See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/47728410

Transmission Parameters for Candidatus Liberibacter asiaticus by

Asian Citrus Psyllid (Hemiptera: Psyllidae)

Article in Journal of Economic Entomology · October 2010

DOI: 10.1603/EC10123 · Source: PubMed

CITATIONS READS

328 734

4 authors, including:

Ronald H. Brlansky Timothy A Ebert

University of Florida University of Florida
208 PUBLICATIONS 3,945 CITATIONS 83 PUBLICATIONS 1,260 CITATIONS

SEE PROFILE SEE PROFILE

All content following this page was uploaded by Timothy A Ebert on 27 August 2014.

The user has requested enhancement of the downloaded file.

 ARTHROPODS IN RELATION TO PLANT DISEASE

Transmission Parameters for Candidatus Liberibacter asiaticus by

Asian Citrus Psyllid (Hemiptera: Psyllidae)
K. S. PELZ-STELINSKI,1,2 R. H. BRLANSKY,3 T. A. EBERT,1 AND M. E. ROGERS1

J. Econ. Entomol. 103(5): 1531Ð1541 (2010); DOI: 10.1603/EC10123

ABSTRACT The purpose of this investigation was to evaluate acquisition and inoculation (together,
transmission) efÞciency of Candidatus Liberibacter asiaticus (Las), the pathogen associated with
citrus huanglongbing (HLB) by the Asian citrus psyllid, Diaphorina citri (Kuwayama) (Hemiptera:
Psyllidae). In laboratory studies, nymphs reared on Las infected plants were more likely to acquire
the bacterium than adults. Acquisition by nymphs ranged from 60 to 100%, whereas acquisition by
adults only reached 40% after 5 wk of feeding on Las-infected plants. Similar rates of pathogen
acquisition by psyllids after nymphal and adult feeding were observed in the Þeld. Transmission of Las
from parent to offspring (transovarial) occurred at a rate of 2Ð 6%. One year after psyllid inoculations,
successful transmission by individual D. citri ranged from 4 to 10%, whereas groups of 100 or more D.
citri transmitted the pathogen at a rate of ⬇88%. In addition, the proportion of Las-positive adult
psyllids, determined using quantitative real-time polymerase chain reaction, decreased over time
when held on healthy plants. Due to the low rate of pathogen acquisition and long time period required
for successful inoculation by adult D. citri, experiments designed to determine the latent period
required for replication and successful inoculation of Las by D. citri did not result in Las-infected plants
after ⬎1 yr of incubation after inoculation. Collectively, these results indicate that adult D. citri which
acquire the HLB pathogen as adults are poor vectors of the pathogen compared with adults that
acquired the pathogen as nymphs.

KEY WORDS citrus greening disease, huanglongbing, acquisition, inoculation, vector

Huanglongbing (HLB), or citrus greening disease, is (Morris et al. 2009a,b). The bacterium systemically
the most economically important disease affecting cit- infects citrus trees and reduces the quantity and qual-
rus production worldwide (Halbert and Manjunath ity of fruit produced. Characteristic symptoms of this
2004, Teixeira et al. 2005, Bové 2006, Wang et al. 2006, disease include mottled leaves, corked veins, yellowed
Batool et al. 2007, Manjunath et al. 2008). Historically shoots, twig dieback, and ultimately tree death. Rec-
endemic throughout Asia and Africa, HLB recently ommended management tactics for HLB in Florida
has spread to South America and some citrus-produc- primarily rely on controlling D. citri populations and
ing regions of North America, including Florida (Bové removing Las-infected trees that are a source of in-
2006). The pathogen associated with citrus greening oculum for acquisition by healthy psyllids (Brlansky et
disease is a vector-borne ␣-proteobacterium (Jagoueix al. 2007).
et al. 1994) that to date has not been maintained in There are two reported vectors of citrus greening
sustained pure culture (Davis et al. 2008); however, disease: the Asian citrus psyllid, Diaphorina citri (Ku-
limited success was reported recently (for to Þve sin- wayama) (Hemiptera: Sternorrhyncha: Psyllidae),
gle-colony transfers) (Sechler et al. 2009). Three dis- and the African psyllid Trioza erytreae (del Guercio)
tinct etiologic agents of HLB have been implicated (Hemiptera: Sternorrhyncha: Triozidae). D. citri is
based on their 16S rRNA gene sequence: Candidatus responsible for transmission of Las in North America,
Liberibacter asiaticus (Asia, North America, and Bra- Brazil, and Asia and Ca. L americanus in Brazil,
zil), Ca. Liberibacter americanus (Brazil), and Ca. whereas T. erytreae transmits Ca. L. africanus in the
Liberibacter africanus (Africa) (Garnier et al. 1984, Middle East, Reunion, and Africa (Halbert and Man-
Jagoueix et al. 1996, Sagaram et al. 2009). Ca. L. asi- junath 2004). D. citri can acquire Las from infected
aticus (Las) was discovered in Florida in August 2005 plants as nymphs or adults (Capoor et al. 1974, Xu et
(Halbert 2005) and subsequently has infected an es- al. 1988). If the pathogen is acquired at the nymphal
timated 1.6% of orange trees in Florida as of 2008 stage, adults are able to transmit immediately after
emergence (Capoor et al. 1974, Xu et al. 1988, Inoue
1 Department of Entomology and Nematology, Citrus Research and
et al. 2009).
Education Center, University of Florida, Lake Alfred, FL 33850.
2 Corresponding author, e-mail: pelzstelinski@uß.edu. In past studies with D. citri and T. erytreae, acqui-
3 Department of Plant Pathology, Citrus Research and Education sition of the HLB pathogen was reported to require a
Center, University of Florida, Lake Alfred, FL 33850. minimum of 15 min to 24 h, and the psyllid access time

