MPMI Vol. 24, No. 10, 2011, pp. 1143–1155. doi:10.1094 / MPMI -04-11-0100.

© 2011 The American Phytopathological Society e -Xtra*

Nonhost Resistance of Rice to Rust Pathogens

Michael Ayliffe,1 Rosangela Devilla,1 Rohit Mago,1 Rosemary White,1 Mark Talbot,1 Anthony Pryor,1 and
Hei Leung2
1
CSIRO Plant Industry, Box1600, Canberra, ACT, 2601, Australia; 2International Rice Research Institute, DAPO Box 7777,
Manila, Philippines
Submitted 20 April 2011. Accepted 26 June 2011.

Rice is atypical in that it is an agricultural cereal that is al. 2006). The potential transfer of rice nonhost rust resistance
immune to fungal rust diseases. This report demonstrates to other cereals is attractive (Borlaug 2000) given the apparent
that several cereal rust species (Puccinia graminis f. sp durability of NHR, extensive rice genomic resources available,
tritici, P. triticina, P. striiformis, and P. hordei) can infect and an example of successful transfer of NHR between cereals
rice and produce all the infection structures necessary for (Zhao et al. 2005).
plant colonization, including specialized feeding cells (haus- The current model of plant NHR (Jones and Dangl 2006)
toria). Some rust infection sites are remarkably large and suggests that all microbes possess a suite of conserved mole-
many plant cells are colonized, suggesting that nutrient up- cules, called microbe- and pathogen-associated molecular pat-
take occurs to support this growth. Rice responds with an terns (MAMPs and PAMPs, respectively) that can be recognized
active, nonhost resistance (NHR) response that prevents by plants, often via a receptor kinase located in the plant plasma
fungal sporulation and that involves callose deposition, membrane (Zipfel 2008). This recognition (PAMP-triggered
production of reactive oxygen species, and, occasionally, cell immunity) evokes activation of an NHR response or basal de-
death. Genetic variation for the efficacy of NHR to wheat fense response that prevents further infection of the plant by
stem rust and wheat leaf rust was observed. Unlike cereal nonadapted pathogen species (Zipfel 2008). In contrast,
rusts, the rust pathogen (Melampsora lini) of the dicotyle- adapted pathogens suppress PAMP-triggered immunity by in-
denous plant flax (Linum usitatissimum) rarely successfully troducing a suite of pathogen molecules (effectors) into the
infects rice due to an apparent inability to recognize host- infected plant cell that suppress this basal defense response
derived signals. Morphologically abnormal infection struc- (Hogenhout et al. 2009). Host plant species, in turn, have
tures are produced and appressorial-like structures often evolved recognition mechanisms for specific effector mole-
don’t coincide with stomata. These data suggest that basic cules of adapted pathogens leading to effector-triggered immu-
compatibility is an important determinate of nonhost infec- nity, which is the underlying molecular basis of the gene-for-
tion outcomes of rust diseases on cereals, with cereal rusts gene model of disease resistance (Jones and Dangl 2006).
being more capable of infecting a cereal nonhost species However, effector-triggered immunity is not just confined to
compared with rust species that are adapted for dicot adapted pathogen recognition and may also play a role in NHR,
hosts. particularly against pathogens that colonize plant species closely
related to the nonhost species (Schulze-Lefert and Pangstruga
2011).
Fungal rust diseases caused by members of the genus Puc- Therefore, NHR involves active recognition and an induced
cinia consistently cause yield losses and occasional devastat- defense response in some instances. However, NHR defenses
ing epidemics in the world’s most important crops, cereals also include preformed physical and chemical barriers that po-
(Roelfs and Bushnell 1985). Most cereal rust disease resis- tential pathogens must overcome for successful plant coloniza-
tance genes have transient efficacy due to pathogen mutations tion (Heath 2000). Superimposed on these active and passive
overcoming resistance. The emergence of Ug99, a new patho- defense mechanisms is a pathogen requirement for appropriate
type of wheat stem rust (WSR) (Puccinia graminis f. sp tritici) plant signals, both physical and chemical, for pathogen recog-
that threatens global wheat production, emphasizes the need nition of a potential plant host (Heath 2000).
for durable rust resistance in cereals (Ayliffe et al. 2008; Several studies have investigated the attempted infection of
Stokstad 2007). rust pathogens on nonhost plant species. Mellersch and Heath
Rice (Oryza sativa) is atypical in that it is an intensively (2003) examined the infection process of bean rust (Uromyces
grown agricultural cereal that is a nonhost of rust pathogens, vignae) on the nonhost plant species, Arabidopsis. Of 17
unlike wheat, barley, maize, rye, triticale, millet, oat and sor- Arabidopsis accessions examined, 1 (WS-0) allowed signifi-
ghum, which are all hosts. Nonhost resistance (NHR) is a cantly more rust growth, with 20% of infection sites each pro-
poorly characterized defense mechanism that makes a plant ducing a few haustoria. The remaining accessions generally
species resistant to most potential phytopathogens (i.e., a non- restricted fungal growth after the formation of short infection
host). The genetic elucidation of NHR components in Arabi- hyphae within the apoplast. Arabidopsis mutants (eds1 and
dopsis demonstrates that NHR is not as intractable as previ- ndr1) which are defective for signaling pathways essential for
ously regarded (Collins et al. 2003; Lipka et al. 2005; Stein et nucleotide-binding site leucine-rich repeat (NBS-LRR) resis-
tance gene function did not show increased rust growth, sug-
gesting that these effector recognition pathways are either not
Corresponding author: Michael Ayliffe; E-mail: [email protected] involved in the NHR of Arabidopsis to this nonadapted patho-
* The e-Xtra logo stands for “electronic extra” and indicates that supplemen- gen or are redundant due to alternative resistance mechanisms.
tary data is published online. In contrast, Arabidopsis plants deficient in salicylic acid (SA)

