud,
which has attracted more and more attention.
1.1. Related Works and Limitations
Aiming at the problem of the security of archives on the cloud, scholars from the field
of social sciences conducted more research from the perspective of laws and regulations and
believe that the solution of the problem requires governments to formulate relevant laws
and regulations for guidance [18,19]. Most of the countries in the world have successively
formulated relevant standards and specifications, such as the Guideline for Document
Management in Cloud Computing Environment in the United States, Advice on Risk
Management of Cloud Computing File Storage in Australia, and Guidelines for Cloud
Storage and Digital Permanent Preservation in the United Kingdom. In recent years, China
has also intensively promulgated three relevant laws and regulations, i.e., Cybersecurity
Law, Data Security Law, and Personal Information Protection Law, which play an important
role in ensuring the security of archives on the cloud [20,21]. However, endless incidents of
privacy breaches show that confidentiality management of archives on the cloud requires
not only laws and regulations, but also the support of technical methods [22–25].
In order to ensure the security of archive data, a digital archive management system
uses a variety of technical methods and strategies, such as identity authentication, access
control and data encryption. Below, we briefly introduce the technical features of these
methods and analyze their application limitations in the confidentiality management of
archives on the cloud. (1) Identity authentication is the process of user identity confirmation,
to prevent illegal users from accessing system resources illegally [11,26]. Specifically,
it can be divided into two categories, i.e., single-factor authentication [27–29] (such as
username and password authentication, smart card authentication, dynamic password
authentication and biometric authentication) and two-factor authentication [30,31] (which
combines two kinds of single-factor authentication to further strengthen the security of
identity authentication). (2) Access control is to restrict access to unauthorized resources
or the use of unauthorized functions, according to the specific identity of a user [32].
Specifically, it can be divided into discretionary access control (DAC) and mandatory access
control (MAC) [33]. Identity authentication and access control have been widely used in
operating systems, database systems, file management systems [34], etc. Although the
two kinds of technical methods can prevent external users from illegally accessing the
sensitive data in a digital archives system, to alleviate the archive security problem to a
great extent, they cannot separate the support of the server side (they assume that the
server side is trusted), i.e., they only target external illegal attackers of a digital archive
system, and cannot prevent the internal staff of the untrusted server side (or the hackers
who conquer the server) from accessing the archive-sensitive data [35–37]. However, the
cloud is not trustworthy, and it is the main source causing the archive security problem.
Therefore, the problem of confidentiality management of archives on the cloud cannot be
solved by traditional access control and identity authentication. (3) Data encryption refers
to strictly encrypting sensitive data before being stored in an untrusted server, so that even
if the encrypted data is leaked, it is difficult to be understood, consequently, ensuring data
security [38,39]. Therefore, it is an important means to solve the data security problem in a
cloud environment [40–43]. However, there are a large number of query operations defined
over archive-sensitive data in a digital archive system (such as querying archives by user
names). Once the sensitive data stored on the cloud is strictly encrypted, the ciphertext
data would lose many inherent characteristics of the corresponding plaintext data (such as
orderliness, similarity and comparability), resulting in most of the original archive query
operations in an archive system no longer being performed correctly on the ciphertext
data, consequently, damaging the accuracy of archival search [44,45]. In order to solve the
ciphertext search problem, we can first transmit all the ciphertext data on the cloud back to
a local server, decrypt the ciphertext data, and then perform archive query operations on
608
Electronics 2022, 11, 2831
the decrypted data. However, for such a method, since almost all the process of archive
search is completed locally, it not only completely loses the cost-efficiency advantage of
archive management on the cloud, but also seriously reduces the efficiency of archive
search (it needs huge overhead for network transmission and decryption). Therefore, the
problem of confidentiality management of digital archives on the cloud cannot be directly
solved by a traditional data encryption method.
In addition, scholars from the field of library science also try to solve the problem of
the security of archives on the cloud from the perspective of technical methods [46–48].
However, the methods proposed by them are usually developed based on some original
technical methods from a digital archive management system (i.e., identity authentication,
access control, data encryption, etc.), so it is difficult to meet the actual needs of confidential-
ity management of archives on the cloud. For the problem of cloud data security, scholars
from the field of information sciences have also conducted in-depth and systematic research
and proposed many effective technical methods [49–53]. However, these methods are not
specifically proposed for digital archives systems, so they still cannot meet the practical
application requirements of confidentiality management of archives on the cloud in terms
of availability, effectiveness and security. To sum up, under the existing architecture of a
digital archive cloud management platform, it remains to be further discussed and studied
how to improve the security of archive-sensitive data on the untrusted cloud without
compromising the availability of an archive system and the effectiveness of archive search.
1.2. Contributions
In this paper, we propose an effective solution for confidentiality management of
archives on the cloud, which can improve the security of sensitive archive data on the cloud
without affecting the efficiency of archive search. Its basic idea is to deploy a local server
between the cloud and each client of an archive system to run a confidentiality management
model of digital archives on the cloud (specifically, which includes an archive release model
and an archive search model), which acts as a layer of middleware between the cloud
and the client, to achieve transparency for users and the cloud, and then achieve effective
integration with the existing archive management system. Specifically, the contributions
of this paper mainly include the following three aspects. (1) Propose a confidentiality
release model of archives on the cloud, which is responsible for strictly encrypting the
archive files and archive data released by an administrator, generating archive feature
data for the archive data, and then submitting them to the cloud for storage to ensure
the security of archive data. (2) Propose a confidentiality search model of archives on the
cloud, which is responsible for rewriting and transforming the query operations defined
on archive data submitted by an inquirer, so that it can be correctly executed on feature
data on the cloud (to filter out most of the non-target records) to ensure the accuracy and
efficiency of archive search. (3) Both theoretical analysis and experimental evaluation
demonstrate the overall performance of the proposed solution, i.e., it can satisfy the actual
requirements in terms of data security, query accuracy, and query efficiency. This paper
gives a valuable study attempt on confidentiality management of archives on the cloud,
which has positive significance for promoting the application and development of cloud
computing technology in digital archives management.
2. Problem Statement
2.1. System Framework
In Figure 1, we show the basic framework of a confidentiality management model of
digital archives on the cloud adopted in this paper. It can be seen that it mainly includes the
following four roles, i.e., archive administrators and their management interfaces (trusted),
archive inquirers and their query interfaces (trusted), a local server (trusted) and the cloud
server (untrusted). The functions of the four types of roles are briefly described below.
609
Electronics 2022, 11, 2831
Figure 1. A framework of a confidentiality management model of archives on the cloud.
1. Archive administrator (also known as archive entry clerk): through a trusted archive
management interface, who submits digital archive files (electronic scanning pictures)
and their corresponding archive data (usually in the form of tables, which are used to
record archive description data to facilitate archive search).
2. Archive inquirer: through a trusted archive search interface, who performs archive
search operations (i.e., perform related archive query operations defined on archive
description data) to obtain target archive files and related materials.
3. Cloud server: which is deployed on the untrusted cloud, is responsible for storing
archive files (in the form of ciphertext), archive description data (in the form of cipher-
text) and archive feature data submitted by the local server, and is also responsible for
executing archive search requests submitted by the local server.
4. Local server: which is deployed on the trusted local, responsible for strictly encrypting
the archive files and archive description data submitted by an archive administrator,
generating the corresponding archive feature data, and then submitting them to the
cloud server for storage, and recording the corresponding encryption key data and
setting parameters locally (i.e., responsible for running the confidentiality release
model of archives on the cloud). In addition, it is also responsible for rewriting the
archive search requests submitted by an archive inquirer, so that they can be correctly
executed on the feature data of the cloud (to filter out most non-target records on the
cloud) to ensure the accuracy and efficiency of archive search (i.e., responsible for
running the confidentiality search model of archives on the cloud).
610
Electronics 2022, 11, 2831
2.2. Design Goals
In order to satisfy the practical application requirements of confidentiality manage-
ment of archives on the cloud, a confidentiality management model constructed based on
the framework shown in Figure 1 should meet the following three constraints.
1. Ensuring the security of archive data, which includes archive file security, archive
data security and feature data security, i.e., from the encrypted archive files, encrypted
archive data and feature data submitted by the local server, it is impossible for the
cloud server to accurately know the original archive files and sensitive archive data.
2. Ensuring the accuracy of archive search. With the help of archive feature data con-
structed by the confidential release model of archives on the cloud, each archive
query operation defined on the archive data submitted by an archive inquirer can
be effectively converted into a feature query operation defined on the feature data
(i.e., Step 4 in Figure 1), so that the result returned by the cloud server by executing
the feature query operation (i.e., the data returned by Step 5 in Figure 1) contains the
real search result to ensure the accuracy of archive search.
3. Ensuring the efficiency of archive search. With the help of feature data, the cloud
server can eliminate most of the non-target records on the cloud by executing each
feature query operation constructed by the confidential search model of archives on
the cloud, so as to reduce the amount of archive data returned to the client (i.e., the
data returned by Step 6 in Figure 1), and in turn, ensure the efficiency of archive
data search.
3. Proposed Solution
3.1. Archive Confidentiality Model
On the basis of the framework of Figure 1, this paper constructs a confidentiality
management model of digital archives on the cloud, which mainly includes two sub-
models, i.e., a confidentiality release model of archives on the cloud, and a confidentiality
search model of archives on the cloud. Here, the confidentiality release model corresponds
to Steps 1 and 2 in Figure 1, i.e., the process of the local server to encrypt archive files
and archive data released by an archive administrator, and attach archive feature data,
which can be further shown in Figure 2. The description can be divided into the following
four steps.
Figure 2. Implementation process of the confidentiality release model.
Step 1.1. Archive Release (executed by an archive administrator). An archive admin-
istrator releases an archive file and its corresponding archive description data through an archive
management interface. The archive description data is denoted by (data[i ][1], data[i ][2], . . .),
where data[i ][ j] denotes a sensitive archive data item (i.e., some private data such as name,
611
Electronics 2022, 11, 2831
ID number, phone number, home address, etc., which cannot be known to the cloud). The
archive file is denoted by file[i ] (usually which is an electronic scanning picture).
Step 1.2. Archive Encryption (executed by the local server). First, the local server
generates an archive file key (denoted by keyF[i ]) and an archive data key (denoted by
keyD[i ]) randomly. Then, using a traditional encryption algorithm (such as RSA, etc.),
the local server strictly encrypts the archive file and archive description data submitted
by an archive administrator, so as to obtain an encrypted archive file (denoted by file∗ )
and an encrypted archive data (denoted by data∗ ), which are, respectively, denoted by
Equations (1) and (2).
data∗ [i ] = EN (keyD[i ], data[i ][1] + data[i ][2] + . . .) (1)
file∗ [i ] = EN (keyF[i ], file[i ]) (2)
Finally, the local server submits the encrypted archive file and the encrypted archive
data to the cloud server for storage and stores the archive file key and archive data key
locally (note that the secret keys are generated dynamically and randomly, and the secret
keys of archive files are different from each other, and the keys of archive data are also
different from each other).
Step 1.3. Feature Construction (executed by the local server). First, the local server
generates the corresponding archive feature data (denoted by data ) for archive-sensitive
data, which is denoted by Equation (3).
data [i ][1] = FN(data[i ][1]), data [i ][2] = FN(data[i ][2]), . . . (3)
Then, the local server submits the feature data to the cloud server for storage. The
parameters related to feature construction are stored on the local server (note that the
same archive data item uses the same feature parameter, and different items use different
feature parameters).
Step 1.4. Archive Storage (executed by the cloud server). The cloud server stores
the encrypted archive data and archive feature data in its archive database, as well as
the encrypted archive files in its storage devices. Then, it establishes the associations
(e.g., using URLs) between the archive data records of the database and the encrypted
archive files.
The confidentiality release model of archives on the cloud corresponds to Steps 3
to 6 in Figure 1, i.e., the process of the local server to rewrite and replace each archive
query operation defined on the archive description data released by an archive enquirer
with a feature query operation defined on the corresponding archive feature data, and the
process of decrypting and filtering the archive query result returned by the cloud server.
The process can be further described in Figure 3, which can be divided into the following
four steps.
Figure 3. Implementation process of the confidentiality search model.
612
Electronics 2022, 11, 2831
Step 2.1. Query Release (executed by an archive inquirer). An archive inquirer submits
an archive query statement (defined on archive description data) through an archive query
interface, to the local server. An archive query statement is mainly composed of a series of
basic query conditions defined on archive data items and connected by logical operations.
To this end, the basic query conditions of an archive query statement can be denoted by
(W[1], W[2], . . . , W[N]).
Step 2.2. Query Rewrite (executed by the local server). The local server converts each
archive query statement defined on archive description data published by an inquirer into
a feature query statement defined on the corresponding feature data and then submits it to
the cloud server for execution. A feature query statement is mainly composed of a series of
basic query conditions defined on feature data and connected by logical operations, which
can be denoted by Equation (4).
(W∗ [1] = TR(W[1]), W∗ [2] = TR(W[2]), . . . , W∗ [N] = TR(W[N])) (4)
Step 2.3. Query Execution (executed by the cloud server). The cloud server executes
the feature query statement submitted by the local server on the feature dataset data {N0 }
(where N0 denotes the size of the feature dataset), and then returns the set of encrypted
archive data data∗ {N1 } (N1 N0 ) and the set of encrypted archive files files∗ {N1 } to the
local server.
Step 2.4. Result Decryption (executed by the local server). For the encrypted archive
dataset returned by the cloud server, in combination with the associated archive data keys
saved by the local server, after decrypting the encrypted data, the local server obtains the
corresponding plaintext archive dataset denoted by data {N1 }. Second, the local server
executes the original archive query statement issued by the archive manager on the plaintext
archive dataset to obtain the target archive dataset denoted by data {N2 } (N2 < N1 ).
Let files∗ {N2 } denote the set of the encrypted archive files associated with the dataset
data {N2 }. Finally, the local server decrypts the ciphertext file set in combination with the
locally stored file keys to obtain the corresponding plaintext archive file set files {N2 }, and
return the archive file set files {N2 } and the archive data set data {N2 } to the client.
3.2. Feature Construction and Query Rewriting
From the previous section, we can see that feature construction (Step 1.3) is the key to
the confidentiality release model of archives on the cloud, and query rewriting (Step 2.3) is
the key to the confidentiality search model of archives on the cloud. Moreover, we can see
the query rewriting strategy is closely dependent on the feature construction strategy. To
this end, this section first gives a simple and effective strategy for feature construction and
then constructs a corresponding strategy for query rewriting accordingly. Note that the
types of archive data items are mainly divided into numerical type (e.g., real number, date,
etc.) and text type (i.e., character string). The strategy of feature construction proposed in
this paper can be applied to the two data types at the same time, whose process mainly
includes the following three steps.
Step 3.1. Suppose that an archive-sensitive data item A0 contains n basic units, respec-
tively, denoted by A1 , A2 , . . . , An . For each basic unit Ak , we divide the domain composed
of all its possible values into Nk subdomains, denoted by D1k , D2k , . . . , DkN , which should
k
meet the constraints.
1. None of the subdomains is an empty set, i.e., Dik = ;
2. Any two subdomains do not overlap, i.e., Dik ∩ Dkj = ;
3. The union of all subdomains is equal to the domain itself of the basic unit, i.e., ∪ Dik = Dk .
Step 3.2 Assign an identifier to each subdomain Dik , denoted by k Dik . All the
identifiers should meet the following constraints.
1. Each identifier itself is selected from the domain Dk of the basic unit, i.e., k Dik ∈ Dk ;
613
Electronics 2022, 11, 2831
2. All identifiers remain in order, i.e., if k Dik ≥ k Dkj , then ∀a ∈ Dik ∀b ∈ Dkj → a ≥ b;
3. The length of each identifier is equal to that of the maximum value of the domain Dk ,
i.e., k Dik = |max(Dk )|.