0022-0493/10/1531Ð1541$04.00/0 䉷 2010 Entomological Society of America

1532 JOURNAL OF ECONOMIC ENTOMOLOGY Vol. 103, no. 5

for pathogen inoculation of healthy plants ranged [Bergera koeniggii (L.) Sprengel] (LogeeÕs Green-
from 15 min to 7 h (Capoor et al. 1974, Buitendag and house, Danielson, CT). With the exception of transo-
von Broembsen 1993). Generally, previous studies of varial transmission, all experiments described below
Las acquisition and inoculation have been conducted were conducted with infected of healthy C. sinensis
by conÞning psyllids on host plants for feeding and Pineapple. Before using plants in psyllid transmission
conÞrming Las presence based on visual observations experiments, multiplex qPCR assays by using primers
of symptomatic tissues. More recently, conventional and probes described by Li et al. (2006) were con-
and quantitative real-time PCR (qPCR) have been ducted to determine the presence of Las.
used to conÞrm presence, multiplication, and trans- Psyllids. D. citri were obtained from a culture col-
mission of Las by D. citri at different developmental lected in 2005 from Polk Co., FL (28⬚ 00⬘ 39.91⬙ N, 81⬚
stages (Hung et al. 2004, Inoue et al. 2009); however, 54⬘ 01.96⬙ W) before the discovery of HLB in the
reports of pathogen transmission efÞciencies are in- state, and maintained on healthy sweet orange plants
consistent and the rates of pathogen acquisition and in an insect-proof greenhouse at the Citrus Research
inoculation by psyllids over variable times have not and Education Center (University of Florida, Lake
been quantiÞed. In addition, reports of the latent pe- Alfred, FL). Psyllids from this colony were sampled
riod of Las in D. citri before successful inoculation monthly to conÞrm that insects remained free of Las.
range from 1 to 25 d postacquisition (Xu et al. 1988, and Psyllids harboring the bacterium were obtained by
Roistacher 1991). These differences may be due to rearing D. citri from the culture on infected citrus
variation in the assays used for Las detection or pos- plants maintained in a secure quarantine facility. Rou-
sibly to differences inherent among the populations of tine sampling indicated that 70 Ð100% of D. citri ob-
D. citri evaluated. The nature of the relationship be- tained from this colony were positive for Las when
tween the purported HLB pathogen and D. citri has groups of 10 Ð20 psyllids were individually tested by
been deÞned using populations from regions including qPCR. Both psyllid colonies were maintained at 25⬚C,
India, China, Taiwan, and Japan; consequently, ge- 60 Ð 80% RH, and a photoperiod of 16:8 (L:D) h.
netic variation among these groups may underlie dif- Acquisition of Las by D. citri in the Laboratory. The
ferences in vector efÞciency. To date, no studies have ability of D. citri nymphs and adults to acquire Las by
been conducted to evaluate the vector efÞciency of D. feeding on infected citrus was evaluated in two ex-
citri in Florida. periments. Adult acquisition was evaluated by conÞn-
Compounding the lack of clear information regard- ing groups of 50 adult D. citri in mesh enclosures on
ing Las transmission, there are inconclusive reports of psyllid-free branches of Las-infected citrus plants for
vertical (transovarial) passage of the bacterium by acquisition access periods (AAPs) ranging from 1 to
psyllids. Studies suggest that T. erytreae can pass Ca. L. 52 d at 25⬚C and 80% RH. Although the extent of Las
africanus transovarially, but that transovarial passage multiplication in D. citri is unclear, surviving adults
of Las by D. citri does not occur (van den Berg et al. were transferred with an aspirator to healthy citrus
1992 and Xu et al.1988). In addition, transovarial trans- seedlings after each AAP for a 1-wk latent period
mission of the pathogen associated with Zebra Chip during which multiplication of Las could occur. At the
disease, Ca. L. psyllaurous/solanacearum (Hansen et end of each acquisition experiment, D. citri were col-
al. 2008; Liefting et al., 2008, 2009) by its psyllid vector lected and preserved in 80% ethanol at ⫺20⬚C for
Bactericera cockerelli (Sulc) has been reported previ- subsequent detection of Las by qPCR. AAPs were
ously (Hansen et al. 2008). Previous investigations of pooled for analysis into six groups representing the
transovarial transmission of Las have been hampered number of days psyllids spent feeding on infected
by detection methods with little sensitivity to low plants:1Ð 6, 7Ð13, 14 Ð20, 21Ð27, 28 Ð34 , and ⱖ35 d. Each
bacterial titers; therefore, we conducted experiments AAP group was replicated three times (n ⫽ 20 Ð120
to assess the prevalence of transovarial transmission in psyllids per AAP).
D. citri using qPCR for detection of Las. In addition, Acquisition of Las by D. citri nymphs was evaluated
we conducted a series of experiments to quantify the by placing excised ßush containing eggs on mature
acquisition and inoculation of Las by D. citri in Florida. leaves of infected citrus plants. Before placement,
SpeciÞcally, we examined the efÞciency of Las acqui- excess ßush was carefully removed from around the
sition and inoculation by D. citri over time, latency of eggs under a stereomicroscope by using forceps and a
the pathogen before psyllid inoculation, and retention camelÕs-hair brush. Branches containing nymphs were
of the pathogen by D. citri postacquisition. enclosed in mesh bags to prevent dispersal of nymphs
during the AAP. Upon emergence after the 11Ð15-d
nymphal developmental period, adults arising from
Materials and Methods
eight replicate groups containing 20 Ð105 psyllids were
Maintenance of Pathogen and Host Plants. In planta collected and preserved for Las detection.
cultures of Las were maintained by graft-inoculation Acquisition of Las in the Field. The rate of Las
of healthy ÔPineappleÕ sweet orange plants [Citrus acquisition by D. citri under Þeld conditions was as-
sinensis (L.) (Rutaceae)] with Las-infected budwood sessed by caging healthy psyllids from our laboratory
collected from citrus groves in Immokalee, FL (Col- colony on HLB symptomatic sweet orange trees in Þve
lier Co.). Healthy (Las-free) host plants used in the Florida citrus groves located in Avon Park (27⬚ 43⬘
following experiments were cultivated from seed (C. 47.66⬙ N, 81⬚ 41⬘ 43.63⬙ W), Lake Placid (27⬚ 21⬘ 51.57⬙
sinensis Pineapple) or obtained as potted seedlings N, 81⬚ 19⬘ 39.66⬙ W), and Lake Henry (27⬚ 44⬘ 59.44⬙
October 2010 PELZ-STELINSKI ET AL.: TRANSMISSION OF LAS BY D. citri 1533

