RESEARCH ARTICLE

crossm

Comprehensive Arrayed Transposon

Mutant Library of Klebsiella pneumoniae
Outbreak Strain KPNIH1

Downloaded from http://jb.asm.org/ on March 5, 2020 at University of Washington

Beth Ramage,a* Roxanne Erolin,a* Kiara Held,a Joe Gasper,a Eli Weiss,b
Mitch Brittnacher,b Larry Gallagher,a Colin Manoila
Departments of Genome Sciencesa and Microbiology,b University of Washington, Seattle, Washington, USA

ABSTRACT Klebsiella pneumoniae and other carbapenem-resistant members of the

family Enterobacteriaceae are a major cause of hospital-acquired infections, yet the Received 26 May 2017 Accepted 21 July
2017
basis of their success as nosocomial pathogens is poorly understood. To help pro-
Accepted manuscript posted online 31 July
vide a foundation for genetic analysis of K. pneumoniae, we created an arrayed, 2017
sequence-defined transposon mutant library of an isolate from the 2011 outbreak of Citation Ramage B, Erolin R, Held K, Gasper J,
infections at the U.S. National Institutes of Health Clinical Center. The library is made Weiss E, Brittnacher M, Gallagher L, Manoil C.
up of 12,000 individually arrayed mutants of a carbapenemase deletion parent strain 2017. Comprehensive arrayed transposon
mutant library of Klebsiella pneumoniae
and provides coverage of 85% of the predicted genes. The library includes an aver- outbreak strain KPNIH1. J Bacteriol
age of 2.5 mutants per gene, with most insertion locations identified and confirmed 199:e00352-17. https://doi.org/10.1128/JB
in two independent rounds of Sanger sequencing. On the basis of an independent .00352-17.
Editor Thomas J. Silhavy, Princeton University
transposon sequencing assay, about half of the genes lacking representatives in this
Copyright © 2017 American Society for
“two-allele” library are essential for growth on nutrient agar. To validate the use of Microbiology. All Rights Reserved.
the library for phenotyping, we screened candidate mutants for increased antibiotic Address correspondence to Colin Manoil,
sensitivity by using custom phenotypic microarray plates. This screening identified [email protected].
several mutations increasing sensitivity to ␤-lactams (in acrB1, mcrB, ompR, phoP1, * Present address: Beth Ramage, Department
of Biology, University of Washington, Seattle,
and slt1) and found that two-component regulator cpxAR mutations increased multi-
Washington, USA; Roxanne Erolin, Jefferson
ple sensitivities (to an aminoglycoside, a fluoroquinolone, and several ␤-lactams). College of Population Health, Thomas Jefferson
Strains making up the two-allele mutant library are available through a web-based University, Philadelphia, Pennsylvania, USA.
request mechanism.
IMPORTANCE K. pneumoniae and other carbapenem-resistant members of the fam-
ily Enterobacteriaceae are recognized as a top public health threat by the Centers for
Disease Control and Prevention. The analysis of these major nosocomial pathogens
has been limited by the experimental resources available for studying them. The
work presented here describes a sequence-defined mutant library of a K. pneu-
moniae strain (KPNIH1) that represents an attractive model for studies of this patho-
gen because it is a recent isolate of the major sequence type that causes infection,
the epidemiology of the outbreak it caused is well characterized, and an annotated
genome sequence is available. The ready availability of defined mutants deficient in
nearly all of the nonessential genes of the model strain should facilitate the genetic
dissection of complex traits like pathogenesis and antibiotic resistance.

KEYWORDS Cre, KPC, ST258, cpxR, essential gene, phenotypic microarray

K lebsiella pneumoniae and other carbapenem-resistant members of the family En-

terobacteriaceae are a major source of antibiotic-resistant hospital-acquired infec-
tions and are one of three bacterial pathogens thought to represent the greatest
current threats to public health by the Centers for Disease Control and Prevention (1).
It has been written that “it is possible that no infectious agent since the introduction
of HIV has threatened our last line therapies more than these pathogens” (2). The
spread of carbapenem-resistant K. pneumoniae is largely associated with a single

October 2017 Volume 199 Issue 20 e00352-17 Journal of Bacteriology jb.asm.org 1

Ramage et al. Journal of Bacteriology

multilocus sequence type (sequence type 258 [ST258]), whose success is not well
understood.
Genomic studies of K. pneumoniae have characterized relationships among clinical
isolates and identified functions required for infection. One study found that ST258
clinical strains isolated worldwide fall into two clades that differ in a 215-kb region that
includes capsule biosynthesis genes (3). Another key study used whole-genome se-
quencing of isolates from an outbreak of carbapenem-resistant K. pneumoniae infec-
tions at the U.S. National Institutes of Health (NIH) Clinical Center to formulate a
scenario for how the infection spread (4).

