Fish Physiol Biochem

DOI 10.1007/s10695-014-9996-6

Molecular cloning and functional characterization

of the hepcidin gene from the convict cichlid (Amatitlania
nigrofasciata) and its expression pattern in response
to lipopolysaccharide challenge
Jing-Ruei Chi • Long-Si Liao •
Rong-Guang Wang • Chu-Sian Jhu •

Jen-Leih Wu • Shao-Yang Hu

Received: 18 May 2014 / Accepted: 23 September 2014

Ó Springer Science+Business Media Dordrecht 2014

Abstract The hepcidin gene is widely expressed in skin after lipopolysaccharide challenge. The synthetic
many fish species and functions as an antimicrobial AN-hepc peptide showed a wide spectrum of antimicro-
peptide, suggesting that it plays an important role in the bial activity in vitro toward gram-positive and gram-
innate immune system of fish. In the present study, the negative bacteria. In particular, this peptide demonstrated
Amatitlania nigrofasciata hepcidin gene (AN-hepc) was potent antimicrobial activity against the aquatic patho-
cloned from the liver and its expression during an gens Vibrio alginolyticus, V. parahaemolyticus, V.
immune response was characterized. The results of vulnificus, Aeromonas hydrophila and Streptococcus
quantitative PCR and RT-PCR showed that the AN-hepc agalactiae. The in vivo bacterial challenge results
transcript was most abundant in the liver. The expression demonstrated that the synthetic AN-hepc peptide signif-
of AN-hepc mRNA was significantly increased in the icantly improved the survival rate of S. agalactiae- and V.
liver, stomach, heart, intestine, gill and muscle but was vulnificus-infected zebrafish. Taken together, these data
not significantly altered in the spleen, kidney, brain or indicate an important role for AN-hepc in the innate
immunity of A. nigrofasciata and suggest its potential
application in aquaculture for increasing resistance to
Jing-Ruei Chi and Long-Si Liao have contributed equally to disease.
this work.
Keywords Hepcidin  Amatitlania nigrofasciata 
Electronic supplementary material The online version of
this article (doi:10.1007/s10695-014-9996-6) contains supple- Cloning  Gene expression  Antimicrobial activity
mentary material, which is available to authorized users.

J.-R. Chi
Department of Biochemical Science and Technology,
National Taiwan University, Taipei, Taiwan Introduction

J.-R. Chi  J.-L. Wu (&) Over the past decade, the major challenge for the
Institute of Cellular and Organismic Biology, Academia
aquaculture industry has been the prevalence of
Sinica, Taipei, Taiwan
e-mail: [email protected] disease, which results in severe annual economic
losses. Antimicrobial peptides (AMPs) are a main
L.-S. Liao  R.-G. Wang  C.-S. Jhu  S.-Y. Hu (&) component of the innate immune defense of fish
Department of Biological Science and Technology,
against opportunistic pathogens. Several investiga-
National Pingtung University of Science and Technology,
No. 1, Shuefu Road, Neipu, Pingtung 912, Taiwan tions have reported that AMPs exhibit antimicrobial
e-mail: [email protected] activity and an immunomodulatory effect, which

123
 Fish Physiol Biochem

enhances piscine host defenses against pathogen of the antimicrobial activity of the hepcidin peptides
infections (Noga et al. 2011). These biological func- toward the various microbial species may differ
tions suggest a potential value for AMPs in aquacul- between fish species, further indicating that the indi-
ture applications and accelerated efforts to clone vidual species of hepcidins may possess specific
teleost genes encoding AMPs have been initiated. antimicrobial actions. In view of these observations,
Hepcidin is a small cysteine-rich cationic antimicro- the antimicrobial characteristics and spectrum must be
bial peptide that was formerly designated as a liver- determined for each newly identified hepcidin peptide.
expressed antimicrobial peptide (LEAP-1 and LEAP- The ornamental aquatic industry is one of the most
2) because its mRNA expression was detected pri- important forms of aquaculture in the world. Recently,
marily in the liver (Park et al. 2001). Since the first the ornamental fish industry has faced the global
identification of hepcidin in the human liver, hepcidin problem of antibiotic-resistant pathogens due to the
genes have been identified from diverse vertebrates, indiscriminate use of antibiotics, which raises concern
including teleost fish (Krause et al. 2000). Thus far, that therapeutic treatments for ornamental fish diseases
hepcidin cDNA has been isolated and characterized in may be ineffective. Thus, alternative strategies for the
several teleost fish species (Gong et al. 2014; Hoang control of pathogen infection are necessary to sustain
and Kim 2013; Liang et al. 2013; Masso-Silva and the ornamental fish industry. The convict cichlid (A.
Diamond 2014), suggesting that hepcidins are wide- nigrofasciata) is a major ornamental fish species that is
spread among fish. Data mining of the hepcidin cultured in Taiwan and Southeast Asian countries.
sequence demonstrated that hepcidin genes in teleosts Since the first transgenic fluorescent A. nigrofasciata
comprise three exons and two introns, and these genes was successfully established in Taiwan, A. nigrofasci-
consist of three regions: the signal peptide, the ata has become more popular, and more attention has
prodomain and the mature peptide. Tissue distribution been devoted to disease resistance. Therefore, the
studies have shown that fish hepcidin transcripts, present study aimed to analyze the A. nigrofasciata
similar to those of mammals, are widely expressed in hepcidin (AN-hepc) cDNA and its genomic organiza-
multiple tissues, but the highest expression level is tion, elucidate the gene expression patterns in vivo and
predominantly observed in the liver (Bao et al. 2005; determine the antimicrobial activity of a synthetic AN-
Chen et al. 2005; Wang et al. 2009). Regarding hepcidin. The present data provide valuable informa-
function, mammalian hepcidin is known to have tion on the antimicrobial role of AN-hepc as a
antimicrobial activity and to be involved in iron molecular component of the innate immunity of A.
metabolism. However, the fish hepcidin genes in the nigrofasciata and are useful for applications associated
liver and other tissues were induced by bacterial with disease prevention in aquaculture.
infection and inflammation and were poorly induced
by iron overload, suggesting that their biological
function is primarily associated with immunity (Hir- Materials and methods
ono et al. 2005; Hu et al. 2007; Rodrigues et al. 2006).
The in vitro and in vivo antimicrobial activities of Animals and bacterial strain
hepcidin have been investigated using synthetic mature
peptides from diverse fish species including bass Juvenile A. nigrofasciata (average body weight of
(Morone chrysops) (Lauth et al. 2005), Japanese approximately 10 g) and adult AB strain zebrafish
flounder (Paralichthys olivaceus) (Hirono et al. (Danio rerio) were obtained from domestic hatcheries
2005), tilapia (Oreochromis mossambicus) (Huang in Pingtung, Taiwan and the Taiwan Zebrafish Core
et al. 2007), gilthead seabream (Cuesta et al. 2008), Facility at Academia Sinica (Taipei, Taiwan), respec-
marine fish (Pseudosciaena crocea) (Wang et al. 2009) tively. The fish were reared in a recirculating fresh-
and orange-spotted grouper (Epinephelus coioides) water system with a controlled light cycle (14-h light/
(Zhou et al. 2011). Most of these peptides exhibit 10-h dark) at 28 °C. The fish were fed daily with
antibacterial and antifungal efficacy, and some also commercial pellets (Tailong, Taipei, Taiwan). All fish
have antitumor activity (Chang et al. 2011; Chen et al. were handled in compliance with local animal welfare
2009). However, the discrepant antimicrobial spectrum regulations. The bacterial strains used in the bacterio-
of the various fish hepcidins suggests that the specificity static and bactericidal assays were purchased from the

