Composites: Part A 152 (2022) 106672

Contents lists available at ScienceDirect

Composites Part A
journal homepage: www.elsevier.com/locate/compositesa

Graphene Oxide-loaded magnetic nanoparticles within 3D hydrogel form

High-performance scaffolds for bone regeneration and tumour treatment
Yan Li a, 1, Lijing Huang b, 1, Guangpin Tai c, Feifei Yan d, *, Lin Cai d, *, Chenxing Xin a,
Shamoon Al Islam a
a
Gemmological Institute, China University of Geosciences, Wuhan 430074, PR China
b
National Engineering Research Center of Novel Equipment for Polymer Processing, The Key Laboratory of Polymer Processing Engineering of Ministry of Education,
South China University of Technology, Guangzhou 510640, PR China
c
Key Lab of Biofabrication of AnHui Higher Education Institution, Centre for Advanced Biofabrication, Hefei University, Hefei 230601, PR China
d
Department of Spine Surgery and Musculoskeletal Tumor, Zhongnan Hospital of Wuhan University, Wuhan, PR China

A R T I C L E I N F O A B S T R A C T

Keywords: The treatment of tumour-related bone defects should ideally combine bone regeneration with tumour treatment.
Graphene Additive manufacturing (AM) could feasibly place functional bone-repair materials within composite materials
Microstructural analysis with functional-grade structures, giving them bone repair and anti-tumour effects. Magnetothermal therapy is a
Thermal properties
promising non-invasive method of tumour treatment that has attracted increasing attention. In this study, we
3-D printing
prepared novel hydrogel composite scaffolds of polyvinyl alcohol/sodium alginate/hydroxyapatite (PVA/SA/
HA) at low temperature via AM. The scaffolds were loaded with various concentrations of magnetic graphene
oxide (MGO) @Fe3O4 nanoparticles. The scaffolds were characterised by fourier transform infrared spectroscopy
(FTIR), scanning electron microscope (SEM) and thermal gravimetric analysis (TGA), which showed that the
scaffolds have good moulding qualities and strong hydrogen bonding between the MGO/PVA/SA/HA compo­
nents. TGA analysis demonstrated the expected thermal stability of the MGO and scaffolds. Thermal effects can
be adjusted by varying the contents of MGO and the strength of an external alternating magnetic field. The
prepared MGO hydrogel composite scaffolds enhance biological functions and support bone mesenchymal stem
cell differentiation in vitro. The scaffolds also show favourable anti-tumour characteristics with effective mag­
netothermal conversion in vivo.

1. Introduction implant acceptance, and overall bio-functionality [5-7]. What’s more,

3D printing can be used to produce biomimetic structures based on a
To repair bone defects caused by tumours, it is necessary to promote computed tomographic image obtained from a patient’s damaged or
bone regeneration and prevent the recurrence of residual tumours [1,2]. injured body organ and shifting these data to a computer-aided-design
Over the past two decades, additive manufacturing (AM) and three- (CAD), which directs the production of a patient-specific customized
dimensional (3D) printing technology has been developed and widely structure with the desired shape and size [8,9], such as ear cartilage
investigated in biomedical engineering and tissue regeneration [3,4], reconstruction [10,11], skeletal muscle [10], and even three-layered
especially in artificial bone tissue that can be used for bone regeneration tubular nerve conduit structure [12]. It can create novel bone tissue
and tumour treatment [1-3]. In addition to the type of materials, the engineering scaffolds with customized shape, architecture, favorable
three-dimensional (3D) architectures of the scaffold play a critical role macro–micro structure, wettability, mechanical strength, and cellular
in defining scaffold responses, especially shape, porosity. From a bio­ responses. For example, a patient’s damaged or injured body organ can
logical perspective, appropriate or certain pores can provide structural be shifted these data to CAD, which can be used to produce biomimetic
support for cells, exchange of nutrients and wastes, and cell migration, structures by 3D printing [13]. Besides, the bone designs and optimi­
which was demonstrated to be critical for adequate tissue integration, zation of 3D-printed bone scaffolds have been researched [14,15]. It is

* Corresponding authors.
E-mail addresses: [email protected] (F. Yan), [email protected] (L. Cai).
1
These authors contributed equally: Yan Li and Lijing Huang.

https://doi.org/10.1016/j.compositesa.2021.106672
Received 27 June 2021; Received in revised form 7 September 2021; Accepted 4 October 2021
Available online 8 October 2021
1359-835X/© 2021 Elsevier Ltd. All rights reserved.
Y. Li et al. Composites Part A 152 (2022) 106672

Fig. 1. Schematic diagrams of MGO hydrogel composite fabrication (above) and application to bone tumour defect regeneration in vitro and in vivo (below).