Vol. 24, No. 10, 2011 / 1143

signaling (sid2) or encoding a salicylate hydroxylase transgene overlap between quantitative trait loci (QTL) for resistance to
(NahG) allowed increased Uromyces infection prior to the fun- each rust species. Interestingly, a number of these same QTL
gus being stopped by other components of NHR. coincided with QTL for partial resistance to the adapted barley
When Arabidopsis was challenged with a second nonad- leaf rust pathogen P. hordei. No association with known barley
apted pathogen, P. triticina, the causative agent of wheat leaf leaf rust resistance (R) genes was observed (Jafary et al. 2008).
rust (WLR), poor infection of the nonhost plant was observed In spite of the unique immunity among cereals of rice to
by this cereal pathogen (Shafiei et al. 2007). Only 12% of ger- cereal rusts, an investigation of the ability of rust pathogens to
minated spores successfully located a stomate and just 0.2% of infect rice has not been reported. In this study, we have devel-
infection sites produced a haustorium within a mesophyll cell oped a simple histochemical staining procedure to demonstrate
(Shafiei et al. 2007). Attempted infection by P. triticina induced that cereal rust pathogens can infect rice and, in some cases,
the production of reactive oxygen intermediates, nitric oxide, produce very large, haustoria-containing infection sites that
SA, and camalexin. Arabidopsis mutants deficient for a range encompass many host mesophyll cells. Natural variation among
of defense-signaling pathway genes, including RAR1 and rice cultivars in the NHR response to wheat stem and leaf rust
EDS1, showed no increased colonization by the nonadapted was observed. No increased rust growth was observed on rice
pathogen compared with control lines (Shafiei et al. 2007). plants that had either lost basal resistance to an adapted rice
Most but not all barley accessions are immune to WLR (P. pathogen (Magnaporthe grisea) or were deficient for several
triticina) and several other fungal rust species (e.g., P. hordei- defense-related genes. These data suggest that rice has sub-
murini, P. hordei-secalini, and P. coronata f. sp avenae) stantial redundancy in NHR mechanisms to cereal rusts. In
(Atienza et al. 2004). In an analysis of this “near-NHR”, map- contrast to the extensive cereal rust growth observed at some
ping families were produced between immune and rare suscep- infection sites on rice, flax rust (Melampsora lini), the rust
tible parents (Jafary et al. 2008). Resistance to these rust patho- pathogen of the dicotledenous plant flax (Linum ussitatissi-
gens was shown to be polygenically inherited, with substantial mum), rarely successfully infects this monocot nonhost species.

Fig. 1. Infection of rice with Puccinia graminis isolate 21-0 and P. hordei. A, Germinated P. graminis spore on the surface of a rice leaf showing germ tube
and appressorium development. B, P. graminis substomatal vesicle, infection hyphae, and haustorium formation inside a rice leaf. C, P. graminis haustorium
located in a rice leaf mesophyll cell. D and E, Two P. graminis appressoria growing on rice leaves. Note altered morphology when compared with F and G. F
and G, P. graminis appressorium development on wheat stomata. H, Confocal microscopy showing infection structures of a P. hordei infection site on rice.
The spore, germ tube, and appressorium are present on the surface of the leaf, while the underlying substomatal vesicle is inside the leaf and seen as a paler
structure at the bottom right of the panel. I, Haustorium produced by a P. hordei infection site on rice. J, The same infection site shown in I, demonstrating
the epidermal cell location of the P. hordei haustorium. K and L, Morphology of P. hordei appressoria on rice leaves. M and N, Morphology of P. hordei
appressoria on barley leaves. O, Variation in P. hordei infection site sizes observed on a single rice leaf. P, Callose production associated with P. hordei infec-
tion sites on a rice leaf. In B, C, I, and J, white arrowheads indicate the position of haustoria.