Based on the settings of the above two steps, any specific value ak of the subdomain
Ak can be mapped to an identifier value of the same length
with ak , i.e., a feature mapping
function is determined, denoted by FNk (ak ) = k Dik , where Dik is the subdomain which
contains ak . Now, based on the settings of the above two steps, we have actually determined
n feature mapping functions for the archive-sensitive data item A0 , which are denoted by
FN1 , FN2 , . . . , FNn (corresponding to the basic units A1 , A2 , . . . , An , respectively).
Step 3.3 For any value a of the archive data item A0 , based on the settings of the above
two steps, we assume that the values corresponding to the basic units of A0 are a1 , a2 , . . . , an ,
respectively, i.e., a = a1 a2 . . . an . Then, based on the functions FN1 , FN2 , . . . , FNn , it can be
mapped to a new feature value (i.e., feature data), denoted by Equation (5).
a = FN(a) = FN1 (a1 ) FN2 (a2 ) . . . FNn (an ) (5)
Example 1. Take the archive-sensitive data item Name as an example to briefly describe the
construction process of feature data. Here, we assume that the maximum length of the name field is 8
Chinese characters (i.e., it contains 8 basic units). First, let us consider the first basic unit. Note that
there are 20902 common Chinese characters, and their UNICODE codes are between 0X4E00 and
0X9FA5. To this end, we simply divide the value range of Chinese characters into 209 subdomains
(so the size of each subdomain is equal to 100) by using an equal-width strategy, respectively, denoted
by D11 , D12 , . . . , D1209 (Step 3.1). Then, we assign an identifier for each subdomain according to the
following strategy 1 D1k = k (Step 3.2),
1 D11 = 0X0001; 1 D12 = 0X0002; . . . ; 1 D1209 = 0X00D1 (6)
To simplify the presentation, for the remaining seven basic units of the data item, we
apply the same subdomain division and identifier assignment strategies as the first unit,
i.e., 1 = 2 = . . . = 8 , so we have that FN1 = FN2 = . . . = FN8 . Now, for any given
specific name, we can generate its corresponding feature data value. For example, for a
Chinese name whose UNICODE encode is 0X8BF8 0X845B 0X4EAE, its feature data value
after feature construction is as 0X009A 0X008B 0X0002.
Based on the settings of Steps 3.1 and 3.2, we can see that feature data has the same
length and format as its corresponding archive data, so feature data generated in Step 3.3
can be directly stored in the field A0 of archive data tables. So far, after feature mapping,
feature data (instead of archive data) is stored in archive-sensitive data item fields of the
cloud database. However, this makes the query operations defined on the archive data
items issued by an archive inquirer no longer correctly executed in the cloud database.
To this end, the purpose of query rewriting is to transform each archive query condition
into a feature query condition defined on feature data. Since an archive query statement is
mainly composed of a series of basic query condition items connected by logical operators,
below, we briefly discuss how to rewrite three kinds of basic archive query condition items
(i.e., equivalent query, implication query and range query), and then introduce Algorithm
1 to show how an archive query statement is rewritten.
614
Electronics 2022, 11, 2831
Algorithm 1 Query Rewriting.
(1) Input: an archive query statement; (2) Output: a feature query statement
01. Divide the archive query statement into a series of basic archive query condition items;
02. FOREACH basic archive query condition item DO
03. IF the item is an equivalent condition item THEN
04. CALL Conversation 1.1 to convert it into a feature equivalent query condition;
05. ELSEIF the item is an implication condition item THEN
06. CALL Conversation 1.2 to convert it into a feature implication query condition;
07. ELSEIF the item is a range condition item THEN
08. CALL Conversation 1.3 to convert it into a feature range query condition;
09. END IF
10. END FOR
11. RETURN a feature query statement constructed based on the feature query conditions.
Conversion 1.1. Equivalent Query Conversion: A basic equivalent query conditional
item defined on an archive-sensitive data item A0 can be generally expressed as A0 = a0 ,
where a0 = a1 a2 . . . an represents a constant defined on the archive data item A0 . Then, the
archive equivalent query condition item can be converted into a feature equivalent query
condition, denoted by Equation (7)
TR(A0 = a0 ) ⇒ A0 = FN(a0 ) ⇒ A0
(7)
= FN1 (a1 ) FN2 (a2 ) . . . FNn (an )
An implication query conditional item is generally constructed based on the predicate
LIKE, whose general syntax can be represented by LIKE<match string>. The matching
string can contain a variety of wildcards, among which % (which denotes to match a
character string of any length) is the most representative wildcard. Below, we only discuss
the conversion of a left direction implication query condition based on the wildcard %.
Conversion 1.2. Implication Query Conversion: A basic implication query condi-
tion item defined on an archive-sensitive data item A0 can be generally expressed as
A0 LIKE a0 %. Based on the setting of Step 3.1, we assume that a0 completely covers k
basic units (i.e., A1 , A2 , . . . , Ak ) of the data item A0 , and the values corresponding to the k
basic units are a1 , a2 , . . . , ak , respectively. Then, the implication query condition item can be
converted into a feature implication query condition, denoted by Equation (8).
TR(A0 LIKE a0 %) ⇒ A0 LIKE FN1 (a1 ) FN2 (a2 ) . . . FNk (ak )% (8)
Conversion 1.3. Range Query Conversion: A range query condition item defined on
an archive-sensitive data item A0 can be generally expressed as A0 ≥ a0 . Then, the range
query condition item can be converted into a feature range query condition, denoted by (9).
TR(A0 ≥ a0 ) ⇒ A0 ≥ FN(a0 ) ⇒ A0 ≥ FN1 (a1 ) FN2 (a2 ) . . . FNn (an ) (9)
Example 2. Take querying the archive-sensitive data item Name as an example to briefly describe
the query rewriting process. Assume that an archive inquirer wants to query the digital archive
information from the persons named “ZhangSan” or surnamed “Liu“. Then, an archive query
statement defined on archive data submitted from a query interface can be presented as follows
SELECT * FROM DATA WHERE Name = “ZhangSan” OR Name LIKE “Liu%”
It can be seen that the statement contains two basic archive query conditional items. Then,
the feature query statement generated by the local server after equivalent query transformation and
implication query transformation can be presented as follows
SELECT * FROM DATA WHERE Name = TR(“ZhangSan”) OR Name LIKE TR(“Liu”)%
From Examples 1 and 2, we can see that the query rewriting strategy is closely depen-
dent on the feature construction strategy, but the converted feature query statement can be
directly executed by the cloud database, and most of the non-target records can be filtered
615
Electronics 2022, 11, 2831
out on the cloud accordingly, thereby ensuring the accuracy and efficiency of archive search
(please refer to the accuracy analysis and efficiency analysis in Section 4 for detail).
4. Analysis and Evaluation
4.1. Security Analysis
Generally, the cloud server is considered to be honest but curious, i.e., although it can
follow the protocol specifications related to cloud services, it remains curious about archive
files and archive data. In other words, the cloud server is not trusted. To this end, in this
section, we theoretically analyze the security of the confidentiality management model
of digital archives on the cloud, including archive file security, archive data security, and
feature data security, i.e., analyze the possibility that the untrusted cloud server obtains
sensitive archive information, according to the encrypted archive files, encrypted archive
data and archive feature data submitted by the local server.
Observation 1.1. The confidentiality management model proposed in this paper
can effectively ensure the security of digital archives on the cloud. The model adopts a
traditional encryption algorithm to strictly encrypt the digital archive files (in the form of
images), and the keys are stored in a trusted local server. As a result, the cloud server can
obtain neither the keys nor the archive content based on the encrypted archive files.
Observation 1.2. The confidentiality management model proposed in this paper can
effectively ensure the security of sensitive data of digital archives on the cloud. The model
adopts a traditional encryption algorithm to strictly encrypt archive-sensitive data, and the
keys are stored in the trusted local server. As a result, the cloud server can obtain neither
the keys, nor the archive-sensitive data based on the encrypted archive data.
Explanation: Observations 1.1 and 1.2 are easy to be explained. The security of tradi-
tional encryption algorithms has been proved by a lot of practice, i.e., without knowing the
secret key, it is almost impossible for an attacker to directly obtain the plaintext correspond-
ing to the ciphertext. However, the secret key is stored in the trusted local server, which
cannot be obtained by the cloud server.
In order to support archive search, the confidentiality management model proposed
in this paper introduces feature data for archive data, which inevitably reflects some key
characteristics (such as comparability and similarity) of archive data, consequently, leading
to some risk of privacy leakage. This risk can be measured by the possibility of an attacker
successfully guessing the corresponding archive data based on the feature data.
Observation 1.3. The confidentiality management model proposed in this paper can
effectively ensure the security of archive feature data on the cloud. Below, we analyze
the probability of the cloud successfully guessing the archival data based on feature data
under the worst case. At this time, we assume that the attacker has completely understood
the feature construction process of an archive data item and obtained the relevant feature
parameters on the local server, i.e., the attacker has mastered the feature function FN.
Assume that the archive data item contains n basic units and the value range Dk of each
basic unit is divided into Nk subdomains. Now, given any feature data a , the possibility of
the attacker successfully guessing the corresponding plaintext data a can be measured as
the Equation (10).
the size of the domain of a ( N1 · N2 · . . . · Nn ) N
PR a a = = = (10)
the size of the domain of a |D1 |·|D2 |· . . . ·|Dn | |D|
It can be seen that the range of the value of N (equal to the accumulation of the
numbers of the subdomains of all the basic units) is [1, |D|], and the feature data security
can be controlled by adjusting the value of N. Moreover, it can be seen that when the value
of N is smaller (i.e., when each basic unit is roughly divided), the possibility of the attacker
obtaining the plaintext would be very small, i.e., even if the cloud server has obtained
the feature mapping function, it is difficult to further obtain the archive data according
to feature data. Below, the value of N/|D| is referred to as feature threshold. The larger
the feature threshold, the worse the security of feature data, and the smaller the feature
616
Electronics 2022, 11, 2831
threshold, the better the security of feature data. Moreover, the feature threshold value
would affect the efficiency of archive search (see Section 4.3 for detail). Based on the above
three observations, it can be further concluded that the confidentiality management model
of archives on the cloud constructed in this paper can effectively ensure the security of
archive files, archive data and feature data, i.e., it has good security.
4.2. Accuracy Analysis
In this section, we analyze the accuracy of the archive confidentiality search model
proposed in this paper. In the mode, with the help of feature data, each query operation
defined on archive data would be transformed into a feature query operation defined
on feature data. In order to ensure the accuracy of archive search, the result returned
from the cloud by executing each feature query operation has to contain the exact result
corresponding to the archive query operation. To this end, below, we first introduce
Observation 2.1 and Observation 2.2 to demonstrate that each feature query condition
obtained based on Conversations 1.1 to 1.3 can ensure the accuracy of archive search.
Observation 2.1. Let W denote an implication query condition before conversion, and
W∗ the feature implication query condition after conversion (Conversion 1.2). Then, for any
archive data a1 a2 . . . an , if its corresponding feature data a1 a2 . . . an ak = FNk (ak ) meets
the condition W∗ , it certainly meets the condition W.
Explanation: An implication query condition is only targeted for textual data (not
for numeric data). Let b1 b2 . . . bm denote the text constant associated with the implication
query condition W, and b1 b2 . . . bm denote its feature data. Because the feature data
a1 a2 . . . an meets the feature implication query condition W∗ (i.e., it contains b1 b2 . . . bm ),
i.e., it exists k ≤ n, such that a1 a2 . . . ak = b1 b2 . . . bm . Based on Conversation 1.2, we can
conclude that the text constant b1 b2 . . . bm corresponding to the feature data b1 b2 . . . bm
is certainly contained in the archive data a1 a2 . . . an corresponding to the feature data
a1 a2 . . . an , i.e., the archive data a1 a2 . . . an meets the implication query condition W.
Observation 2.2. Let W denote a range query condition before conversion, and W∗ the
feature range query condition after conversion (Conversion 1.3). Then, for any archive data
a1 a2 . . . an , if its corresponding feature data a1 a2 . . . an meets the condition W∗ , it certainly
meets the condition W.
Explanation: A range condition is targeted for both textual data and numeric data.
Let b0 denote the text constant associated with the range query condition W. For any given
archive data a0 , it may not be consistent with the length of the constant b0 . In this situation, it
can be right-padded with zeros (encode values) for short text data, or left-padded with zeros
(integer values) for numeric data, to make both with the same length. Let a0 = a1 a2 . . . an
and b0 = b1 b2 . . . bn , and a0 = a1 a2 . . . an and b0 = b1 b2 . . . bn denote the feature data
corresponding to a0 and b0 . Because the feature data a1 a2 . . . an meets the range condition
W∗ , i.e., a1 a2 . . . an ≥ b1 b2 . . . bn (it is assumed to be greater than the comparison), we
conclude that there certainly exists that 1 ≤ k ≤ n such that a1 = b1 , a2 = b2 , . . . , ak ≥ bk .
Based on the constraints of the previous feature construction strategy (Step 3.2), we can
further conclude that a1 = b1 , a2 = b2 , . . . , ak ≥ bk ( a1 a2 . . . an ≥ b1 b2 . . . bn ), i.e., the
archive data meets the range query condition W.
An equivalence query can be regarded as a special implication query or a special
range query, so its accuracy analysis is no longer presented. Note that equivalence query,
implication query and range query are three kinds of the most common basic conditions,
and other query conditions can be completed directly or indirectly by means of them.
Therefore, based on the above observations, we can further conclude that various query
operations defined on archive-sensitive data can be converted into feature query operations
defined on feature data, and the results returned from the cloud by executing these feature
query operations certainly contain the real results corresponding to the original query
operations, i.e., the confidentiality management model of archives on the cloud proposed
in this paper can effectively ensure the accuracy of archive search.
617
Electronics 2022, 11, 2831
4.3. Efficiency Evaluation
In this section, we evaluate the efficiency of the archive confidentiality search model
through experiments, i.e., whether the feature query can filter out most of the non-target
data on the cloud, so as to improve the archive search efficiency. The experiments were run
on a randomly generated table of one million digital archive data records. The experiment
selects two sensitive archive data items (name and birthday), which are text type and
numerical type, respectively. From the archival data (i.e., Name and Birthday), which
are text type and numerical type, respectively. From the search process of archive data
shown in Figure 3, it can be seen that the search efficiency of feature data depends on
the filtering effect of the feature query operations obtained by query transformation on
the non-target records on the cloud. To this end, we introduce the following definition to
measure search efficiency.
Definition 1. Let W denote a query condition before transformation, and W∗ denote the fea-
ture query condition defined on feature data after transformation. Let N0 denote the number
of archive records, N2 denote the number of records that meet the archive query W, and N1 de-
note the number of records that meet the feature query W∗ . Then, the search efficiency of fea-
ture data can be measured by the filtering effect of the feature query on the non-target records,
i.e., FR (W∗ , W) = ( N0 − N1 )/( N0 − N2 ).