undeniable that 3D printing provides significant possibilities and op­ possible to control and regulate the functions of cells under external
portunities for the research of biological scaffolds. magnetic field conditions [36-38]. Graphene-based macrostructures
Recently, bioresorbable materials made with 3D printing technology show great potential for applications in bioengineering and material
have been investigated for use as biomedical artificial materials. Such sciences and as a novel antibacterial agent for damaging bacterial
materials do not require surgical removal, provide an appropriate membranes [39-41]. Iron oxide NPs are compounded in graphene-based
environment for cell survival and enhance cell proliferation, unlike macrostructures to introduce magnetic properties and to increase heat
metal implants [16,17]. Sodium alginate (SA) is a natural biopolymer conductivity [10,42]. Yang et al. [42] prepared macro-/meso-porous 3D
hydrogel that has recently been implemented for 3D bioprinting due to magnetic graphene by compounding Fe3O4 NPs and graphene oxide
its inherent biocompatibility, high water content and molecular struc­ (GO) in phenolic hydroxyl groups for charge- and size-selective dye
ture, which is similar to that of the natural extracellular matrix [3,11,18- removal applications. Although the magnetic graphene oxide (MGO) has
20]. Representative polymer materials that are supported and approved been used to fabricate the scaffold and enhance the differentiation of
for clinical use include polyvinyl alcohol (PVA), polylactide (PLA) and hepatocytes and bile duct cells, it is still at the stage of cell culture in
its copolymer poly(lactic-co-glycolic acid) (PLGA) [21-23]. PVA vitro of the scaffolds with MGO in literature [43,44].
hydrogels are excellent water-soluble polar polymers that are suitable In this study, MGO was combined with PVA/SA/HA hydrogel com­
for biomedical and pharmaceutical applications because of their bio- posite scaffolds to prepare a novel printing slurry for applications in the
adhesive, non-carcinogenic and non-toxic characteristics [24]. PVA treatment of bone tumour defects. The innovative feature of this work
hydrogels also show very high swelling on contact with water and a lies in the utilisation of 3D-printed composite scaffolds to simulta­
rubbery texture and, hence, they closely simulate natural body tissue neously promote bone repair and kill residual tumours. PVA and HA
[25,26]. However, artificial bone tissues made of a single material are were incorporated into an SA suspension to increase the viscosity of the
inadequate due to their respective shortcomings, for example, inflam­ hydrogel slurry while simultaneously increasing the biocompatibility,
matory or allergic reactions, poor strength and low bioactivity [27,28]. osteoinductivity and osteoconductivity of the printed scaffold. Addi­
Kim et al. [29] balanced the physical and biological factors relevant to tionally, MGO was incorporated into an alginate hydrogel and 3D
bone implants by fabricating gelatin/PVA scaffolds via a low- printed to increase the ability of the scaffolds to promote bone regen­
temperature 3D printing process. Nano-hydroxyapatite (HA), one of eration and to confer a good magnetothermal property for bone tumour
the major components of human bone, makes implants more osteo­ treatment.
conductive, thus improving tissue compatibility [30]. Besides, HA par­
ticles can improve the mechanical strength properties of hydrogel 2. Materials and methods
composites [25,27]. The PVA/SA/HA hydrogels could gradually the
degraded in PBS solution, and HA nanocrystals are easily formed on the 2.1. Materials
surface which is beneficial for the differentiation growth of chon­
drocytes [31]. Graphene oxide was provided by ZhiYang Technologies Co. Ltd,
Recently, the application of thermal effects to tumour cell killing has China. Polyvinyl alcohol (MW = 89,000–98,000) was purchased from
attracted increasing attention. Graphene-based photothermal agents Kuraray China Co. Ltd. Ferrous chloride tetrahydrate (FeCl2⋅4H2O, 98%;
exhibit good photothermal conversion efficiency, but the limited light- Sinopharm Chemical Reagent Co. Ltd, China), ferric chloride hexahy­
penetration depth of photothermal therapy restricts the treatment of drate (FeCl3⋅6H2O, 98%; Sinopharm), deionised water, and ammonium
some tumours in deep positions, such as in bones [32,33]. Super­ hydroxide (NH3⋅H2O, 25%; Sinopharm) were used to fabricate Fe3O4
paramagnetic Fe3O4 nanoparticles (NPs) show an incredible heating nanoparticles. Hydroxyapatite was provided by Hubei Lianjie Co. Ltd,
effect in deep tumours when exposed to a high-frequency alternating China. Sodium alginate (MW = 32,000–250,000; Sinopharm) and cal­
magnetic field. This heating effect is due to losses of energy during cium chloride (CaCl2, 96.0%; Sinopharm) were employed to fabricate
magnetisation and demagnetisation. Heat is generated either through the hydrogel. Sodium chloride (NaCl, 98%; Sinopharm) and disodium
Néel relaxation, in which rapid changes in the direction of magnetic hydrogen phosphate (Na2HPO4, 98%; Sinopharm) were used to adjust
moments is hindered by anisotropic energy, or through Brown relaxa­ solution pH.
tion, in which the physical rotation of magnetic NPs in a suspended
medium is hindered by the viscosity of that medium [34,35]. Magnetic
nano-iron particles retain their biological activity as nanoscale materials 2.2. Preparation and characterisation of the GO/Fe3O4 nanoframework
and have a strong ability to couple with cell surfaces, which makes it
Conventionally and widely used chemical synthesis methods were