N, 81⬚ 43⬘ 37.5⬙ W). Groups of newly emerged D. citri ment before testing for the presence of Las. Citrus
adults were enclosed in mesh bags on branches for seedlings that tested negative after 3 mo were retested
acquisition access. Before acquisition experiments, bimonthly for 1 yr after inoculation experiments. Only
the presence of the bacterium in individual branches plants exposed to psyllids harboring Las were included
was conÞrmed by qPCR. Adults were conÞned for in subsequent tests for successful inoculation.
AAPs of 10 Ð51 d. AAPs were pooled for analysis into In a second experiment, transmission of Las to
six groups representing the number of days psyllids healthy citrus plants by groups of psyllids was assessed
spent feeding on infected plants:1Ð13, 14 Ð27, 28 Ð34, by allowing Las-positive D. citri to feed for an IAP of
35Ð 42, and ⱖ42 d. Each pooled acquisition period was 30 d. A group of 200 D. citri obtained from our Las-
replicated at least Þve times, with at least 100 D. citri positive colony was caged with test plants (n ⫽ 15) for
per replicate. At the end of each AAP, D. citri adults the course of the experiment. Live psyllids remaining
were collected and preserved for subsequent assess- on the plant at the end of this period were collected
ment of Las acquisition by qPCR. to conÞrm the presence of Las. Test plants were re-
A second experiment to determine the rate of ac- tained as above and evaluated bimonthly beginning 3
quisition by nymphs was conducted by similarly cag- mo after the IAP.
ing adult psyllids on infected citrus trees. The wings of Transovarial Transmission. The objective of this
adults were notched to distinguish this generation of experiment was to determine the potential for and
adults from their progeny. In addition, because a min- frequency of vertical transmission of Las from adult D.
imum of 15 d is required for the production of adult citri females to progeny. One female and two male
progeny after oviposition (Mead 1977, Chavan and psyllids reared from eggs on infected citrus plants
Summanwar 1993), the original D. citri adults were were caged on ßushing, Las-negative sweet orange
removed before this period to preclude interaction seedlings for oviposition. Adults were removed after
between progenitors and offspring (F1 generation). F1 one week or upon the appearance of eggs and tested
adults were collected 14 Ð37 d after oviposition and as described previously to conÞrm the presence of Las
preserved as described above before testing to deter- by using qPCR. Introduction of bacteria at the ovipo-
mine the level of Las acquired by D. citri during sition site may occur as a result of female feeding. To
nymphal development. Acquisition access periods prevent subsequent acquisition of the pathogen by
were calculated from the day original D. citri adults offspring, eggs were transferred to B. koenigii. Al-
were placed on plant (day 0), because this day was though the latter is known to be an alternate host of
the earliest possible date on which oviposition could D. citri (Halbert and Manjunath 2004), it is not a host
occur. for Las (Damsteegt et al. 2010). Egg transfers were
Retention of Las by D. citri. Retention of Las was conducted by placing egg containing ßush on new
assessed in D. citri reared on Las-infected sweet or- plants after carefully removing excess plant tissue
ange trees. Las-infected branches containing psyllid from around the eggs with forceps and a camelÕs-hair
eggs were enclosed in mesh sleeves until 3 d after the brush under a stereomicroscope. Eggs and any at-
appearance of the Þrst adult psyllid. At that time, D. tached leaf tissue remaining were rinsed with 10%
citri adults and nymphs were aspirated and then trans- bleach followed by sterile water to eliminate potential
ferred individually to healthy sweet orange seedlings surface contamination. All plants used in transovarial
where they were enclosed under 1-liter clear plastic transmission experiments were conÞrmed to be neg-
deli cups perforated for ventilation. D. citri and plants ative for Las with qPCR before oviposition and after
were held at 25⬚C and a photoperiod of 16:8 (L:D) h. offspring were collected.
Adults psyllids (n ⫽ 10 Ð 40 per date) were collected Replication of maternally derived Las may occur as
every 3Ð 4 d and tested for the presence of Las by using progeny progress through life stages, such that bac-
qPCR as described below. In addition, the status of terial titers undetectable in eggs may be discernible in
infected and healthy plants was conÞrmed with qPCR later stages. Therefore, we evaluated the extent of
before and after retention tests. transovarial passage on three distinct D. citri devel-
Inoculation of Citrus With Las by D. citri. Two opmental stages: eggs, nymphs, and newly eclosed
experiments were conducted to assess the success of adult offspring. Allowing eggs to develop increases the
Las transmission over time. Individual, putatively in- likelihood the bacteria will multiply to detectable lev-
fective adult psyllids (reared on Las-infected citrus els within the psyllid. Due to the low concentration of
plants) were each caged on a single 6 Ð9-mo-old DNA recovered (Hung et al. 2004), eggs and nymphs
healthy sweet orange seedlings (Pineapple) ⬇20 cm arising from individual infected females were pooled
high and allowed to feed for 1-, 4-, 7-, 15-, or 24-d (20 Ð50 and 20 Ð30 per pool, respectively) for testing.
inoculation access periods (IAPs). The number of We chose the lower boundary for egg pools based on
single-psyllid inoculations conducted for each IAP a previous study by Hung et al. (2004) that determined
ranged from 40 to 60. Psyllids were caged on plants that DNA extracts from pools of 10 or fewer D. citri
within Plexiglas tubes vented with mesh to permit air eggs did not contain sufÞcient material for spectro-
circulation such that the entire plant was accessible for photometric detection of DNA at optical density260.
feeding. After each IAP, psyllids were removed and DNA was extracted from pooled egg and nymphal
tested for Las with qPCR (n ⫽ 214), and plants were samples, individual D. citri adult offspring, and pro-
held for 3 mo in an insect-proof greenhouse to allow genitor female D. citri and then tested for the presence
time for pathogen replication and symptom develop- of Las. The experiment was replicated until a mini-
1534 JOURNAL OF ECONOMIC ENTOMOLOGY Vol. 103, no. 5