The efficiency evaluation is divided into three groups of experiments, i.e., range query
on numeric data, range query on textual data, and implication query on textual data. (1) The
first group of experiments aims to evaluate the efficiency of range query operations on
numeric data. The experimental results are shown in Figure 4, where the abscissa represents
the feature threshold (see Observation 1.3 for detail), and the ordinate represents the query
efficiency. It can be seen that the filtering effect of feature range query operations on the
non-target records would become worse as the feature threshold decreases. This is because
the decrease in the feature threshold would increase the number of possible plaintexts
corresponding to each feature data value, resulting in a decrease in the query efficiency
measure. However, even if the feature threshold is smaller (e.g., less than 2−12 ), each
feature range query operation can still filter out most of the non-target records (greater than
0.99), thereby, reducing the scale of the records returned to the client, and in turn, greatly
improving the range query efficiency. (2) The second group of experiments aims to evaluate
the efficiency of range query operations on textual data, and the experimental results are
shown in Figure 5. It can be seen that the change trend of the range query efficiency measure
of textual data with respect to the feature threshold is consistent with that of numerical
data. (3) The third group of experiments aims to evaluate the implication query efficiency
of textual data, and the experimental results are shown in Figure 6. It can be seen that
with the decrease in the feature threshold, the filtering effect of feature implication query
operations on the non-target records would become worse (the change trend is basically
the same as that of textual range query operations); however, compared with textual range
query operations, implication feature query operations have a better filtering effect on
non-target records (i.e., having greater values for the efficiency measure). This is because
the target record set of an implication query is extremely smaller (usually thousands), while
the target record set of a range query is extremely larger (usually hundreds of thousands).
From the three groups of experiments mentioned above, we can draw a conclusion
that both for implication query conditions or range query conditions, both for textual data
and numerical data, by executing the feature query conditions obtained through feature
transformation, the cloud can filter out most non-target records (greater than 0.99), thereby
reducing the scale of records returned to a client, and in turn, effectively reducing the time
overhead of archive search, i.e., feature data has good search efficiency.
618
Electronics 2022, 11, 2831
Figure 4. Evaluation results for numeric data range query efficiency.
Figure 5. Evaluation results for textual data range query efficiency.
Figure 6. Evaluation result for textual data implication query efficiency.
Finally, Table 1 presents a brief comparison between our proposed solution and other
related ones mentioned in Section 1.1. From the table, we see that compared with others,
our solution has better overall performance in terms of confidentiality, accuracy, efficiency
and availability, which demonstrates again that our solution can well meet the goals
presented in Section 2.2. At last, it should be pointed out that although the solution of
this paper is targeted at the confidentiality management of digital archives in a cloud
619
Electronics 2022, 11, 2831
environment, it can be transferred to other problems of data confidentiality management
as well, such as multimedia data management [54,55], knowledge management [56–60],
and series management [61–64].
Table 1. A comparison between our solution and other related ones.
Methods Confidentiality Accuracy Efficiency Availability
Our solution Good Good Good Good
Identity Authentication Not good Good Good Good
Access Control Not good Good Good Good
Encryption Good Good Good Not good
5. Conclusions
Aiming at the problem of confidentiality management of digital archives in a cloud
environment, this paper constructs an archive release model and an archive search model,
whose basic idea is to strictly encrypt all archive files and their corresponding archive data
on a trusted local server, before they are submitted to the cloud for storage, to ensure the
security of archive data on the untrusted cloud. In order to solve the problem of archive
search, the solution also adds additional feature data to the encrypted archive data, so that
each query operation defined on archive data can be executed on the cloud, thereby, greatly
improving the efficiency of archive data query, and in turn ensuring the effectiveness
of archive search. This paper presents a valuable research attempt on the problem of
confidentiality management of archives on the cloud. The solution proposed in this paper
can effectively balance the security of archive data and the effectiveness of archive search,
i.e., it can ensure the security of sensitive archive information on the untrusted cloud,
without affecting the efficiency and accuracy of archive search. It has positive significance
for promoting the further application and development of cloud computing technology in
archives management.
However, the proposal of this paper is not the end of our work. In future work, we
will try to further study some problems, e.g., (1) how to simplify the archive release model
and the archive search model to reduce the workload of the local server; (2) how to design
different feature construction schemes for different archive data types, to improve the
efficiency and security; and (3) the practical implementation of the proposed method in a
management system of digital archives in a cloud environment.
Finally, Table 2 describes some key symbols used in the paper.
Table 2. Symbols and their meanings.
Symbols Meanings
data[i ] A sensitive archive data record
data∗ [i ] An encrypted archive data record
data [i ] An archive feature data record
W[ i ] A basic query condition defined on archive data
W∗ [ i ] A basic query condition defined on feature data
Ak A basic unit of an archive-sensitive data item
Dik A subdomain of the domain of the basic unit Ak
k Dik An identifier of the subdomain Dik
FNk A feature mapping function for the basic unit Ak
a A value of an archive data item
FN(a) A feature mapping function for an archive data item
a A feature value of an archive data item
TR A condition conversion function
620
Electronics 2022, 11, 2831
Author Contributions: Methodology, S.X.; writing—original draft preparation, J.X. software, W.Y.;
writing—review and editing, Z.W.; software, H.C. All authors have read and agreed to the published
version of the manuscript.
Funding: The work is supported by the key project of Humanities and Social Sciences in Colleges
and Universities of Zhejiang Province (No 2021GH017), Humanities and Social Sciences Project of the
Ministry of Education of China (No 21YJA870011), Zhejiang Philosophy and Social Science Planning
Project (No 22ZJQN45YB) and National Social Science Foundation of China (No 21FTQB019).
Institutional Review Board Statement: Not applicable.
Data Availability Statement: Not applicable.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Liu, J.; Wang, X.; Shen, S.; Fang, Z.; Yu, S.; Yue, G.; Li, M. Intelligent jamming defense using DNN Stackelberg game in sensor
edge cloud. IEEE Internet Things J. 2021, 9, 4356–4370. [CrossRef]
2. Liu, J.; Wang, X.; Shen, S.; Yue, G.; Yu, S.; Li, M. A bayesian q-learning game for dependable task offloading against ddos attacks
in sensor edge cloud. IEEE Internet Things J. 2020, 8, 7546–7561. [CrossRef]
3. Shen, S.; Huang, L.; Zhou, H.; Yu, S.; Fan, E.; Cao, Q. Multistage signaling game-based optimal detection strategies for suppressing
malware diffusion in fog-cloud-based IoT networks. IEEE Internet Things J. 2018, 5, 1043–1054. [CrossRef]
4. Wu, Z.; Shen, S.; Li, H.; Lu, C.; Xie, J. A basic framework for privacy protection in personalized information retrieval. J. Organ.
End User Comput. 2021, 33, 1–26. [CrossRef]
5. Wu, B.; Zhao, Z.; Cui, Z.; Wu, Z. Secure and efficient adjacency search supporting synonym query on encrypted graph in the
cloud. IEEE Access 2019, 7, 133716–133724. [CrossRef]
6. Wu, Z.; Shen, S.; Li, H.; Zhou, H.; Zou, D. A comprehensive study to the protection of digital library readers’ privacy under an
untrusted network environment. Libr. Hi Tech 2021. [CrossRef]
7. Wu, Z.; Xie, J.; Lian, X.; Su, X.; Pan, J. A privacy protection approach for xml-based archives management in a cloud environment.
Electron. Libr. 2019, 37, 970–983. [CrossRef]
8. Wu, Z.; Xuan, S.; Xie, J.; Lu, C.; Lin, C. How to ensure the confidentiality of electronic medical records on the cloud: A technical
perspective. Comput. Biol. Med. 2022, 147, 105726. [CrossRef]
9. Wu, Z.; Xu, G.; Lu, C.; Chen, E.; Jiang, F.; Li, G. An effective approach for the protection of privacy text data in the CloudDB.
World Wide Web 2018, 21, 915–938. [CrossRef]
10. Mei, Z.; Zhu, H.; Cui, Z.; Wu, Z.; Peng, G.; Wu, B.; Zhang, C. Executing multi-dimensional range query efficiently and flexibly
over outsourced ciphertexts in the cloud. Inf. Sci. 2018, 432, 79–96. [CrossRef]
11. Wang, T.; Bhuiyan, M.Z.A.; Wang, G.; Li, L.; Wu, J. Preserving balance between privacy and data integrity in edge-assisted
Internet of Things. IEEE Internet Things J. 2019, 7, 2679–2689. [CrossRef]
12. Wu, Z.; Shen, S.; Lu, C.; Li, H.; Su, X. How to protect reader lending privacy under a cloud environment: A technical method.
Libr. Hi Tech 2021. [CrossRef]
13. Wu, Z.; Xie, J.; Pan, J.; Su, X. An effective approach for the protection of user privacy in a digital library. Libri 2019, 69, 315–324.
[CrossRef]
14. Wu, Z.; Shen, S.; Lian, X.; Su, X.; Chen, E. A dummy-based user privacy protection approach for text information retrieval. Knowl.
Based Syst. 2020, 195, 105679. [CrossRef]
15. Chen, Z.; Xu, W.; Wang, B.; Yu, H. A blockchain-based preserving and sharing system for medical data privacy. Future Gener.
Comput. Syst. 2021, 124, 338–350. [CrossRef]
16. Cui, Z.; Wu, Z.; Zhou, C.; Gao, G.; Zhao, Z.; Wu, B. An efficient subscription index for publication matching in the cloud.
Knowl.-Based Syst. 2016, 110, 110–120. [CrossRef]
17. Wu, B.; Chen, X.; Wu, Z.; Zhao, Z. Privacy-guarding optimal route finding with support for semantic search on encrypted graph
in cloud computing scenario. Wirel. Commun. Mob. Comput. 2021, 2021, 6617959. [CrossRef]
18. Wu, Z.; Xie, J.; Zheng, C.; Chen, E. A framework for the protection of user behavior preference privacy of digital library. J. Libr.
Sci. China 2018, 44, 72–85.
19. Cheng, Z.; Yue, D.; Shen, S.; Hu, S. Secure frequency control of hybrid power system under DoS attacks via lie algebra. IEEE
Trans. Inf. Forensics Secur. 2022, 17, 1172–1184. [CrossRef]
20. Shen, Y.; Shen, S.; Li, Q.; Wu, Z. Evolutionary privacy-preserving learning strategies for edge-based IoT data sharing schemes.
Digit. Commun. Netw. 2022. [CrossRef]
21. Shen, Y.; Shen, S.; Wu, Z.; Yu, S. Signaling game-based availability assessment for edge computing-assisted IoT systems with
malware dissemination. J. Inf. Secur. Appl. 2022, 66, 103140. [CrossRef]
22. Feng, S.; Wu, C.; Zhang, Y.; Olvia, G. WSN deployment and localization using a mobile agent. Wirel. Pers. Commun. 2017,
97, 4921–4931. [CrossRef]
621
Electronics 2022, 11, 2831
23. Feng, S.; Shi, H.; Huang, L.; Shen, S.; Yu, S. Unknown hostile environment-oriented autonomous WSN deployment using a
mobile robot. J. Netw. Comput. Appl. 2021, 182, 103053. [CrossRef]
24. Liu, J.; Shen, S.; Yue, G.; Han, R.; Li, H. A stochastic evolutionary coalition game model of secure and dependable virtual service
in sensor-cloud. Appl. Soft Comput. 2015, 30, 123–135. [CrossRef]
25. Li, H.; Zhu, Y.; Wang, J.; Liu, J.; Shen, S.; Gao, H. Consensus of nonlinear second-order multi-agent systems with mixed
time-delays and intermittent communications. Neurocomputing 2017, 251, 115–126. [CrossRef]
26. Abuarqoub, A. D-FAP: Dual-factor authentication protocol for mobile cloud connected devices. J. Sens. Actuator Netw. 2019, 9, 1.
[CrossRef]
27. Wang, S.; Cong, Y.; Zhu, H.; Chen, X.; Qu, L. Multi-scale context-guided deep network for automated lesion segmentation with
endoscopy images of gastrointestinal tract. IEEE J. Biomed. Health Inform. 2020, 25, 514–525. [CrossRef]
28. Fan, C.; Hu, K.; Feng, S.; Ye, J. Heronian mean operators of linguistic neutrosophic multisets and their multiple attribute
decision-making methods. Int. J. Distrib. Sens. Netw. 2019, 15, 1550147719843059. [CrossRef]
29. Cao, Y.; Sun, Y.; Min, J. Hybrid blockchain–based privacy-preserving electronic medical records sharing scheme across medical
information control system. Meas. Control 2020, 53, 1286–1299. [CrossRef]
30. Liu, J.; Yu, J.; Shen, S. Energy-efficient two-layer cooperative defense scheme to secure sensor-clouds. IEEE Trans. Inf. Forensics
Secur. 2017, 13, 408–420. [CrossRef]
31. Li, T.; Wang, H.; He, D.; Yu, J. Blockchain-based privacy-preserving and rewarding private data sharing for IoT. IEEE Internet
Things J. 2022. [CrossRef]
32. Lu, C.; Wu, Z.; Liu, M.; Guo, J. A patient privacy protection scheme for medical information system. J. Med. Syst. 2013, 37, 9982.
[CrossRef] [PubMed]
33. Li, Q.; Zhang, Q.; Huang, H.; Zhang, W. Secure, efficient and weighted access control for cloud-assisted industrial IoT. IEEE
Internet Things J. 2022. [CrossRef]
34. Li, T.; Wang, H.; He, D.; Yu, J. Synchronized provable data possession based on blockchain for digital twin. IEEE Trans. Inf.
Forensics Secur. 2022, 17, 472–485. [CrossRef]
35. Wu, Z.; Li, G.; Liu, Q.; Xu, G.; Chen, E. Covering the sensitive subjects to protect personal privacy in personalized recommendation.
IEEE Trans. Serv. Comput. 2018, 11, 493–506. [CrossRef]
36. Zhang, S.; Ren, W.; Tan, X.; Wang, Z.; Liu, Y. Semantic-aware dehazing network with adaptive feature fusion. IEEE Trans. Cybern. 2021.
[CrossRef]
37. Fu, J.; Wang, N.; Cai, Y. Privacy-preserving in healthcare blockchain systems based on lightweight message sharing. Sensors 2020,
20, 1898. [CrossRef]
38. Wu, Z.; Shi, J.; Lu, C.; Chen, E. Constructing plausible innocuous pseudo queries to protect user query intention. Inf. Sci. 2015,
325, 215–226. [CrossRef]
39. Wu, Z.; Xu, G.; Yu, Z.; Zhang, Y. Executing SQL queries over encrypted character strings in the Database-As-Service model.
Knowl.-Based Syst. 2012, 35, 332–348. [CrossRef]
40. Wu, Z.; Shen, S.; Zhou, H.; Li, H.; Xu, G. An effective approach for the protection of user commodity viewing privacy in
e-commerce website. Knowl.-Based Syst. 2021, 220, 106952. [CrossRef]
41. Wu, Z.; Zheng, C.; Xie, J.; Zhou, Z.; Xu, G.; Chen, E. An approach for the protection of users’ book browsing preference privacy in
a digital library. Electron. Libr. 2018, 36, 1154–1166. [CrossRef]
42. Zhou, H.; Shen, S.; Liu, J. Malware propagation model in wireless sensor networks under attack defense confrontation. Comput.
Commun. 2020, 162, 51–58. [CrossRef]
43. Zhao, L.; Lin, T.; Zhang, D.; Zhou, K. An ultra-low complexity and high efficiency approach for lossless alpha channel coding.
IEEE Trans. Multimed. 2019, 22, 786–794. [CrossRef]
44. Chen, L. Road vehicle recognition algorithm in safety assistant driving based on artificial intelligence. Soft Comput. 2021, 1–10.