2
Y. Li et al. Composites Part A 152 (2022) 106672

used to fabricate the MGO nanoframework composites. 1 g graphene was used to determine the presence of specific chemical structure of the
oxide powder was dispersed ultrasonically in 100 mL deionised water. MGO and hydrogel composite in the frequency range of 400–4000 cm− 1.
16 g FeCl3⋅6H2O and FeCl2⋅4H2O were mixed at a molar ratio of nFeCl3:
nFeCl2 = 2:1 in deionised water under a stream of N2. This reaction 2.4.4. X-ray diffraction spectra of different MGO contents
continued at 80 ◦ C with magnetic stirring until the solids were X-ray diffraction (XRD) spectra were obtained using an X-ray
completely dissolved. Then, the GO suspension was mixed into the so­ diffractometer (D8-FOCUS X, Bruker AXS D8-Focus, Germany) with Cu-
lution from the previous step and reacted for 30 min at 80 ◦ C until a Kα radiation (incident light wavelength λ = 0.15418 nm). Fe3O4, GO and
dark-brown precipitate was obtained. To ensure MGO’s purity, centri­ MGO were qualitatively evaluated by XRD spectra with phase analysis at
fugation was carried out multiple times with anhydrous ethanol and a scanning rate of 10.0◦ /min. Data collection was performed in the
distilled water respectively, then dried in a vacuum for 12 h. Then the range of 2θ = 10.0–70. 0◦ .
MGO particles were separated by the magnetic field.
2.4.5. Thermal gravimetric analysis
2.3. Preparation of the hydrogel composite via slurry extrusion The thermal properties of the hydrogel composites were obtained by
thermal gravimetric analysis (TGA; STA-449C, Netzsch, Germany) using
To prepare hydrogel scaffolds, different contents of MGO nano­ a heating speed of 10 ◦ C/min from room temperature to 600 ◦ C under
composites were suspended in 10.0 mL of deionised water by ultrasonic N2.
vibration for 5 min to form a uniform MGO/water suspension. To pre­
pare the alginate-PVA composites, 1.5 wt.% Na2HPO4 sodium alginate 2.4.6. Magnetic property measurement
was added to 5 wt.% PVA solution until there were no alginate clumps The magnetic properties of the hydrogel composites with different
left. The solution was further mixed with 5 wt.% HA and different amounts of MGO were measured under various applied magnetic fields
contents of MGO/water suspension (referred to as MGO/PVA/SA/HA by a magnetic property measurement system (PPMS, SQUID-VSM,
hereafter), then kept in a water bath at 80 ◦ C for 30 min. After that, the Quantum Design Company, USA). The hysteresis of the magnetisation
liquid was transferred to the extrusion nozzle of the 3D-printing ma­ was acquired by varying the applied magnetic field between − 20,000
chine (3D Discovery, regenHU, Switzerland) (Fig. 1). The 3D printer and 20,000 Oe at 300 K.
used “a 3D honeycomb”, a porous prototype with 3D interconnectivity
[45]. We restricted our work to a single computer aided design (CAD) 2.4.7. Evaluation of the magnetothermal properties
design with printing parameters as follows: road width of 0.51 mm; road For evaluation of the magnetothermal properties of the hydrogel
gap of 1.50 mm; slice thickness of 0.40 mm; lay-down pattern 0/90◦ ; composites, an alternating magnetic field was used. The magneto­
nozzle tip 0.51 mm; mould size 16.0 mm × 16.0 mm × 4.0 mm. The thermal effects of the hydrogel composites were evaluated at 200 GS,
printed MGO/PVA/SA/HA hydrogel scaffold was then immersed in 250 GS and 300 GS (48 kHz) in dry and wet states. The temperature of
CaCl2 solution for cross-linking. After that, the cross-linked samples the samples with different MGO contents was monitored by an infrared
were washed with distilled water and then dried. thermal imaging system (FLIR system, C2, Teledyne FLIR Company,
USA) in real-time.
2.4. Characterisation of MGO scaffolds
2.5. In vitro osteogenic activity of rat bone marrow stem cells in the
2.4.1. Scanning electron microscopy and element mapping hydrogel composite
The surface morphologies and elemental distribution of MGO/PVA/
SA/HA scaffolds were observed by scanning electron microscopy (SEM; 2.5.1. Purification of rat bone marrow stem cells
SU8220, Hitachi, Japan) equipped with an energy dispersive spec­ Bone mesenchymal stem cells (BMSCs) were obtained from the
trometer (EDS). A drop of obtained dispersion was added onto sample bilateral humeri and femurs of a female Sprague Dawley (SD) rat (n = 1;
stages and dried at room temperature for SEM. The dry scaffold sample 2-weeks old) by rinsing the bone marrow cavity as described in previous
was cut into small and mounted on sample stages with double sided studies [46,47]. Cells were cultured in Dulbecco’s Modified Eagle’s
adhesive carbon tape. The samples were subsequently sputter-coated Medium (DMEM, Gibco, USA) containing 10% foetal bovine serum (FBS,
with gold, to allow SEM imaging at an acceleration voltage of 10 kV. Gibco) at 37 ◦ C with 5% CO2.

2.4.2. Transmission electron microscopy 2.5.2. Preparation of hydrogel composite extracts

For GO and MGO particles, the samples were dispersed by anhydrous Hydrogel composite extracts were prepared to test BMSCs in vitro for
ethanol for 5 mins. A drop of obtained dispersion was put onto a carbon- their osteogenic properties. Briefly, sterilised hydrogel composite and
coated copper grid and dried at room temperature for transmission MGO hydrogel composite scaffolds were added into a Minimum Essen­
electron microscopy (TEM; TF20-2100F, JEOL, Japan) observation. tial Medium (MEM) α at a concentration of 200 mg/mL according to
Conventionally and widely used chemical synthesis methods were ISO/EN 10993–5 standards and incubated at 37 ◦ C for 24 h. After that,
used to fabricate the MGO nanoframework composites. 1 g GO powder the material extracts were obtained by centrifugation and filtration.
was dispersed ultrasonically in 100 mL deionised water. 16 g
FeCl3⋅6H2O and FeCl2⋅4H2O were mixed at a molar ratio of nFeCl3:nFeCl2 2.5.3. In vitro BMSC proliferation assay
= 2:1 in deionised water under a stream of N2. This reaction continued at To test the cell viability, BMSCs were seeded at 8 × 103 cells per well
80 ◦ C with magnetic stirring until the solids were completely dissolved. in 200 μL of culture medium in a 96-well tissue culture plate for 24 h at
Then, the GO suspension was mixed into the solution from the previous 37 ◦ C in a 5% CO2 atmosphere. The medium was then replaced with the
step and reacted for 30 min at 80 ◦ C until a dark-brown precipitate was composite extracts and 15% FBS, 1% penicillin (Gibco) and 1% strep­
obtained. To ensure MGO’s purity, centrifugation was carried out mul­ tomycin (Gibco). Normal α-MEM was used in the control group. After
tiple times with anhydrous ethanol and distilled water respectively, then incubation at 5% CO2 at 37 ◦ C for 1 and 3 days, cells were assessed using
dried in a vacuum for 12 h. The MGO was dispersed in the deionised a Cell counting kit-8 (CCK-8, Dojindo, Japan). All experiments were
water, then TEM (TF20-2100F, JEOL, Japan) was used to observe the performed in triplicate.
coating of Fe3O4 nanoparticles on the GO surface.
2.5.4. In vitro BMSC mineralisation
2.4.3. Fourier transform infrared spectroscopy Osteoblastic mineralisation was determined using alkaline phos­
Fourier transform infrared spectroscopy (FTIR; Nicolet IS50, USA) phatase (ALP) staining and Alizarin Red staining. The rBMSCs cells were

