ODISHA ADARSHA VIDYALAYA SANGATHAN

HALF YEARLY EXAMINATION, 2023-24

Class: XII Maximum Mark:70
Subject: Biology (044) Time: 3 Hrs

GENERAL INSTRUCTIONS:
1. All questions are compulsory.
2. The question paper has five sections and 33 questions. All questions are compulsory.
3. Section–A has 16 questions of 1 mark each; Section–B has 5 questions of 2 marks each; Section– C has
7 questions of 3 marks each; Section– D has 2 case-based questions of 4 marks each; and Section–E has
3 questions of 5 marks each.
4. There is no overall choice. However, internal choices have been provided in some questions. A student
has to attempt only one of the alternatives in such questions.
5. Wherever necessary, neat and properly labelled diagrams should be drawn.

SECTION-A
1. Double fertilisation is 1
(A) Fusion of two male gametes of a pollen tube with two different eggs
(B) Fusion of one male gamete with two polar
(C) Fusion of two male gametes with one egg
(D) Syngamy and triple fusion

2. Second maturation division of mammalian ovum occurs 1

(A) Until sperm has penetrated ovum
(B) Until nuclei of sperm and ovum fuse
(C) In Graafian follicle soon after first maturation division
(D) Shortly after ovulation before entry into fallopian tube

3. 1

Given below is a chart which exhibits the concentration of hormones in circulating 100 % blood as
percentage of their maximum possible concentration. Can you find out the phase of ovarian cycle
of a mammal the chart represents?
(A) Ovulation phase (C) Follicular phase
(B) Secretory phase (D) Menstruation
4. Frame shift mutation occurs when 1
(A) Base is added (B) Base is deleted
(C) Base is added or deleted (D) None of the above
5. Which of the following pairs is wrongly matched? 1
(A) Starch synthesis in pea: Multiple alleles
(B) ABO blood grouping: Co-dominance
(C) XO type sex determination: Grasshopper
(D) T.H. Morgan: Linkage

Page 1 of 5
6. A woman has an X-linked condition on one of her X chromosomes. This chromosome can be 1
inherited by
(A) Only daughters
(B) Only sons
(C) Only grandchildren
(D) Both sons and daughters
7. Choose the correct symbols: 1
RNA--a---> DNA---b--->DNA---c--->mRNA--d--->Polypeptide
(A) a = Replication, b = Transcription, c = Translation, d-Transduction
(B) a = Reverse transcription, b = Translation, c = Transcription, d-Replication
(C) a = Replication, b- Transformation, c-Transcription, d= Translation
(D) a = Reverse transcription, b=Replication, c = Transcription, d= Translation

8. Taylor demonstrated chromosome replication to be semi-Conservative in 1

(A) Vicia faba
(B) Pea
(C) E. Coli
(D) Mouse liver cell
9. Find out the correct options 1
1. Amino acids may have more than one codon
2. All amino acids have more than one codon
3. Codons are common for higher and lower organisms
4. Codons are not found in bacteria
(A) 1, 2, 3 correct
(B) 2, 4 correct
(C) 1, 2 correct
(D) 1,3 correct
10. Which of the following nitrogenous base is double Ringed? 1
(A) Guanine
(B) Thymine
(C) Uracil
(D) Cytosine
11. The factor that leads to Founder effect in a Population is 1
(A) Natural selection
(B) Mutation
(C) Genetic drift
(D) Genetic recombination
12. Which one of the following statement regarding BOD is True? 1
(A) The greater the BOD of waste water, more is its Polluting potential.
(B) The greater the BOD of waste water, less is its Polluting potential.
(C) The lesser the BOD of waste water, more is its Polluting potential
(D) All of the above
Question No. 13 to 16 consist of two statements – Assertion (A) and Reason (R). Answer these
questions selecting the appropriate option given below:
A Both A and R are true and R is the correct explanation of A.
B. Both A and R are true and R is not the correct explanation of A.
C. A is true but R is false.
D. A is False but R is true.

Page 2 of 5
13. Assertion (A) Foreign DNA and vector DNA cut with the help of ligase 1
Reason (R) Ligase acts by forming phosphodiester bond
14. Assertion (A): Antibiotic resistance is becoming a major health issue across the world. 1
Reason (R): Health sector has often witnessed unchecked, unnecessary prescriptions of antibiotics
to the patients.
15. Assertion (A) In gel electrophoresis, DNA fragments are separated 1
Reason (R) DNA is negatively charged, so it moves towards anode under electric field.
16. Assertion (A) Downs syndrome, Klinefelter’s syndrome and Turner’s syndrome are chromosomal 1
disorders
Reason (R) Downs syndrome is caused due to additional copy of 21st chromosome
SECTION-B
17. Distinguish between primary sludge and activated Sludge. 2

18. Do eukaryotic cells have restriction endonucleases? Justify your answer. 2

19. Where B cell and T cells are are formed? How do they differ from each other? 2

20. The human male never passes on the gene for haemophilia to his son. Why is it so? 2

21. Write any four characteristics of an ideal contraceptive. 2

OR

Explain the process of hormonal regulation of spermatogenesis.