123
Fish Physiol Biochem

Bioresource Collection and Research Center (BCRC), at -20 °C until use. The primers used in the present
Food Industry Research and Development Institute study are listed in Table 1. The AN-Hep-F1 and AN-
(FIRDI), Hsinchu, Taiwan. The A. hydrophila, V. Hep-R1 primers were designed according to the
vulnificus, V. parahaemolyticus, V. alginolyticus and conserved sequences in the coding regions of the
S. agalactiae strains used herein were obtained as TH1-5, TH2-2 and TH2-3 hepcidin genes from tilapia
described in a previous report (Faikoh et al. 2014). (O. mossambicus), a species that belongs to the
These bacterial strains were stored at 20 °C as glycerol Cichlidae family, similar to convict cichlids (Huang
stocks until use. et al. 2007). Partial sequences of the AN-hepc cDNA
from A. nigrofasciata were amplified from the liver
Cloning and sequencing of AN-hepc cDNAs cDNA using PCR. The PCR conditions were as
follows: 94 °C for 5 min, followed by 40 cycles of
Total RNA from the liver of A. nigrofasciata was 94 °C for 30 s, 58 °C for 30 s and 72 °C for 60 s with
isolated using the TRIzol reagent according to the a final cycle of 72 °C for 10 min. The PCR products
manufacturers’ instructions. First-strand cDNA syn- were cloned into a TA cloning vector (RBC, Taipei,
thesis from 5 lg of total RNA was carried out using Taiwan) to confirm the sequences. To obtain the full-
the SuperScriptIII Kit (Invitrogen) according to the length AN-hepc cDNA, 50 -RACE and 30 -RACE were
manufacturer’s instructions, and the cDNA was stored carried out using the rapid amplification of cDNA ends

Table 1 Sequences of the Primers Primer sequence (50 –30 )

primers used in this study
cDNA, PCR, RT-PCR analysis
AN-Hep F1: ATGAAGACGTTCAGTGTTGCAGTTG
R1: GAATCTGCAAGCACAATTCACAG
F2: ATGAAGACATTCAGTGTTGCTGTTG
R2: TCAGAATCTGCAGCACAATCCACAG
AN-gHep F: AGACAGGAGAACTCAAGGGAGCTC
R: GGTTGTTGGAGCAGGAATCCTCA
AN-b-actin F1: ATGGAGAAGATCTGGCATCACAC
R1: ATCCACATCTGCTGGAAGGTGGA
RACE and real-time PCR analysis
GSP 1: ATGAAGACGTTCAGTGTTGCAGTTG
2: GGCCACTGCAACAGCGCAACACT
3: GCAGCCAAACTTCAAACCTTCCTAG
4: GGCATCAGTGGACACAATGG
AN-qHep F1: CTGCTGTCCCACTCACTGAA
R1: ATCTGCAGCACAATCCACA
AN-b-actin F2: AGGCACAGAGCAAAAGAGGA
R2: CCACATACATGGCAGGAGTG
Tumor necrosis factor-a (TNF-a) F: AAGGAGAGTTGCCTTTACCG
R: ATTGCCCTGGGTCTTATGG
Interleukin-15 (IL-15) F: ATGTCATTGGAACTCAGAGGTTTG
R: CTGTTCTGGATGTCCTGCTTGA
Interleukin-1b (IL-1b) F: TGGACTTCGCAGCACAAAATG
R: CACTTCACGCTCTTGGATGA
Interleukin-6 (IL-6) F: CAACTTCTCCAGCGTGATG
R: TCTTTCCCTCTTTTCCTCCTG
Elongation factor 1a (EF-1a) F: AACAGCTGATCGTTGGAGTC
R: TTGATGTATGCGCTGACTTCCT