[CrossRef]
45. Wu, Z.; Li, R.; Zhou, Z.; Su, X. A user sensitive subject protection approach for book search service. J. Assoc. Inf. Sci. Technol. 2020,
71, 183–195. [CrossRef]
46. Wu, Z.; Li, G.; Shen, S.; Xu, G. Constructing dummy query sequences to protect location privacy and query privacy in location-
based services. World Wide Web 2021, 24, 25–49. [CrossRef]
47. Wu, Z.; Lu, C.; Zhao, Y.; Xie, J.; Zhou, H.; Su, X. The protection of user preference privacy in personalized information retrieval:
Challenges and overviews. Libri 2021. [CrossRef]
48. Wu, Z.; Wang, R.; Li, Q.; Lian, X.; Xu, G.; Chen, E. A location privacy-preserving system based on query range cover-up for
location-based services. IEEE Trans. Veh. Technol. 2020, 69, 5244–5254. [CrossRef]
49. Li, Q.; Cao, Z.; Ding, W.; Li, Q. A multi-objective adaptive evolutionary algorithm to extract communities in networks. Swarm
Evol. Comput. 2020, 52, 100629. [CrossRef]
50. Shen, S.; Zhou, H.; Feng, S.; Huang, L.; Liu, J.; Yu, S. HSIRD: A model for characterizing dynamics of malware diffusion in
heterogeneous WSNs. J. Netw. Comput. Appl. 2019, 146, 102420. [CrossRef]
51. Liu, J.; Wang, X.; Yue, G.; Shen, S. Data sharing in VANETs based on evolutionary fuzzy game. Future Gener. Comput. Syst. 2018,
81, 141–155. [CrossRef]
622
Electronics 2022, 11, 2831
52. Shen, S.; Hu, K.; Huang, L.; Li, H.; Han, R. Quantal response equilibrium-based strategies for intrusion detection in WSNs. Mob.
Inf. Syst. 2015, 2015, 179839. [CrossRef]
53. Jiang, G.; Shen, S.; Hu, K.; Huang, L. Evolutionary game-based secrecy rate adaptation in wireless sensor networks. Int. J. Distrib.
Sens. Netw. 2015, 11, 975454. [CrossRef]
54. Zhou, Q.; Zhao, L.; Zhou, K.; Lin, T.; Wang, H. String prediction for 4: 2: 0 format screen content coding and its implementation
in AVS3. IEEE Trans. Multimed. 2020, 23, 3867–3876. [CrossRef]
55. Wu, Z.; Xu, G.; Zhang, Y.; Li, G.; Hu, Z. GMQL: A graphical multimedia query language. Knowl. Based Syst. 2012, 26, 135–143.
[CrossRef]
56. Wu, Z.; Zhu, H.; Li, G.; Cui, Z.; Li, J.; Huang, H.; Chen, E.; Xu, G. An efficient Wikipedia semantic matching approach to text
document classification. Inf. Sci. 2017, 393, 15–28. [CrossRef]
57. Pan, J.; Zhang, C.; Wang, H.; Wu, Z. A comparative study of Chinese named entity recognition with different segment representa-
tions. Appl. Intell. 2022, 1–13. [CrossRef]
58. Xu, G.; Wu, Z.; Li, G.; Chen, E. Improving contextual advertising matching by using Wikipedia thesaurus knowledge. Knowl. Inf.
Syst. 2015, 43, 599–631. [CrossRef]
59. Li, Q.; Li, L.; Wang, W.; Zhong, J. A comprehensive exploration of semantic relation extraction via pre-trained CNNs. Knowl.
Based Syst. 2020, 194, 105488. [CrossRef]
60. Xu, G.; Zong, Y.; Jin, P.; Wu, Z. KIPTC: A kernel information propagation tag clustering algorithm. J. Intell. Inf. Syst. 2015,
45, 95–112. [CrossRef]
61. Yan, W.; Li, G.; Wu, Z.; Wang, S.; Yu, P. Extracting diverse-shapelets for early classification on time series. World Wide Web 2020,
23, 3055–3081. [CrossRef]
62. Li, Q.; Cao, Z.; Zhong, J.; Li, Q. Graph representation learning with encoding edges. Neurocomputing 2019, 361, 29–39. [CrossRef]
63. Bai, B.; Li, G.; Wang, S.; Wu, Z.; Yan, W. Time series classification based on multi-feature dictionary representation and ensemble
learning. Expert Syst. Appl. 2021, 169, 114162. [CrossRef]
64. Wu, Z.; Jiang, T.; Su, W. Efficient computation of shortest absent words in a genomic sequence. Inf. Process. Lett. 2010, 110, 596–601.
[CrossRef]
623
electronics
Article
Spatial and Temporal Normalization for Multi-Variate Time
Series Prediction Using Machine Learning Algorithms
Alimasi Mongo Providence 1 , Chaoyu Yang 2, *, Tshinkobo Bukasa Orphe 1 , Anesu Mabaire 1
and George K. Agordzo 3
1 School of Economics and Management, Anhui University of Science and Technology, Huainan 232000, China
2 School of Artificial Intelligence, Anhui University of Science and Technology, Huainan 232000, China
3 School of Mathematics and Big Data, Anhui University of Science and Technology, Huainan 232000, China
* Correspondence: [email protected]
Abstract: Multi-variable time series (MTS) information is a typical type of data inference in the real
world. Every instance of MTS is produced via a hybrid dynamical scheme, the dynamics of which
are often unknown. The hybrid species of this dynamical service are the outcome of high-frequency
and low-frequency external impacts, as well as global and local spatial impacts. These influences
impact MTS’s future growth; hence, they must be incorporated into time series forecasts. Two types
of normalization modules, temporal and spatial normalization, are recommended to accomplish
this. Each boosts the original data’s local and high-frequency processes distinctly. In addition, all
components are easily incorporated into well-known deep learning techniques, such as Wavenet
and Transformer. However, existing methodologies have inherent limitations when it comes to
isolating the variables produced by each sort of influence from the real data. Consequently, the study
encompasses conventional neural networks, such as the multi-layer perceptron (MLP), complex deep
learning methods such as LSTM, two recurrent neural networks, support vector machines (SVM), and
their application for regression, XGBoost, and others. Extensive experimental work on three datasets
Citation: Providence, A.M.; Yang, C.; shows that the effectiveness of canonical frameworks could be greatly improved by adding more
Orphe, T.B.; Mabaire, A.; Agordzo,
normalization components to how the MTS is used. This would make it as effective as the best MTS
G.K. Spatial and Temporal
designs are currently available. Recurrent models, such as LSTM and RNN, attempt to recognize the
Normalization for Multi-Variate Time
temporal variability in the data; however, as a result, their effectiveness might soon decline. Last but
Series Prediction Using Machine
not least, it is claimed that training a temporal framework that utilizes recurrence-based methods
Learning Algorithms. Electronics
2022, 11, 3167. https://doi.org/
such as RNN and LSTM approaches is challenging and expensive, while the MLP network structure
10.3390/electronics11193167 outperformed other models in terms of time series predictive performance.
Academic Editor: Jordi Guitart
Keywords: spatial-temporal systems; neural networks; machine learning; information systems;
Received: 18 July 2022 forecasting; time series
Accepted: 26 September 2022
Published: 1 October 2022
Publisher’s Note: MDPI stays neutral
1. Introduction
with regard to jurisdictional claims in
published maps and institutional affil- A crucial part of many industry sectors is forecasting, which is the method of pre-
iations. dicting the present significance of time series data [1]. Forecasting distribution networks
and airline requests, finance price levels, power, and traffic or weather systems are just
a few examples of its applications. As disputed to univariate (solitary time series data)
predicting, multi-variate time series analysis is frequently necessary for large statistics of
Copyright: © 2022 by the authors. linked time series data. Suppliers may, for instance, need to forecast the sales and requests
Licensee MDPI, Basel, Switzerland. of millions of different commodities at tens of thousands of varying locations, resulting in
This article is an open access article
billions of marketing time series data. The statistical modeling research has widely covered
distributed under the terms and
multivariate time series prediction, which entails learning from traditional multi-variate
conditions of the Creative Commons
data to estimate the prospective qualities of several factors. However, the majority of
Attribution (CC BY) license (https://
the studies (also latest) concentrate on linear methods, deal with situations in which only
creativecommons.org/licenses/by/
a small number of variables are available, and only occasionally use forecasting horizons
4.0/).
Electronics 2022, 11, 3167. https://doi.org/10.3390/electronics11193167 https://www.mdpi.com/journal/electronics
625
Electronics 2022, 11, 3167
greater than another uses. In financial predicting research, particularly Dynamic Factor
Models (DFM) [2], which are typically limited to linear methods, will more frequently
consider huge difference setups. The big information transformation is currently calling for
methods that can handle very multiple amounts of non-linear time series, possibly closely
associated or predicated, and forecast their transformation over longer timeframes [3]. The
Internet of Things (IoT) devices, of which the key effect is the development of a constant
flow of spatiotemporal transmissions predicted to be generated and evaluated, serve as
the most obvious source of inspiration [4]. This is already taking place in an increasing
number of research and applied fields, including financial services, meteorology, indus-
trial activities, atmospheric engineering, and physical sciences. As a result, performing
univariate forecasting instead of multi-variate forecasting is also a common strategy. The
most popular statistical forecasting techniques in use today in business include exponential
smoothing (ES), auto-regressive AR and ARIMA designs, and more overall state space
designs [5]. These techniques utilize a simple mathematical model of historical data and
future predictions. Until recently, these techniques consistently surpassed machine learning
techniques such as RNNs in large-scale predicting contests. Multi-task univariate projec-
tions, which shares deep learning design variables across all sequence, possibly including
some series-specific basis functions or parameterized range of fundamental, is a major
factor in the latest achievements of deep learning for forecasting. For instance, a hybrid
ES-RNN framework [6] simultaneously learns different seasons and level ES variables for
every sequence to regulate those gained by the M4 predicting competition. This model
forecasts each series using a single cohesive univariate RNN prototype.
In many commercial and industrial implementations, time series predictions are a crit-
ical issue. For example, if a public transportation provider can predict that a specific area
will experience a supply issue in the coming hours, they could allocate enough capacity to
reduce queuing times in that area in advance [7]. As another illustration, a Robo-advisor
that can anticipate a prospective financial collapse can help an investor avoid financial loss.
Real-world time series frequently exhibit varied dynamics because of the complicated and
constantly changing influencing factors. This makes them exceptionally non-stationary. For
example, the state of the road, its location, the time of day, and the climate all have an im-
portant influence on the amount of circulation that passes over it. The latest season, value,
and product all play a role in determining a product’s sales within the retail industry [8].
Time series forecasting faces a great deal of difficulty as a result of the diverse interactions.
This would then research multi-variate time series prediction in this research, their several
variables changing over time. Numerous disciplines, including physical sciences, engineer-
ing, weather forecasting, and tracking of human health, are conducting extensive research
on time series prediction [9]. We proposed the most appropriate technique to test, evaluate,
and verify the most popular forecasting methodologies using a collection of information.
It appears that using just a few of the models cannot be a suitable method for simulating
the hydrological time series. In such cases, time series modeling and artificial intelligence
models might be combined to account for hydrological processes rather than utilizing a sin-
gle model [10]. It is well recognized that the experimental dataset, the machine learning
model, and the use of efficient variables for model creation depending on such a challenge
are all very important components in building a reliable machine learning technique [11].
A non-linear multi-variate (or variable) time series’ multi-step ahead prediction is
recognized to be quite challenging. If a forecasting task is modeled as an autoregressive
procedure, this task poses several formidable difficulties for every learning machine, in-
cluding the high dimensional space of outputs and inputs, cross-sectional and seasonal
high dependence (which results in both non-linear multi-variate connections within inputs
as well as a nonlinear framework within outputs), and last but not least, the danger of error
reproduction [12]. Earlier work has concentrated on a particular sub-problem product’s
sale within the issue of the one-step-ahead predictive model of sequential multi-variate
time series, discussions of the issue of multiple-step-ahead predicting of such a univariate
time series, and the latest manuals that individuals take into account linear methods [13].
626
Electronics 2022, 11, 3167
In a wide range of works, the topic of dimensionality decrease is protected more normally,
although without addressing how to expand it to multiple steps predicting.
Extraction of structures and characteristics that characterize the key characteristics
of the data is frequently the first step in the analysis and investigation of a time series
(and other kinds of analysis). The exploitation of worldwide time series characteristics
(including spectral characteristics measured with a conversion, such as the Discrete Cosine
or Wavelet Transforms) and utilization of such global characteristics (that characterize
time series characteristics as a collective) for archiving are standard techniques in the
research [14]. Worldwide, fingerprints of multi-variate time series data could be extracted
using correlations, transfer functions, statistical groupings, spectral characteristics, Singular-
Value Decomposition (SVD), and related eigen decomposition. Tensor degradation is
the equivalent analysis procedure on a tensor that can be utilized to depict the time
dynamics of multi-modal information [15]. Costly methods include tensor and matrix
degradation processes, probabilistic methods (such as Dynamic Topic Modeling, DTM),
and autoregressive incorporated moving average (ARIMA) predicated analysis, which
divide a statistical model into informatics, moving average, and autoregressive elements for
simulation and prediction. A dependable structure for modeling and learning time series
structures is offered by conventional time series forecasting techniques, such as ARIMA
and state-space models (SSMs). These techniques, however, have a great implication for
the normality of a time series, which poses serious practical challenges if the majority of the
influencing factors are not accessible. Deep learning methods have recently advanced to
the point where they can now handle complex dynamic nature as a single entity, even in the
absence of increased affecting variables. Recurrent neural networks (RNN) [16], long-short
term memories (LSTM), Transformer, Wavenet [17], and temporal convolution networks
are popular neural structures used on time series information (TCN). The key would be
to further modify various components of different kinds from the initial measurement.
Interactions that set dynamics apart from the spatial or temporal perspective can then be
collected. This research offers two different types of normalization configurations that
individually improve its high-frequency and local elements: Spatial Normalization (SN)
and Temporal Normalization (TN) [18]. To do this, academics have become interested in
applying ML approaches to create models that are more potent with greater accuracy. The
shortcomings of traditional modeling methods were widely addressed by ML approaches
to solve complicated environmental technical challenges [19]. This paper’s contribution is
the refinement of further categories of original measuring elements. Connections that set
dynamics apart from the temporal or spatial view can then be represented. In this study,
two different types of normalization modules are presented that individually enhance the
high-frequency and local elements: temporal normalization (TN) and spatial normalization
(SN). In particular, the local component makes it easier to separate dynamics from the
spatial perspective, and the high-frequency component helps to distinguish dynamics from
the temporal view. The system can uniquely fit every cluster of data because of its difference
over space and time, specifically those long-tailed samples. The paper also demonstrates
how the approach compares to existing state-of-the-art (SOTA) methods that use mutual
relationship development to discern between dynamics.
Numerous applications produce and/or use multi-variate temporal data, but experts
frequently lack the tools necessary to effectively and methodically look for and under-
stand multi-variate findings. Efficient prediction models for multi-variate time series are
crucial because of the incorporation of sensory systems into vital applications, including
aviation monitoring, construction energy efficiency, and health management. Time series
prediction methods have been expanded from univariate predictions to multi-variate time
series predictions to meet this requirement. However, naive adaptations of prediction
approaches result in an unwanted rise in the expense of model simulation, and more
crucially, a significant decline in prediction accuracy since the extensive models are unable
to represent the fundamental correlations between variates. However, research has shown
that investigating both geographical and temporal connections might increase predictive
627
Electronics 2022, 11, 3167
performance. These effects also influence how MTS will develop in the future, making it
crucial to include them in time series forecasting work. Conventional approaches, however,
have inherent limitations in separating the components produced by each type of effect
from the source data. Two different normalization components are suggested with machine
learning techniques to do this. The local component underlying the original data as well as
the improved high-frequency element is separated by the suggested temporal and spatial
normalization. Additionally, these modules are simple to include in well-known deep learn-
ing architectures like Wavenet and Transformer. Mixtures and original data can be difficult
to distinguish using conventional methods. In this way, it incorporates well-known neural
networks, such as the multi-layer perceptron (MLP), complex deep learning techniques,
such as RNN and LSTM, two recurrent neural networks, support vector machines (SVM),
and its application to regression, XGBoost, and others.
2. Related Works
Modern applications, such as climatic elements and requirement predicting, have
high-dimensional time series estimation difficulties. In the latter requirement, 50,000 pieces
must be predicted. The data are irregular and contain missing values. Modern applications
require scalable techniques that can handle noisy data with distortions or missing values.