Downloaded from http://jb.asm.org/ on March 5, 2020 at University of Washington

K. pneumoniae causes a variety of infections, including pulmonary, blood, and
urinary tract infections, yet most infecting strains are not particularly virulent in
infection models (5, 6). The bacteria usually lack typical virulence factors easily recog-
nizable from genome sequences like type III secretion systems and extracellular toxins,
and the most important Klebsiella pathogenicity factors identified to date are capsule,
lipopolysaccharide, siderophores, and adhesins (6). Strains can encode a remarkable
multiplicity of antibiotic resistance functions, e.g., up to six predicted ␤-lactamases and
three aminoglycoside-modifying enzymes. Resistance to biocides, desiccation, and
other environmental factors, in addition to antibiotics, probably contributes to the
organism’s success as a nosocomial pathogen (6).
Large-scale mutant screens have been carried out to identify K. pneumoniae patho-
genesis determinants. For example, signature-tagged mutagenesis with different
strains and infection models has identified a number of candidate virulence functions,
although there has been limited follow-up validation (6–8). A recent transposon
sequencing (Tn-seq) screen also identified hundreds of potential factors needed for
lung infection in a mouse model (9). That study validated six of the virulence genes with
constructed deletion mutants and identified potential reasons for their virulence
defects with additional phenotypic tests.
One factor that has limited genome-scale genetic studies of K. pneumoniae has been
the need to construct individual mutants to test genotype-phenotype associations
suggested by experiment or genome sequence analysis. To help address this limitation,
we have constructed an arrayed library of transposon mutants with multiple insertions
in most of the nonessential genes represented. The mutants are derivatives of strain
KPNIH1, an early isolate from the NIH Clinical Center outbreak that belongs to ST258
(clade 2) and carries three plasmids (pKPN-498 [244 kb], pKpQIL [114 kb], and pAAC154
[15 kb]) (4). Strains making up the arrayed library are available to the research
community and should be useful both for mutant hunts and for testing of genotype-
phenotype associations suggested by other approaches.

RESULTS AND DISCUSSION

Overall approach. The primary goal of this work was to create an arrayed,
sequence-defined transposon mutant library of K. pneumoniae KPNIH1 with near-
saturation coverage of nonessential genes. We wanted it to include multiple mutants
for each gene to allow immediate confirmation of genotype-phenotype associations in
screens and to minimize missed associations due to noninactivating mutations or strain
cross-contamination. We created the library in two stages. First, a large primary
collection of mutants generated by random insertion mutagenesis was arrayed and
transposon junction fragments were individually sequenced. This collection contained
more than seven unique mutants per coding gene. Second, individual mutants from
this primary collection corresponding to two or three unique insertions per gene were
colony purified, rearrayed, and resequenced. This smaller, resequenced library is called
the “two-allele library.”
Construction of a carbapenemase gene deletion strain (MKP103). As a parent
strain for transposon mutagenesis, we created a KPNIH1 derivative with the KPC-3
carbapenemase-encoding gene deleted. The strain was constructed in order to limit
inadvertent spread of the resistance determinant, which is carried on a conjugal
plasmid (pKpQIL). We created the mutation by recombination by transforming KPNIH1

October 2017 Volume 199 Issue 20 e00352-17 jb.asm.org 2

Arrayed Mutant Library of K. pneumoniae Journal of Bacteriology

Downloaded from http://jb.asm.org/ on March 5, 2020 at University of Washington

FIG 1 Transposon T30. (A) Overall structure. The transposon is a 1,271-bp Tn5 derivative carrying mosaic
ends (ME) and loxP recombination sites flanking the chloramphenicol resistance determinant (cat). The
resistance marker can be eliminated by Cre recombination at the loxP sites, leaving a 219-bp insertion
“scar” carrying both mosaic ends and one loxP site. (B) Whole transposon sequence. (C) Insertion scar
sequence. The 219-bp sequence remaining after loxP ⫻ loxP recombination is shown. The sequence
encodes stop codons in all except the ⫹2 reading frame.