123
 Fish Physiol Biochem

method (Invitrogen). The 50 -end cDNA amplification to amplify the AN-hepc gene. PCR was performed as
was performed using two gene-specific primers, GSP- follows: 94 °C for 3 min, 35 cycles of 94 °C for 30 s,
1 and GSP-2, to obtain the 50 -UTR and remnant 58 °C for 30 s and 72 °C for 1 min, followed by 72 °C
N-terminal nucleotides of the AN-hepc cDNA. The for 10 min. The final holding temperature was 4 °C.
GSP-3 and GSP-4 primers were designed for 30 -end The ubiquitously expressed b-actin gene was mea-
cDNA amplification to clone the complete 30 -UTR of sured using the AN-b-actin-F1 and AN-b-actin-R1
the AN-hepc cDNA. These PCRs were carried out as primers to serve as an internal normalization control.
follows: 94 °C for 5 min, 5 cycles of 94 °C for 30 s, Real-time PCR was performed using SYBR Green
60 °C for 30 s, and 72 °C for 90 s and 30 cycles of PCR reagents in an Applied Biosystems StepOne
94 °C for 30 s, 58 °C for 30 s and 72 °C for 90 s, Real-Time PCR system. The AN-qHep-F1 and AN-
followed by 72 °C for 7 min. The second-round PCR qHep-R1 primers for the AN-hepc gene and the AN-b-
products were cloned into a T&A cloning vector actin-F2 and AN-b-actin-R2 primers for the reference
(Yeastern) and transfected into competent E. coli b-actin gene were used to quantify the expression of
DH5a cells to confirm the sequence. The full-length AN-hepc during the lipopolysaccharide (LPS) chal-
sequence of the AN-hepc cDNA was registered in the lenge. To perform the challenge experiment, 20
GenBank database (accession no. KF134002) and juvenile A. nigrofasciata were intraperitoneally
compared with other closely related species by injected with approximately 5 lg of LPS (Sigma,
searching GenBank using the nucleotide Blast pro- E. coli O127:B8) in 25 lL of sterile physiological
gram (http://www.ncbi.nlm.nih.gov/BLAST/). saline solution (PSS) per fish (0.5 lg/g). An equal
number of fish were similarly injected with 25 lL of
AN-hepc genomic DNA sequence determination sterile PSS as a control. Tissue samples (n = 3) were
obtained at 0 h (from the normal fish) and 6, 12, 24 and
Genomic DNA was extracted from the liver of A. 48 h post-injection from the LPS-challenged and PSS
nigrofasciata using the phenol–chloroform method (Hu mock-challenged A. nigrofasciata. The AN-hepc gene
et al. 2010). To determine the structure of the AN-hepc expression was compared in the tissue samples from
gene, the AN-gHep-F1 and AN-gHep-R1 primers were the LPS-challenged and PSS-challenged fish. The
used to amplify AN-hepcidin from genomic DNA. PCR results were obtained by subtracting the PSS-chal-
amplification was carried out using Platinum Taq lenged calibrator DCT values from the LPS-chal-
polymerase (Invitrogen) with the following cycling lenged target DCT values to yield a DDCT value, and
parameters: 94 °C for 3 min, 35 cycles of 94 °C for the relative gene expression is presented as 2-DDCT.
30 s, 58 °C for 30 s and 72 °C for 90 s, followed by All expression values are presented as the mean ±
72 °C for 10 min. The final holding temperature was standard error (S.E.).
4 °C. The resulting fragment was analyzed using 1 %
agarose gel electrophoresis and purified using a gel In vitro antimicrobial assay for the synthetic AN-
extraction kit (Viogene). The gel-purified PCR products hepc peptide
were subcloned into the T&A cloning vector (Yeastern)
and sequenced. The genomic DNA sequence obtained The synthetic peptide (GIKCRFCCGCCTAGVCG
was analyzed to identify the exon and intron structure of LCCRF) corresponding to the predicted mature AN-
the AN-hepc cDNA sequence. hepc sequence was produced by the GenScript Cor-
poration (Piscataway, NJ) with a purity of [ 90 %.
Analysis of the tissue distribution of AN-hepc The molecular mass and purity of the synthetic peptide
transcripts by RT-PCR and real-time PCR were verified by mass spectroscopy and HPLC,
respectively. The synthetic AN-hepc peptide was
Total RNA was extracted from the liver, spleen, dissolved in PBS buffer before use. The in vitro
stomach, heart, intestine, gill, brain, eye and skin of antimicrobial activity of this peptide was determined
adult A. nigrofasciata. RT-PCR was used to determine using a resazurin microplate assay according to the
the expression levels of AN-hepc in the different method described in a previous report (Faikoh et al.
tissues using the AN-Hep-F2 and AN-Hep-R2 primers 2014).