1144 / Molecular Plant-Microbe Interactions

RESULTS (79 × 98%), while 79% (80 × 99%) of germinated WSR spores
produced infection hyphae on the susceptible wheat Morocco.
Infection of rice by four species of cereal rusts. In contrast, when these two cereal rusts were inoculated onto
Three rice cultivars (‘IR64’, ‘Kyeema,’ and ‘Namaga’) were a number of different rice cultivars, on average, 43% of BLR
inoculated with P. graminis f. sp tritici race 21-0, the causal (46 × 93%) and 43% of WSR (55 × 79%) spores that germi-
agent of WSR, and microscopically assayed after staining with nated successfully produced infection hyphae.
wheat germ agglutinin-alexa 488 (WGA-alexa). Of the 331 Obvious alteration in the appressorium morphology of BLR
spore germination events examined on these three cultivars, on was observed when grown on rice compared with the barley
average, 55% successfully produced appressoria (Fig. 1A) host, with appressoria appearing more bulbous and lobed (Fig.
while the remaining 45% produced only germ tubes (Table 1). 1K to N). Similar morphological differences were observed
On wheat ‘Morocco’, which is susceptible to this stem rust when WSR was grown on rice compared with wheat, with
isolate, 80% of WSR spore germination events generated ap- more bulbous appressoria again observed (Fig. 1D to G). How-
pressoria (Table 1). ever, these bulbous appressoria did subsequently produce infec-
Similar results were observed when rice was infected with P. tion hyphae and haustoria (Fig. 1B, C, I, and J). The frequency
hordei, the causal agent of barley leaf rust (BLR). Analysis of of haustorium production was not quantified due to difficulty
585 BLR spore germination events on seven rice cultivars in their routine identification.
showed that, on average, 46% of germinated spores success- Some BLR and, particularly, WSR infection sites became
fully produced an appressorium over a stomate (Fig. 1H; Table very large and encompassed hundreds of mesophyll cells
1). The remaining spore germination events (54%) produced a (Fig. 2). The size of these infection sites and the presence of
germ tube that did not produce an appressorium. When the haustoria suggest that direct nutrient uptake from this non-
same BLR race was used to infect the susceptible host species, host species tissue is occurring because the energy reserves
‘Golden Promise’ barley, 79% of germinated spores success- of a single spore are unlikely to sustain such extensive
fully went on to produce appressoria (Table 1). growth. Considerable variation in infection site sizes of both
Of those BLR infection sites on rice that successfully pro- rusts was observed, even on the same leaf, suggesting a dy-
duced appressoria, 93% subsequently went on to produce sub- namic but relatively stochastic interaction occurring between
stomatal vesicles and infection hyphae (Fig. 1H; Table 2), while rice and these nonadapted cereal rust pathogens (Fig. 1O).
79% of WSR appressoria produced on rice gave rise, in turn, Within the same leaf, infections that progressed beyond the
to substomatal vesicles and infection hyphae (Fig. 1B; Table 2). substomatal vesicle stage varied from those that formed only
When these rusts were inoculated onto susceptible host species, one or two short infection hyphae with no haustoria to those
98% of barley leaf rust appressoria produced infection hyphae with a very large proliferation of infection hyphae with haus-
on barley, as did 99% of WSR appressoria on wheat. toria (Figs. 1O and 2).
These initial infection processes can be summarized as fol- Coupled with the apparent stochastic development of these
lows. Of the BLR spores that germinate on the susceptible bar- two cereal rust species on rice were clear environmental effects
ley Golden Promise, 77% successfully produce infection hyphae on nonadapted pathogen development. Significant differences

Table 1. Percentage of germinated rust spores that produce appressoria on rice compared with host species
Spores producing germ tube only Spores producing germ tube and Number of germinated
Cultivar, plant Rusta (%) appressorium (%) spores examined
IR64 rice WSR 21-0 46 54 116
Kyeema rice WSR 21-0 52 48 99
Namaga rice WSR 21-0 38 62 116
Morocco wheat WSR 21-0 20 80 97
IR64 rice BLR 58 42 69
Purple rice BLR 79 21 114
Wild rice BLR 39 61 90
Pelde rice BLR 67 33 60
Namaga rice BLR 20 80 97
Amaroo rice BLR 57 43 81
Koshihikara rice BLR 57 43 74
Golden Promise barley BLR 21 79 172
a
WSR = wheat stem rust and BLR = barley leaf rust.

Table 2. Percentage of rust infections that, upon forming an appressorium, subsequently produce only an appressorium (App.), an appressorium and
substomatal vesicle (ssv), or an appressorium + ssv + infection hyphae (ifh) on rice and host species
Cultivar, plant Rusta App. only (%) App. + ssv (%) App + ssv + ifh (%) Number of infection sites examined
IR64 rice BLR 4 6.5 89.5 46
YRM54 rice BLR 4.5 2 94.5 44
Opus rice BLR 0 0 100 80
Langi rice BLR 7.5 2.5 90 40
Namaga rice BLR 0 1 99 76
Amaroo rice BLR 4 11 85 55
Koshihikara rice BLR 0 9 91 57
Golden Promise barley BLR 2 0 98 61
IR64 rice WSR 21-0 17 0 83 71
Kyeema rice WSR 21-0 25 0 75 27
Morocco wheat WSR 21-0 1 0 99 130
a
BLR = barley leaf rust and WSR = wheat stem rust.