mum of 40 samples per developmental stage produced and Las primers (LasF, 5⬘-TCGAGCGCGTATG-
by Las-positive females were available for analysis. CAATACG-3⬘; LasR, 5⬘-GCGTTATCCCGTAGAAA-
Latent Period of Las in D. citri. The time (latent AAGGTAG-3⬘), 118 nM each of Wg hydrolysis probe
period) between acquisition and subsequent inocula- (TTACTGACCATCACTCTGGACGC) and Las hy-
tion of citrus with Las by adult D. citri was investi- drolysis probe (AGACGGGTGAGTAACGCG), and 1
gated. In total, 30 adult psyllids (n ⫽ 3) were conÞned ␮l of template DNA (Li et al. 2006). Plant reactions
on Las-infected sweet orange plants for 7 d AAPs. (27 ␮l) were conducted similarly, but contained 270
After each AAP, single psyllids were transferred to nM each of internal control primers (CoxF, 5⬘-GTAT-
separate healthy sweet orange seedlings. Serial trans- GCCACGTCGCATTCCAGA-3⬘; CoxR, 5⬘-GCCAA-
fers of the individual psyllids to a new, healthy sweet AACTGCTAAGGGCATTC-3⬘), 216 nM Las primers,
orange seedling were then made every 7 d for ⬇1 mo and 135 nM each of Cox hydrolysis probe (ATCCA-
to estimate the number of days until pathogen inoc- GATGCTTACGCTGG) and Las hydrolysis probe (Li
ulation occurred. At the end of the experiment, psyl- et al. 2006). The default ABI 7500 Real-Time ampliÞ-
lids were collected and immediately stored in 80% cation protocol used consisted of an initial denatur-
ethanol at ⫺20⬚C for subsequent testing for the pres- ation step of 95⬚C for 10 min followed by 40 cycles of
ence of Las by using qPCR. All plant material was held 95⬚C for 15 s and 60⬚C for 60 s. Reactions were con-
for 3 mo and then tested bimonthly for an 18-mo sidered positive for either target sequence if the cycle
period to assess successful inoculations of plants with quantiÞcation (Cq) value, determined by the ABI
Las. 7500 Real-Time software (version 1.4, Applied Bio-
Preparation of Nucleic Acids From Sample Tissues. systems), was ⱕ35.
Individual adult psyllids, pooled nymphs, or pooled Statistical Methods. Acquisition of Las by D. citri in
eggs collected from experiments were homogenized laboratory and Þeld assays was evaluated with analysis
in a buffer solution (QIAGEN, Valencia, CA) by using of variance (ANOVA) followed by means separation
a sterile mortar and lysed overnight at 56⬚C in a hy- by using Fisher protected least signiÞcant difference
bridization oven (model 136400, Boekel ScientiÞc, (LSD) test (PROC GLM, SAS Institute 2005). In ad-
Feasterville, PA). Subsequent extraction of DNA from dition, linear regression and PearsonÕs correlation co-
Las-positive psyllids and healthy controls was con- efÞcient were used to assess the relationship between
ducted according to the manufacturerÕs instructions Las infection of D. citri and time for acquisition and
using the DNeasy Blood and Tissue kit (QIAGEN) pathogen retention studies. Differences among
with a protocol modiÞed for detection of bacterial transovarial transmission rates at different life stages
DNA in arthropods (QIAGEN, Anonymous 2008). were compared using the KruskalÐWallis chi-square
Whole-psyllid DNA was eluted in a Þnal volume of test (PROC npar1way, SAS Institute 2005).
35 ␮l.
Leaf samples collected from citrus plants were
Results
stored in plastic bags at 4⬚C and used for DNA ex-
traction within 24 h. Composites of leaf petiole and Acquisition of Las by D. citri in the Laboratory.
midvein tissue from four leaves were subsampled (100 Acquisition of Las by D. citri adults and nymphs was
mg) for preparations of total DNA from plant samples. positively correlated with conÞnement time on in-
Tissue samples were ground in a bead mill (Tissue- fected plants (b ⫽ 9.6; PearsonÕs correlation coefÞ-
Lyzer II, QIAGEN) under liquid nitrogen for 1 min at cient, r ⫽ 0.79, F ⫽ 56.5, P ⬍ 0.0001). Acquisition of the
30 Hz/s in 1.5-ml microcentrifuge tubes containing a pathogen by adults D. citri was signiÞcantly lower
5-mm stainless steel bead. Plant DNA was then ex- when psyllids fed on Las-infected plants for AAPs ⬍7
tracted from the ground samples using the DNeasy d compared with longer AAPs (ANOVA: F ⫽ 9.16; df ⫽
Plant kit (QIAGEN) according to the manufacturerÕs 6, 36; P ⫽ 0.0001). After ⱖ35 d of conÞnement on
protocol and eluted in a Þnal volume of 50 ␮l. infected citrus, signiÞcantly more (39%) adult D. citri
Real-Time PCR Assays. A multiplex TaqMan qPCR acquired Las than for any other AAP (Fig. 1). In
assay was used to determine the presence of Las in addition, the level of Las infection in D. citri was
insect and plant tissues. Duplicate ampliÞcations of signiÞcantly higher after a 28 d AAP than for AAPs of
Las-speciÞc DNA from psyllid and plant extracts were ⱕ20 d. Psyllids reared from eggs to adults on Las-
conducted in conjunction with probe-primer sets tar- infected citrus accounted for the greatest percentage
geting insect wingless (Wg)- or citrus cytochrome of pathogen acquisition. More than 60% of newly
oxidase (Cox) gene regions, respectively (Thao et al. emerged adult D. citri tested positive for Las after
2000, Li et al. 2006), as internal controls for DNA acquisition as nymphs, a signiÞcantly greater number
extractions. Each PCR assay included positive and than obtained from AAPs ⬍35 d (Fig. 1).
negative controls for target and internal control se- Acquisition of Las in the Field. Acquisition of Las by
quences. PCR ampliÞcations were carried out in an adult D. citri was positively correlated with time (b ⫽
ABI 7500 Real-Time PCR System (Applied Biosys- 0.02; PearsonÕs correlation coefÞcient, r ⫽ 0.71, F ⫽
tems, Foster City, CA). Psyllid reactions (26 ␮l) con- 10.1, P ⫽ 0.01) (Fig. 2). Acquisition rates remained
tained 12.5 ␮l of TaqMan Universal PCR mastermix ⬍15% until adults fed on infected citrus for ⬎40 d and
(Applied Biosystems), 235 nM each of internal control increased thereafter to as much as 100%. An exception
primers (WgF, 5⬘-GCTCTCAAAGATCGGTTTGAC- to this occurred with psyllids held on plants for 28 d,
GG-3⬘; WgR, 5⬘-GCTGCCACGAACGTTACCTTC-3⬘) which exhibited an acquisition rate of 80%. Las acqui-
October 2010 PELZ-STELINSKI ET AL.: TRANSMISSION OF LAS BY D. citri 1535

Fig. 1. Percentage of D. citri (mean ⫾ SE) that tested positive for Las in laboratory experiments after feeding on infected
citrus for AAPs lasting 1Ð45 d (adults) or for the duration of nymphal development from the egg stage through the Þfth instar
(11Ð15 d). Presence of Las was assessed using qPCR after each AAP. AAPs for adults were grouped by week for analysis. Means
for adult AAPs with different letters are signiÞcantly different (␣ ⫽ 0.05; Fisher protected LSD).

sition by D. citri was signiÞcantly higher when psyllids df ⫽ 4, 72; P ⬍ 0.0001). The highest level of Las
fed on Las-infected plants for AAPs lasting 28 Ð 42 d acquisition, 80%) occurred when adults were given
compared with AAPs of ⬍28d (ANOVA: F ⫽ 21.8; access to infected plants for ⬎42 d.

Fig. 2. Percentage of D. citri (mean ⫾ SE) that tested positive for Las under Þeld conditions after feeding on infected
citrus for AAPs of 1Ð51 d. Presence of Las was assessed using qPCR after each AAP. AAPs for adults were grouped for analysis.
Means for adult AAPs with different letters are signiÞcantly different (␣ ⫽ 0.05; Fisher protected LSD).
1536 JOURNAL OF ECONOMIC ENTOMOLOGY Vol. 103, no. 5

Fig. 3. Percentage of D. citri (mean ⫾ SE) reared on infected citrus under Þeld conditions that tested positive for Las
(mean ⫾ SE). Adult psyllids were collected from infected plants 14Ð37 d after oviposition. Presence of Las was assessed using
qPCR after each AAP. The solid line indicates the regression line of best Þt (y ⫽ ⫺0.04 ⫹ 0.98).