Classical time series techniques often miss these issues. This research gives a basis for data-
driven temporal learning and predicting, dubbed temporal regularized matrix factorization
(TRMF). Create new regularization methods and scalable matrix factorization techniques
for high-dimensional time series analysis with missing values. The proposed TRMF is com-
prehensive and includes multiple time series assessment methods. Linking autoregressive
structural correlations to pattern regularization is needed to better comprehend them.
According to experimental findings, TRMF is superior in terms of scalability and
prediction accuracy. Specifically, TRMF creates greater projections on real-world datasets
such as Wal-Mart E-commerce data points and is two requirements of magnitude quicker
than some other techniques [20].
Using big data and AI, it is possible to predict the citywide audience or traffic intensity
and flow. It is a crucial study topic with various applications in urban planning, traffic
control, and emergency planning. Combining a big urban region with numerous fine-
grained mesh grids can display citywide traffic data in 4D tensors. Several grid-based
forecasting systems for citywide groups and traffic use this principle to do reevaluating
the intensity and in-out flow forecasting issues and submitting new accumulated human
mobility source data from a smartphone application. The data source has many mesh
grids, a fine-grained size distribution, and a high user specimen. By developing pyramid
structures and a high-dimensional probabilistic model based on Convolutional LSTM, we
offer a new deep learning method dubbed Deep Crowd for this enormous crowd collection
of data. Last but not least, extensive and rigorous achievement assessments have been
carried out to show how superior its suggested Deep Crowd is when compared to various
state-of-the-art methodologies [21].
Regional forecasting is crucial for ride-hailing services. Accurate ride-hailing demand
forecasting improves vehicle deployment, utilization, wait times, and traffic density. Com-
plex spatiotemporal needs between regions make this job difficult. While non-Euclidean
pair-wise correlation coefficients between possibly remote places are also crucial for ac-
curate predicting, typical systems focus on modeling Euclidean interrelations between
physically adjacent regions. This paper introduces the spatiotemporal multi-graph con-
volution network for predicting ride-hailing consumption (ST-MGCN). Non-Euclidean
pair-wise relationships between regions are encoded into graphs before explicitly modeling
correlation coefficients using a multi-graph transform. Perspective Landscaping recurrent
neural networks, which add context-aware limits to re-weight historical observational data,
are presented as a way to use global data to build association coefficients. This tests the
suggested concept using two large-scale ride-hailing requirement data sources from the
true world and finds that it consistently outperforms benchmarks by more than 10% [7].
628
Electronics 2022, 11, 3167
To address multi-horizon probability forecasting, we use a data-driven technique to
predict a time series distribution over upcoming horizons. Observed changes in historical
data are vital for predicting long-term time series. Traditional methodologies rely on build-
ing a temporal relationship by hand to explore historical regularities, which is unrealistic for
predicting long-term series. Instead, they propose learning how to use deep neural systems
to display hidden knowledge and generate future predictions. In this study, an end-to-end
deep-learning structure for multi-horizon time series prediction is proposed, along with
temporal focus procedures to more efficiently capture latent patterns in historical data
that are relevant for future prediction. Based on latent pattern properties, several future
projections can be made. To accurately demonstrate the future, we also suggest a multi-
modal fusion process that combines characteristics from various periods of history. Results
from experiments show that the method produces cutting-edge outcomes on two sizable
predicting data sources in various fields [22]. Multi-horizon prediction sometimes uses
static (time-invariant) confounders, recognized future components, and other external time
series only identified in the past. Deep learning techniques abound. “Black-box” designs
do not describe how they employ real-world inputs. The Temporal Fusion Transformer
(TFT) demands maximum multi-horizon prediction using temporal insights. TFT uses
self-attention structures to create long-term connections and factors for learning temporal
correlation at different scales and uses elements to pick relevant characteristics and gating
pieces to override superfluous components. This improves performance above baselines
on a wide range of real data sources and exhibits three TFT use cases [23]. Academic
research struggles with hierarchical time series prediction. The precision of each hierar-
chical system, notably the interrupted time series at the bottom, is explored thoroughly.
Hierarchical reunification boosts system productivity. This article provides a hierarchical
prediction-to-alignment technique that considers bottom step projections changeable to im-
prove upper hierarchical prediction performance. The bottom stage employed Light GBM
for occasional time series and N-BEATS for constant time series. Hierarchical prediction
with orientation is a simple but effective bottom-up improvement that adjusts for biases
hard to discover at the bottom. It increases the average accuracy of less accurate estimates.
The first author developed this study’s technique in M5 Predicting Precision tournaments.
The business-oriented approach may be effective for strategic business planning [24].
3. Methodology
3.1. Normalization
Since normalization is initially used in deep image processing, now almost all deep
learning activities have seen a significant improvement in model performance. Each nor-
malization approach has been future to report a specific gathering of computer vision
applications, including group normalization, instance normalization, positional normal-
ization layer normalization, and batch normalization [25]. Instance normalization, which
was initially intended for image generation due to its ability to eliminate style data from
its images, does have the highest opportunity for research. Researchers have discovered
that attribute statistical data could collect an image’s design and that after initializing the
statistical data, the remaining characteristics are in charge of the image’s substance. This
ability to deliver an image’s material in the fashion of another image, also recognized as
extracting features, is made possible by its distinguishable assets. Similar to scale details
in the time series is the style data in the image. Another area of research investigates the
rationale behind the normalization trick’s facilitation of deep neural network learning. One
of their key findings is that normalization could improve the evaluation of an attribute
space, allowing the framework to retrieve characteristics that are more different.
Figure 1 presents a high-level assessment of the structure used. Along the computation
path, a few significant variables and their shapes have been branded at the appropriate
locations. The structure normally has a Wavenet-like structure, with the addition of modules
for spatial and temporal normalization, collectively referred to as ST-Norm or STN.
629
Electronics 2022, 11, 3167
Figure 1. Overall high-level assessment structure.
3.2. Dilated Causal Convolution
This segment provides a brief introduction to dilated causal convolution, which applies
the filter while skipping beliefs. The causal convolution on component t for the 1D signal
z ∈ RT and a filter f : {0, . . . , k − 1} → R is described in Equation (1) as follows:
k −1
F (t) = (c ∗ f )(t) = ∑ f (i ).ct−i (1)
i =0
This formula is simple to categorize for multi-dimension signals, but for the sake of
brevity, it will not be included it here. To guarantee length continuity, padding (zero as well
as recreate) to the dimension of k − 1 is added to a left tail of a transmitter [26]. To give so
every component a larger receptive ground, we combined several causal convolution layers.
Figure 2 shows the structure of dilated causal convolution. Trying to cause an outburst
of characteristics when predicting long history is one drawback of using causal convolution,
because the diameter of a kernel or its number of layers grows linearly with the dimensions
of a receptive sector [27]. The obvious solution to this problem is pooling, but doing so
compromises the signal’s order details. To achieve this, dilated causal convolution is used,
a form that encourages the exponential growth of an approachable pitch. The structured
computing method is expressed in Equation (2).
k −1
F (t) = (c ∗d f )(t) = ∑ f (i ).ct−d .i, (2)
i =0
In Equation (2), d is its component for dilation. Typically, d grows exponentially with
network depth (namely, 2l at stage l of a system). The variable d which denotes the dilated
convolution operator decreases to the ∗d a normal convolution controller if d is 1 or (20 ).
630
Electronics 2022, 11, 3167
Figure 2. Dilated causal convolution architecture.
3.3. Neural Networks
3.3.1. Multi-Layer Perceptrons (MLPs)
A brief overview of Random Forests, multi-layer perceptrons (MLP), XGBoost, long-
short term memory (LSTM) systems, and support vector regressors (SVR) is provided as
an introduction to creating the research self-contained. MLP is regarded as an effective
technique for capturing interactions among the parameter estimation that are not linear. It is
being used effectively in hydrology, particularly time series modeling, hazard identification,
and sediment supply [28]. The most popular artificial neural networks (ANN) for the
classification of a regression issue are multi-layer perceptrons (MLPs). An input layer, each
or many hidden layers, as well as an output layer, make up this category of designs [29].
A three-layer MLP is shown in Figure 3.
Figure 3. Multi-layer perceptron network graph layer.
A network diagram, for example, can produce the following results in Equation (3)
L q p
A ( t ) = α0 + ∑ ∑ α jl g β 0jl + ∑ β ijl Xt−i + t (3)
l =1 j =1 i =1
The numbers L,P,q represent the number of hidden sections, inputs Xt (i = 1, 2, . . . p),
and nodes in a specific hidden layer, respectively. The ReLU function ( g( x ) = 1/(1 + e− a ))
or the convolution ((e a − e− a )/(e a + e− a )) are some examples of activation functions
631
Electronics 2022, 11, 3167
ReLU ( g( x ) = max(0, x )). Equation (4) becomes simpler for networks including a single
hidden layer:
q p
Xt = α0 + ∑ αj g β 0j + ∑ β ij Xt−i + t (4)
j =1 i =1
3.3.2. LSTM
The LSTM is a design for such a recurrent neural network composed of three gates
and two states: Input gate, Output gate, Forget gate, Cell state, and Hidden state.
Figure 4 displays the network’s total schematic. In the mentioned reasoning, we will use it
as a constant. This Figure 4 includes the hyperbolic tangent tanh( a) = (e a + e− a )/(e a − e− a )
and the sigmoid σ( a) = 1/(1 + e− a ). The elements of the vector are subjected to activation
functions [30]. Additionally, the element-wise addition and multiplication processes are
denoted by and ⊕. The two related matrices are finally concatenated ! " vertically when
A
two lines intersect. The formula for this procedure is Ș : A Ș B = .
B
+LGGHQ
VWDWH
)RUJHW +LGGHQ
,QSXWJDWH
JDWH JDWH KW
&HOO &HOOVWDWH
F Wƺ FW
7DQK
ı ı 7DQK ı
2XWSXW
+LGGHQ
K Wƺ KW
,QSXW DW
Figure 4. The cell structure of Long-Short Term Memory.
One could demonstrate h r! and c r! as a component of h r −1! , c r −1! , and a r! without
using these formulae in Equation (5):
c r! = c r −1!
⊕ σ " f h r −1! † a r ! ⊕
tanh "c h r − 1 ! †x r ! σ "i h r − 1 ! † a (r ) (5)
h r! = tanh c r! σ "o h r−1! † a r!
where a r! , c r! , and h r! stand for the input signal (time series amount at time r), ap-
proximate output importance for time r, and cell condition at time r, respectively. The
characteristics of an LSTM framework were its matrices " f , "i , "c , "o .
3.3.3. SVM
The -insensitive loss capability is used by its support vector regression (SVR) al-
gorithm, which was developed. The time series analysis At in SVR is transformed non-
632
Electronics 2022, 11, 3167
linear, Φ, from its input space to such greater dimensional storage, which is denoted in
Equations (6) and (7):
Φ = Rn → F (6)
f ( a) = < u, Φ( a) > + y (7)
where the linear function f is minimized by a vector of characteristics (also known as
weights) called w 2 F, and b 2 R is continuous. SVR typically selects the insensitive loss
function again for minimization procedure instead of more traditional loss functions,
such as the mean absolute percentage error (MAPE) and the least mean average error
(MAE) [31]. One must reduce the risk formalized function to reduce its weight vector w,
and subsequently, the function of f in Equation (8):
l
min1/2 |w| 2 + C ∑ ξ i + ξ i∗
i =1 (8)
s.t.bi − < w, Φ( ai ) > − b ≤ + ξ i
< w, Φ( ai ) > + y − bi ≤ + ξ i∗
where ≥ 0 represents the separation among the real charge of y and the assumed shape
of f . Slack variables ξ, ξ ∗ ≥ 0 are added to accommodate errors bigger than that . When
fitting training data, the regularization constant C is utilized to define the trade-off between
generalization and precision.
In actuality, the Lagrangian multiplier-based expressions of w and f have been utilized
in Equation (9):
t
w = ∑ αi − αi∗ Φ( ai )
i =1 (9)
t
f ( a) = ∑ αi − αi∗ K ( ai − a) − y
i =1
where αi − αi∗ ≤ C denotes the partial derivative of Φ( xi ) and Φ( x ), also known as the
kernel features, and where K ( ai , a). The literature provides more information on support
vector machines and how to use them to solve regression issues.
3.3.4. Tree-Based Techniques
(a) Random forest regressor
As ensemble learning methods, random forests (RF) [32] could be used for correla-
tion by averaging many different regression trees zn ( a, "m , Dn ), where " has been the
model’s parameters variable and Dn would be the training set ( A1 , B1 ), . . . , ( An , Bn ). The
assessment of the combined trees’ regression function in Equation (10):
r n ( A, Dn ) = E" [rn ( A, ", Dn )] (10)
where E has been the assumption or conditional mean for the specified posterior distri-
bution. To create a forest of nonlinear individual trees, packing and feature stochastic are
also used. When predictions are made by a committee rather than by individual trees,
the results are more precise. References provide thorough configurations of a random
forest classifier.
(a) XGBoost
The gradient tree boosting (GBT) development known as XGBoost (eXtreme Gradient
Boosting) is indeed a tree ensemble machine learning technique. The forecast is described
as follows at the time (or phase) r in Equation (11):
t
(r −1)
b̂(r) = ∑ f k ( ai ) = b̂i + f i ( ai ) (11)
k =1
633
Electronics 2022, 11, 3167
where ai would be the feature variable, also known as the input observation, which refers
to the prior time values within the time series analysis set. Moreover, at time t, f i ( ai ) seems
to be the learner, which is typically a regression tree. The XGBoost framework employs
a normalized objective function to protect the excessively of its training examples, as shown
in Equation (12):
n t
O(t) = ∑ l b̂, b + ∑ Ω( f i ) (12)
k =1 k =1
where t denotes the leaf count, Ω denotes the leaf score, and O denotes the regularization
attribute. The leaf node splitting minimum loss value O is represented by the parameter.
The research of Chen and Guestrin provides more information on the XGBoost framework
and how it was put into practice.
3.4. Temporal Normalization
The goal of temporal normalization (TN) is to smooth out the high frequency of local
and global elements of a hybrid signal. High-frequency elements and the low-frequency ele-
ments are each summarized separately here, using the two notations that are demonstrated
in Equation (13):
high lh gh I I gl
Ci,t = Ci,t Ct · Ci,t
low
= Ci,t Ct . (13)
The reasonable inference that low-frequency element evolving charges are significantly
slower than high-frequency element evolving rates is the foundation for the suitability
of TN. Technically speaking, every low-frequency element over a period roughly equals
a constant [33]. This presumption allows us to pertain TN to time sequence without its need
for additional characteristics that characterize the frequency. Many real-world issues where
the specialized frequency is unavailable can benefit from this characteristic. To achieve
a desirable form for whom unique amounts could be determined from information, begin
high
by expanding Ci,t in Equation (14):
high highl
high Ci,t − ECi,t i highl highl
Ci,t = high σCi,t i + ECi,t i
σCi,t i +
high low low EC highl i
Ci,t Ci,t −Ci,t highl highl
= low σC highl i +
i,t
σCi,t i + ECi,t i
Ci,t i,t (14)
Ci,t − ECi,t Ci,tlow ,i
highl highl
= (±)σZi,t Zi,t low ,i + σCi,t i + ECi,t i
Ci,t − ECi,t Ci,t
low ,i
highl highl
= low ,i +
σZi,t Zi,t
(±)σCi,t i + ECi,t i,
where Ci,t is perceptible, is a minor constant to maintain numerical stability, and the
high-frequency impact mostly on ith time series over time is represented mostly by vectors
highl highl
E Ci,t i and (±)σ Ci,t i, which can be estimated by a sequence of the learnable feature
high high
vector γi and β i low , i and σ C C low , i can be
with a size of dz , the values of E Ci,t Ci,t i,t i,t
calculated by Equation (15):
δ
low , i ≈ 1/δ low low
ECi,t Ci,t ∑ Ci,t −t +1 Ci,t
t =1
δ
≈ 1/δ ∑ low
Ci,t low
−t +1 Ci,t−t +1 (15)
t =1
δ
≈ 1/δ ∑ Ci,t
low
−t +1 − ECi,t Ci,t , i
low 2
t =1
where δ is a time interval when the low-frequency element roughly stays continuous. For
the sake of easiness, make several input appropriate actions in the task equitable. Research
634
Electronics 2022, 11, 3167
can acquire the recognition of the high-frequency element by replacing the estimates of
four non-observable parameters in Equation (16):
high Ci,t − ECi,t Ci,t
low , i
high high
Ci,t = low , i +
γi + βi (16)
σCi,t Ci,t
Notably, TN and instance normalization (IN) for image data have a special connec-
tion in which style acts as a low-frequency element and material as a high-frequency
element [33]. The research is novel because it identifies the source of TN within the per-
spective of MTS and pieces together TN step-by-step of its source.