Vol. 24, No. 10, 2011 / 1145

between medium infection site sizes were observed between Cytological evaluation of the rice NHR response
replicate experiments, and longer infection times did not nec- to cereal rust infection.
essarily correlate with increase fungal development (described An active NHR response was shown to be involved in the
below), even though experiments were undertaken in climate- suppression of cereal rust growth on rice. Aniline blue staining
controlled glasshouses. This experimental variation precludes indicated that callose deposition was associated with rust infec-
direct quantitative comparisons between different experiments; tion sites (Fig. 1P), as was occasional plant cell autofluores-
however, qualitative observations were consistent. cence, which is indicative of cell death (Fig. 3A to F). Staining
Infection of rice with another three rust species—P. triticina with 3-3diaminobenzidine (DAB) detected the production of
(WLR), P. striiformis (wheat stripe rust), and P. sorghi (com- hydrogen peroxide around rust infection sites, with larger in-
mon maize rust) (not shown)—also produced a distribution of fection sites showing greater zones of hydrogen peroxide pro-
infection sites ranging from little more than substomatal vesi- duction (Fig. 3G to J). Hydrogen peroxide production was not
cles to those that encompassed numerous mesophyll cells and limited to infected mesophyll cells and stomatal guard cells
produced haustoria (Fig. 2). At no stage did any rust species also produced this reactive oxygen species in response to ap-
complete their asexual cycle by producing urediospores, and pressorium production or even to what appeared to be attempted
no evidence of the spore producing asexual reproductive struc- appressorium production (Fig. 3K and L). Callose deposition
ture, the uredium, was apparent. These data demonstrate that and hydrogen peroxide production were commonly observed
five different cereal rust species that are pathogens of Poaceae at rust infection sites whereas autofluorescence was uncom-
spp. can all infect rice plants and, in some instances, produce mon, suggesting that most rust infections were prevented by
large infection sites that colonize hundreds of mesophyll cells mechanisms other than rice cell death that produced autofluo-
prior to fungal growth being suppressed by an NHR response. rescence.

Fig. 2. Large, single cereal rust infection sites observed on rice. From left to right: rice infected with Puccinia hordei (P.h), P. graminis (P.g), P. triticina (P.t),
and P. striiformis (P.s). Upper row shows extensive growth of infection hyphae (i) within the leaf, while spores (s), germ tubes (g), and appressoria (a) are
present on the leaf surface. Lower row shows haustoria (marked with an arrowhead) present within rice mesophyll cells. Each image in the upper row is a
composite of stacked photographs.

Fig. 3. A, Puccinia graminis appressorium on the surface of a rice leaf with underlying infection structures inside in the leaf visible in a different focal plane.
B, Autofluorescent mesophyll cells associated with the P. graminis infection site shown in A. C, P. hordei substomatal vesicle (ssv) and infection hyphae
inside a rice leaf. D, Autofluorescent mesophyll cells associated with the P. hordei infection site shown in C. E, P. striiformis infection site showing extensive
ramification of infection hyphae within a rice leaf. F, Autofluorescence of rice mesophyll cells at the P. striiformis infection site shown in E. G and H, 3-
3Diaminobenzidine (DAB) staining showing hydrogen peroxide production associated with P. graminis infection sites on rice leaves. I and J, Hydrogen
peroxide production associated with a P. hordei infection site on a rice leaf. I shows wheat germ agglutinin-alexa 488 staining of the rust infection site while
panel J shows localization of hydrogen peroxide around this same site by DAB staining. K, Attempted appressorium formation of a P. hordei germ tube on
the surface of a rice leaf. L, Hydrogen peroxide formation in stomatal guard cells associated with the attempted P. hordei appressorium formation shown in
K. M, Melampsora lini infection site growing on a flax leaf. The germinating spore, germ tube, and appressorium are evident on the surface of the leaf while
underlying infection hyphae can be seen inside the leaf. N, Germinated M. lini spore showing appressorium development on the surface of a flax leaf. O,
Appressorium development of M. lini on the surface of a rice leaf. P and Q, Appressorium development of an M. lini infection site on rice that is not
associated with a stomate. In Q, the arrow indicates the position of the nearest stomate. R, Two M. lini infection sites on rice. The upper infection site has
produced an appressorium over a stomate (arrow), while the lower infection site has produced an aberrant appressorium-like infection structure that is not
associated with a stomate. S and T, M. lini infection sites that have produced appressoria with additional hyphal-like extensions. Stomates are indicated in
each panel with arrows. U, Two M. lini infection sites on rice that produce aberrant appressoria-like structures that are not associated with stomata. V, Two
M. lini infection sites on rice. The upper spore has germinated to produce an appressorium with a short infection hyphae (indicated with a white arrow) that
has entered the leaf. The lower infection site has produced an appressorium only. W, M. lini infection site showing a germinated spore that has produced an
appressorium over a rice leaf stomate and short infection hyphae (indicated with a white arrow) within the leaf apoplast.