with a PCR fragment carrying the chloramphenicol resistance gene (cat) in place of the
KPC-3-encoding gene, followed by elimination of the cat gene by FLP-mediated
recombination at FRT sites flanking the gene (see Materials and Methods). As expected,
MKP103 was imipenem sensitive and carried a deletion of the predicted size (see
Materials and Methods).
Transposon T30. For mutagenesis of MKP103, we created transposon T30, a
mini-Tn5 derivative encoding chloramphenicol resistance (Fig. 1). T30 carries mosaic
end sequences to support the formation of transposon-transposase complexes in vitro.
The transposon also carries loxP recombination sites near its ends, making it possible to
eliminate the cat gene by Cre recombination (Fig. 1). It should be possible to create
double mutants from library strains by deleting the resistance marker from one mutant
and introducing a second insertion by transformation of genomic DNA from a different
mutant (10).
Primary mutant collection. To create the primary transposon mutant collection,
MKP103 was mutagenized by transformation of transposon T30-transposase com-
plexes, followed by selection for chloramphenicol-resistant colonies (11). Colonies were
then arrayed robotically in a 384-well format (see Materials and Methods). To identify
transposon insertion locations, arrayed cells were grown overnight and PCR fragments
corresponding to genome-transposon junction regions were amplified and individually
sequenced (see Materials and Methods). A total of 41,769 unique insertions were
identified, corresponding to 86% of the strain’s predicted coding genes (Table 1).

October 2017 Volume 199 Issue 20 e00352-17 jb.asm.org 3

Ramage et al. Journal of Bacteriology

TABLE 1 K. pneumoniae transposon mutant librarya

Result in:
Parameter Primary set Two-allele library
No. of arrayed strains 54,528 12,000
No. of sequence-mapped insertions 42,951 11,985
No. of insertion locations confirmed by resequencing 10,259
No. of unique insertions 41,769 11,750
No. of unique insertions within open reading frames 34,697 11,564
No. of genes hit (of 5,411) 4,666 4,583
% of genes hit 86 85

Downloaded from http://jb.asm.org/ on March 5, 2020 at University of Washington

No. of mutants/gene hit 7.4 2.5
aThe two-allele library was constructed from the primary set of mutants by colony purification and
rearraying and resequencing two or three mutants per gene represented.

Two-allele library. A smaller library with two or three unique insertion mutants per
gene was constructed from the primary mutant collection (Table 1). Mutants with
insertion sites in the centers of genes were chosen for inclusion where possible, and
strains were colony purified and resequenced to verify genome insertion locations. The
identities of mutants in this two-allele library and additional information are provided
in Data Set S1 in the supplemental material and in a genome browser (http://tools
.uwgenomics.org/tn_mutants/index.php) (Fig. 2).
KPNIH1 essential genes. Mutants deficient in 828 KPNIH1 genes were absent from
the two-allele library (Table 1; Data Set S2). We assume that these genes represent both
functions essential for growth under the mutant selection conditions used and non-
essential genes missed by chance. To help distinguish the essential subset, we gener-

FIG 2 Mutant browser screenshot. The locations of transposon insertions in the two-allele library are shown for one of two lac regions
in the KPNIH1 genome. The searchable browser (https://tools.uwgenomics.org/tn_mutants/index.php) provides linked information about
each insertion and can be used to create lists of mutants for request.

October 2017 Volume 199 Issue 20 e00352-17 jb.asm.org 4

Arrayed Mutant Library of K. pneumoniae Journal of Bacteriology

Downloaded from http://jb.asm.org/ on March 5, 2020 at University of Washington

FIG 3 Essential genes unrepresented in the two-allele library. (Top) Overlap between K. pneumoniae
genes unrepresented in the two-allele library and identified as essential by Tn-seq. (Bottom) Overlap of
E. coli essential genes with K. pneumoniae genes.