3.5. Spatial Normalization
Refining local elements, which are made up of the native high-frequency component
as well as the regional low-frequency element, is the goal of spatial normalization (SN) [34].
The first step in achieving this goal is to get rid of global elements, which are caused by
factors corresponding to the time of day, day of the week, climate, etc. This also presents
two notations for enumerating regional and global elements as given in Equation (17):
global gh gl
Ct = Ct Ct , Ci,t
local
= Ci,t
lh ll
Ci,t . (17)
The suitability of SN is also predicated on the idea that all time series will be affected
similarly by global impacts. Here, it is significant to say that we do not also strictly need
global effects to have identical effects on every time series. The specified local element
could supplement those impacts which are not equally identified in each time series. This
begins by extending Ci,tlocal to a representation where another term can either be delegated
with trainable parameters or an approximation based on data in Equation (18):
local − EC local t
Ci,t
local =
Ci,t i,t local t + EC local t
σCi,t
locall t +
σCi,t i,t
global
Ci,t − ECi,t Ct ,t global global
= global σCi,t t + ECi,t t (18)
(±)σCi,t Ct ,t+
global
Ci,t − ECi,t Ct ,t
= global (±)σCitlocal t + ECitlocal t
σCi,t Ct ,t+
where Ci,t is easily observable and (±)σ Ci,t
local t and E C local t have been estimated by
i,t
global global
two teachable vectors2 (γ local and β local), the prediction of ECi,t Ct , t and σ ECi,t Ct ,
t could be derived from it so information in the following methods in Equation (19):
global N global global
ECi,t Ct ,t = 1
N ∑ Cj,t Ct
j =1
N
1
N ∑ c j,t
j =1 (19)
global global global
σ2 Ci,t Ct , t = E[ Ci,t − ECi,t Ct , t Ct ,t
N global
= 1
N ∑ Ci,t − ECi,t Ct , t2
j =1
This can get the composite illustration of local elements by putting the estimations of
four non-observable factors into Equation (18), which reads as follows (Equation (20)):
global
global Ci,t − ECi,t Ct ,t
Ci,t = global
γlocal + βlocal (20)
σCi,t Ct ,t+
In the spatial domain, SN is TN’s counterpart because it uses high-frequency elements
to represent local elements and low-frequency elements to represent global elements. The
635
Electronics 2022, 11, 3167
model takes into account fine-grained variability by removing the local and high-frequency
elements with the actual signal, which is extremely helpful in time series prediction.
3.6. Learning and Forecasting
This designates C ( L) ∈ R Nl ×Tin ×dz as the result of the final residual block, in which
every row of C ( L) ∈ RTin ×dz stands for a different variable. Next, temporal accumulation is
undertaken for each variable using a temporal pooling block. Depending on the issue being
investigated, various pooling processes could be used, including max pooling and mean
pooling [35]. In this instance, the pooling result is chosen to represent the entire signal by
choosing the vector from the latest time slot. Finally, depending on the recognition acquired
by a common fully connected layer, each creates different forecasting for each variable. The
goal in the learning stage is to reduce the mean squared error (MSE) among the expected
attributes and the standards obtained from the ground truth. Additionally, this goal can be
maximized using the Adam optimizer.
4. Result and Discussion
4.1. Data Collection
To verify the efficacy of ST-Norm from various angles, perform comprehensive studies
on three common data sources in this section by using Jupyter notebook. Using three real-
world datasets, such as PeMSD7, BikeNYC, and Electricity, a framework can be verified, as
well as statistics for each dataset and the correlating planned task settings. The principles
in every dataset can be simplified to make training easier, and when testing is complete,
the principles can be converted back to their original magnitude. In addition to SN and
TN, an instance normalization (IN) control unit can be added. The sample size is four, and
the batch pattern’s input length is sixteen. For every DCC element’s kernel size for such
Wavenet backbone is set to 2, and its related dilation percentage is 2i , where i have been
the layer’s index (counting from 0). Together, these settings allow Wavenet’s output to
recognize 16 input steps. Each DCC contains 16 hidden channels (dz ). To make the duration
of a DCC output equivalent to 16, zero-stuffing can be extended to the left tail of an input.
The Adam optimizer has a training set of 0.0001.
4.2. Evaluation Metrics
Then, we use the mean absolute error (MAE), mean squared error (RMSE), and mean
absolute error (MSE) proportion to confirm the prototype (MAPE). For every model and
every dataset, the test is repeated 10 times, and the average of outcomes is presented.
Graph Wavenet has a similar architecture to MTGNN. The primary distinction would be
that the former depends on a soft graph with a perpetual probability for every pair of nodes
to be attached. This model designs segment-level correlation while capturing long-term
correlations in time series information via the use of a consideration method, where its
explanations and enquires are produced by the correlational convolution over a specific
setting. MTGNN introduces a graph-learning device to create inter-variate connections.
The diagram learning method particularly links every center node to its top k closest
neighbors in a specified dimensional space. Wavenet is the primary design of MTGNN for
sequential simulation.
A graph-learning component is also included in AGCRN to help develop inter-variable
relationships. Additionally, it models the sequential connection for every time series using
a customized RNN.
LSTNet consists of two parts: an LSTM with a supplemental skip correlation from
an overtime component, and a traditional autoregressive design.
Graph Wavenet has a similar structure to MTGNN. The primary distinction would be
that the distinction generates a soft chart with a constant likelihood that every pair of base
stations is attached.
TCN’s architecture is similar to Wavenet’s, with the exception that every residual
block’s nonlinear transition is composed of two rectified linear units (ReLU).
636
Electronics 2022, 11, 3167
This is also evaluated by using TCN and Inductor function when STN is used similarly
before every layer’s causal convolution procedure.
4.3. Ablation Study
This creates numerous variations as regards verifying the efficacy of SN and TN. This
will also test a combination that includes both STN and a graph-learning module to see
if it enhances STN. Since the normal Wavenet backbone is present in all of the variations,
Wavenet is left out of the phrase for simplicity.
On each of the three datasets, these variants were tested, and Table 1 presents the
overall findings. SN and TN both relate to the improvement. Moreover, STN’s achieve-
ment slightly improves with a responsive graph-learning device. This shows that STN
significantly outperforms and replaces the graph-learning device.
Table 1. Study of ablation.
STN GSTN SN TN Graph Vanilla
MAE 2.46 2.48 2.64 2.65 2.98 3.45
P RMSE 5.19 5.22 2.45 4.65 7.35 6.32
MAPE 19.5 19.3 18.5 18.7 21.5 24.9
MAE 2.76 2.84 3.04 2.88 3.45 3.95
B RMSE 5.14 5.23 5.33 5.28 5.67 6.54
MAPE 5.85 5.96 6.34 6.08 7.35 8.34
MAE 17.6 18.7 20.5 20.87 21.54 22.3
E RMSE 37.5 39.65 39.54 38.32 44.87 43.8
MAPE 15.3 15.66 14.32 15.32 15.23 15.45
4.4. Model Optimization
To identify any underfitting or overfitting, learning shapes of prediction accuracy upon
that train and validation datasets have been used. Each applicant’s model’s effectiveness
was represented as a loss function and plotted against the epochs for both the training and
validation sets. One could quickly determine whether the model might result in increased
variation (overfit) or bias by correlating and examining the patterns of plotted loss features
(underfit). K-fold cross-validation is utilized when a model has several hyperparameters
because there were also too several more possible mixtures of hyperparameter attributes.
A manual method should, therefore, be avoided because it is time-consuming. This method
divides the training set into k smaller sets. Several of the k-folds is processed in the manner
described below:
• A structure is trained by utilizing k − 1 of folds as training information;
• The architecture was authorized on a residual data portion.
The two stages above were recurring k-times by utilizing another data portion for
validations. By computing the mean calculated for the k steps, the effectiveness identified
by k-fold cross-validation is obtained. Although this method may be computationally
time affordable, it does not necessitate as much information as repairing a specialized
validation set. Other methods exist that might be slightly different, but usually adhere to
the same fundamentals.
4.5. XGBoost
Several parameters could be given specific values to characterize XGBoost models.
They must be chosen towards optimizing the performance of the approach on a particular
dataset and in a manner that guards against both underfitting and overfitting as well as
unnecessary difficulty. These parameters also include effect, learning algorithm, lambda,
637
Electronics 2022, 11, 3167
alpha, and the number of boosting repetitions. In XGBoost, the amount of shaped consecu-
tive trees is referred to as the number of boosting iterations. The largest number of splits is
determined by the tree’s maximum depth; a high maximum depth can lead to overfitting.
Before growing trees, random subsampling corresponds to a particular ratio of a training
dataset within every iteration. The optimization method is stronger by using a learning
rate, which essentially lessens the effect of every individual tree and allows future trees
to enhance the framework. Increases in the variables make the model extra conservative
because they are normalization terms for weight training. The values for each parameter
are obtained by applying a grid search algorithm and a 10-fold cross-validation procedure.
In total, there were 500 boosting repetitions, 25 maximum tree depths, and 1 (0.8) for the
subsample ratio of the training dataset, 0.5 for the subsample ratio of the columns, and
λ = 1, α = 0.2, and 0.1 for the learning rate.
4.6. Analysis of Hyperparameter Configurations
We investigated the impact of various hyperparameter configurations in the suggested
modules. The percentage of historical steps entered into the model, the dimensions of
a DCC kernel, the batch dimensions, and the element of hidden channels (dz ) are the four
hyperparameters that need a manual process set by professionals. The study’s findings
are shown in Figure 5, which can infer that STN not only improves effectiveness, but also
multiplies the achievement stability in various hyperparameter configurations.
Figure 5. Analysis of hyperparameters.
They can be applied to the raw input data to see if they reduce the problems raised and
to show how TN and SN redefine the extracted features. The original quantity is against
both the temporally normalized amount and the spatially normalized quantity. There are
differences among regions and days within the pairwise connection between the make
sure and the temporally normalized quantity as well as among the original measure and
the spatially normalized quantity. Insufficient SOTA methods suggest that to improve the
local element, various time series should be made to have a mutual relationship with one
another. In essence, they highlight the local element of individual time series by contrasting
a pair of time series that have similar global elements over time. Multiple connections
reflect the individuality of every time series are produced, for instance, by contrasting the
638
Electronics 2022, 11, 3167
three-time series within a single time series (referred to as an anchor). Dissimilar time
series might need to be multiplied along various anchors because it is frequently unknown
which ones are eligible anchors. These approaches use a graph-learning component to
investigate every potential couple of time series to mechanically recognize the anchor for
each time series. Here, O TN 2 refers to the computational complexity. The method’s
normalization modules, in contrast to other ones that have been suggested in this field,
only call for O( TN ) operations.
4.7. Model Comparison
The MASE of every method is established for various lead times to demonstrate their
effects on various time series predictions. MASE for every model is then calculated for
every lead time. Table 2 shows the proposed model’s comparison with existing methods.
Figure 6 demonstrates the competitive performances of Multi-variate RNN, LSTM, MLP,
and SVM for 5–15 min early time series prediction. However, their prediction accuracy
declines significantly as lead time lengthens. Given the strong correlation, a simulation
model such as MLP can be supplemented by using both temporal and spatial data as
input. As a result, predicting accuracy could be increased. Figure 6 demonstrates that MLP
performs better than other methods for every lead time. This happens because MLP, which
has a deep architecture having nonlinear properties, can accurately capture and recreate the
entire target, whereas other approaches cannot do so, owing to their linear characteristics.
Table 2. Performance comparison with MASE.
Leading Time/ MASE
Methods RNN LSTM SVM MLP
5 98.1 85.3 71.3 68.2
10 94.8 80.1 70.3 64.5
15 96.7 90.2 68.6 56.3
25 98.1 91.4 73.9 78.2
30 90.1 86.3 77.3 60.6
0RGHO3HUIRUPDQFH
0RGHOV
511
/670
690
0/3
/HDGLQJWLPH
Figure 6. Comparison of the proposed method.
4.8. Computation Time Comparison
Table 3 lists the times for training (on the training set) as well as predicting (on the
testing set) for every approach. The training time for the many multi-variate algorithms
that have been suggested, including MLP, RNN, LSTM, and SVM, is the total of the training
times, as well as the prediction time, determined in the same manner. The persistent
method’s learning and forecasting times are 0 and are, therefore, not listed. As seen in
Table 3, because periodic retraining and refreshing of forecasts are eliminated, the time
effectiveness is comparable to other approaches while training spatial-temporal predictions.
639
Electronics 2022, 11, 3167
The MTS spatial and temporal prediction is taught live by incremental learning, which
saves time by avoiding periodic model retraining and refreshing.
Table 3. Time computation comparison.
Leading
RNN LSTM SVM MLP
Method/Methods
Process/(s) Train Pred Train Pred Train Pred Train Pred
5 1545 4.21 22,540 20.09 17,680 0.38 134 0.25
10 1445 3.82 20,020 21.13 16,560 0.33 185 0.22
15 1685 3.45 37,140 22.55 15,580 0.34 182 0.34
20 1510 3.41 25,860 23.42 14,230 0.34 225 0.32
25 1415 3.30 39,770 21.01 17,380 0.36 261 0.37
30 1500 3.29 22,590 24.10 12,730 0.25 228 0.59
5. Conclusions
This paper proposes a novel method for factorizing MTS data. We suggest spatial
and temporal normalization following factorization, which improves the local and high-
frequency components of the MTS data, respectively. Due to the nonlinear nature of
demand variations, current research demonstrates that statistical methods lack predictive
value in real-world circumstances. In particular, predictions beyond a few hours may be
imprecise when employing these algorithms. As evidenced by the multiple plots in the
current edition, these shifts occur after a few hours, particularly when the demand varies
drastically. The results of the experiment illustrate the capability and performance of these
two components. However, this study has significant limitations, including controlling
the modeling process through improved machine learning model parameters and locating
appropriate variables for taking the input from the models into consideration. Future
studies may take into account the use of various hybrid frameworks with optimization
techniques as a unique addition to spatial and temporal prediction.
Author Contributions: Conceptualization, A.M.P. and C.Y.; methodology, A.M.P. and C.Y.; software,
G.K.A.; validation, A.M.P. and C.Y.; formal analysis, A.M.P. and C.Y.; investigation, A.M.P.; resources,
A.M.P.; data curation, A.M.P.; writing—original draft preparation, A.M.P.; writing—review and
editing, A.M.P., T.B.O. and A.M.; visualization, G.K.A.; supervision, C.Y.; funding acquisition, C.Y.
All authors have read and agreed to the published version of the manuscript.