1146 / Molecular Plant-Microbe Interactions

Vol. 24, No. 10, 2011 / 1147
 Genetic variation of rice NHR to cereal rust.
To determine whether genetic variation may exist between
rice cultivars for the efficacy of the NHR response to WSR, 12
different rice cultivars (listed below) were assessed in a pre-
liminary, qualitative screen for differences in infection site
areas. From this preliminary screen, two cultivars (Kyeema
and Namaga) appeared to have, on average, larger rust infec-
tion sites compared with the remaining cultivars.
A quantitative analysis (described below) was undertaken on
WSR infection site areas for Kyeema, Namaga, and IR64 rice.
This latter cultivar was representative of the remaining rice
cultivars that were all more restrictive of WSR growth and was
chosen because of the availability of mutants of this line (de-
scribed below). The areas of WGA-alexa-stained stem rust
infection sites were measured over four replicate experiments
using three different infection times (Fig. 4). Only those infec-
tion sites that produced infection hyphae were considered.
For all three cultivars, a spectrum of infection site sizes was
observed that ranged from small (i.e., little more than a sub-
stomatal vesicle) to very large (i.e., encompassing hundreds of
mesophyll cells). However, from these analyses, it was appar-
ent that reproducible differences in infection site areas were
observed. In general, most infection sites on IR64 were small
in area, whereas the infection sites of Namaga and, particu-
larly, Kyeema were frequently larger (Fig. 4). This infection
site area distribution pattern was consistent for these three cul-
tivars over the four experiments. Statistical analyses using
Mann Whitney U tests indicated a highly significant difference
(P < 0.01) in the distribution of infection site areas between all
three cultivars in each experiment, except for Namaga and
Kyeema in experiment 1 (Table 3). The differences in WSR
growth on these three cultivars was also reflected in median
infection site area values (Fig. 5A; Table 3).
Several observations are noteworthy in this dataset. First,
large differences in individual infection site areas were ob-
served on each rice cultivar, including IR64, the cultivar most
restrictive of WSR growth. Second, the infection site areas
obtained between experiments was variable and was not neces-
sarily a function of infection time (Fig. 4, compare experiment
3 [11 days postinfection] and experiment 4 [16 days postinfec-
Fig. 4. Growth of wheat stem rust isolate 21-0 on ‘Namaga’, ‘IR64’, and tion]). These two observations suggest that, in addition to
‘Kyeema’ rice. Nine separate graphs are shown that each depict that the genetic factors, environmental factors influence the growth of
distribution of infection site areas measured on a single rice cultivar. Each WSR on rice. Significant experimental variation in NHR to
row of three graphs are the results from a single experiment while each rust infection was also reported for the interaction between
column shows the distribution of infection site sizes observed for the same
cultivar over each of four experiments. The y axis on each graph indicates Arabidopsis and Uromyces spp. (Mellersch and Heath 2003).
percent of infection sites while the x axis indicates infection site area in In spite of this interexperiment variation, the relative growth of
square micrometers. Infection site sizes were measured for experiments 1 WSR was consistently greatest on Kyeema, followed by Na-
to 4 after 7, 7, 11, and 16 days postinoculation, respectively. maga and IR64.

Table 3. Comparison of wheat stem rust 21-0 (WSR) and wheat leaf rust (WLR) infection site areas on three rice cultivars
Comparison Rust Experiment 1a Expriment 2a Expriment 3a Expriment 4a
Namaga vs. IR64 WSR 3,948 vs. 65 (91) (36) 3,443 vs. 496 (95) (61) 4,144 vs. 2,240 (101) (113) 2,920 vs. 1,281 (147) (75)
P < 0.0001 P < 0.0001 P < 0.007 P < 0.0017
Kyeema vs. IR64 WSR 4,353 vs. 55 (71) (36) 7,435 vs. 496 (23) (61) 15,623 vs. 2,240 (117) 4,394 vs. 1,281 (73) (75)
P < 0.0001 P < 0.0001 (113) P < 0.0001 P < 0.0001
Kyeema vs. Namaga WSR 4,353 vs. 3948 (71) (91) 7,435 vs. 3443 (23) (95) 15,623 vs. 4,144 (117) 4,394 vs. 2,920 (73) (147)
0.24 < P < 0.47 P < 0.01 (101) P < 0.0001 P < 0.0015
Namaga vs. IR64 WLR 353 vs. 182 (58) (84) 480 vs. 195 (37) (55) 270 vs. 136 (87) (63) 691 vs. 150 (56) (49)
0.0005 < P < 0.001 P < 0.0001 P < 0.0001 P < 0.0001
Kyeema vs. IR64 WLR 196 vs. 182 (48) (84) 282 vs. 195 (70) (55) 249 vs. 136 (72) (63) 320 vs. 150 (49) (49)
0.24 < P < 0.48 P < 0.0017 P < 0.0003 P < 0.001
Kyeema vs. Namaga WLR 196 vs. 353 (48) (58) 282 vs. 480 (70) (37) 249 vs. 270 (72) (87) 320 vs. 691 (49) (56)
0.015 < P < 0.03 0.023 < P < 0.046 0.15 < P < 0.29 0.006 < P < 0.013
a
The median rust infection site area in square micrometers measured on each rice cultivar being compared. The number of infection sites measured for each
cultivar in each experiment is shown in parentheses with Mann Whitney U test probability values comparing the spectrum of infection site areas measured
on each cultivar shown beneath. Statistically significantly different distributions of infection sites areas (P < 0.01) are in bold. The area of a single rice
mesophyll cells is approximately 80 µm2.