ated a pool of ⬃100,000 transposon T30 mutants and characterized it by Tn-seq (12)
(see Materials and Methods). That analysis identified 642 putative essential genes, 373
of which were also unrepresented in the two-allele library. (Fig. 3, top; Data Set S2).
Genes scored as essential by Tn-seq thus account for nearly half (373/828) of those
absent from the KPNIH1 two-allele library.
To help identify any KPNIH1 essential genes represented in the two-allele library by
nonnull mutations, we examined orthologues of the highly validated Escherichia coli
K-12 essential gene set (13). Since K. pneumoniae and E. coli are closely related, most K.
pneumoniae orthologues of E. coli essential genes should also be essential. Of the 289
KPNIH1 orthologues we identified, more than two-thirds (205) fell into the high-
confidence set of 373 E. coli essential genes (Fig. 3, bottom; Data Set S2) (13). However,
another 46 orthologues were scored as essential by Tn-seq but had mutants in the
two-allele library (Fig. 3, bottom; Data Set S2). Most of these 46 genes were underrep-
resented in the arrayed primary mutant collection (data not shown). We therefore
assume that most or all of the 46 genes are essential in KPNIH1 and that insertions
mapping to them in the two-allele library are not inactivating. Five orthologues were
absent from the two-allele library but scored as nonessential by Tn-seq, and 33
orthologues were nonessential by both criteria (Fig. 3; Data Set S2). Mutants deficient
in many of these additional 38 genes were underrepresented in the Tn-seq pool,
suggesting that they may grow slowly (Data Set S2). Overall, this analysis bolsters the
conclusion that about half of the genes without mutants in the two-allele library are
missing because they are essential and identifies mutants in the library that are unlikely
to have fully inactivating mutations because they affect essential genes. A consensus
set of 424 KPNIH1 essential genes based on our studies is presented in Data Set S2.
Genotype-phenotype validation tests using custom PM plates. We evaluated
the use of the two-allele mutant library to identify genotype-phenotype associations for
seven clinically relevant antibiotic resistance traits. Candidate resistance genes corre-
sponded to two-component regulators, efflux pumps, and additional genes ortholo-
gous to established E. coli resistance functions (14, 15). We wished to screen candidate
mutants by using phenotype microarray (PM) assays (Biolog) (16, 17), but the levels of
many antibiotics in the commercially available plates were too low to support effective
screening. Thus, we designed custom PM plates tailored to the resistance profile of the
MKP103 parent strain. The plates provided coverage of three classes of antibiotics
used to treat K. pneumoniae infections: an aminoglycoside (amikacin), five different
␤-lactams, and a fluoroquinolone (ciprofloxacin) (Fig. S1).
We assayed antibiotic sensitivity in triplicate in a total of 76 mutants corresponding
to insertions in 46 genes (Data Set S3). For genes represented by multiple mutant

October 2017 Volume 199 Issue 20 e00352-17 jb.asm.org 5

Ramage et al. Journal of Bacteriology

TABLE 2 Antibiotic sensitivities of candidate mutantsa

Mutant Sensitivity (MIC ␮g/ml)
No. of alleles E. coli
Locus tag Gene Functionb tested Amikacin Aztreonam Cefazolin Imipenem Levofloxacin phenotype(s)c
Parent strain (MKP103) ⱖ11 0.5 195 ⱖ0.3 150
KPNIH1_00370 cpxA TCR 1 2.2 0.22 58 0.06 44 1, 2
KPNIH1_00375 cpxR TCR 2 3.3 0.18 58 0.04 55 1, 2
KPNIH1_03580 slt PG 2 7.5 0.22 87 ⱖ0.3 150 1, 2
KPNIH1_04480 mcrB PG 1 ⱖ11 0.22 87 0.06 ⱖ225 2
KPNIH1_05950 acrB RND 2 ⱖ11 0.18 162 ⱖ0.3 150 2, 3
KPNIH1_10025 phoQ TCR 2 7.5 0.36 87 0.13 100 2, 3

Downloaded from http://jb.asm.org/ on March 5, 2020 at University of Washington

KPNIH1_10030 phoP1 TCR 2 5 0.27 103 0.2 100 2, 3
KPNIH1_24525 envZ TCR 2 ⱖ11 0.22 78 0.09 125 2, 3
KPNIH1_24530 ompR TCR 2 ⱖ11 0.22 72 0.17 150
to five of seven antibiotics tested (the aminoglycoside amikacin; the ␤-lactams aztreonam, cefazolin, and imipenem; and the fluoroquinolone
aSensitivities

ciprofloxacin) are shown for genes with significant mutant phenotypes (Fig. S1 and Data Set S2). Assays were carried out in triplicate, and average values for two
mutant alleles are provided for all genes except cpxA and mcrB. E. coli phenotypes are based on lists of aminoglycoside (amikacin, gentamicin, streptomycin, and
tobramycin), ␤-lactam (aztreonam, ceftoxime, cefsulodin, amdinocillin, and oxacillin), and quinolone (ciprofloxacin, nalidixic acid, and norfloxacin) sensitivity
phenotypes (15).
bRND, resistance-nodulation-division family efflux; PG, peptidoglycan metabolism; TCR, two-component regulation.

c1, aminoglycoside sensitive; 2, ␤-lactam sensitive; 3, quinolone sensitive.