In contrast, psyllids reared on infected citrus ex- inoculating population tested 93.9% (n ⫽ 33) positive
hibited a mean acquisition rate of 50% at 14 d poste- for the presence of Las.
mergence (Fig. 3). Because the progenitors of these Transovarial Transmission. In transovarial trans-
psyllids were removed after 14 d, before the emer- mission tests, three stages of offspring were screened
gence of adult offspring, adults collected on day 28 for the presence of transovarially-inherited Las:
could be no ⬎14 d old. The rate of acquisition signif- pooled eggs, thirdÐÞfth instars, and newly eclosed
icantly increased over time such that D. citri offspring adults. Despite being reared on healthy (Las-free)
collected at 37 d were nearly 100% positive for Las plants, 3.6% of combined psyllid offspring (eggs,
(b ⫽ 0.02; PearsonÕs correlation coefÞcient, r ⫽ 0.93, nymphs, and adults) derived from Las-infected fe-
F ⫽ 18.0, P ⫽ 0.02). males tested positive for Las, indicating that transo-
Retention of Las by D. citri. After acquisition of Las varial transmission occurred at a low rate in D. citri
as nymphs, newly emerged adults transferred to (Table 2). There were no signiÞcant differences
healthy citrus experienced decreased levels of the among life stages in the F1 generation testing positive
bacterium over their lifetime. The proportion of Las- for the presence of Las (KruskalÐWallis, ␹2 ⫽ 2.56,
positive adult D. citri decreased signiÞcantly over time df ⫽ 2, P ⫽ 0.279).
(R2 ⫽ 0.72; PearsonÕs correlation coefÞcient, r ⫽ Latent Period of Las in D. citri. Although positive
⫺0.85, F ⫽ 31.3, P ⫽ 0.0001) when not continuously psyllids were collected from test plants at the end of
exposed to Las-infected plants, resulting in a retention experiments, transmission of Las was not observed;
rate of ⬍20% after 24 d on healthy plants (Fig. 4). therefore, we were unable to determine the latent
Inoculation of Citrus With Las by D. citri. In total, period between acquisition of the pathogen by adult
eight plants tested positive for the presence of Las at D. citri and subsequent inoculation of uninfected host
3, 5, 7, 9, and 12 mo after inoculation access. The mean plants.
numbers of plants testing positive for Las after IAPs of
1, 4, 7, 15, and 24 d were not signiÞcantly different
Discussion
(ANOVA: F ⫽ 0.41; df ⫽ 4, 122; P ⫽ 0.801). Individual
positive adult psyllids successfully inoculated citrus Acquisition of Las was greater for psyllids reared
with Las, with a mean efÞciency of 5% (Table 1). In from eggs on Las-infected citrus plants compared with
a second experiment, groups of 200 newly emerged D. D. citri that were caged (and presumably fed) only on
citri reared on Las-infected plants (n ⫽ 15) transmit- infected citrus as adults. The percentage of adult D.
ted the bacterium to healthy sweet orange plants at a citri acquiring Las increased with conÞnement time on
rate of 73% after a 30-d IAP. Psyllids sampled from the infected citrus plants from 0% at 1 wk to 39% at 5 wk.
October 2010 PELZ-STELINSKI ET AL.: TRANSMISSION OF LAS BY D. citri 1537

Fig. 4. Retention of Las over time by D. citri that were reared as nymphs on infected citrus and then held on healthy
(Las-free) citrus for 1Ð24 d. Presence of Las was assessed using qPCR.

Longer conÞnement on infected plants may allow Japanese and Florida populations of D. citri. Differ-
time for bacterial titer to increase. In addition, higher ences in acquisition efÞciencies also may be linked to
acquisition rates of Las over longer times is probably features associated with the physiology of host plants,
due to the uneven distribution of the bacterium the pathogen, or both.
throughout infected plants (Teixeira et al. 2008), be- Changes in the efÞciency of Las inoculation by
cause the probability of encountering the bacterium single adult psyllids did not occur in response to the
increases with the duration of insect feeding (Almeida length of the IAP; however, a higher rate (up to 100%)
et al. 2005). Our results differed from a previous Jap- of successful pathogen inoculation occurred when
anese study in which 88% of D. citri adults acquired larger numbers of Las-positive adult psyllids were held
Las after just 24 h of feeding (Inoue et al. 2009). This on plants for inoculation feeding. Our results showed
comparatively higher level of infection could possibly that a single adult psyllid was able to inoculate the
be an artifact of the small number of psyllids tested in pathogen after a 1-d IAP, but the overall rate of suc-
the latter (n ⫽ 25). In contrast, the large sample cessful inoculation did not exceed 6.3% with single-
population (n ⫽ 478) evaluated in our study did not psyllid inoculation feedings. The probability of suc-
produce any positive psyllids, suggesting that differ- cessful inoculation may increase if a critical number of
ences in vector competence could exist between the bacteria are required for an infection to establish
(Almeida et al. 2005). We suspect that the titer of Las
required to cause disease is higher than that typically
Table 1. Inoculation of C. sinensis with Las by individual adult
D. citri reared on Las-infected plants

Positive psyllidsb/ Infected Table 2. Transovarial transmission of Las from female D. citri
IAPa to offspring (F1 generation)
total psyllids conÞned plants (%)c
1 16/35 6.3 Developmental
4 42/58 7.1 nb %c
stagea
7 39/48 7.7
15 27/39 3.7 Egg 49 2.0
24 4/61 0.0 Nymph 48 6.3
Adult 42 2.4
a
Inoculation access period (in days) provided to D. citri on test
a
plants. Samples consisting of pooled (20 Ð50) eggs, pooled (20 Ð30)
b
ConÞrmation of Las presence in single D. citri determined by nymphs, or individual F1 adults from Las-positive females were tested
qPCR after IAPs. for the presence of Las by using qPCR.
c b
ConÞrmation of the presence of Las in plants determined by qPCR n is number of pooled (eggs and nymphs) or individual D. citri
by 18 mo after the IAP. Percentage of infected plants refers to number screened by qPCR.
c
of Las-infected plants/total number of plants with positive D. citri. Percentage of D. citri positive by qPCR.
1538 JOURNAL OF ECONOMIC ENTOMOLOGY Vol. 103, no. 5