1148 / Molecular Plant-Microbe Interactions

 A similar, albeit more modest, reproducible difference in the
growth of WLR was observed among these three rice cultivars
at the 0.01% significance level (Fig. 5B; Table 3). IR64 was
again consistently the most restrictive in terms of rust growth
compared with the other two cultivars, apart from a single
comparison with Kyeema (Fig. 5; Table 3, experiment 1). No
consistent difference in WLR growth was observed between
Namaga and Kyeema based on Mann Whitney U test results,
with only one experiment in four showing a significant differ-
ence (Table 3). Overall, the median infection site areas of
WLR were much less in these experiments compared with the
preceding WSR experiments (Table 3).
Rice has previously been reported to show substantial varia-
tion in free SA content between different rice cultivars, with SA
levels ranging from 0.01 to 37.19 µg/g FW (Raskin et al. 1990;
Silverman et al. 1995). Free SA levels were measured in rice
seedlings of IR64, Kyeema, and Namaga, when grown side-by-
side, using high-performance liquid chromatography (HPLC)
analysis. IR64 was shown to have 3.5 times higher levels of SA
compared with either Kyeema or Namaga (P = 0.04 and 0.02,
respectively) (Fig. 5D), thereby raising a possible association
between reduced SA levels and increased WSR and WLR
growth on these latter two cultivars. No increase in free SA
accumulation was observed in these three rice cultivar following
inoculation with WSR (data not shown). Unlike most plants, rice
is atypical in that it contains high levels of SA compared with
other plant species and previous reports have shown no increase
in rice SA levels upon infection with either avirulent or virulent
adapted pathogens (Silverman et al. 1995).
In contrast to the variation observed for WSR and WLR,
when these three rice cultivars were infected with either BLR
or common maize rust no consistent difference in rust growth
was apparent. From three replicate experiments with barley
leaf rust, the majority (i.e., 7/9) of comparisons between these
three cultivars were not statistically significantly different.
Similarly, from four replicated experiments using maize rust, 9
of 12 comparisons between cultivars were not significantly dif-
ferent (data not shown).

Heritability of NHR efficacy in rice.

To examine the heritability of the differential NHR response
of Kyeema and IR64 rice to WSR, a cross was made between
these two cultivars. An F2 family of 31 individuals was in-
fected with WSR when seedlings were at the three-leaf stage
and infected tissue was harvested 14 days postinfection. When
these same seedlings had progressed to the sixth-leaf stage,
they were reinoculated with WSR and tissue was harvested
from the fifth and sixth leaves 14 days postinoculation. An
average of 30 rust infection sites was measured for each plant
at each time point and median infection site area calculated.

Fig. 5. A, Median infection site areas in square micrometers (y axis)

determined for growth of wheat stem rust 21-0 on ‘IR64’ (white columns),
‘Namaga’ (black columns), and ‘Kyeema’ (gray columns) rice over four
experiments. B, Median infection site areas in square micrometers
determined for IR64 (white columns), Namaga (black columns), and
Kyeema (gray columns) rice after infection with wheat leaf rust. Four
experiments are shown using tissue that was harvested after 11, 8, 13, and
13 days postinoculation, respectively. C, Graphs showing median infection
site area measurements of wheat stem rust isolates 21-0 (black columns)
and 326 (gray columns) when grown on IR64 (graphs on left) and Namaga
(graphs on right) rice. The y axis indicates median infection site areas in
square micrometers. Individual leaves from the same seedlings were
inoculated with either rust at the same time and tissue harvested and
measured at the same time. D, Salicylic acid (SA) content of uninfected
leaf tissue from IR64, Kyeema, and Namaga rice. The y axis indicates SA
concentrations in micrograms of SA per gram fresh weight of leaf tissue.