123
Fish Physiol Biochem

Preparation of cells for scanning electron Sequence analysis and statistical analysis
microscopy (SEM)
The hepcidin cDNA and predicted protein sequences
Bacteria in the mid-exponential growth phase were were analyzed using bioinformatics software. Gene
diluted with distilled water to an OD600nm of 3 and expression was compared between two groups using
incubated with synthetic AN-hepc (50 lg/mL) at the t test. Multiple-group comparisons were analyzed
25 °C for 1 h. After centrifugation at 2,0009g for using one-way analysis of variance (ANOVA). Dif-
10 min at 4 °C, the resulting pellet was washed twice ferences were defined as significant at p \ 0.05.
with sterile saline and then re-suspended in 3.0 %
glutaraldehyde for 12 h at ambient temperature.
Subsequently, the solution was rinsed three times
with 10 mM sodium phosphate buffer (pH 7.0) and Results
dehydrated in a graded series of ethanol solutions.
After critical point drying and sputter-coating gold Nucleotide sequence of AN-hepc cDNA
(20 nm thickness), microscopy was performed with an
S-3000 N scanning electron microscope (Hitachi, The complete AN-hepc cDNA sequence comprises
Tokyo, Japan). Bacterial cells that were not treated 593 bp, including the complete coding sequence
with synthetic AN-hepc were used as a control. (CDS), 75 bp of 50 -untranslated region (UTR) and a
30 -UTR, in which the polyadenylation consensus
The effect of synthetic AN-hepc on the survival signal (AATAAA) appeared 208 bp downstream from
rates of V. vulnificus- and S. agalactiae-challenged the stop codon (TGA). The amino acid sequence
zebrafish deduced from the AN-hepc cDNA was 86 residues in
length, including a signal peptide comprising 24
Vibrio vulnificus and S. agalactiae were cultured in amino acids, a prodomain comprising 40 amino acids
TSB broth supplemented with or without 1.5 % NaCl, and a mature peptide comprising 22 amino acids. The
respectively, at 28 °C for 24 h. After cultivation, the signal peptide cleavage site of the deduced AN-hepc
V. vulnificus and S. agalactiae cultures were adjusted was predicted to be between Ala 24 and Val 25. The
to concentrations of 1 9 106 CFU/mL with PSS. cleavage site (RQKR) for the mature peptide was
Adult zebrafish were divided into four groups, each of predicted to be between Arg 64 and Gly 65 (Fig. 1).
which was cultured in a 10-L aquarium tank (n = 20 The processed mature peptide of AN-hepc was
in each tank) for the bacterial challenge. The effect of predicted to be positively charged at a neutral pH.
the synthetic AN-hepc on the survival rates of the V. The AN-hepc gene consists of two introns and three
vulnificus- or S. agalactiae-infected zebrafish was exons; this structure and organization is identical to
evaluated by injecting each fish with 10 lL of AN- that of hepcidin genes in mammals and teleosts. The
hepc (0.1 lg/fish) alone or 10 lL of AN-hepc (0.1 lg/ first exon contains the 50 UTR, the signal peptide and 5
fish) 3 h prior to injecting 10 lL of V. vulnificus (104 amino acid residues of the prodomain peptide. The
CFU/fish) or 10 lL of S. agalactiae (104 CFU/fish). prodomain extends from exon 1 through exon 3. Two
Zebrafish injected with 10 lL of PSS or 10 lL of PSS introns are inserted into the prodomain, thus separat-
containing bacteria were used as the positive and ing the peptide into three exons. Exon 3 encodes the
negative controls, respectively, and the experiments mature peptide and the 30 UTR (Fig. 2). The alignment
were performed in triplicate. The survival rate was of the putative amino acids sequences of AN-hepc and
evaluated every day until it remained constant. The several other fish hepcidin genes showed that most of
survival rate of each group was recorded daily after the the listed hepcidins are characterized by eight con-
injection. Total RNA was isolated from the AN-hepc- served cysteine residues at identical positions in the
or PSS-injected zebrafish, and the expression levels of mature peptide. The predicted signal peptide is highly
IL-1b, IL-6, IL-15, TNF-a and elongation factor 1-a conserved between AN-hepc and most other fish
(ef1-a) were determined using quantitative PCR; ef1- hepcidins. The deduced amino acid sequence of AN-
a served as an internal control. The PCR primers used hepc and tilapia (O. niloticus) hepcidin showed the
herein are listed in Table 1. highest homology (87.2 %) (Fig. 3).

123
 Fish Physiol Biochem

Fig. 1 Nucleotide
sequence of cDNA
predicted amino acid
sequence and genomic DNA
organization of convict
cichlid (A. nigrofasciata)
hepcidin (AN-hepc). The
exon sequence is shown in
capital letters. The deduced
amino acid sequences are
translated and labeled with
blue color. Vertical arrows
show the predicted positions
of cleavage sites for the
signal peptide and mature
peptide, and the box
indicates the putative RXKR
motif. The start codon
(ATG), stop codon (TGA)
and polyadenylation signal
(AATAAA) are underlined.
(Color figure online)

Expression of the AN-hepc gene in multiple tissues expression patterns of the AN-hepc gene in diverse
of normal and LPS-challenged A. nigrofasciata tissues of LPS-challenged A. nigrofasciata were
investigated to understand the AN-hepc response to
The tissue-specific gene expression of AN-hepc in bacterial challenge. The results showed that AN-hepc
normal adult A. nigrofasciata was investigated by real- expression was significantly up-regulated in the liver,
time PCR. The results revealed that the AN-hepc stomach, heart, intestine, gill and muscle after the LPS
mRNA transcripts were ubiquitously distributed in all challenge, and the gene expression patterns were
tissues tested, including the liver, spleen, kidney, different between these tested tissues (Fig. 5). The
stomach, gill, heart, intestine, brain, muscle and skin. level of AN-hepc transcripts was significantly
The highest amount of AN-hepc mRNA transcripts increased in the liver and muscle at 6, 12 and 48 h;
was observed in the liver, and relatively low levels of in the stomach and gill at 6 and 12 h; in the heart at
expression were observed in the other tissues. The 12 h; and in the intestine at 6 h. The liver and muscle
expression level in the brain was the lowest among all displayed the highest expression levels at 6 h, with
the tested tissues in the normal fish (Fig. 4). The increases of over 270- and fivefold, respectively,

123
Fish Physiol Biochem

i ii
Homo sapiens I II III
2.1 k
i ii
Mus musculus I II III
1.1 k
i ii
Danio rerio I II III
1.5 k
i ii
Oryzias melastigma I II III
i ii
Oreochromis niloticus I II III
i ii
Epinephelus coioides I II III
i ii
Pseudosciaena crocea I II III
i ii 100 bp
AN-hepc I II III