inoculated by a single psyllid. The high rate of suc- (with actual feeding of unknown duration) and patho-
cessful inoculation we observed when plants were gen acquisition rate. These studies further conÞrm the
exposed to 200 Las-positive psyllids supports this hy- higher rate of pathogen acquisition by psyllids reared
pothesis, although additional studies with quantitative on Las-infected trees, compared with psyllids that
PCR are needed to determine the minimum titer re- acquired the pathogen as adults. Variation in the rate
quired for successful inoculation. of psyllids acquiring Las under Þeld conditions as
Inoculation rates resulting from IAPs by single adult adults, particularly on day 28 (Fig. 2), may reßect the
psyllids in this study were generally less efÞcient than variable distribution of the pathogen within host trees.
rates previously reported for D. citri. Xu et al. (1988) Adults caged on branches with high bacterial titers
reported 80% of test plants exhibited HLB symptoms would presumably have a greater likelihood of acquir-
after inoculation feeding by single adult psyllids in ing the pathogen compared with psyllids held on
China. Successful transmissions in this study was de- branches with low titers. Additional studies of Las
termined based on the appearance of HLB symptoms acquisition by adults by using qPCR are needed to
on test plants, in absence of molecular diagnostic tools determine the relationship between acquisition and
now available to researchers. In a more recent study bacterial titer within the plant. The observed high
using qPCR to detect successful transmission, no in- acquisition rates in psyllid offspring caged on infected
oculation was observed from a population of Japanese trees for longer periods probably resulted from con-
psyllids that acquired the pathogen as adults, although tinuous acquisition postemergence, bacterial replica-
groups of three adult D. citri newly emerged from tion, or possibly a combination. Although the occur-
nymphs reared on Las-infected plants transmitted at a rence of transovarial transmission could not be
rate of 66% after a 30-d IAP (Inoue et al. 2009). In completely addressed in the Þeld acquisition experi-
contrast, transmission by psyllids in Taiwan less efÞ- ment, the results of our transovarial transmission study
cient than observed in our study; after inoculation indicate that the acquisition rate in adult offspring was
assays; only Þve of 380 plants exposed to adult psyllids probably augmented by maternal passage of the bac-
for a 1-mo IAP exhibited HLB symptoms (Huang et al. teria directly to offspring.
1984). Differences in inoculation efÞciency among Retention of Las in adult psyllids that acquired the
populations of insect vectors of plant viruses have pathogen as nymphs declined over time, despite re-
been documented, although there are few examples of ports of bacterial multiplication in previous studies
population-level differences in the transmission of conducted with different populations of D. citri or T.
plant bacterial pathogens (Purcell 1982, Galetto et al. erytrae and Liberibacter (Moll and Martin 1973, Inoue
2009). The mollicute Spiroplasma citri, for example, is et al. 2009). Lower rates of inoculation efÞciency after
transmitted with differential efÞciency by different increased time postpathogen acquisition have been
populations of beet leafhopper, Circulifer tenellus reported in other plantÐpathogenÐinsect systems, in-
(Baker) (De Almeida et al. 1997). It is possible that cluding Spiroplasma citri and its insect host beet leaf-
genetic differences in the Florida population of D. citri hopper (Purcell 1982, Whitcomb et al. 1973). Here, we
produce phenotypes that have a reduced capacity for used qPCR to assess the level of Las in psyllids in
transmission. Furthermore, the physiological condi- response to time postacquisition, rather than directly
tion of plants may confer resistance to Las inoculated assessing the relationship between time postacquisi-
by psyllids. tion and inoculation rate, due to the generally low rate
Alternatively, differences in acquisition and inocu- of inoculation observed in our previous experiments.
lation efÞciency among psyllid populations may be Declines in pathogen titer over time may be the
due to the host plant used in assays. We selected sweet result of initial concentrations of Las in the psyllid,
orange as our source for pathogen acquisition because host aging, or negative effects of the bacterium on
it is representative of the typical host encountered by the insect host (e.g., Purcell 1982), even though
D. citri in commercial citrus groves in Florida. Cer- multiplication may occur. Alternatively, decreases
tainly, the host plantÐpathogen interaction could in- in the number of psyllids carrying Las strongly sug-
ßuence the efÞciency of acquisition and inoculation. gest that the pathogen does not persist in D. citri.
Differential susceptibility of hosts is commonly asso- Although these psyllids may test positive for Las
ciated with generalist pathogens (Tooley and Kyde immediately after acquisition, the absence of mul-
2007, Lopes et al. 2009), but there is little information tiplication in adult D. citri would explain our ob-
regarding differences associated with narrow host servation of increasingly higher rates of Las-nega-
ranges. Although numerous Citrus species and their tive psyllids over time. Although multiplication of
relatives have been reported as hosts for Las (Halbert Las in nymphs was not directly assessed in our
and Manjunath 2004), pathogen acquisition from studies, our results to not exclude the possibility that
these various hosts and subsequent inoculation of cit- replication of Las does occur in D. citri nymphs.
rus plants remains unexplored. Thus, use of varying Additional studies that quantify bacterial titers over
citrus varieties (e.g., sour orange, sweet orange and time are needed to determine whether Las propa-
rough lemon citrus) for assays may underlie differ- gates in nymphs and to conÞrm our observation that
ences in reported transmission efÞciency. Las are not propagative in D. citri.
In addition to laboratory assays, we conducted ac- The latent period of Las before successful inocula-
quisition experiments under Þeld conditions which tion of citrus plants by D. citri was not deÞned in our
corroborate the correlation between access time study, presumably due to the low inoculation efÞ-
October 2010 PELZ-STELINSKI ET AL.: TRANSMISSION OF LAS BY D. citri 1539