Vol. 24, No. 10, 2011 / 1149

For each time point, all 31 plants were ranked based on small- No difference in infection site areas of WSR 21-0 infections
est to largest median infection site area. was observed between wild-type rice lines and rice lines that
Spearman rank correlation coefficient analysis indicated that were deficient for either the OsRAR1 gene (Os02g0535400),
a highly statistically significant correlation was apparent be- which encodes a protein chaperone required for NBS-LRR
tween median infection site area rankings, with P = 0.008. gene function and basal resistance (Shirasu et al. 1999; Wang
However, the correlation coefficient was relatively modest et al. 2008) (Fig. 5D); the OsEDS1 gene (Os09g0392100),
(0.48). From this analysis, we conclude that there is heritable which encodes a lipase protein required for TIR (toll inter-
difference existing among these F2 progeny for the efficacy of leukin 1 receptor)-NBS-LRR gene function and basal defense
the NHR response to WSR. However, the variance in pheno- in Arabidopsis (Wiemar et al. 2005) (Fig. 5D); and the rice
type that arises from as-yet-unidentified environmental factors OsCeBip (Os03g0133400) gene, which encodes a plasma
results in only a modest correlation between these two data- membrane receptor involved in recognition of chitin (Kaku et
sets. Therefore, resolution of this heritable difference in NHR al. 2006; Miya et al. 2007) (data not shown).
into distinct QTL may not be possible among this F2 family. We hypothesized that common host defense mechanisms
may exist between NHR and basal resistance to the blast fun-
Assessment of genetic variation among WSR pathogens. gus, Magnaporthe oryzae, an adapted rice pathogen with long
To determine whether rice shows different infection responses co-evolutionary history with rice. This hypothesis would pre-
to genetically distinct isolates of WSR, IR64 and Namaga dict that loss of resistance to blast would compromise NHR.
were inoculated with two WSR isolates that possess different Over 14,000 IR64 mutant lines (Wu et al. 2005) were screened
virulence patterns on wheat. These WSR isolates, 21-0 and with a virulent blast isolate to identify mutants with enhanced
326, differ by six avirulence or virulence specificities (discussed susceptibility to this strain. From this screen, 300 putative mu-
below). To reduce experimental variation, each rust isolate was tants were identified that showed increased blast susceptibility
inoculated onto different leaves of the same rice seedlings, and under natural infection. The reduced basal resistance of these
individual leaves were harvested from these seedlings 10 days plants was confirmed by reinoculation.
postinoculation. From a total of 531 infection site areas meas- These 300 rice mutant lines with apparently reduced basal
ured over three separate experiments, no consistent difference resistance were screened with WSR 21-0 for increased infec-
in median infection site areas was observed between these rust tion and growth by this nonadapted pathogen. However, micro-
isolates when grown on the same rice cultivar (Fig. 5C; Table scopic assays on these plants revealed no increase in WSR
4). For both WSR isolates, significantly more fungal growth growth compared with wild-type IR64 plants. These data sug-
occurred on Namaga compared with IR64 (Fig. 5C; Table 4), gest that either little overlap exists between the rice NHR
consistent with previous results (Fig. 4; Table 3). However, the response to WSR and the basal defense response to rice blast
median infection site areas of 21-0 rust in these experiments disease or, alternatively, an additional defense mechanism is
(Table 4) were significantly smaller than those observed in the apparent in these rice lines that can be circumvented by the
preceding experiments (Table 3), again demonstrating substan- adapted pathogen but not by cereal rusts. In this latter scenario,
tial environmental influence on rust growth. Although it should the effect on rust growth of disruption in basal defense would
be noted that large rust infection sites were also observed in be masked by redundancy in resistance mechanisms.
these latter experiments, the frequency of small infection sites
was obviously greater. Challenge of rice plants with an autoecious rust pathogen
of a dicotyledenous plant species.
Disruption in defense response genes or disruption in basal Melampsora lini is a rust pathogen of the dicotledenous
defense to Magnaporthe grisea an adapted rice pathogen plant species flax (L. ussitatisimum) and, unlike the above
does not alter the efficacy of NHR to WSR. cereal rust species, it confines its lifecycle to a single plant
Rice T-DNA insertion lines were obtained that contained in- species. Rusts of the genus Melampsora and Puccinia are clas-
sertions within rice homologues of known defense-related sified taxonomically as being in different families of the same
genes. Plants homozygous for the insertion were identified by order, Uredinales. Intuitively, a rust species exclusively
polymerase chain reaction (PCR) analysis (Supplementary adapted for a dicotyledenous host species would be predicted
data). RNA blot analysis was then used to confirm both the to be less effective at infecting a monocotyledonous nonhost
inability of these plants to produce endogenous transcripts and species compared with nonadapted cereal rust pathogens. To
their homozygosity. Rust infection data was collected only test this hypothesis, rice plants were challenged with flax rust
from seedlings that had been confirmed by RNA blot assay to urediospores.
not produce transcripts. At least three seedlings were measured When flax rust urediospores were inoculated onto ‘Hoshan-
in each experiment. gabad’ flax, 92% of germinated spores successfully produced

Table 4. Growth of wheat stem rust (WSR) isolates 21-0 and 326 on ‘IR64’ and ‘Namaga’ rice
WSR 21-0 WSR 326 U test of 21-0 vs. 326 U test of 21-0 WSR growth on U test of 326 WSR growth on
Cultivar Exp.a median ISAb median ISAb rust growthc Namaga vs. IR64c Namaga vs. IR64c
IR64 1 123 (33) 175 (14) 0.25 < P < 0.51 P < 0.0001 0.0018 < P < 0.0035
Namaga 1 255 (52) 300 (43) 0.18 < P < 0.37 … …
IR64 2 139 (57) 179 (51) 0.0004 < P < 0.0008 P < 0.0001 P < 0.0001
Namaga 2 269 (46) 420 (64) 0.02 < P < 0.05 … …
IR64 3 147 (43) 157 (55) 0.35 < P < 0.72 P < 0.0001 0.0004 < P < 0.0008
Namaga 3 265 (33) 253 (40) 0.2 < P < 0.4 … …
a
In each experiment (Exp.), different leaves of the same IR64 and Namaga seedlings were inoculated with either WSR 21-0 or WSR 326 at the same time
and incubated for the same period. Infection site areas in square micrometers were then determined for each rust isolate by pooling leaves from seedlings of
the same cultivar infected with the same isolate. The area of a single rice mesophyll cells is approximately 80 µm2.
b
ISA = infection site areas. Numbers in parentheses indicate the number of infection sites measured.
c
Mann Whitney U tests were used to compare the distribution of ISAs observed for WSR 21-0 and WSR 326 growth on each rice cultivar. Significantly
different infection site areas (P < 0.01) are in bold.