alleles, different alleles generally led to congruent phenotypes. Mutants deficient in

nine genes exhibited significant increased-sensitivity phenotypes (Table 2). Mutations
inactivating the two-component regulator cpxAR strongly increased sensitivities to all
three classes of antibiotics tested, whereas the other mutations caused less dramatic
changes. The phenotype caused by cpxAR is similar to that seen in E. coli (increased
sensitivity to aminoglycosides and ␤-lactams) (18, 19), although the K. pneumoniae
mutant phenotypes were stronger. Other K. pneumoniae phenotypes also largely
agree with those seen in E. coli, including those caused by five genes in which
mutations increased sensitivity to multiple ␤-lactams (acrB1, mcrB, ompR, phoP1,
and slt1) (Table 2) (15). Overall, the results confirm the utility of the KPNIH1 mutant
library for identifying genotype-phenotype associations and also suggest that
known E. coli associations provide a valuable source of K. pneumoniae candidate
genes for traits of interest.
Transfer of mutations between strains. Transposon insertion alleles could be
transferred between KPNIH1 strains by homologous recombination after electropora-
tion of PCR fragments carrying insertions and flanking genome sequences (see Mate-
rials and Methods). For example, mutations in cpxR (KPNIH1_00375) and a capsule gene
(KPNIH1_17405) were transferred to carbapenemase-positive KPNIH1, with successful
transfer confirmed by PCR and by phenotype analysis (not shown). The transfer was not
highly efficient (see Materials and Methods), and it may be possible to increase its
efficiency by the expression of foreign recombinases in recipient cells (20).
Mutant availability. Individual strains making up the two-allele library, as well as
copies of the entire library, are available through a web-based request mechanism from
a University of Washington cost recovery center (http://www.gs.washington.edu/labs/
manoil/kpneumoniae_library.htm).
Concluding remarks. Comprehensive mutant libraries such as that described here
have proved to be a valuable resource for genetic studies for two reasons. First, the
libraries can be screened directly for relatively complete identification of nonessential
genes contributing to a given trait. Second, the libraries are a source of strains that can
be used to test the validity of genotype-phenotype associations suggested by genome-
scale experimental methods like Tn-seq and transcriptome sequencing. Single-mutant
verification of candidate genes identified by such approaches is commonly modest in
scale because of the effort required to construct mutants yet is critical for confirming
the authenticity of associations they indicate. Having defined mutants already available
should improve the extent of such verification that is feasible in studies of K. pneu-
moniae.

October 2017 Volume 199 Issue 20 e00352-17 jb.asm.org 6

Arrayed Mutant Library of K. pneumoniae Journal of Bacteriology

MATERIALS AND METHODS

Strains. K. pneumoniae KPNIH1 was generously provided by Karen Frank (National Institutes of Health
Clinical Center) (4). MKP103, a carbapenemase (KPC-3) deletion derivative of KPNIH1, was generated in
two steps. First, KPNIH1 was transformed by electroporation with a 3,059-bp PCR fragment (⬃100 ng)
carrying the chloramphenicol resistance (cat) gene and adjacent FRT recombination sites derived from
pKD3 (21) bracketed by ⬃1-kb regions corresponding to sequences on each side of the KPC-3-encoding
gene on plasmid pKpQIL (22). A chloramphenicol-resistant transformant (MKP102) selected on LB agar
plus 175 ␮g/ml chloramphenicol exhibited greater imipenem sensitivity than KPNIH1 and was confirmed
by PCR to carry the cat gene in place of the KPC-3-encoding gene. Second, the cat gene in MKP102 was
eliminated by FLP recombination. MKP102 was electroporated with a plasmid carrying the FLP
recombinase-encoding gene (pFLP3) (21) with selection for tetracycline-resistant transformants on LB