Funding: The National Natural Science Foundation of China under Grant No. 61873004.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Fildes, R.; Nikolopoulos, K.; Crone, S.F.; Syntetos, A.A. Forecasting and operational research: A review. J. Oper. Res. Soc. 2008, 59,
1150–1172. [CrossRef]
2. Forni, M.; Hallin, M.; Lippi, M.; Reichlin, L. The Generalized Dynamic Factor Model. J. Am. Stat. Assoc. 2005, 100, 830–840.
[CrossRef]
3. Perez-Chacon, R.; Talavera-Llames, R.L.; Martinez-Alvarez, F.; Troncoso, A. Finding Electric Energy Consumption Patterns in
Big Time Series Data. In Distributed Computing and Artificial Intelligence, 13th International Conference; Omatu, S., Semalat, A.,
Bocewicz, G., Sitek, P., Nielsen, I.E., García García, J.A., Bajo, J., Eds.; Springer International Publishing: Cham, Switzerland, 2016;
Volume 474, pp. 231–238. [CrossRef]
4. Galicia, A.; Torres, J.F.; Martínez-Álvarez, F.; Troncoso, A. Scalable Forecasting Techniques Applied to Big Electricity Time Series.
In Advances in Computational Intelligence; Rojas, I., Joya, G., Catala, A., Eds.; Springer International Publishing: Cham, Switzerland,
2017; Volume 10306, pp. 165–175. [CrossRef]
5. Hyndman, R.; Koehler, A.B.; Ord, J.K.; Snyder, R.D. Forecasting with Exponential Smoothing: The State Space Approach; Springer
Science & Business Media: West Lafayette, IN, USA, 2008.
6. Makridakis, S.; Hyndman, R.J.; Petropoulos, F. Forecasting in social settings: The state of the art. Int. J. Forecast. 2020, 36, 15–28.
[CrossRef]
640
Electronics 2022, 11, 3167
7. Geng, X.; Li, Y.; Wang, L.; Zhang, L.; Yang, Q.; Ye, J.; Liu, Y. Spatiotemporal Multi-Graph Convolution Network for Ride-Hailing
Demand Forecasting. Proc. Conf. AAAI Artif. Intell. 2019, 33, 3656–3663. [CrossRef]
8. Ding, D.; Zhang, M.; Pan, X.; Yang, M.; He, X. Modeling Extreme Events in Time Series Prediction. In Proceedings of the 25th
ACM SIGKDD International Conference on Knowledge Discovery & Data Mining, Anchorage, AK, USA, 4–8 August 2019;
pp. 1114–1122. [CrossRef]
9. Piccialli, F.; Giampaolo, F.; Prezioso, E.; Camacho, D.; Acampora, G. Artificial intelligence and healthcare: Forecasting of medical
bookings through multi-source time-series fusion. Inf. Fusion 2021, 74, 1–16. [CrossRef]
10. Fathian, F.; Mehdizadeh, S.; Sales, A.K.; Safari, M.J.S. Hybrid models to improve the monthly river flow prediction: Integrating
artificial intelligence and non-linear time series models. J. Hydrol. 2019, 575, 1200–1213. [CrossRef]
11. Gul, E.; Safari, M.J.S.; Haghighi, A.T.; Mehr, A.D. Sediment transport modeling in non-deposition with clean bed condition using
different tree-based algorithms. PLoS ONE 2021, 16, e0258125. [CrossRef] [PubMed]
12. Bontempi, G.; Ben Taieb, S. Conditionally dependent strategies for multiple-step-ahead prediction in local learning. Int. J. Forecast.
2011, 27, 689–699. [CrossRef]
13. Ben Taieb, S.; Bontempi, G.; Atiya, A.F.; Sorjamaa, A. A review and comparison of strategies for multi-step ahead time series
forecasting based on the NN5 forecasting competition. Expert Syst. Appl. 2012, 39, 7067–7083. [CrossRef]
14. Kolda, T.; Bader, B.W. Tensor Decompositions and Applications. SIAM Rev. 2009, 51, 455–500. [CrossRef]
15. De Silva, A.; Hyndman, R.J.; Snyder, R. The vector innovations structural time series framework: A simple approach to
multivariate forecasting. Stat. Model. 2010, 10, 353–374. [CrossRef]
16. Bai, S.; Kolter, J.Z.; Koltun, V. An Empirical Evaluation of Generic Convolutional and Recurrent Networks for Sequence Modeling.
arXiv 2018, arXiv:1803.01271. [CrossRef]
17. Oord, A.V.D.; Dieleman, S.; Zen, H.; Simonyan, K.; Vinyals, O.; Graves, A.; Kalchbrenner, N.; Senior, A.; Kavukcuoglu, K.
WaveNet: A Generative Model for Raw Audio. arXiv 2016, arXiv:1609.03499. [CrossRef]
18. Liu, C.-T.; Wu, C.-W.; Wang, Y.-C.F.; Chien, S.-Y. Spatially and Temporally Efficient Non-local Attention Network for Video-based
Person Re-Identification. arXiv 2019, arXiv:1908.01683. [CrossRef]
19. Safari, M.J.S. Hybridization of multivariate adaptive regression splines and random forest models with an empirical equation for
sediment deposition prediction in open channel flow. J. Hydrol. 2020, 590, 125392. [CrossRef]
20. Yu, H.-F.; Rao, N.; Dhillon, I.S. Temporal Regularized Matrix Factorization for High-dimensional Time Series Prediction. Adv.
Neural Inf. Processing Syst. 2016, 29, 9.
21. Jiang, R.; Cai, Z.; Wang, Z.; Yang, C.; Fan, Z.; Chen, Q.; Tsubouchi, K.; Song, X.; Shibasaki, R. DeepCrowd: A Deep Model for
Large-Scale Citywide Crowd Density and Flow Prediction. IEEE Trans. Knowl. Data Eng. 2021. [CrossRef]
22. Fan, C.; Zhang, Y.; Pan, Y.; Li, X.; Zhang, C.; Yuan, R.; Wu, D.; Wang, W.; Pei, J.; Huang, H. Multi-Horizon Time Series Forecasting
with Temporal Attention Learning. In Proceedings of the 25th ACM SIGKDD International Conference on Knowledge Discovery
& Data Mining, Anchorage, AK, USA, 4–8 August 2019; pp. 2527–2535. [CrossRef]
23. Anderer, M.; Li, F. Hierarchical forecasting with a top-down alignment of independent-level forecasts. Int. J. Forecast. 2022, 38,
1405–1414. [CrossRef]
24. Lin, S.; Xu, F.; Wang, X.; Yang, W.; Yu, L. Efficient Spatial-Temporal Normalization of SAE Representation for Event Camera. IEEE
Robot. Autom. Lett. 2020, 5, 4265–4272. [CrossRef]
25. Wang, J.-H.; Lin, G.-F.; Chang, M.-J.; Huang, I.-H.; Chen, Y.-R. Real-Time Water-Level Forecasting Using Dilated Causal
Convolutional Neural Networks. Water Resour. Manag. 2019, 33, 3759–3780. [CrossRef]
26. Zhang, X.; You, J. A Gated Dilated Causal Convolution Based Encoder-Decoder for Network Traffic Forecasting. IEEE Access
2020, 8, 6087–6097. [CrossRef]
27. Zhao, W.; Wu, H.; Yin, G.; Duan, S.-B. Normalization of the temporal effect on the MODIS land surface temperature product
using random forest regression. ISPRS J. Photogramm. Remote Sens. 2019, 152, 109–118. [CrossRef]
28. Botalb, A.; Moinuddin, M.; Al-Saggaf, U.M.; Ali, S.S.A. Contrasting Convolutional Neural Network (CNN) with Multi-Layer
Perceptron (MLP) for Big Data Analysis. In Proceedings of the 2018 International Conference on Intelligent and Advanced System
(ICIAS), Kuala Lumpur, Malaysia, 13–14 August 2018; pp. 1–5. [CrossRef]
29. Shi, X.; Li, Y.; Yang, Y.; Sun, B.; Qi, F. Multi-models and dual-sampling periods quality prediction with time-dimensional K-means
and state transition-LSTM network. Inf. Sci. 2021, 580, 917–933. [CrossRef]
30. de Myttenaere, A.; Golden, B.; Le Grand, B.; Rossi, F. Mean Absolute Percentage Error for regression models. Neurocomputing
2016, 192, 38–48. [CrossRef]
31. Aschner, A.; Solomon, S.G.; Landy, M.S.; Heeger, D.J.; Kohn, A. Temporal Contingencies Determine Whether Adaptation
Strengthens or Weakens Normalization. J. Neurosci. 2018, 38, 10129–10142. [CrossRef]
32. Diao, Z.; Wang, X.; Zhang, D.; Liu, Y.; Xie, K.; He, S. Dynamic Spatial-Temporal Graph Convolutional Neural Networks for Traffic
Forecasting. In Proceedings of the AAAI Conference on Artificial Intelligence, Honolulu, HI, USA, 27 January–1 February 2019;
Volume 33, pp. 890–897. [CrossRef]
33. Makridakis, S.; Spiliotis, E.; Assimakopoulos, V. Statistical and Machine Learning forecasting methods: Concerns and ways
forward. PLoS ONE 2018, 13, e0194889. [CrossRef]
641
Electronics 2022, 11, 3167
34. Safari, M.J.S.; Arashloo, S.R. Sparse kernel regression technique for self-cleansing channel design. Adv. Eng. Inform. 2021,
47, 101230. [CrossRef]
35. Mohammadi, B.; Guan, Y.; Moazenzadeh, R.; Safari, M.J.S. Implementation of hybrid particle swarm optimization-differential
evolution algorithms coupled with multi-layer perceptron for suspended sediment load estimation. CATENA 2021, 198, 105024.
[CrossRef]
642
MDPI
St. Alban-Anlage 66
4052 Basel
Switzerland
www.mdpi.com
Electronics Editorial Office
E-mail: [email protected]
www.mdpi.com/journal/electronics
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are
solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s).
MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from
any ideas, methods, instructions or products referred to in the content.
Academic Open
Access Publishing
www.mdpi.com ISBN 978-3-0365-8487-4
You might also like
- 2024.Advances in Intelligent Data Analysis and Its ApplicationsNo ratings yet2024.Advances in Intelligent Data Analysis and Its Applications528 pages
- Esteban Tlelo-Cuautle, Jose Martinez-Carranza, Everardo Inzunza - Machine Learning For Complex and Unmanned Systems (2024, CRC Press) - Libgen - LiNo ratings yetEsteban Tlelo-Cuautle, Jose Martinez-Carranza, Everardo Inzunza - Machine Learning For Complex and Unmanned Systems (2024, CRC Press) - Libgen - Li386 pages
- Big Data Analytics Using Artificial IntelligenceNo ratings yetBig Data Analytics Using Artificial Intelligence5 pages
- (Studies in Systems, Decision and Control, Volume 444) Samsul Ariffin Abdul Karim - Intelligent Systems Modeling and Simulation II. Machine Learning, Neural Networks, Efficient Numerical Algorithm AndNo ratings yet(Studies in Systems, Decision and Control, Volume 444) Samsul Ariffin Abdul Karim - Intelligent Systems Modeling and Simulation II. Machine Learning, Neural Networks, Efficient Numerical Algorithm And688 pages
- ICDSMLA 2023 Vol 1 Survey Paper(With Conference Title)No ratings yetICDSMLA 2023 Vol 1 Survey Paper(With Conference Title)28 pages
- Artificial Intelligence AI Applied in Civil EngineeringNo ratings yetArtificial Intelligence AI Applied in Civil Engineering700 pages
- Artificial Intelligence AI Applied in Civil Engineering 1714617671No ratings yetArtificial Intelligence AI Applied in Civil Engineering 171461767120 pages
- Artificial Intelligence of Things AIoT TechnologieNo ratings yetArtificial Intelligence of Things AIoT Technologie2 pages
- Computational Intelligence and Its Applications_ Evolutionary Computation, Fuzzy Logic, Neural Network and Support Vector Machine Techniques ( PDFDrive )No ratings yetComputational Intelligence and Its Applications_ Evolutionary Computation, Fuzzy Logic, Neural Network and Support Vector Machine Techniques ( PDFDrive )318 pages
- Deep Learning and Machine Learning AlgorithmsNo ratings yetDeep Learning and Machine Learning Algorithms10 pages
- Gocheva-Ilieva S. Statistical Data Modeling... Applications 2021No ratings yetGocheva-Ilieva S. Statistical Data Modeling... Applications 2021186 pages
- Dokumen - Pub - Applied Machine Learning For Smart Data Analysis 9780429440953 0429440952 97811383397980% (1)Dokumen - Pub - Applied Machine Learning For Smart Data Analysis 9780429440953 0429440952 9781138339798245 pages
- Data Science and Applications (Satyasai Jagannath Nanda, Rajendra Prasad Yadav Etc.) (Z-Library)No ratings yetData Science and Applications (Satyasai Jagannath Nanda, Rajendra Prasad Yadav Etc.) (Z-Library)546 pages
- Machine Learning For Antennas and Radar Signal ProcessingNo ratings yetMachine Learning For Antennas and Radar Signal Processing2 pages
- Cunha - 2023 - A Review of Machine Learning Methods Applied To STNo ratings yetCunha - 2023 - A Review of Machine Learning Methods Applied To ST40 pages
- Computational Methods and Data Engineering Proceedings of ICCMDE 2021 (Vijayan K. Asari, Vijendra Singh Etc.) (Z-Library)No ratings yetComputational Methods and Data Engineering Proceedings of ICCMDE 2021 (Vijayan K. Asari, Vijendra Singh Etc.) (Z-Library)563 pages
- (Ebook) Machine Learning in Action by Peter Harrington ISBN 9781617290183, 1617290181 download100% (1)(Ebook) Machine Learning in Action by Peter Harrington ISBN 9781617290183, 1617290181 download49 pages
- Proceedings of The International Conference On Intelligent Vision and Computing (ICIVC 2021)No ratings yetProceedings of The International Conference On Intelligent Vision and Computing (ICIVC 2021)592 pages
- S. No. Project Id Deep Learning Titles DomainNo ratings yetS. No. Project Id Deep Learning Titles Domain43 pages
- Big Data, Cloud Computing, and Data Science Engineering PDF100% (1)Big Data, Cloud Computing, and Data Science Engineering PDF222 pages
- Proceedings of The 2015 Chinese Intelligent Systems ConferenceNo ratings yetProceedings of The 2015 Chinese Intelligent Systems Conference650 pages
- MAJDANI SHABESTARI 2020 Automated Anomaly Recognition in Real TimeNo ratings yetMAJDANI SHABESTARI 2020 Automated Anomaly Recognition in Real Time181 pages
- Dan Zhang (Editor), Xuechao Duan (Editor) - Smart Sensors and Devices in Artificial Intelligence-Mdpi AG (2021)No ratings yetDan Zhang (Editor), Xuechao Duan (Editor) - Smart Sensors and Devices in Artificial Intelligence-Mdpi AG (2021)338 pages
- Data Science and Applications (Etc.) (Z-Library)No ratings yetData Science and Applications (Etc.) (Z-Library)569 pages
- Production Planning and Control in Semiconductor ManufacturingNo ratings yetProduction Planning and Control in Semiconductor Manufacturing106 pages
- Neural Networks, Machine Learning, and Image ProcessingNo ratings yetNeural Networks, Machine Learning, and Image Processing221 pages
- Applied Computational Intelligence and Soft Computing - 2020 - Kamsing - Deep Neural Learning Adaptive Sequential MonteNo ratings yetApplied Computational Intelligence and Soft Computing - 2020 - Kamsing - Deep Neural Learning Adaptive Sequential Monte9 pages
- Application of Artificial Intelligence in Power System Monitoring and Fault Diagnosis 1No ratings yetApplication of Artificial Intelligence in Power System Monitoring and Fault Diagnosis 1182 pages
- Data Science and Big Data An Environment of Computational Intelligence100% (4)Data Science and Big Data An Environment of Computational Intelligence303 pages
- Application of Machine Learning To Antenna KimNo ratings yetApplication of Machine Learning To Antenna Kim2 pages
- Integrating Machine Learning With Advanced Electronics For Next-Generation Smart SystemsNo ratings yetIntegrating Machine Learning With Advanced Electronics For Next-Generation Smart Systems13 pages
- Complete Download Data-Driven Science and Engineering Steven L. Brunton PDF All Chapters100% (1)Complete Download Data-Driven Science and Engineering Steven L. Brunton PDF All Chapters31 pages
- Advanced Machine Learning a Comprehensive Survey and New Research DirectionsNo ratings yetAdvanced Machine Learning a Comprehensive Survey and New Research Directions15 pages