ciency by individual psyllids. Previous reports of the the Þrst study to provide evidence for the existence of
latent period in D. citri ranged from 24 h to 25 d transovarial transmission in D. citri.
(Roistacher 1991, Xu et al. 1988). Although only plants
exposed to psyllids that tested positive for Las by
qPCR were screened in the latency experiments, we Acknowledgments
suspect that an insufÞcient titer of bacteria was inoc- We thank Ruben Blanco, Carmen Bierman, and Rhonda
ulated into susceptible plants for the development of Schumann for capable technical assistance in processing
HLB. Below a certain threshold pathogen titer, it is samples. In addition, we appreciate the helpful comments
possible that plants may be able to resist Las infections. provided by several anonymous reviewers of this manuscript.
Further studies are needed to elucidate plant resis- This work was supported by the Florida Citrus Production
tance mechanisms that may confer protection against Research Advisory Council (FCPRAC) and the Florida Spe-
Las infection. Under Þeld conditions, longer feeding cialty Crop Foundation.
periods and exposure to multiple infected psyllids
would be expected to result in higher pathogen trans- References Cited
mission rates.
One of the primary goals of this study was to de- Almeida, R.P.P., M. J. Blua, J.R.S. Lopes, and A. Purcell.
termine whether D. citri can transmit the HLB asso- 2005. Vector transmission of Xylella fastidiosa: applying
ciated bacterium vertically from parent to offspring. fundamental knowledge to generate disease management
strategies. Ann. Entomol. Soc. Am. 98: 775Ð786.
Although Las-positive nymphs have been reported Anonymous. 2008. PuriÞcation of total DNA from ticks for
from asymptomatic citrus in Florida, it was not deter- detection of Borrelia DNA (DY16 Jun-08). (http://
mined whether the plant tissues from which the www.qiagen.com/literature/default.aspx).
nymphs were collected were also Las-positive before Batool, A., Y. Iftikhar, S. M. Mughal, M. M. Khan, M. J.
psyllid infestation (Manjunath et al. 2008). Xu et al. Jaskani, M. Abbas, and I. A. Khan. 2007. Citrus greening
(1988) reported that no transovarial transmission oc- diseaseÑa major cause of citrus decline in the worldÑa
curs in D. citri; albeit, in their study, the infection review. Hortic. Sci. 34: 159 Ð166.
Bové, J. M. 2006. Huanglongbing: a destructive, newly-
status of the parental generation was unknown and
emerging, century-old disease of citrus. J. Plant Pathol. 88:
successful pathogen inoculations were scored on the 7Ð37.
basis of visual symptoms. If transovarial transmission Buitendag, C. H., and L. A. von Broembsen. 1993. Living
does not occur, psyllids nymphs could possibly act as with citrus greening in South Africa. Citrus J. 3: 29 Ð32.
sentinels for asymptomatic plants in citrus groves be- Brlansky, R. H., and M. E. Rogers. 2007. Citrus huanglong-
cause the bacteria are more readily detected in psyl- bing: understanding the vector-pathogen interaction for
lids than in plant tissue; however, the feasibility of disease management. Plant Health Prog. (http://www.
sampling psyllid nymphs remains untested (Manju- apsnet.org/online/feature/HLB/).
Capoor, S. P., D. G. Rao, and S. M. Viswanath. 1974.
nath et al. 2008). Field-collected nymphs that test Greening disease of citrus in the Deccan Trap Country
positive for the presence of Las would indicate that and its relationship with the vector, Diaphorina citri
their natal host tree also is infected with the bacte- Kuwayama, pp. 43Ð 49. In L. G. Weathers and M. Cohen
rium. Our observation of transovarial passage in the [eds.], Proceedings of the 6th Conference of the In-
current study suggests that a small number of psyllids ternational Organization of Citrus Virologists, 21Ð28
have the capacity to inoculate Las immediately after August 1973, Swaziland. Division of Agricultural Sci-
emerging as adults on a healthy plant if they were the ence, University of California, Berkeley, CA.
offspring of a Las-positive female. Chavan, V. M., and A. S. Summanwar. 1993. Population
dynamics and aspects of the biology of citrus psylla,
Control measures for arthropod-borne plant patho- Diaphorina citri Kuw., in Maharashtra, pp. 286 Ð290. In
gens are more effective when the nature of the patho- P. Moreno, J. V. da Graça, and L. W. Timmer [eds.],
genÐvector relationship is understood. The current Proceedings of the12th Conference of the Interna-
strategies for managing the spread of HLB rely on tional Organization of Citrus Virologists, 23Ð27 No-
vector control and removal of Las-infected trees vember 1992, New Delhi, India. University of Califor-
(Brlansky and Rogers 2007); therefore, a clear under- nia, Riverside, CA.
standing of the salient aspects of Las transmission by Damsteegt, V., E. Postnikova, A. Stone, M. Kuhlmann, C.
Wilson, A. Sechler, N. Schaad, R. Brlansky, and W.
Florida D. citri is essential for constructing and tai-
Schneider. 2010. The relevance of Murraya paniculata
loring disease prevention tactics. Collectively, our re- and related species as potential hosts and inoculum res-
sults indicate that adult D. citri that acquire Las ervoirs of Candidatus Liberibacter asiaticus, causal agent
through feeding on infected plants are less likely to of huanglongbing (HLB). Plant Dis. (in press).
successfully inoculate the pathogen compared with Davis, M. J., S. N. Mondal, H. Chen, M. E. Rogers, and R. H.
adults that acquired the pathogen as nymphs. Pre- Brlansky. 2008. Co-cultivation of ÔCandidatus Liberib-
venting oviposition and subsequent development of acter asiaticusÕ with actinobacteria from citrus with huan-
nymphs on Las-infected citrus plants may provide glongbing. Plant Dis. 92: 1547Ð1550.
De Almeida, L., B. Raccah, and M. Klein. 1997. Transmis-
signiÞcant disease control if included as part of an
sion characteristics of Spiroplasma citri and its effect on
integrated pest management strategy. Future studies leafhopper vectors from the Circulifer tenellus complex.
are needed to elucidate whether there is a genetic Ann. Appl. Biol. 130: 49 Ð59.
basis to the clear variation in transmission biology that Garnier, M., N. Danel, and J. M. Bové. 1984. The organism
occurs among D. citri populations. In addition, this is is a gram-negative bacterium, pp. 115Ð124. In S. M. Garn-
1540 JOURNAL OF ECONOMIC ENTOMOLOGY Vol. 103, no. 5