Downloaded from http://jb.asm.org/ on March 5, 2020 at University of Washington

agar plus 50 ␮g/ml tetracycline. Transformants were then grown in the absence of tetracycline to allow
spontaneous loss of pFLP3, and a cured derivative that had lost the cat gene was identified by its
chloramphenicol sensitivity. That strain (MKP103) carries a deletion of codons 15 to 291 of the 294-codon
KPC-3-encoding gene, with an FRT “scar” in its place. MKP103 showed an ⬃100-fold lower imipenem
minimal growth inhibitory concentration and was confirmed by PCR to carry a KPC-3-encoding gene
deletion of the expected size.
Construction of transposon T30. Transposon T30 was constructed from transposon T26 in plasmid
pLG123 (23) by replacement of a NotI-AscI restriction fragment carrying the tetracycline resistance gene
and adjacent promoter with a PCR fragment carrying cat and its promoter amplified from plasmid
pACYC184.
Transposon mutagenesis. T30 mutagenesis was carried out by transformation of transposon-
transposase complexes (11). The transposon was amplified from plasmid pT30 by using primers and
procedures described previously for transposon T26 (23). Transposon-transposase complexes were
generated by mixing transposon DNA with EZ-Tn5 transposase (Epicentre) and introduced by elec-
troporation into MKP103, which had been grown in LB to an optical density at 600 nm of 0.4 to 0.6,
washed three times in distilled water, and resuspended in 1/133 volume of 10% glycerol (23).
Electroporation was carried out for mixtures of 50 ␮l of cells and ⬃0.1 ␮l of the transposon-
transposase complex in 1-mm cuvettes by pulsing at 200 ⍀, 25 ␮F, and 1.75 kV with a Bio-Rad Gene
Pulser. Electroporated cells were added to ⬃0.5 ml of Super Optimal broth with catabolite repression
(SOC), grown for 1 h at 37°C, and then plated on LB agar plus chloramphenicol (175 ␮g/ml). A typical
mutagenesis yielded ⬃20,000 colonies per electroporation.
Construction of the primary mutant collection. To generate the primary mutant collection, T30
insertion mutant colonies were robotically arrayed into 142 384-well plates containing LB with 5%
dimethyl sulfoxide (DMSO) and 100 ␮g/ml chloramphenicol by a QPix2 colony-picking robot (Genetix).
Plates were incubated for 24 h at 37°C and then stored at ⫺80°C. Insertion sites were identified by
two-stage semidegenerate PCR amplification and Sanger sequencing of transposon-genome junctions
(24, 25). The sequences of the primers used for PCR 1 were TATCAACAGGGACACCAGGATTTA and a
mixture of GGCCACGCGTCGACTAGTACNNNNNNNNNNCTGAG, GGCCACGCGTCGACTAGTACNNNNNNNN
NNAGTGC, and GGCCACGCGTCGACTAGTACNNNNNNNNNNTGCT; those of the primers used for PCR 2
were CTGCGAAGTGATCTTCCGTCAC and GGCCACGCGTCGACTAGTAC; and that of the primer used for
sequencing was CGGCCGCATAACTTCGTATAATGT. Insertion sites were mapped to the KPNIH1 genome
with an overall success rate of 89.6%.
Construction of the two-allele library. To create the two-allele library from the primary mutant
collection, custom scripts and manual curation were used to choose up to three unique mutants per
gene whose insertions had been mapped by using high-quality sequence data and that were located
at distributed sites between 5 and 90% of the coding sequences. Strains were cherry picked from the
primary library, colony purified, rearrayed, and resequenced to confirm the initial assignments.
Mutants were stored in a 96-well format at ⫺80°C in LB with 5% DMSO and 100 ␮g/ml chloram-
phenicol.
Tn-seq identification of KPNIH1 essential genes. Genes essential for growth on nutrient medium
were identified by Tn-seq analysis of a pool of ⬃105 transposon T30 mutants selected on LB agar
containing 175 ␮g/ml chloramphenicol (23). For each gene, the number of transposon sequence reads
per kilobase was calculated for insertions within 5 to 90% of the coding sequence. Hit and read density
was calculated by dividing reads (5 to 90%) by locus length (5 to 90%), and the distributions of reads per
gene were calculated. Genes with zero values were considered essential. The remaining assignments
(reads per gene) were log2 transformed, and data were fitted to a normal distribution. Loci with values
falling below a P value cutoff of 0.01 were added to the zero-value set for the final set of candidate
essential loci (12).
Custom PM analysis. Custom PM plates were formulated for six antibiotics (amikacin, aztreonam,
cefazolin, ceftriaxone, imipenem, levofloxacin, and piperacillin-tazobactam [8:1, wt/wt]) with six concen-
trations per antibiotic and 1.5-fold concentration steps. The highest concentrations of each of the
antibiotics in the custom plates were chosen in preliminary tests to give at least partial inhibition of
MKP103. The PM assays were carried out in a 96-well format in triplicate for each strain in accordance
with the procedures recommended by the supplier (Biolog). Growth in each well was monitored as the
rate of tetrazolium reduction with an OmniLog reader (16, 17).
Transfer of transposon insertions between strains. Insertion mutations were transferred into
new strains by electroporation of PCR products carrying the insertions and flanking regions of
homology. PCR products with 2- to 2.5-kb sequences flanking T30 insertions were purified, dialyzed
against water, and electroporated into cells grown and prepared as described above for transposon

October 2017 Volume 199 Issue 20 e00352-17 jb.asm.org 7

Ramage et al. Journal of Bacteriology

mutagenesis. Electroporated cells were grown in SOC and plated on LB agar supplemented with
chloramphenicol (175 ␮g/ml). The efficiency of transformation was approximately 10 transfor-
mants/␮g of PCR DNA.
Deletion of transposon T30 sequences by Cre/lox recombination. Transposon T30 sequences
between directly repeated loxP sequences near the transposon ends were eliminated by recombination
through transient introduction of a nonreplicating plasmid (pCre2) expressing Cre recombinase (26).
Transposon insertion mutants were conjugated with SM10␭pir/pCre2 by mixing cells at a donor-to-
recipient ratio of 10:1, spotting them on 0.45-␮m-thick nitrocellulose membranes (Millipore), and
incubating them for 4 h at 37° on LB agar. Cells were then resuspended in 1 ml of LB and streaked onto
LB agar. Resulting colonies were screened to identify those that had become chloramphenicol sensitive
(⬃50% of the total). Such sensitive strains (in three cases examined) were found by PCR and DNA

Downloaded from http://jb.asm.org/ on March 5, 2020 at University of Washington

sequence analysis to carry the expected 219-bp recombination product “scar.”