3
Y. Li et al. Composites Part A 152 (2022) 106672

Table 1 the qPCR results using CFX Manager Software (Bio-Rad, USA) with
Primers used in the RT-PCR. GAPDH as the reference gene.
Gene Primer sequence (F, forward; R, reverse; 5′ -3′ ) Product Size
(bp) 2.6. Anti-tumour efficiency of the MGO hydrogel composite in vivo
GAPDH F: CGCCTGGAGAAAGCTGCTA 104
R: ACGACCTGGTCCTCGGTGTA This study was approved by the Animal Ethics Committee of the
OCN F: CATGAGGGCCCTCACTCTTG 292 Animal Experiment Centre of Wuhan University. Eight Balb/c nude mice
R: GTAGAAGCGCTGGTAGGCGT (4–6 weeks old from the Wanqian Jiaxing Bio-Technology Co., Ltd.,
RUNX2 F: TGCCACTTCTGACTTCTGCCT 239
R: GTGGCAGGTAGGTATGGTAGTGG
Wuhan, China) were used in this study. The mice received a subcu­
ALP F: CCCAAACCTTTCATAATCCCA 275 taneous injection of metastatic human 143B osteosarcoma cells (1 × 107
R: CCGACAATGCCACTTCCAC cells). When the diameter of the tumour reached approximately 8 mm:
OPN F: AAACCCTGACCCATCTCAGAAG 190 (i) 15% w/w MGO hydrogel composite was implanted in the centre of
R: ATCGTCGGATTCATTGGAGTC
the tumour tissue; (ii) Balb/c nude mice were divided into two groups
with or without an alternating magnetic field (AMF) intervention (n = 4,
cultured in hydrogel composite extracts for 3 days and then the medium per group). The intensity of the AMF was calibrated and measured by a
replaced with mesenchymal stem cell osteogenic differentiation medium CH-3600 high-precision 3D Gaussian meter (CH-Magnetoelectricity
(ScienCell Research Laboratories, USA). After 7 days, the cells were Technology Co., Ltd., China). For the AMF treatment, the mice were put
stained with an ALP kit from Beyotime (China). Alizarin red S (ARS) in the centre of tumour (intensity = 300 Gs) for 10 mins every day under
staining was performed after incubation for 21 days. inhalation anaesthesia and monitored via the FLIR thermal imaging
system. Every other day, the tumour volume was measured with a ver­
2.5.5. In vitro BMSC osteogenesis-related gene expression nier calliper according to the equation: volume (mm3) = (length ×
To examine osteogenesis-related gene expressions, BMSCs at a width2)/2. On day 14, the mice were sacrificed and photographed.
seeding density of 1 × 105 cells/well were plated in 24-well plates. After
24 h, the culture medium was replaced by control, hydrogel composite, 2.7. Statistical analysis
and 15% w/w MGO hydrogel composite extracts, respectively. After
culturing for 3 and 7 days, the gene expressions of Runx2, OPN, OCN and Statistical analysis was performed by two-way ANOVA (p < 0.05).
BMP-2 were analysed by real-time quantitative polymerase chain reac­ Post hoc analysis using the Tukey method was applied to determine
tion (RT-qPCR) (Table 1). Total RNA was extracted using an EASY Spin multiple comparisons (GraphPad Prism 7.02, USA). Differences were
Tissue/Cell RNA Rapid Extraction Kit (Aidlab, USA). The expression of considered statistically significant at p < 0.05.
osteogenic markers was quantified using the One Step TB Green Pri­
meScript RT-PCR Kit II (TaKaRa, Japan). GAPDH served as an internal
reference. The comparative threshold cycle method was used to analyse

Fig. 2. Morphological features of MGO and MGO hydrogel composite scaffolds (A) TEM of GO; (B) TEM of MGO; (C–D) photographs of the 3D-printed MGO scaffold;
(E–G) SEM of MGO scaffold; (H–J) element mapping of Ca, C and Fe on the surface of an MGO scaffold.

4
Y. Li et al. Composites Part A 152 (2022) 106672

Fig. 3. (A) FTIR spectra and (C) XRD patterns of GO, Fe3O4 and GO@Fe3O4; (B) FTIR of each component of the composite materials; (D) XRD, (E) TGA and (G)
hysteresis curves of composite scaffolds with different MGO contents.

3. Results and discussion fabricated the 3D printed cartilage tissue with SA/COL with favorable
mechanical strength, the scaffold has been printed as the dimension of
3.1. Morphological features of MGO and hydrogel composite scaffolds 20 mm × 20 mm × 0.5 mm. In this work, the MGO/PVA/SA/HA scaf­
folds were printed with the “a 3D honeycomb” mold size 16.0 mm ×
The morphologies of the GO and MGO were explored using SEM and 16.0 mm × 4.0 mm. Initially, the MGO/PVA/SA/HA slurry was pre­
TEM micrographs. After ultrasonic dispersion of samples, a representa­ pared and HA crystals within the hydrogels can be served as the initial
tive GO SEM image (Fig. 2A) shows the typical single-layer flakes with sites to form nano-HA crystals and crosslinked structure of SA and PVA,
curled edges and some wrinkles. In Fig. 2B, dark spots can be observed which maintain the crosslinking and curing of the gel. HA crystals could
in the TEM image, which are Fe3O4 nanocomposites evenly distributed be incorporated into the PVA hydrogel to strengthen its compressive
over the GO-layered surfaces. This reveals that Fe3O4 nanocomposites mechanical properties [31]. After 3D printing, the scaffolds were soaked
were successfully loaded onto the GO sheets. Consequently, a magnetic a few times in CaCl2 to improve the mechanism of scaffolds. Underex­
property was conferred to the composites and this process can be used to posure to divalent cations such as Ca2+, alginate undergoes rapid and
avoid aggregation of GO and to collect and separate the composites vigorous gelation by chemical cross-linking, whereby the polymer
[48,49]. A general view of the dark-brown MGO scaffold can be seen in chains form a structure wrapping MGO particles. It was not easy to
Fig. 2C–D. It is still a challenge to improve the thickness of printed collapse that the MGO had not been exposed on the surface. According
scaffolds in the current literature. By blending the thermoresponsive to the detailed observation of the SEM images (Fig. 2E–G) and elemental
polymer poly(N-isopropyl acrylamide) and a photocrosslinkable mapping analyses (Fig. 2H–J), the MGO scaffold had good porosity with
biopolymer, Matti et al. [50] were able to produce scaffolds with a a pore size of about 300 μm, which is conducive to the growth of cells
diameter of 10 mm and a height of 2.8 mm. Izadifar et al. [51] fabricated and nutrient transportation [10]. The surface of the scaffold with MGO
the 3D hybrid constructs of PCL and cell-impregnated alginate hydrogel enhanced the cell adhesion, probably due to the anionic functional
with 6 consecutive layers at a thickness of 1.5–2.35 mm. Yang et al. [52] groups from the MGO, such as –COOH or –OH [10,53]. In addition, the