sey, L. W. Timmer, and J. A. Dodds [eds.], Proceedings management of citrus huanglongbing in Florida. Phyto-
of the 9th Conference of the International Organization pathology 98: 387Ð396.
of Citrus Virologists, 9 Ð13 May 1993, Argentina. Univer- Mead, F. W. 1977. The Asiatic citrus psyllid, Diaphorina citri
sity of California, Riverside, CA. Kuwayama (Homoptera: Psyllidae), pp. 1Ð 44. Entomol-
Galetto, L., M. Nardi, P. Saracco, A. Bressan, C. Marzachı̀, and ogy Circular 180. Florida Department of Agriculture and
D. Bosco. 2009. Variation in vector competency de- Consumer Services, Division of Plant Industry, Gaines-
pends on chrysanthemum yellows phytoplasma distribu- ville, FL.
tion within Euscelidius variegates. Entomol. Exp. Appl. Morris, R. A., C. Erick, and M. Estes. 2009a. Greening in-
131: 200 Ð207. fection at 1.6%, survey to estimate the rate of greening and
Halbert, S. E. 2005. The discovery of huanglongbing in Flor- canker infection in Florida citrus groves. Citrus Ind. 90:
ida. In Proceedings of the 2nd International Citrus Canker 16 Ð18.
and Huanglongbing Research Workshop, Florida Citrus Morris, R. A., C. Erick, and M. Estes. 2009b. The incidence
Mutual, Orlando, FL. Florida Department of Agriculture of greening and canker infection in Florida citrus groves
and Consumer Services Division of Plant Industry, from September 2007 through August 2008 (EDIS doc-
Gainesville, FL. ument FE823). University of Florida, Institute of Food
Halbert, S. E., and K. L. Manjunath. 2004. Asian citrus psyl- and Agricultural Sciences, Gainesville, FL. (http://
lids (Sternorrhyncha: Psyllidae) and greening disease of edis.ifas.uß.edu/fe823).
citrus: a literature review and assessment of risk in Flor- Moll, J. N., and M. M. Martin. 1973. Electron microscope
ida. Fla. Entomol. 87: 330 Ð353. evidence that citrus psylla (Trioza erytreae) is a vector of
Hansen, A. K., J. T. Trumble, R. Stouthamer, and T. D. greening disease in South Africa. Phytophylactica 5:
Paine. 2008. A new huanglongbing (HLB) Candidatus 41Ð 44.
species, “C. Liberibacter psyllaurous”, found to infect Purcell, A. H. 1982. Insect vector relationships with pro-
tomato and potato is vectored by the psyllid Bacte- caryotic plant pathogens Annu. Rev. Phytopathol. 20:
ricerca cockerelli (Sulc). Appl. Environ. Microbiol. 74: 397Ð 417.
5862Ð5865. Roistacher, C. N. 1991. Greening, pp. 35Ð 45. In Techniques
Huang, C.H.M., Y. Tsai, and C. L. Wang. 1984. Transmission for biological detection of speciÞc citrus graft transmis-
of citrus likubin by a psyllid, Diaphorina citri. J. Agric. Res. sible diseases. Food and Agricultural Organization of the
China 33: 65Ð72. United Nations, Rome, Italy.
Hung, T. H., S. C. Hung, C. N. Chen, M. S. Hsu, and H. J. Su. Sagaram, U. M., K. M. DeAngelis, P. Trivedi, G. L. Andersen,
2004. Detection by PCR of Candidatus Liberibacter asi- S. Lu, and N. Wang. 2009. Bacterial diversity analysis of
aticus, the bacterium causing citrus huanglongbing in huanglongbing pathogen-infected citrus, using phylochip
vector psyllids: application to the study of vectorÐpatho- arrays and 16s rRNA gene clone library sequencing. Appl.
gen relationships. Plant Pathol. 53: 96 Ð102. Environ. Microbiol. 75: 1566 Ð1574.
Inoue, H., J. Ohnishi, T. Ito, K. Tomimura, S. Miyata, T. SAS Institute. 2005. SAS users guide. SAS Institute, Cary,
Iwanami, and W. Ashihara. 2009. Enhanced prolifer- NC.
ation and efÞcient transmission of Candidatus Liberib- Sechler, A., E. L. Schuenzel, P. Cooke, S. Donnua, N.
acter asiaticus by adult Diaphorina citri after acquisi- Thaveechai, E. Postnikova, A. L. Stone, W. L. Schneider,
tion feeding in the nymphal stage. Ann. Appl. Biol. 155: V. D. Damsteegt, and N. W. Schaad. 2009. Cultivation of
29 Ð36. ÔCandidatus Liberibacter asiaticusÕ, ÔCa. L. africanusÕ, and
Jagoueix, S., J. M. Bové, and M. Garnier. 1994. The ÔCa. L. americanusÕ associated with huanglongbing. Phy-
phloem-limited bacterium of greening disease of citrus topathology 99: 480 Ð 486.
is a member of alpha subdivision of Proteobacteria. Int. Teixeira, D. C., C. Saillard, S. Eveillard, J. L. Danet, P. I. da
J. Syst. Bacteriol. 44: 379 Ð386. Costa, A. J. Ayres, and J. M. Bové. 2005. ÔCandidatus
Jagoueix, S., J. M. Bové, and M. Garnier. 1996. PCR de- Liberibacter americanusÕ, associated with citrus huan-
tection of the Candidatus Liberibacter species associ- glongbing (greening disease) in São Paulo State, Brazil.
ated with greening disease of citrus. Mol. Cell Probes Int. J. Syst. Evol. Microbiol. 55: 1857Ð1862.
10: 43Ð50. Teixeira, D. C., C. Saillard, C. Couture, E. C. Martins, N. A.
Li, W., J. S. Hartung, and L. Levy. 2006. Quantitative real- Wulff, S. Eveillard-Jagoueix, P. T. Yamamoto, A. J. Ayres,
time PCR for detection and identiÞcation of Candidatus and J. M. Bové. 2008. Distribution and quantiÞcation of
Liberibacter species associated with huanglongbing. J. Candidatus Liberibacter americanus, agent of huanglong-
Microbiol. Methods 66: 104 Ð115. bing disease of citrus in São Paulo state, Brasil, in leaves
Liefting, L. W., L. I. Ward, J. B. Shiller, and G.R.G. Clover. of an affected sweet orange tree as determined by PCR.
2008. A new ÔCandidatus LiberibacterÕ species in Sola- Mol. Cell Probes 22: 139 Ð150.
num betaceum (Tamarillo) and Physalis peruviana (Cape Thao, M. L., N. A. Moran, P. Abbot, E. B. Brennan, D. H.
Gooseberry) in New Zealand. Plant Dis. 92: 1588. Burckhardt, and P. Baumann. 2000. Cospeciation of
Liefting, L. W., P. W. Sutherland, L. I. Ward, K. L. Paice, B. S. psyllids and their primary prokaryotic endosymbionts.
Weir, and G.R.G. Clover. 2009. A new ÔCandidatus Appl. Environ. Microbiol. 66: 2898 Ð2905.
LiberibacterÕ species associated with diseases of solana- Tooley, P. W., and K. L. Kyde. 2007. Susceptibility of some
ceous crops. Plant Dis. 93: 208 Ð214. eastern forest species to Phytophthora ramorum. Plant
Lopes, J.R.S., M. P. Daugherty, and R.P.P. Almeida. 2009. Dis. 91: 435Ð 438.
Context-dependent transmission of a generalist plant van den Berg, M. A., S. P. vanVuuren, and V. E. Deacon.
pathogen: host species and pathogen strain mediate in- 1992. Studies on greening disease transmission by the
sect vector competence. Entomol. Exp. Appl. 131: 216 Ð citrus psylla, Trioza erytreae (Hemiptera: Triozidae). Isr.
224. J. Entomol. 25: 51Ð56.
Manjunath, K. L., S. E. Halbert, C. Ramadugu, S. Webb, and Wang. Z., Y. Yin, H. Hu, Q. Yuan, G. Peng, and Y. Xia. 2006.
R. F. Lee. 2008. Detection of ÔCandidatus Liberibacter Development and application of molecular-based diag-
asiaticusÕ in Diaphorina citri and its importance in the nosis for ÔCandidatus Liberibacter asiaticusÕ, the causal
October 2010 PELZ-STELINSKI ET AL.: TRANSMISSION OF LAS BY D. citri 1541

pathogen of citrus huanglongbing. Plant Pathol. 55: 630 Ð Diaphorina citri Kuwayama, pp. 243Ð248. In L. W. Tim-
638. mer, S. M. Garnsey, and L. Navarro [eds.], Proceedings
Whitcomb, R. F., J. G. Tully, J. M. Bové, and P. Saglio. 1973. of the 10th Conference of the International Organization
Spiroplasma and acholeplasmas: multiplication in insects. of Citrus Virologists, 17Ð21 November 1986, Valencia,
Science 182: 1251Ð1253. Spain. University of California, Riverside, CA.
Xu, C. F., Y. H. Xia, K. B. Li, and C. Ke. 1988. Further study
of the transmission of citrus huanglongbing by a psyllid, Received 31 March 2010; accepted 30 June 2010.

View publication stats