Fig. 2 Gene structure of convict cichlid (A. nigrofasciata) niloticus (DQ388036), Epinephelus coioides (GU391243) and
hepcidin (AN-hepc) compared with Homo sapiens Pseudosciaena crocea (EU443735) hepcidins. Exons I–III and
(NM_021175.2), Mus musculus (NM_032541.1), Danio rerio introns i–ii are indicated as white boxes and lines, respectively.
(AY258137), Oryzias melastigma (HM990657), Oreochromis The 50 - and 30 -untranslated regions are shown as black boxes

relative to the control. At 12 h, the levels in the S. agalactiae was also examined by SEM. In the
stomach and gills increased over 6.7- and 5.2-fold, control group, the surfaces of E. coli, A. hydrophila
respectively, compared with the control, whereas the and S. agalactiae appeared normal without apparent
level in the heart at 12 h increased over 2.8-fold. At cellular debris. In comparison, a variety of morpho-
6 h, the levels in the intestine increased over 5.9-fold logical changes were visualized in the groups treated
compared with the control. The highest induction of with AN-hepc. For example, a larger number of pores
AN-hepc expression in response to the LPS challenge and micelles appeared on the membrane surface of the
was observed in the liver. Moreover, no significant cells in the treated group compared with that of the
changes in gene expression were detected in the control group (Supplementary Fig. 2S).
spleen, kidney, brain or skin (Supplementary Fig. 1S).
The synthetic AN-hepc improved the survival rate
In vitro antimicrobial activity of the synthetic AN- of bacteria-challenged zebrafish
hepc peptide
The excellent antimicrobial efficacy of AN-hepc
The antimicrobial activity of the synthetic AN-hepc against aquatic pathogens encouraged us to further
peptide against a variety of bacteria was determined study its in vivo protective effect in fish. Zebrafish
using MIC and MBC assays. As shown in Table 2, the were used as a model, and the fish were given single
antimicrobial activity of the synthetic AN-hepc pep- injections of 10 lL of the synthetic AN-hepc peptide
tide against a variety of microorganisms was deter- (0.1 lg/fish). We found that the difference in the
mined using MIC and MBC assays, and it was found survival rate between the AN-hepc-injected group and
that synthetic AN-hepc was active against the gram- the PSS-injected group during the 8-day trial was not
negative and gram-positive bacteria tested. In partic- significant (Fig. 6), and the cytokine genes IL-1b, IL-
ular, AN-hepc showed strong antimicrobial activity 6, IL-15 and TNF-a were up-regulated at 3 h post-
against several important aquatic pathogens: The injection in the AN-hepc-injected group compared to
MICs of AN-hepc were 25 lg/mL for V. alginolyticus the PSS-injected group (Supplementary Fig. 3S).
and V. parahaemolyticus and 30 lg/mL for A. hydro- These results suggest that the synthetic AN-hepc had
phila, V. vulnificus and S. agalactiae. Additionally, the no toxic effects on zebrafish and AN-hepc induced the
synthetic AN-hepc yielded MBCs between 45 and expression of the cytokines IL-1b, IL-6, IL-15 and
95 lg/mL for all tested bacteria. The antimicrobial TNF-a in zebrafish. The survival rates of zebrafish
potency of AN-hepc against E. coli, A. hydrophila and injected with AN-hepcidin prior to V. vulnificus and S.

123
 Fish Physiol Biochem

Fig. 3 Alignment and comparison of the amino acid sequence Lateolabrax japonicus (GenBank accession no. ADN22956);
deduced from convict cichlid (A. nigrofasciata) hepcidin (AN- Psetta maxima (GenBank accession no. CAI65387); Siniperca
hepc) cDNA with the protein sequences of similar hepcidins. chuatsi (GenBank accession no. ACO88905); Acanthopagrus
The amino acid sequence deduced from AN-hepc cDNA is schlegelii (GenBank accession no. AAU00798); Micropterus
obtained from GenBank (accession no. AHF46363). Other salmoides (GenBank accession no. ACD13024); Micropterus
similar hepcidin proteins are predicted and obtained from dolomieu (GenBank accession no. ACD13026); Perca fluviatilis
GenBank as follows: D. rerio (GenBank accession no. (GenBank accession no. ABR04075); Epinephelus moara
NP991146); Ictalurus punctatus (GenBank accession no. (GenBank accession no. ADY16662); Notothenia angustata
AAX39715); Cyprinus carpio (GenBank accession no. (GenBank accession no. ABY84831 and GenBank accession no.
AFY23859); Salmo salar (GenBank accession no. ABY84839); Pagrus major (GenBank accession no.
AAO85553); Larimichthys crocea (GenBank accession no. AAS66305); and Oplegnathus fasciatus (GenBank accession
ABL96317); O. niloticus (GenBank accession no. ADN22956); no. AEM60415)

agalactiae infection were evaluated. The results 58.3 ± 10.41 and 41.7 ± 2.89 %, respectively, at
showed that the survival rates of the two groups of 8 days. These increased survival rates were signifi-
zebrafish injected with PSS buffer were 98.3 ± 2.89 cantly different (Fig. 6). The results demonstrated that
and 95 ± 5.0 % at 8 days. However, the survival rates AN-hepc has a protective function and can improve
of zebrafish at 5 days after infection with bacteria the survival rates of S. agalactiae- and V. vulnificus-
were dramatically reduced, and nearly all the zebrafish infected zebrafish.
were dead at 8 days after injection of either S.
agalactiae or V. vulnificus alone. Interestingly, com-
pared with the group injected with S. agalactiae or Discussion
V. vulnificus alone, the survival rates for the groups
that were pretreated by injection with AN-hepc prior Hepcidin is an important mediator of the innate
to the injection of S. agalactiae or V. vulnificus were immune system, which plays a critical role in host

123
Fish Physiol Biochem

Fig. 4 The tissue (A)

distribution of AN-hepc
gene transcripts in normal
convict cichlids (A.
nigrofasciata) is analyzed
using a real-time PCR and
b RT-PCR. The
ubiquitously expressed b-
actin gene is used as an
endogenous control. The
expression level of AN-hepc
in the brain is set as 1 and is
located on the left side of the
abscissa. The expression
levels of AN-hepc in other
tissues are presented relative
to that in the brain. B brain,
S skin, G gill, M muscle, Sp
spleen, St stomach, H heart,
I intestine, K kidney, L liver (B) M B S G M Sp St H I K L
500 bp
250 bp AN-hepc