SUPPLEMENTAL MATERIAL
Supplemental material for this article may be found at https://doi.org/10.1128/JB
.00352-17.
SUPPLEMENTAL FILE 1, XLSX file, 1.1 MB.
SUPPLEMENTAL FILE 2, XLSX file, 0.1 MB.
SUPPLEMENTAL FILE 3, XLSX file, 0.1 MB.
SUPPLEMENTAL FILE 4, PDF file, 0.3 MB.

ACKNOWLEDGMENTS
We thank Karen Frank for supplying KPNIH1.
This work was supported by grant U54AI057141 from the National Institute of
Allergy and Infectious Diseases of the National Institutes of Health.

REFERENCES
1. Pitout JD, Nordmann P, Poirel L. 2015. Carbapenemase-producing Kleb- of the Francisella novicida restriction barrier. J Bacteriol 190:7830 –7837.
siella pneumoniae, a key pathogen set for global nosocomial dominance. https://doi.org/10.1128/JB.01188-08.
Antimicrob Agents Chemother 59:5873–5884. https://doi.org/10.1128/ 11. Goryshin IY, Jendrisak J, Hoffman LM, Meis R, Reznikoff WS. 2000.
AAC.01019-15. Insertional transposon mutagenesis by electroporation of released Tn5
2. Chen L, Mathema B, Chavda KD, DeLeo FR, Bonomo RA, Kreiswirth BN. transposition complexes. Nat Biotechnol 18:97–100. https://doi.org/10
2014. Carbapenemase-producing Klebsiella pneumoniae: molecular and .1038/72017.
genetic decoding. Trends Microbiol 22:686 – 696. https://doi.org/10 12. Lee SA, Gallagher LA, Thongdee M, Staudinger BJ, Lippman S, Singh PK,
.1016/j.tim.2014.09.003. Manoil C. 2015. General and condition-specific essential functions of
3. Deleo FR, Chen L, Porcella SF, Martens CA, Kobayashi SD, Porter AR, Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 112:5189 –5194.
Chavda KD, Jacobs MR, Mathema B, Olsen RJ, Bonomo RA, Musser JM, https://doi.org/10.1073/pnas.1422186112.
Kreiswirth BN. 2014. Molecular dissection of the evolution of 13. Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA,
carbapenem-resistant multilocus sequence type 258 Klebsiella pneu- Tomita M, Wanner BL, Mori H. 2006. Construction of Escherichia coli K-12
moniae. Proc Natl Acad Sci U S A 111:4988 – 4993. https://doi.org/10 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst
.1073/pnas.1321364111. Biol 2:2006.0008. https://doi.org/10.1038/msb4100050.
4. Snitkin ES, Zelazny AM, Thomas PJ, Stock F, NISC Comparative Sequenc- 14. Tamae C, Liu A, Kim K, Sitz D, Hong J, Becket E, Bui A, Solaimani P, Tran
ing Program Group, Henderson DK, Palmore TN, Segre JA. 2012. Tracking KP, Yang H, Miller JH. 2008. Determination of antibiotic hypersensitivity
a hospital outbreak of carbapenem-resistant Klebsiella pneumoniae with among 4,000 single-gene-knockout mutants of Escherichia coli. J Bacte-
whole-genome sequencing. Sci Transl Med 4:148ra116. https://doi.org/ riol 190:5981–5988. https://doi.org/10.1128/JB.01982-07.
10.1126/scitranslmed.3004129. 15. Nichols RJ, Sen S, Choo YJ, Beltrao P, Zietek M, Chaba R, Lee S, Kazmierc-
5. Tzouvelekis LS, Miriagou V, Kotsakis SD, Spyridopoulou K, Athanasiou E, zak KM, Lee KJ, Wong A, Shales M, Lovett S, Winkler ME, Krogan NJ,
Karagouni E, Tzelepi E, Daikos GL. 2013. KPC-producing, multidrug- Typas A, Gross CA. 2011. Phenotypic landscape of a bacterial cell. Cell
resistant Klebsiella pneumoniae sequence type 258 as a typical opportu- 144:143–156. https://doi.org/10.1016/j.cell.2010.11.052.
nistic pathogen. Antimicrob Agents Chemother 57:5144 –5146. https:// 16. Bochner BR. 2009. Global phenotypic characterization of bacteria. FEMS
doi.org/10.1128/AAC.01052-13. Microbiol Rev 33:191–205. https://doi.org/10.1111/j.1574-6976.2008
6. Broberg CA, Palacios M, Miller VL. 2014. Klebsiella: a long way to go .00149.x.
towards understanding this enigmatic jet-setter. F1000Prime Rep 6:64. 17. Bochner BR, Gadzinski P, Panomitros E. 2001. Phenotype microarrays for
https://doi.org/10.12703/P6-64. high-throughput phenotypic testing and assay of gene function. Ge-
7. Struve C, Forestier C, Krogfelt KA. 2003. Application of a novel multi- nome Res 11:1246 –1255. https://doi.org/10.1101/gr.186501.
screening signature-tagged mutagenesis assay for identification of Kleb- 18. Mahoney TF, Silhavy TJ. 2013. The Cpx stress response confers resistance
siella pneumoniae genes essential in colonization and infection. Micro- to some, but not all bactericidal antibiotics. J Bacteriol 195:1869 –1874.
biology 149:167–176. https://doi.org/10.1099/mic.0.25833-0. https://doi.org/10.1128/JB.02197-12.
8. Lawlor MS, Hsu J, Rick PD, Miller VL. 2005. Identification of Klebsiella 19. Delhaye A, Collet JF, Laloux G. 2016. Fine-tuning of the Cpx envelope
pneumoniae virulence determinants using an intranasal infection stress response is required for cell wall homeostasis in Escherichia coli.
model. Mol Microbiol 58:1054 –1073. https://doi.org/10.1111/j.1365 mBio 7:e00047-16. https://doi.org/10.1128/mBio.00047-16.
-2958.2005.04918.x. 20. Sharan SK, Thomason LC, Kuznetsov SG, Court DL. 2009. Recombineering: a
9. Bachman MA, Breen P, Deornellas V, Mu Q, Zhao L, Wu W, Cavalcoli JD, homologous recombination-based method of genetic engineering. Nat
Mobley HL. 2015. Genome-wide identification of Klebsiella pneumoniae Protoc 4:206–223. https://doi.org/10.1038/nprot.2008.227.
fitness genes during lung infection. mBio 6:e00775. https://doi.org/10 21. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal
.1128/mBio.00775-15. genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci
10. Gallagher LA, McKevitt M, Ramage ER, Manoil C. 2008. Genetic dissection U S A 97:6640 – 6645. https://doi.org/10.1073/pnas.120163297.