5
Y. Li et al. Composites Part A 152 (2022) 106672

Fig. 4. The magnetothermal conversion effect of MGO magnetic scaffolds in an AMF in vitro. Curves of temperature over time corresponding to MGO hydrogel
composites with different contents of MGO in a 250-Gs AMF in the dry state (A) and in phosphate-buffered saline (PBS, B). Curves of temperature over time cor­
responding to 15% w/w MGO composite under various AMF intensities in the dry state (C) and in PBS (D). Time-dependent infrared thermography of the 15% w/w
MGO hydrogel composite in dry and wet environments under an AMF of 250 Gs (E).

elemental mapping shows that MGO diffused into the PVA/SA/HA vibration of the Fe–O band in Fe3O4 at 568 cm− 1. PVA/SA/HA hydrogel
hydrogel composite scaffolds. composites and MGO/PVA/SA/HA hydrogel composites were processed
by refrigeration and dehydration, respectively. As shown in Fig. 3B,
3.2. Characteristics of the MGO and hydrogel composite scaffolds there is a hydroxyl (–OH) telescopic vibration at 3452 cm− 1, a tele­
scopic vibration peak at 2928 cm− 1, and a peak produced by an asym­
The crystal structures of Fe3O4 nanocomposites, GO and MGO were metric telescopic vibration at 1035 cm− 1, which corresponds to PVA.
also observed by FTIR and XRD. FTIR spectroscopy was used to confirm The 1628 cm− 1 and 1419 cm− 1 peaks were caused by a –COO– sym­
the functionalisation and to explore the interaction between Fe3O4, GO metric telescopic vibration and an asymmetric telescopic vibration of
and MGO. The MGO spectrum (Fig. 3A) shows the oxygen functional­ SA. FTIR spectra of the MGO/PVA/SA/HA hydrogel composites show
ities of GO. The absorption peaks at 1110, 1650 and 3440 cm− 1 were that the –OH telescopic vibration peak of PVA is widened and shifts to
assigned to the stretching vibrations of carbonyl (C– – O) and carboxyl 3419 cm− 1 at low frequencies, indicating that the addition of MGO can
group (–COOH), and the symmetrical stretching vibration of the hy­ form a strong hydrogen bond with PVA and SA.
droxyl group (–OH) respectively. Therefore, it can be concluded that The XRD results indicate that the crystalline HA and MGO can be
the functional groups (–OH, –COOH and C– – O) were contained within stably loaded onto 3D-printed scaffolds (Fig. 3C–D). Thermogravimetric
the GO. This makes it able to combine with polar molecules to form analysis was used to investigate the thermal stability of the composite
hydrogen bonds, thus giving it good solubility and dispensability in materials of the various scaffolds (Fig. 3E). The first instance of weight
polar solutions. By comparing the FTIR spectra of GO, Fe3O4 and MGO, loss happened below 200 ◦ C, which was due to the evaporative loss of
the MGO exhibits a characteristic peak consistent with the stretching the physically adsorbed water. A sharp decrease of 85% occurred at

6
Y. Li et al. Composites Part A 152 (2022) 106672

Fig. 5. BMSC osteogenesis of the MGO hydrogel composite in vitro. (A) ALP staining and Alizarin Red staining; (B) proliferation of rat BMSCs under the treatment of
extract composites with 15% FBS, 1% penicillin (Gibco) and 1% streptomycin (Gibco). (C–F) Osteogenesis-related gene expression: BMP-2, OCN, OPN and Runx-2.
(For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Fig. 6. Inhibition of osteosarcoma tumour growth in vivo. (A) In vivo infrared thermography of 143b-tumour-bearing nude mice after intratumorally implantation
with MGO hydrogel composite under AMF at various time points. (B) Temperature versus time at the tumour sites implanted with MGO hydrogel composite with and
without AMF. (C) Digital photographs of the dissected tumours. (D) Relative tumour volume changes over time after the different treatments.

7
Y. Li et al. Composites Part A 152 (2022) 106672

around 200–300 ◦ C was due to the pyrolysis of the functional groups of Infrared thermography with a FLIR system can safely monitor the
PVA. A third region at 300–600 ◦ C appears to be caused by the radiant temperature field of a tumour from its centre to the surroundings
decomposition of the SA skeleton. The addition of MGO improved the (Fig. 6A–B). The closer to the centre of the scaffold, the higher the
thermal stability, which may also be due to the layered structure of GO temperature, and the surrounding temperature gradually decreases.
preventing the diffusion of small molecules [10,42,54]. Intratumorally implantation with MGO hydrogel composite and treat­
The magnetic character of the MGO hydrogel composites was ment with AMF for 14 consecutive days successfully inhibited the
determined at room temperature using a magnetic property measure­ tumour growth (Fig. 6C–D). In contrast, the MGO hydrogel composite
ment system (PPMS). The magnetisation hysteresis loops appeared S- group without AMF exhibited no obvious tumour-inhibition effects. The
shaped (Fig. 3F). The hysteresis of each component of the composite rising temperature could reverse the ratio of early and late apoptosis
material plotted as a fine “S” curve, with zero residual magnetism, all of because the significant cytotoxicity observed at 43 ◦ C was mainly due to
which indicate ultra-smooth magnetic phenomena. The addition of late apoptosis, while the cytotoxicity at 55 ◦ C was largely attributed to
MGO gave the hydrogel composite material magnetic properties, which both necrosis and late apoptosis. It has been reported that hyperthermia
means that the printed scaffolds respond to an external magnetic field. (55 ◦ C) can potentially induce inflammation and cancer metastasis
With increasing MGO contents, the magnetic energy of the composite through a direct necrosis cell death process [57,59]. Therefore, a
materials became stronger and more obvious. Some studies have treatment temperature of about 43 ◦ C is preferred for cancer therapy and
improved the magnetothermal conversion efficiency of nanoparticles by can be achieved by controlling the magnetic strength of the implant
changing the mesocrystalline structure of Fe3O4, resulting in an enlarged material and the strength of the AMF.
hysteresis loop and an increased ratio of Fe2+/Fe3+ [55,56].
4. Conclusions
3.3. Thermal properties of the MGO hydrogel composite
A novel PVA/SA/HA hydrogel formulation was prepared by 3D
Given the magnetic properties of the scaffolds with different MGO printing and its properties were optimised by varying the concentrations
contents, the magnetothermal conversion ability of the MGO hydrogel of MGO. Fe3O4 particles were evenly distributed on the surface of GO
composite was studied in further detail. As shown in Fig. 4, the MGO and no obvious reunion phenomenon was observed. In vitro, the pre­
hydrogel composite exhibited both a time-dependent heating behaviour pared MGO hydrogel composite scaffolds have enhanced physical and
with the varying MGO concentrations and an alternating magnetic field effective magnetothermal conversion efficiency. They not only support
(AMF) intensity. When the AMF intensity remains the same, the tem­ rat BMSC differentiation in vitro but can also provide favourable anti-
peratures were obviously increased with the increasing MGO concen­ tumour effects in vivo. The scaffold’s good biological function pro­
tration (Fig. 4A–B). To better simulate the human environment, we vides the potential for clinical treatment.
compared the scaffold heating effects in dry and humid environments.
The maximum temperatures of the 5%, 10% and 15% w/w MGO CRediT authorship contribution statement
hydrogel composites reached > 45 ◦ C in the dry environment (Fig. 4A).
However, in the humid environment, only the 15% w/w MGO hydrogel Yan Li: Conceptualization, Methodology, Writing – review & edit­
composite reached 45 ◦ C at 250 Gs (Fig. 4B). In addition, the tempera­ ing, Funding acquisition, Resources, Supervision. Lijing Huang: Vali­
ture increased with increasing external AMF intensity at the same MGO dation, Formal analysis, Writing – original draft. Guangpin Tai:
content. The temperature rise curve (Fig. 4C–D) and infrared thermog­ Validation. Feifei Yan: Methodology, Investigation, Writing – review &
raphy (Fig. 4E) indicate the different magnetothermal effects of the 15% editing. Lin Cai: Resources, Funding acquisition. Chenxing Xin: .
w/w MGO hydrogel composite in dry and humid environments under Shamoon Al Islam: Writing – review & editing.
the same AMF intensity of 250 Gs.

