Scribd
Upload
20 views3 pages

2024 Module 5 Individual Written Problem Set Student-1

Uploaded by

kkru8165
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
20 views3 pages

2024 Module 5 Individual Written Problem Set Student-1

Uploaded by

kkru8165
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 3

/12

CSB201 Module 5 Problem Set

Name: __________________________________________

1a.) In the DNA sequence below, the “+1” transcription site is underlined and bolded. What is
the sequence of the RNA strand transcribed from this sequence if the strand shown below is the
template strand? Be sure to label the ends of your transcript. (2 marks)

5’-ACTGTGCGGCATACTTAATTATACATTTGAAACGCGCCCA-3’

Template DNA strand:


3' - TAC TTAATTATACATTTGAAACGCGCCCA - 5'
Transcribed RNA strand:
5' - AUGAAUUAAUAUGUAAACUUUGCGCGGGU - 3'
So, the correct RNA sequence transcribed from the +1 transcription site (T) is:
5' - AUGAAUUAAUAUGUAAACUUUGCGCGGGU - 3'

1b.) What is the sequence of the RNA strand transcribed from this sequence if the
complementary strand to the one shown above (1a) is the template strand? Be sure to label the
ends of your transcript and show the complementary DNA strand sequence (labelled) as well.
Assume the transcription start position is the same corresponding base as in 1a. (3 marks)

TemplateDNAStrand(complementarystrand):

3' -TGAATTAATATGTAAACTTTGCGCGGGT - 5'


Transcribed RNAStrand:
5' - ACUUAAUUAUACAUUUGAAACGCGCCCA -3'
Final Answer:
1. Complementary DNAstrand: 3' - TGACACGCCGATGAATTAATATGTAAACTTTGCGCGGGT -5'
2. RNAtranscript from the complementary strand: 5' - ACUUAAUUAUACAUUUGAAACGCGCCCA -3'

2. Predict how a mutation in the promoter sequence (a change in the DNA sequence in the promoter
region) could affect the transcription of a gene. Answer completely and explain your answer(s). (2 marks)

A mutation in the promoter sequence could change how well the gene gets transcribed. If the mutation
makes it harder for the proteins that start transcription to bind, the gene might not get expressed as much
or at all. On the other hand, if the mutation makes binding easier, the gene could be overactive and
produce too much protein.

3.You obtain a sample of double-stranded DNA and transcribe mRNA from the DNA.
You then analyze the base composition of each of the two DNA strands and the one mRNA
strand, and get the following results. The numbers below indicate the percentage of each base
in the strand. Note that there is experimental error associated with real data like this—
percentages might not quite add up to 100% in all cases.

A G C T U

Strand 1 18.3 25.1 16.6 40.0 0.0

Strand 2 40.1 16.4 25.2 18.3 0.0

Strand 3 40.0 16.6 25.2 0.0 18.2


a. Which of these strands must be the mRNA? Explain. (2 marks)

Strand 3 must be the mRNA because it contains uracil (U) instead of thymine (T), which is
found in DNA. In addition, the base composition shows that the percentage of adenine (A) is
nearly equal to the percentage of uracil (U), which aligns with the complementary base
pairing that occurs during transcription (A pairs with U in RNA). Since Strand 3 is the only
one with U present, it confirms that it is the transcribed mRNA strand.

b. Which one is the template strand for the mRNA? Explain. (2 marks)

Strand 2 is the template strand for the mRNA because it has a higher percentage of guanine (G)
and a lower percentage of adenine (A) compared to the mRNA (Strand 3). The template strand is
complementary to the mRNA; thus, where there is adenine (A) in the mRNA, there should be
thymine (T) in the template strand. The base composition of Strand 2 supports this relationship
with the right proportions of bases.

c. Which strand is the non-coding strand? Which is the sense strand? (1 mark)

The non-coding strand is Strand 1, as it serves as the template for transcription and does not
directly code for the protein. The sense strand is Strand 2 because it has the same sequence as the
mRNA (except that thymine replaces uracil), reflecting the coding information that will be
translated into a protein.

You might also like