- Luo2019-Big Data Analytics-Enabled Cyber-Physical SystemNo ratings yetLuo2019-Big Data Analytics-Enabled Cyber-Physical System17 pages
- (Ebook) Modeling and Simulation in Engineering, 2nd Edition by Camelia Petrescu Valeriu David ISBN 9783036582894, 3036582894 download pdf100% (7)(Ebook) Modeling and Simulation in Engineering, 2nd Edition by Camelia Petrescu Valeriu David ISBN 9783036582894, 3036582894 download pdf81 pages
- Data-Driven Science and Engineering Steven L. Brunton - Download the ebook today to explore every detail100% (1)Data-Driven Science and Engineering Steven L. Brunton - Download the ebook today to explore every detail76 pages
- (Ebook) Innovations in Machine and Deep Learning: Case Studies and Applications by Gilberto Rivera, Alejandro Rosete, Bernabé Dorronsoro, Nelson Rangel-Valdez, (eds.) ISBN 9783031406874, 3031406877 - The full ebook set is available with all chapters for download100% (2)(Ebook) Innovations in Machine and Deep Learning: Case Studies and Applications by Gilberto Rivera, Alejandro Rosete, Bernabé Dorronsoro, Nelson Rangel-Valdez, (eds.) ISBN 9783031406874, 3031406877 - The full ebook set is available with all chapters for download84 pages
- Deep learning in computational mechanics a reviewNo ratings yetDeep learning in computational mechanics a review51 pages
- How To Do Machine Learning With Small DataNo ratings yetHow To Do Machine Learning With Small Data22 pages
- A Review On The Emerging Technology of TinyMLNo ratings yetA Review On The Emerging Technology of TinyML37 pages
- Machine Learning For Complex And Unmanned Systems 1st Edition Esteban Tlelo-Cuautle - The complete ebook is available for download with one click100% (1)Machine Learning For Complex And Unmanned Systems 1st Edition Esteban Tlelo-Cuautle - The complete ebook is available for download with one click56 pages
- Journal of Computer Science Research - Vol.5, Iss.2 January 2023No ratings yetJournal of Computer Science Research - Vol.5, Iss.2 January 202382 pages
- Complete Download Innovations in Machine and Deep Learning Case Studies and Applications Gilberto Rivera PDF All Chapters100% (6)Complete Download Innovations in Machine and Deep Learning Case Studies and Applications Gilberto Rivera PDF All Chapters37 pages
- Bitnet: Scaling 1-Bit Transformers For Large Language ModelsNo ratings yetBitnet: Scaling 1-Bit Transformers For Large Language Models14 pages
- Correlated Optical Convolutional Neural Network With "Quantum Speedup"No ratings yetCorrelated Optical Convolutional Neural Network With "Quantum Speedup"27 pages
- How Banks Can Better Serve Their Customers Through Artificial TechniquesNo ratings yetHow Banks Can Better Serve Their Customers Through Artificial Techniques16 pages
- Z Score Estimation For Indian Banking Sector: Roli PradhanNo ratings yetZ Score Estimation For Indian Banking Sector: Roli Pradhan5 pages
- Surveying The Reach and Maturity of Machine Learning and Artificial Intelligence in AstronomyNo ratings yetSurveying The Reach and Maturity of Machine Learning and Artificial Intelligence in Astronomy40 pages
- Real World Textured Terrain Generation Using GANs 1No ratings yetReal World Textured Terrain Generation Using GANs 111 pages
- Novel_Transfer_Learning_Approach_for_Driver_Drowsiness_Detection_Using_Eye_Movement_BehaviorNo ratings yetNovel_Transfer_Learning_Approach_for_Driver_Drowsiness_Detection_Using_Eye_Movement_Behavior14 pages
- Convolutional_Neural_network_based_Online_Rail_surface_Crack_DetectionNo ratings yetConvolutional_Neural_network_based_Online_Rail_surface_Crack_Detection5 pages
- Artificial Neural Network Drilling Parameter Optimization System Improves ROP by PreNo ratings yetArtificial Neural Network Drilling Parameter Optimization System Improves ROP by Pre13 pages
- Neural Networks Applications in TextileNo ratings yetNeural Networks Applications in Textile34 pages
- A Survey On Requirements of Future IntelNo ratings yetA Survey On Requirements of Future Intel36 pages
- Computer Vision-Based Monitoring Method of Non-Wearing Helmet Events Using Face RecognitionNo ratings yetComputer Vision-Based Monitoring Method of Non-Wearing Helmet Events Using Face Recognition20 pages
- Artificial Intelligence in Mechanical Engineering: A Case Study On Vibration Analysis of Cracked Cantilever BeamNo ratings yetArtificial Intelligence in Mechanical Engineering: A Case Study On Vibration Analysis of Cracked Cantilever Beam4 pages
- Advancing Ai Across Insurance Final PDFNo ratings yetAdvancing Ai Across Insurance Final PDF40 pages
- Summary - Data Analytics& Machine LearningNo ratings yetSummary - Data Analytics& Machine Learning18 pages
- Zhang - Performance Prediction of PV ModulesNo ratings yetZhang - Performance Prediction of PV Modules14 pages
- Notre Dame University - Louaize EEN 489 Approved Professional TrainingNo ratings yetNotre Dame University - Louaize EEN 489 Approved Professional Training26 pages
- Electricity Price Forecasting On The Day-Ahead Market Using Machine LearningNo ratings yetElectricity Price Forecasting On The Day-Ahead Market Using Machine Learning17 pages
- Neural Network Based Closed Loop Speed Control of DC Motor Using Arduino Uno.No ratings yetNeural Network Based Closed Loop Speed Control of DC Motor Using Arduino Uno.4 pages
- 2024.Advances in Intelligent Data Analysis and Its Applications2024.Advances in Intelligent Data Analysis and Its Applications
- Esteban Tlelo-Cuautle, Jose Martinez-Carranza, Everardo Inzunza - Machine Learning For Complex and Unmanned Systems (2024, CRC Press) - Libgen - LiEsteban Tlelo-Cuautle, Jose Martinez-Carranza, Everardo Inzunza - Machine Learning For Complex and Unmanned Systems (2024, CRC Press) - Libgen - Li
- (Studies in Systems, Decision and Control, Volume 444) Samsul Ariffin Abdul Karim - Intelligent Systems Modeling and Simulation II. Machine Learning, Neural Networks, Efficient Numerical Algorithm And(Studies in Systems, Decision and Control, Volume 444) Samsul Ariffin Abdul Karim - Intelligent Systems Modeling and Simulation II. Machine Learning, Neural Networks, Efficient Numerical Algorithm And
- ICDSMLA 2023 Vol 1 Survey Paper(With Conference Title)ICDSMLA 2023 Vol 1 Survey Paper(With Conference Title)
- Artificial Intelligence AI Applied in Civil EngineeringArtificial Intelligence AI Applied in Civil Engineering
- Artificial Intelligence AI Applied in Civil Engineering 1714617671Artificial Intelligence AI Applied in Civil Engineering 1714617671
- Artificial Intelligence of Things AIoT TechnologieArtificial Intelligence of Things AIoT Technologie
- Computational Intelligence and Its Applications_ Evolutionary Computation, Fuzzy Logic, Neural Network and Support Vector Machine Techniques ( PDFDrive )Computational Intelligence and Its Applications_ Evolutionary Computation, Fuzzy Logic, Neural Network and Support Vector Machine Techniques ( PDFDrive )
- Gocheva-Ilieva S. Statistical Data Modeling... Applications 2021Gocheva-Ilieva S. Statistical Data Modeling... Applications 2021
- Dokumen - Pub - Applied Machine Learning For Smart Data Analysis 9780429440953 0429440952 9781138339798Dokumen - Pub - Applied Machine Learning For Smart Data Analysis 9780429440953 0429440952 9781138339798
- Data Science and Applications (Satyasai Jagannath Nanda, Rajendra Prasad Yadav Etc.) (Z-Library)Data Science and Applications (Satyasai Jagannath Nanda, Rajendra Prasad Yadav Etc.) (Z-Library)
- Machine Learning For Antennas and Radar Signal ProcessingMachine Learning For Antennas and Radar Signal Processing
- Cunha - 2023 - A Review of Machine Learning Methods Applied To STCunha - 2023 - A Review of Machine Learning Methods Applied To ST
- Computational Methods and Data Engineering Proceedings of ICCMDE 2021 (Vijayan K. Asari, Vijendra Singh Etc.) (Z-Library)Computational Methods and Data Engineering Proceedings of ICCMDE 2021 (Vijayan K. Asari, Vijendra Singh Etc.) (Z-Library)
- (Ebook) Machine Learning in Action by Peter Harrington ISBN 9781617290183, 1617290181 download(Ebook) Machine Learning in Action by Peter Harrington ISBN 9781617290183, 1617290181 download
- Proceedings of The International Conference On Intelligent Vision and Computing (ICIVC 2021)Proceedings of The International Conference On Intelligent Vision and Computing (ICIVC 2021)
- Big Data, Cloud Computing, and Data Science Engineering PDFBig Data, Cloud Computing, and Data Science Engineering PDF
- Proceedings of The 2015 Chinese Intelligent Systems ConferenceProceedings of The 2015 Chinese Intelligent Systems Conference
- MAJDANI SHABESTARI 2020 Automated Anomaly Recognition in Real TimeMAJDANI SHABESTARI 2020 Automated Anomaly Recognition in Real Time
- Dan Zhang (Editor), Xuechao Duan (Editor) - Smart Sensors and Devices in Artificial Intelligence-Mdpi AG (2021)Dan Zhang (Editor), Xuechao Duan (Editor) - Smart Sensors and Devices in Artificial Intelligence-Mdpi AG (2021)
- Production Planning and Control in Semiconductor ManufacturingProduction Planning and Control in Semiconductor Manufacturing
- Neural Networks, Machine Learning, and Image ProcessingNeural Networks, Machine Learning, and Image Processing
- Applied Computational Intelligence and Soft Computing - 2020 - Kamsing - Deep Neural Learning Adaptive Sequential MonteApplied Computational Intelligence and Soft Computing - 2020 - Kamsing - Deep Neural Learning Adaptive Sequential Monte
- Application of Artificial Intelligence in Power System Monitoring and Fault Diagnosis 1Application of Artificial Intelligence in Power System Monitoring and Fault Diagnosis 1
- Data Science and Big Data An Environment of Computational IntelligenceData Science and Big Data An Environment of Computational Intelligence
- Integrating Machine Learning With Advanced Electronics For Next-Generation Smart SystemsIntegrating Machine Learning With Advanced Electronics For Next-Generation Smart Systems
- Complete Download Data-Driven Science and Engineering Steven L. Brunton PDF All ChaptersComplete Download Data-Driven Science and Engineering Steven L. Brunton PDF All Chapters
- Advanced Machine Learning a Comprehensive Survey and New Research DirectionsAdvanced Machine Learning a Comprehensive Survey and New Research Directions
- Luo2019-Big Data Analytics-Enabled Cyber-Physical SystemLuo2019-Big Data Analytics-Enabled Cyber-Physical System
- (Ebook) Modeling and Simulation in Engineering, 2nd Edition by Camelia Petrescu Valeriu David ISBN 9783036582894, 3036582894 download pdf(Ebook) Modeling and Simulation in Engineering, 2nd Edition by Camelia Petrescu Valeriu David ISBN 9783036582894, 3036582894 download pdf
- Data-Driven Science and Engineering Steven L. Brunton - Download the ebook today to explore every detailData-Driven Science and Engineering Steven L. Brunton - Download the ebook today to explore every detail
- (Ebook) Innovations in Machine and Deep Learning: Case Studies and Applications by Gilberto Rivera, Alejandro Rosete, Bernabé Dorronsoro, Nelson Rangel-Valdez, (eds.) ISBN 9783031406874, 3031406877 - The full ebook set is available with all chapters for download(Ebook) Innovations in Machine and Deep Learning: Case Studies and Applications by Gilberto Rivera, Alejandro Rosete, Bernabé Dorronsoro, Nelson Rangel-Valdez, (eds.) ISBN 9783031406874, 3031406877 - The full ebook set is available with all chapters for download
- Machine Learning For Complex And Unmanned Systems 1st Edition Esteban Tlelo-Cuautle - The complete ebook is available for download with one clickMachine Learning For Complex And Unmanned Systems 1st Edition Esteban Tlelo-Cuautle - The complete ebook is available for download with one click
- Journal of Computer Science Research - Vol.5, Iss.2 January 2023Journal of Computer Science Research - Vol.5, Iss.2 January 2023
- Complete Download Innovations in Machine and Deep Learning Case Studies and Applications Gilberto Rivera PDF All ChaptersComplete Download Innovations in Machine and Deep Learning Case Studies and Applications Gilberto Rivera PDF All Chapters
- Bitnet: Scaling 1-Bit Transformers For Large Language ModelsBitnet: Scaling 1-Bit Transformers For Large Language Models
- Correlated Optical Convolutional Neural Network With "Quantum Speedup"Correlated Optical Convolutional Neural Network With "Quantum Speedup"
- How Banks Can Better Serve Their Customers Through Artificial TechniquesHow Banks Can Better Serve Their Customers Through Artificial Techniques
- Z Score Estimation For Indian Banking Sector: Roli PradhanZ Score Estimation For Indian Banking Sector: Roli Pradhan
- Surveying The Reach and Maturity of Machine Learning and Artificial Intelligence in AstronomySurveying The Reach and Maturity of Machine Learning and Artificial Intelligence in Astronomy
- Real World Textured Terrain Generation Using GANs 1Real World Textured Terrain Generation Using GANs 1
- Novel_Transfer_Learning_Approach_for_Driver_Drowsiness_Detection_Using_Eye_Movement_BehaviorNovel_Transfer_Learning_Approach_for_Driver_Drowsiness_Detection_Using_Eye_Movement_Behavior
- Convolutional_Neural_network_based_Online_Rail_surface_Crack_DetectionConvolutional_Neural_network_based_Online_Rail_surface_Crack_Detection
- Artificial Neural Network Drilling Parameter Optimization System Improves ROP by PreArtificial Neural Network Drilling Parameter Optimization System Improves ROP by Pre
- Computer Vision-Based Monitoring Method of Non-Wearing Helmet Events Using Face RecognitionComputer Vision-Based Monitoring Method of Non-Wearing Helmet Events Using Face Recognition
- Artificial Intelligence in Mechanical Engineering: A Case Study On Vibration Analysis of Cracked Cantilever BeamArtificial Intelligence in Mechanical Engineering: A Case Study On Vibration Analysis of Cracked Cantilever Beam
- Notre Dame University - Louaize EEN 489 Approved Professional TrainingNotre Dame University - Louaize EEN 489 Approved Professional Training
- Electricity Price Forecasting On The Day-Ahead Market Using Machine LearningElectricity Price Forecasting On The Day-Ahead Market Using Machine Learning
- Neural Network Based Closed Loop Speed Control of DC Motor Using Arduino Uno.Neural Network Based Closed Loop Speed Control of DC Motor Using Arduino Uno.