3.4. In vitro osteogenic differentiation of BMSCs on the MGO hydrogel Declaration of Competing Interest
composite
The authors declare that they have no known competing financial
After 7 days of osteogenic differentiation, there was stronger ALP interests or personal relationships that could have appeared to influence
activity in the PVA/SA/HA and MGO-PVA/SA/HA groups than in the the work reported in this paper.
control group (Fig. 5A). Extracellular matrix calcification, which serves
as a marker of late osteogenesis, was measured by Alizarin Red staining Acknowledgements
after 21 days of osteogenic induction. Significantly increased numbers of
extracellular matrix mineralisation nodules were observed in PVA/SA/ The authors gratefully acknowledge financial support from National
HA and MGO-PVA/SA/HA groups compared with the control group Natural Science Foundation of China (No. 51902295), Applied Basic
(Fig. 5A), possibly due to the content of HA particles [27,57]. The MGO/ Frontier Research of Wuhan Science and Technology Bureau
PVA/SA/HA had the greatest increase in ALP activity and mineralisa­ (No.2019020701011454) and Hubei Province Natural Science Foun­
tion, except for the HA particles, which may be attributed to the iron dation grant (No. 2019CFB264). The authors also gratefully acknowl­
ions and graphene oxide contained in MGO. Previous reports have edge support from the bio excellence international tech Co., Ltd.
shown that they both promote bone differentiation [10,58]. The MGO
hydrogel composite stimulated osteo differentiation, also resulting in References
the upregulation of different osteogenic genes (Fig. 5C–F). In addition,
[1] Xiang H, Yang Q, Gao Y, Zhu D, Pan S, Xu T, et al. Cocrystal Strategy toward
through the CCK-8 experiment, whether the hydrogel contained MGO or
Multifunctional 3D-Printing Scaffolds Enables NIR-Activated Photonic
not had no significant effect on the proliferation of rat BMSCs, which Osteosarcoma Hyperthermia and Enhanced Bone Defect Regeneration. Adv Funct
indicates that the scaffolds have good biocompatibility (Fig. 5B). Mater 2020;30(25):1909938. https://doi.org/10.1002/adfm.v30.2510.1002/
adfm.201909938.
[2] Chen B, Xiang H, Pan S, Yu L, Xu T, Chen Yu. Advanced Theragenerative
3.5. Magnetothermal effect inhibited osteosarcoma tumour growth in Biomaterials with Therapeutic and Regeneration Multifunctionality. Adv Funct
nude mice Mater 2020;30(34):2002621. https://doi.org/10.1002/adfm.v30.3410.1002/
adfm.202002621.
[3] Axpe E, Oyen M. Applications of alginate-based bioinks in 3D bioprinting. 2016.
We determined whether the MGO hydrogel composite had an anti- [4] Zhao Y, Min X, Ding Z, Chen S, Ai C, Liu Z, et al. Metal-Based Nanocatalysts via a
tumour effect through subcutaneous tumour-bearing experiments. Universal Design on Cellular Structure. J Advanced Science 2020;7(3).