750 bp
actin
500 bp

defense against bacterial invasion. In the present et al. 2003; Hirono et al. 2005; Wang et al. 2009; Yang
study, the cDNA of the hepcidin gene from A. et al. 2007; Zhou et al. 2011), and the hepcidin
nigrofasciata, AN-hepc, was cloned and character- transcript levels were increased when the fish were
ized. Additionally, the genomic organization of the infected with bacteria. Moreover, a previous report has
AN-hepc gene was examined. AN-hepc consists of an mentioned that the hepcidin transcript levels in fish
ORF of 261 bases encoding 86 amino acids. The AN- challenged with bacteria were primarily increased in
hepc protein comprises a signal peptide, a prodomain the liver and were only increased to a limited extent in
and a mature peptide. The genomic organization of the other tissues (Hilton and Lambert 2008). For example,
AN-hepc gene is similar to that of previously reported Japanese flounder Hep-JF1 and Hep-JF2 were more
fish and mammalian hepcidins, containing three exons highly expressed in the liver (Hirono et al. 2005), olive
and two introns with a conserved GT/AG at the exon– flounder HAMP2 was highly induced in the liver and
intron boundary region; however, the sizes of the other tissues upon LPS stimulation (Kim et al. 2005),
introns and exons are different between fish and and the expression of white bass HAMP was increased
mammalian species. The putative amino acid predominantly in the liver following bacterial chal-
sequence of AN-hepc is highly similar to that of other lenge (Shike et al. 2002). Similar to the results
known fish hepcidins. The putative mature peptide obtained in most fish species, the present study
contains eight cysteine residues, which form four showed that the highest levels of AN-hepc transcript
disulfide bonds and are conserved in most fish, and the were detected in the liver of normal A. nigrofasciata
putative RQKR motif identified in the sequence is (Fig. 4). Although the expression of AN-hepc was
identical to the conserved RX(K/R)R motif found in induced significantly by LPS in diverse tissues such as
most fish. These features indicate that AN-hepc is a the stomach, heart, intestine, gill and muscle, the
member of the hepcidin family. strongest induction was noted in the liver. The intense
Previous studies have indicated that hepcidin induction of the AN-hepc transcript in the liver before
transcripts are usually expressed at high levels in the and after LPS challenge suggests that liver-expressed
livers of normal fish, such as Atlantic salmon, black AN-hepc is potentially involved in the defense mech-
porgy, Japanese flounder and marine fish (Douglas anism and initial immune response to microbial

123
 Fish Physiol Biochem

Fig. 5 Quantitative
analysis of AN-hepc gene
expression in the tissues of
LPS-challenged convict
cichlids (A. nigrofasciata)
using real-time PCR. All
data are normalized to the b-
actin gene and are presented
as the mean ± standard
error (SE). The results
shown are the mean of three
individual RNA samples
obtained from LPS-
challenged fish. The
expression of the AN-hepc
gene in control fish, which
are injected with LPS-free
PSS, is shown in parallel.
The 0-h group represents
normal fish without any
treatment. The values with
an asterisk (*) indicate a
significant difference
(p \ 0.05)

invasion. The present study also showed that the had strong antimicrobial potency against A. hydro-
expression patterns of LPS-induced AN-hepc differed phila, V. alginolyticus, V. parahaemolyticus, V. vul-
among these tissues. As shown in Fig. 5, the expres- nificus and S. agalactiae aquatic pathogens, which
sion of AN-hepc was significantly increased in the cause diseases and have led to the most severe
liver at 6, 12, 24 and 48 h; in the stomach and gill at 6 economic losses in the aquaculture industry. AN-
and 12 h; in the heart at 12 h; in the intestine at 6 h; hepcidin also exhibited antimicrobial potency against
and in the muscle at 6, 12 and 24 h. The differences in S. aureus, P. aeruginosa, S. typhimurium, E. coli and
the tissue-specific expression patterns are most likely L. monocytogenes. S. aureus and P. aeruginosa are
associated with the antimicrobial properties and other two of the most important opportunistic bacterial
physiological functions of AMPs, as previously infections of humans and often cause acute nosoco-
described (Kawashima et al. 2014; Tomioka et al. mial necrotizing pneumonia in the lungs of cystic
2014). fibrosis patients (Hoffman et al. 2006). S. typhimurium
As shown in Table 2, the synthetic AN-hepc and E. coli are food-borne bacteria that produce Shiga
exhibited effective antimicrobial activity against the toxin, which causes bloody diarrhea and can lead to
tested gram-positive and gram-negative bacteria and kidney failure in humans with weakened immune

123
Fish Physiol Biochem

Table 2 Antimicrobial activity of the synthetic AN-hepc

Microorganisms AN-hepc
MIC MBC
(lg/mL) (lg/L)

Gram-negative bacteria
Aeromonas hydrophila 30 50
Escherichia coli (BCRC 11634) 55 75
Pseudomonas aeruginosa 50 80
(BCRC 12902)
Salmonella typhimurium 50 85
(BCRC 12947)
Vibrio alginolyticus 25 45
Vibrio parahaemolyticus 25 45
Vibrio vulnificus 30 50
Gram-positive bacteria
Staphylococcus aureus 35 85
(BCRC 10780)
Streptococcus agalactiae 30 70
Listeria monocytogenes (BCRC 14846) 55 95