SECTION-C

22. Continued self pollination lead to inbreeding depression. List three devices which flowering plant 3
have developed to discourage self pollination?

23. Figure’s given below are Darwins’s finches? 3

(a) Mention the specific geographic areas where these were found?
(b) Name and explain the phenomenon that has resulted in the evolution of such diverse
species in the region.
(c) How did Darwin visit the particular geographical area?

24. Choose any three microbes, from the following, which are suited for organic farming which is in 3
great demand these days for various reasons. Mention one application of each one chosen.
Mycorrhiza, Monascus, Anabaena, Rhizobium, Methanobacterium, Trichoderma

Page 3 of 5
25. Study the flow chart given below. Name the hormones involved at each stage in human female. 3

26. Give another name of sexually transmitted diseases. Name two sexually transmitted diseases 3
which are curable and two diseases which are not curable.

27. Since DNA is a hydrophilic molecule, it cannot pass through cell membranes. Name and 3
explain the techniques with which the DNA is forced into (i) bacterial cell (ii) plant cell (iii)
animal cell.
OR
Why is “Agrobacterium mediated genetic engineering transformation” in plants considered as
natural genetic engineering?
28. A selectable marker is used in the selection of recombinants on the basis of their ability to 3
produce colour in presence of chromogenic substrate.
(a) Mention the name of mechanism involved?
(b) Which enzyme is involved in production of colour?
(c) How is it advantageous over using antibiotic resistant gene as a selectable marker?
SECTION-D
Q.29 and Q30. ARE CASE BASED QUESTIONS. Each question has 3 sub parts with internal choice in one subpart.
29. The immune system of a patient is suppressed. He was found positive for a pathogen in the 4
diagnostic test ELISA.
(a) Name the disease, the patient is suffering from.
(b) Which pathogen is identified by ELISA test?
(c) Which cells of the body are attacked by the pathogen?
OR
(d) Name the organisation that educate people about aids transmission.
30 Read the passage given below and answer the questions that follows 4
Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only
one end of each molecule is cut and these ends have regions of single stranded DNA. BamHI is one
such Restriction enzyme which binds at the recognition Sequence,
5’-GGATCC-3’ and cleaves these sequences just after the 5’- guanine on each strand.
(a) What is the objective of this action?
(b) Explain how the gene of interest is introduced into a vector.
(c) You are given the DNA shown below.

5’ ATTTTGAGGATCCGTAATGTCCT 3’
3’ TAAAACTCCTAGGCATTACAGGA 5’

Page 4 of 5
 If this DNA was cut with BamHI, how many DNA Fragments would you expect? Write the
sequence Of these double-stranded DNA fragments with Their respective polarity.
(d) A gene M was introduced into E. Coli cloningVector pBR322 at BamHI site. What will be its
impact on the recombinant plasmids? Give a possible way by which you could differentiate non-
recombinant to recombinant plasmids.
SECTION-E
31 1. (a) Draw the embryo sac of a flowering plant and label the parts: 5
(i) Which guide the entry of pollen tube?
(ii) Which develop into endosperm ?
(iii) Which fuses with male gamete to form zygote?

(b) What will be the fate of antipodal cells after fertilization?

(c) name the cell that develops into embryo sac. How many embryo sac are formed from one
megaspore mother cell?(5)
OR
What is polyembryony and how it can be commercially exploited?
32 Observe the representation of genes involved in the lac operon given below. 5

(i) Identify the region where the repressor protein will attach normally.
(ii) Under certain conditions repressor is unable to attach at this site. Explain.
(iii) If repressor fails to attach to the said site what products will be formed by z, y and a?
(iv) Analyse why this kind of regulation is called Negative regulation.
Or

(a) Identify the polarity of x and x’ in the diagram below and mention how many more amino
acids are expected to be added to this polypeptide chain.
(b) Mention the codon and anticodon for alanine.
(c) Why UAA, UAG, and UGA are called stop codons?
(d) Why are some untranslated sequences of bases seen in mRNA coding for a polypeptide?
Where exactly are they present in mRNA?
33 The pathogen of a disease depends on RBCs of human for growth and reproduction. The person 5
with this pathogen suffers from chills and high fever.
(a) Identify the disease.
(b) Name the pathogen.
(c) What is the cause of the fever?
(d) Represent the lifecycle of the pathogen diagrammatically.
OR
Explain the role of Primary and Secondary Lymphoid organs with the help of suitable examples.
<<<<All the Best>>>>

Page 5 of 5