8
Y. Li et al. Composites Part A 152 (2022) 106672

[5] Jordan SW, Fligor JE, Janes LE, Dumanian GA. Implant Porosity and the Foreign [33] Xu J-W, Yao K, Xu Z-K. Nanomaterials with a photothermal effect for antibacterial
Body Response. Plast Reconstr Surg. 2018;141(1):103e–12e. activities: an overview. Nanoscale 2019;11(18):8680–91.
[6] Jakus AE, Geisendorfer NR, Lewis PL, Shah RN. 3D-printing porosity: A new [34] Lisjak D, Mertelj A. Anisotropic magnetic nanoparticles: A review of their
approach to creating elevated porosity materials and structures. Acta Biomater. properties, syntheses and potential applications. Prog Mater Sci 2018;95:286–328.
2018;72:94–109. [35] Zhang J, Li J, Chen S, Kawazoe N, Chen G. Preparation of gelatin/Fe3O4 composite
[7] Yang S, Ph D, Leong KF, SE M, Smejtepa M. The design of scaffolds for use in tissue scaffolds for enhanced and repeatable cancer cell ablation. J Mater Chem B 2016;4
engineering. Part I. Traditional factors 2002;8(1):1–11. (34):5664–72.
[8] Deo KA, Singh KA, Peak CW, Alge DL, Gaharwar AK. Bioprinting 101: Design, [36] Ortega G, Reguera E. In: Materials for Biomedical Engineering. Elsevier; 2019.
Fabrication, and Evaluation of Cell-Laden 3D Bioprinted Scaffolds. Tissue Eng Part p. 397–434. https://doi.org/10.1016/B978-0-12-816913-1.00013-1.
A. 2020;26(5-6):318–38. [37] Yang X, Zhang X, Ma Y, Huang Y, Wang Y, Chen Y. Superparamagnetic graphene
[9] Mandrycky C, Wang Z, Kim K, Kim DH. 3D bioprinting for engineering complex oxide–Fe3O4nanoparticles hybrid for controlled targeted drug carriers. J Mater
tissues. Biotechnol Adv. 2016;34(4):422–34. Chem 2009;19(18):2710. https://doi.org/10.1039/b821416f.
[10] Kang H-W, Lee SJ, Ko IK, Kengla C, Yoo JJ, Atala A. A 3D bioprinting system to [38] Hai-Yan X, Ning G. Magnetic responsive scaffolds and magnetic fields in bone
produce human-scale tissue constructs with structural integrity. Nat Biotechnol. repair and regeneration. Front Mater Sci 2014.
2016;34(3):312–9. [39] Palmieri V, Spirito MD, Papi M. Graphene-based scaffolds for tissue engineering
[11] Markstedt K, Mantas A, Tournier I, Martínez Ávila H, Hägg D, Gatenholm P. 3D and photothermal therapy. Nanomedicine 2020;15(14):1411–7.
Bioprinting Human Chondrocytes with Nanocellulose-Alginate Bioink for Cartilage [40] Huang SS, Liu HL, Liao KD, Hu QQ, Guo R, Deng KX. Functionalized GO
Tissue Engineering Applications. Biomacromolecules 2015;16(5):1489–96. Nanovehicles with Nitric Oxide Release and Photothermal Activity-Based
[12] Lai J, Wang C, Wang M. 3D printing in biomedical engineering: Processes, Hydrogels for Bacteria-Infected Wound Healing. ACS Appl Mater Interfaces. 2020;
materials, and applications. Applied. Phys Rev 2021;8(2):021322. https://doi.org/ 12(26):28952–64.
10.1063/5.0024177. [41] Bai G, Yuan P, Cai B, Qiu X, Jin R, Liu S, et al. Stimuli-Responsive Scaffold for
[13] Ramiah P, du Toit LC, Choonara YE, Kondiah PPD, Pillay V. Hydrogel-Based Breast Cancer Treatment Combining Accurate Photothermal Therapy and Adipose
Bioinks for 3D Bioprinting in Tissue Regeneration. Front Mater 2020;7. Tissue Regeneration. Adv Funct Mater 2019;29(36).
[14] Midha S, Dalela M, Sybil D, Patra P, Mohanty S. Advances in three-dimensional [42] Yang Y, Hu G, Chen F, Liu J, Liu W, Zhang H, et al. Atom-Scale Interfacial
bioprinting of bone: Progress and challenges. J Tissue Eng Regen Med. 2019;13(6): Coordination Strategy to Prepare Hierarchically Porous Fe3O4-Graphene
925–45. Frameworks and their Application in Charge and Size Selective Dye Removal.
[15] Bahraminasab M. Challenges on optimization of 3D-printed bone scaffolds. Biomed Chem Commun. 2015.
Eng Online 2020;19(1):69. [43] Lu R, Zhang W, He Y, Zhang S, Fu Q, Pang Y, et al. Ferric ion crosslinking-based 3D
[16] Catros S, Fricain JC, Guillotin B, Pippenger B, Bareille R, Remy M, et al. Laser- printing of a graphene oxide hydrogel and its evaluation as a bio-scaffold in tissue
assisted bioprinting for creating on-demand patterns of human osteoprogenitor engineering. Biotechnol Bioeng. 2021;118(2):1006–12.
cells and nano-hydroxyapatite. Biofabrication 2011;3(2):025001. https://doi.org/ [44] Soares PIP, Machado D, Laia C, Pereira LCJ, Coutinho JT, Ferreira IMM, et al.
10.1088/1758-5082/3/2/025001. Thermal and magnetic properties of chitosan-iron oxide nanoparticles. Carbohydr
[17] Catros S, Guillemot F, Nandakumar A, Ziane S, Moroni L, Habibovic P, et al. Layer- Polym. 2016;149:382–90.
by-Layer Tissue Microfabrication Supports Cell Proliferation In Vitro and In Vivo. [45] Kalita, S.J., Bose, S., Hosick, H.L., Bandyopadhyay, A., Development of controlled
Tissue Eng Part C Methods 2012;18(1):62–70. porosity polymer-ceramic composite scaffolds via fused deposition modeling.
[18] Bendtsen ST, Quinnell SP, Wei M. Development of a novel alginate-polyvinyl 2003;23(5):611-20.
alcohol-hydroxyapatite hydrogel for 3D bioprinting bone tissue engineered [46] He L, He T, Xing J, Zhou Q, Rong L. Therapy. Bone marrow mesenchymal stem cell-
scaffolds. J Biomed Mater Res Part A 2017;105(5):1457–68. derived exosomes protect cartilage damage and relieve knee osteoarthritis pain in a
[19] Berglund L, Rakar J, Junker JPE, Forsberg F, Oksman K. Utilizing the Natural rat model of osteoarthritis. Stem Cell Res Ther 2020;11(1).