systems (Zhao et al. 2014). L. monocytogenes is a

food-borne opportunistic pathogen capable of causing
life-threatening infections in animals and human
populations at risk (Schuppler and Loessner 2010).
The antimicrobial activity of AN-hepcidin appears to
differ from that of synthetic hepcidin from other fish
species. Hepcidin from striped bass was active against
gram-negative pathogens and fungi in vitro but
showed no activity against gram-negative pathogens
(Lauth et al. 2005). Tilapia hepcidin TH1-5 showed
activity against L. monocytogenes and S. aureus but no
activity against V. vulnificus, whereas contrasting
results were shown for tilapia hepcidin TH2-3 (Huang Fig. 6 Zebrafish survival rates after infection with a S.
agalactiae and b V. vulnificus are measured. The comparisons
et al. 2007). The difference between the antimicrobial of survival rates between groups are performed at the same time
spectrum of AN-hepcidin and hepcidins from other point. The daily survival rate of each group is recorded and is
fish species suggests that hepcidins from different presented as the mean ± standard deviation (SD) from three
sources may have specific antimicrobial actions. In independent experiments. The values with an asterisk (*)
indicate a significant difference (p \ 0.05)
summary, the antimicrobial potency of AN-hepc
against the bacteria examined in this study suggests after S. agalactiae or V. vulnificus infection (Hsieh et al.
that AN-hepc has potential value for enhancing 2010). In addition, reports have shown that treatment
disease resistance in aquaculture, clinical protection with orally administered or injectable hepcidin peptide
and therapy and food preservation. significantly improved the survival rate of bacteria-
Zebrafish has been extensively used as a model to challenged zebrafish by suppressing bacterial growth
study the innate immune response to diseases caused by and stimulating host immunity (Pan et al. 2011, 2012).
S. agalactiae or V. vulnificus (Novoa and Figueras Similarly, injection of zebrafish with AN-hepc (0.1 lg/
2012). A recent report showed that cytokine expression fish) induced the expression of genes encoding the
was altered in transgenic zebrafish overexpressing cytokines IL-1b, IL-6, IL-15 and TNF-a, and the
tilapia hepcidin, and the fish were protected from death survival rates of zebrafish infected with S. agalactiae or

123
 Fish Physiol Biochem

V. vulnificus were significantly improved. Cytokines Chen JY, Lin WJ, Lin TL (2009) A fish antimicrobial peptide,
secreted from macrophages and monocytes regulate the tilapia hepcidin TH2-3, shows potent antitumor activity
against human fibrosarcoma cells. Peptides 30:1636–1642
host response to infection. The induction of cytokine Cuesta A, Meseguer J, Esteban MA (2008) The antimicrobial
expression in zebrafish by synthetic AN-hepc suggests peptide hepcidin exerts an important role in the innate
that AN-hepc may enhance immunity against bacterial immunity against bacteria in the bony fish gilthead sea-
infection and suppress bacterial growth in S. agalactiae- bream. Mol Immunol 45:2333–2342
Douglas SE, Gallant JW, Liebscher RS, Dacanay A, Tsoi SC
or V. vulnificus-infected zebrafish to improve survival (2003) Identification and expression analysis of hepcidin-
rates. In the present study, the A. nigrofasciata hepcidin like antimicrobial peptides in bony fish. Dev Comp
gene (AN-hepc) was identified and its cDNA and Immunol 27:589–601
genomic DNA sequences were characterized. AN-hepc Faikoh EN, Hong YH, Hu SY (2014) Liposome-encapsulated
cinnamaldehyde enhances zebrafish (Danio rerio) immu-
transcripts were widely expressed in a variety of nity and survival when challenged with Vibrio vulnificus
A. nigrofasciata tissues, with the strongest expression and Streptococcus agalactiae. Fish Shellfish Immunol
observed in the liver. The AN-hepc gene expression 38:15–24
patterns in LPS-challenged A. nigrofasciata showed Gong LC, Wang H, Deng L (2014) Molecular characterization,
phylogeny and expression of a hepcidin gene in the blot-
that the liver is the major organ that responds to ched snakehead Channa maculata. Dev Comp Immunol
invading bacteria. The synthetic AN-hepc peptide 44:1–11
exhibited antimicrobial activity against various tested Hilton KB, Lambert LA (2008) Molecular evolution and char-
bacteria, with particularly strong activity against acterization of hepcidin gene products in vertebrates. Gene
415:40–48
aquatic pathogens and an effective capacity to improve Hirono I, Hwang JY, Ono Y, Kurobe T, Ohira T, Nozaki R, Aoki
the survival rate of V. vulnificus- or S. agalactiae- T (2005) Two different types of hepcidins from the Japanese
infected A. nigrofasciata. This is the first study to flounder Paralichthys olivaceus. FEBS J 272:5257–5264
describe the hepcidin gene in an ornamental fish Hoang VL, Kim SK (2013) Antimicrobial peptides from marine
sources. Curr Protein Pept Sci 14:205–211
species. Its effective antimicrobial potency against Hoffman LR, Déziel E, D’Argenio DA et al (2006) Selection for
aquatic pathogens suggests that this peptide may have Staphylococcus aureus small-colony variants due to
potential applications for disease resistance in growth in the presence of Pseudomonas aeruginosa. Proc
aquaculture. Natl Acad Sci U S A 103:19890–19895
Hsieh JC, Pan CY, Chen JY (2010) Tilapia hepcidin (TH)2-3 as
a transgene in transgenic fish enhances resistance to Vibrio
Acknowledgments We thank the Taiwan Zebrafish Core vulnificus infection and causes variations in immune-rela-
Facility at Academia Sinica (TZCAS), which is supported by a ted genes after infection by different bacterial species. Fish
grant from the National Science Council (NSC 101-2321–B- Shellfish Immunol 29:430–439
001-026) in Taiwan, for providing the AB strain zebrafish. This Hu X et al (2007) Channel catfish hepcidin expression in
research was supported by a grant from the National Science infection and anemia. Comp Immunol Microbiol Infect Dis
Council (NSC 102-2324-B-020-001-CC1). We appreciate Dr. 30:55–69
Jyh-Yih Chen and Dr. Chung-Hung Liu for kindly providing the Hu SY, Lin PY, Liao CH, Gong HY, Lin GH, Kawakami K, Wu
bacterial pathogens. JL (2010) Nitroreductase-mediated gonadal dysgenesis for
infertility control of genetically modified zebrafish. Mar
Biotechnol (NY) 12:569–578
Huang PH, Chen JY, Kuo CM (2007) Three different hepcidins
from tilapia, Oreochromis mossambicus: analysis of their
References expressions and biological functions. Mol Immunol
44:1922–1934
Bao B, Peatman E, Li P, He C, Liu Z (2005) Catfish hepcidin Kawashima R, Shimizu T, To M, Saruta J, Jinbu Y, Kusama M,
gene is expressed in a wide range of tissues and exhibits Tsukinoki K (2014) Effects of stress on mouse beta-de-
tissue-specific upregulation after bacterial infection. Dev fensin-3 expression in the upper digestive mucosa. Yonsei
Comp Immunol 29:939–950 Med J 55:387–394
Chang WT, Pan CY, Rajanbabu V, Cheng CW, Chen JY (2011) Kim YO, Hong S, Nam BH, Lee JH, Kim KK, Lee SJ (2005)
Tilapia (Oreochromis mossambicus) antimicrobial peptide, Molecular cloning and expression analysis of two hepcidin
hepcidin 1-5, shows antitumor activity in cancer cells. genes from olive flounder Paralichthys olivaceus. Biosci
Peptides 32:342–352 Biotechnol Biochem 69:1411–1414
Chen SL, Xu MY, Ji XS, Yu GC, Liu Y (2005) Cloning, char- Krause A, Neitz S, Magert HJ, Schulz A, Forssmann WG,
acterization, and expression analysis of hepcidin gene from Schulz-Knappe P, Adermann K (2000) LEAP-1, a novel
red sea bream (Chrysophrys major). Antimicrob Agents highly disulfide-bonded human peptide, exhibits antimi-
Chemother 49:1608–1612 crobial activity. FEBS Lett 480:147–150