October 2017 Volume 199 Issue 20 e00352-17 jb.asm.org 8

Arrayed Mutant Library of K. pneumoniae Journal of Bacteriology

22. Leavitt A, Chmelnitsky I, Carmeli Y, Navon-Venezia S. 2010. Complete Olson MV, Manoil C. 2003. Comprehensive transposon mutant library of
nucleotide sequence of KPC-3-encoding plasmid pKpQIL in the epi- Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 100:14339 –14344.
demic Klebsiella pneumoniae sequence type 258. Antimicrob Agents https://doi.org/10.1073/pnas.2036282100.
Chemother 54:4493– 4496. https://doi.org/10.1128/AAC.00175-10. 25. Gallagher L, Turner C, Ramage E, Manoil C. 2007. Creating recombination-
23. Gallagher LA, Ramage E, Weiss EJ, Radey M, Hayden HS, Held KG, Huse activated genes and sequence-defined mutant libraries using transposons.
HK, Zurawski DV, Brittnacher MJ, Manoil C. 2015. Resources for genetic Methods Enzymol 421:126 –140. https://doi.org/10.1016/S0076
and genomic analysis of emerging pathogen Acinetobacter baumannii. J -6879(06)21012-7.
Bacteriol 197:2027–2035. https://doi.org/10.1128/JB.00131-15. 26. Bailey J, Manoil C. 2002. Genome-wide internal tagging of bacterial
24. Jacobs MA, Alwood A, Thaipisuttikul I, Spencer D, Haugen E, Ernst S, Will exported proteins. Nat Biotechnol 20:839 – 842. https://doi.org/10.1038/
O, Kaul R, Raymond C, Levy R, Chun-Rong L, Guenthner D, Bovee D, nbt715.

Downloaded from http://jb.asm.org/ on March 5, 2020 at University of Washington

October 2017 Volume 199 Issue 20 e00352-17 jb.asm.org 9