Composition of Brown Seaweed for the Preparation of Hybrid Ink for 3D Printing of [47] Gartland A, Mechler J, Mason-Savas A, Mackay CA, Mailhot G, Marks SC, et al. In
Hydrogels. ACS Appl Bio Mater 2020;3(9):6510–20. vitro chondrocyte differentiation using costochondral chondrocytes as a source of
[20] Unagolla JM, Jayasuriya AC. Hydrogel-based 3D bioprinting: A comprehensive primary rat chondrocyte cultures: an improved isolation and cryopreservation
review on cell-laden hydrogels, bioink formulations, and future perspectives. Appl method. 2005;37(4):530-44.
Mater Today 2020;18:100479. https://doi.org/10.1016/j.apmt.2019.100479. [48] Amiri A, Baghayeri M, Sedighi M. Magnetic solid-phase extraction of polycyclic
[21] Jiang Y, Hou Y, Fang J, Liu W, Zhao Y, Huang T, et al. Preparation and aromatic hydrocarbons using a graphene oxide/Fe3O4@polystyrene
characterization of PVA/SA/HA composite hydrogels for wound dressing. Int J nanocomposite. Microchim Acta 2018;185(8):393.
Polym Anal Charact 2019;1–10. [49] Zhang J, Wang J, Lin T, Wang CH, Ghorbani K, Fang J, et al. Magnetic and
[22] Kadajji VG, Betageri GV. Water Soluble Polymers for Pharmaceutical Applications. mechanical properties of polyvinyl alcohol (PVA) nanocomposites with hybrid
Polymers 2011;3(4):1972–2009. nanofillers - Graphene oxide tethered with magnetic Fe3O4 nanoparticles. Chem
[23] Danoux CB, Barbieri D, Yuan H, de Bruijn JD, van Blitterswijk CA, Habibovic P. In Eng J -LAUSANNE-. 2014;237:462–8.
vitro and in vivo bioactivity assessment of a polylactic acid/hydroxyapatite [50] Kesti M, Müller M, Becher J, Schnabelrauch M, D’Este M, Eglin D, et al. A versatile
composite for bone regeneration. Biomatter 2014;4(1):e27664. https://doi.org/ bioink for three-dimensional printing of cellular scaffolds based on thermally and
10.4161/biom.27664. photo-triggered tandem gelation. 2015;11:162-72.
[24] Jiang S, Sha L, Feng W. PVA hydrogel properties for biomedical application. [51] Izadifar Z, Chang T, Kulyk W, Chen X, Eames BF. Analyzing Biological Performance
J Mech Behavior Biomedical Mater 2011;4(7):1228–33. of 3D-Printed, Cell-Impregnated Hybrid Constructs for Cartilage. Tissue Eng 2016;
[25] Zhang D, Duan J, Wang D, Ge S. Effect of Preparation Methods on Mechanical 22(3):173–88.
Properties of PVA/HA Composite Hydrogel. J Bionic Eng. 2010;7(3):235–43. [52] Yang X, Lu Z, Wu H, Wei L, Li Z, Zhao J, et al. Collagen-alginate as bioink for three-
[26] Kanimozhi K, Khaleel Basha S, Sugantha Kumari V. Processing and dimensional (3D) cell printing based cartilage tissue engineering. Mater Sci Eng
characterization of chitosan/PVA and methylcellulose porous scaffolds for tissue 2018;83(feb):195.
engineering. Mater Sci Eng C Mater Biol Appl. 2016;61:484–91. [53] Wu C, Xia L, Han P, Xu M, Fang B, Wang J, et al. Graphene-oxide-modified
[27] Chen K, Yang X, Zhang D, Xu L, Zhang X, Wang Q. Biotribology behavior and fluid β-tricalcium phosphate bioceramics stimulate in vitro and in vivo osteogenesis.
load support of PVA/HA composite hydrogel as artificial cartilage. Wear 2017;376- Carbon 2015;93:116–29.
377:329–36. [54] Kassaee MZ, Motamedi E, Majdi M. Magnetic Fe3O4-graphene oxide/polystyrene:
[28] Mallakpour S, Khani Z. Fabrication of poly(vinyl alcohol) nanocomposites having Fabrication and characterization of a promising nanocomposite. Chem Eng J 2011;
different contents of modified SiO2 by vitamin B1 as biosafe and novel coupling 172(1):540–9.
agent to improve mechanical and thermal properties. Polym Compos 2018;39(S3): [55] Yang C, Wu J, Hou Y. Fe3O4 nanostructures: synthesis, growth mechanism,
E1589–97. properties and applications. Chem Commun 2011;47(18):5130–41.
[29] Kim H, Yang GH, Choi CH, Cho YS, Kim G. Gelatin/PVA scaffolds fabricated using a [56] Hatel R, Goumri M, Ratier B, Baitoul M. Graphene derivatives/Fe3O4/polymer
3D-printing process employed with a low-temperature plate for hard tissue nanocomposite films: Optical and electrical properties. Mater Chem Phys. 2017;
regeneration: Fabrication and characterizations. Int J Biol Macromol. 2018;120: 193:156–63.
119–27. [57] Zhang K, Zhou Y, Xiao C, Zhao W, Wu H, Tang J, et al. Application of
[30] Kattimani VS, Kondaka S, Lingamaneni KP, Insights TR. Hydroxyapatite—Past, hydroxyapatite nanoparticles in tumor-associated bone segmental defect. Sci Adv.
Present, and Future in Bone Regeneration. Bone Tissue Regeneration Insights 2016; 2019;5(8):eaax6946. https://doi.org/10.1126/sciadv.aax6946.
7. https://doi.org/10.4137/BTRI.S36138. [58] Shimizu K, Ito A, Yoshida T, Yamada Y, Ueda M, Honda H. Bone tissue engineering
[31] Porous PVA/SA/HA hydrogels fabricated by dual-crosslinking method for bone with human mesenchymal stem cell sheets constructed using magnetite
tissue engineering %J. J. Biomater. Sci. 2020. nanoparticles and magnetic force. J Biomed Mater Res B. 2007;82B(2):471–80.
[32] Qian K-Y, Song Y, Yan X, Dong L, Xue J, Xu Y, et al. Injectable ferrimagnetic silk [59] Yoo D, Jeong H, Noh S-H, Lee J-H, Cheon J. Magnetically Triggered Dual
fibroin hydrogel for magnetic hyperthermia ablation of deep tumor. Biomaterials Functional Nanoparticles for Resistance-Free Apoptotic Hyperthermia. Angew
2020;259:120299. https://doi.org/10.1016/j.biomaterials.2020.120299. Chem Int Ed 2013;52(49):13047–51.