123
Fish Physiol Biochem

Lauth X, Babon HH, Stannard JA et al (2005) Bass hepcidin Rodrigues PN, Vazquez-Dorado S, Neves JV, Wilson JM (2006)
synthesis, solution structure, antimicrobial activities and Dual function of fish hepcidin: response to experimental
synergism, and in vivo hepatic response to bacterial iron overload and bacterial infection in sea bass (Dicen-
infections. J Biol Chem 280:9272–9282 trarchus labrax). Dev Comp Immunol 30:1156–1167
Liang T, Ji W, Zhang GR, Wei KJ, Feng K, Wang WM, Zou GW Schuppler M, Loessner MJ (2010) The opportunistic pathogen
(2013) Molecular cloning and expression analysis of liver- Listeria monocytogenes: pathogenicity and interaction
expressed antimicrobial peptide 1 (LEAP-1) and LEAP-2 with the mucosal immune system. Int J Inflam
genes in the blunt snout bream (Megalobrama amblycep- 2010:704321
hala). Fish Shellfish Immunol 35:553–563 Shike H, Lauth X, Westerman ME et al (2002) Bass hepcidin is a
Masso-Silva JA, Diamond G (2014) Antimicrobial peptides novel antimicrobial peptide induced by bacterial challenge.
from fish. Pharmaceuticals (Basel) 7:265–310 Eur J Biochem 269:2232–2237
Noga EJ, Ullal AJ, Corrales J, Fernandes JM (2011) Application Tomioka H, Nakagami H, Tenma A et al (2014) Novel anti-
of antimicrobial polypeptide host defenses to aquaculture: microbial peptide SR-0379 accelerates wound healing via
exploitation of downregulation and upregulation respon- the PI3 kinase/Akt/mTOR pathway. PLoS ONE 9:e92597
ses. Comp Biochem Physiol Part D Genomics Proteomics Wang KJ, Cai JJ, Cai L, Qu HD, Yang M, Zhang M (2009)
6:44–54 Cloning and expression of a hepcidin gene from a marine
Novoa B, Figueras A (2012) Zebrafish: model for the study of fish (Pseudosciaena crocea) and the antimicrobial activity
inflammation and the innate immune response to infectious of its synthetic peptide. Peptides 30:638–646
diseases. Adv Exp Med Biol 946:253–275 Yang M, Wang KJ, Chen JH, Qu HD, Li SJ (2007) Genomic
Pan CY, Peng KC, Lin CH, Chen JY (2011) Transgenic organization and tissue-specific expression analysis of
expression of tilapia hepcidin 1-5 and shrimp chelonianin hepcidin-like genes from black porgy (Acanthopagrus
in zebrafish and their resistance to bacterial pathogens. Fish schlegelii B). Fish Shellfish Immunol 23:1060–1071
Shellfish Immunol 31:275–285 Zhao T, Zhao P, Chen D, Jadeja R, Hung YC, Doyle MP (2014)
Pan CY, Huang TC, Wang YD, Yeh YC, Hui CF, Chen JY Reductions of Shiga Toxin-Producing Escherichia coli and
(2012) Oral administration of recombinant epinecidin-1 Salmonella typhimurium on beef trim by lactic acid, lev-
protected grouper (Epinephelus coioides) and zebrafish ulinic acid, and sodium dodecyl sulfate treatments. J Food
(Danio rerio) from Vibrio vulnificus infection and Prot 77:528–537
enhanced immune-related gene expressions. Fish Shellfish Zhou JG, Wei JG, Xu D et al (2011) Molecular cloning and
Immunol 32:947–957 characterization of two novel hepcidins from orange-
Park CH, Valore EV, Waring AJ, Ganz T (2001) Hepcidin, a spotted grouper, Epinephelus coioides. Fish Shellfish
urinary antimicrobial peptide synthesized in the liver. Immunol 30:559–568
J Biol Chem 276:7806–7810

123