1150 / Molecular Plant-Microbe Interactions

appressoria (number of sites examined [n] = 93) (Fig. 3M and The NHR mechanisms that operate against cereal rusts on
N). In contrast, when four rice cultivars (‘Doongara’, ‘Millin’, rice appear to occur at several levels. An obvious difference in
‘Langi’, and wild rice) were inoculated with flax rust uredio- infection efficiency was demonstrated for WSR and BLR on
spores, 37% of germinated spores successfully produced an their respective host species compared with rice. An approxi-
appressorium over a rice stomate on these four cultivars (n = mately twofold difference in successful stomate location and
234) (Fig. 3O). Many flax rust appressoria that developed on appressorium formation was observed for rust infection of host
rice leaves were morphologically aberrant when compared species compared with rice. This difference may be due to
with appressoria that developed on flax plants, with the former inappropriate biochemical or thigmotrophic signals arising
infection structures often (67%) producing hyphal-like exten- from the nonhost. The altered appressorium morphology of
sions (Fig. 3M to O). In addition, 20% of germinated flax rust WSR and BLR when grown on rice is consistent with this ob-
spores produced appressorial-like structures on rice that were servation.
not localized over a stomate (Fig. 3P and Q). Often (86%) A probable absence of appropriate physical and chemical
associated with these appressorial–like structures was a large signals was dramatically illustrated when rice was infected
amount of additional hyphal-like growth (Fig. 3R to U). with the rust of flax and aberrant infection structures were pro-
The aberrant structures observed when flax rust was grown duced. These aberrant growths were not observed on Arabi-
on rice were not observed when this pathogen was grown on dopsis and are likely to be a consequence of the differences in
its natural host, flax. Similarly, when flax rust was inoculated leaf architecture of cereals and dicot plants (Wynn 1981).
onto a nonhost dicot species, Arabidopsis ecotype Landsberg, Similar limited fungal development was observed when Arabi-
these aberrant infection structures were again absent. In this dopsis was inoculated with urediospores of WSR (Shafiei et al.
latter case, 41% of germinated flax rust spores successfully 2007). It would be of interest to infect Arabidopsis with WSR
produced an appressorium over an Arabidopsis stomate (n = basidispores, given that the sexual phase of WSR occurs exclu-
66) and 91% of these appressoria developed substomatal vesi- sively on dicot plant species (genus Berberis).
cles with occasional very short infection hyphae (n = 104) Therefore, basic incompatibility appears to reduce the effi-
(data not shown). ciency of cereal rust infection of rice but it is insufficient to
Additional microscopic analysis of flax rust development on prevent approximately half of attempted colonization events.
flax indicated that 99% of flax rust appressoria successfully Upon rust entry into the rice leaf, the nonhost responds with
entered the host leaf to produce infection hyphae, with haus- the production of reactive oxygen species (i.e., hydrogen per-
toria usually also visible (n = 108) (Fig. 3M). In contrast, only oxide), deposition of callose, and occasional cell death, as indi-
20% of flax rust appressoria that developed on rice went on to cated by autofluorescence. Both hydrogen peroxide production
successfully enter the rice leaf and produce infection hyphae and autofluorescence can be observed at the same infection
(n = 83) (Fig. 3V and W). In all cases, these infection hyphae site. For technical reasons, we have not examined callose depo-
were very short and were only produced by appressoria that sition at the same time. The majority of rust infections did not
did not have additional hyphal-like extensions. evoke rice cell death that led to autofluorescence, suggesting
In summary, 91% (92 × 99%) of flax rust urediospores that that this response is not essential for cessation of nonadapted
germinate on flax plants successfully infect the host and pro- pathogen growth. These responses were observed on all three
duce infection hyphae within the leaf. In contrast, only 7.5% rice cultivars (IR64, Kyeema, and Namaga) examined in this
(37 × 20%) of flax spore germination events on rice produced study and were also apparent at both small and large infection
short infection hyphae within the rice leaf. No evidence of sites. The difference in rust infection site sizes observed on a
haustorium production was observed for any flax rust infection single rice leaf could be a consequence of delayed activation
site on either rice or Arabidopsis in this study. of NHR or, alternatively, a transiently successful suppression
of the NHR response by the nonadapted pathogen.
DISCUSSION The immunity of rice to rust could theoretically have been
acquired by two routes. Either rice evolved from a rust-suscepti-
All five species of cereal rust examined in this study have ble progenitor grass and acquired resistance or, alternatively, the
the capacity to infect rice and produce many of the infection NHR mechanisms of rice evolved in the absence of cereal rust
structures required for the establishment of parasitism. All of pathogens and are in no way specifically adapted for defense
these rust species are capable of producing large infection sites against these species. The prevailing model of P. graminis evolu-
that encompass many (hundreds) rice mesophyll cells and pro- tion, for example, proposed by Leppik (1961) favors the latter
duce haustoria. Given the finite resources contained within a hypothesis. The progenitor of P. graminis was believed to have
single rust spore, the size of these larger, haustoria-producing existed as the aecial form of the species which parasitized dicot
infection sites argues that each nonadapted rust species has the plants of the ancestral Berberidaceae in the Northern Hemi-
ability to extract nutrients from the plant nonhost, prior to sphere, prior to the evolution of the Mahonia and Berberis gen-
growth cessation by an NHR response. era in this family. The grasses (Poaceae family) evolved and
In spite of the extensive growth occurring at some rust infec- formed subfamilies during their subsequent radiation. Some spe-
tion sites on rice, most attempted infections were generally cies (particularly members of the subfamily Pooideae) came into
more restricted, often confined to only substomatal vesicles close association with infected Berberis plants, leading to the
that produced small infection hyphae with occasional haus- parasitism of these grasses and subsequent evolution of the mod-
toria. Therefore, a stochastic process of rust infection was ob- ern macrocyclic, heteroecious species of P. graminis (Leppik
served on rice with a large variation in infection site size occur- 1961; Wahl et al. 1984).
ring between experiments and even upon a single leaf. This is For this reason, the large number of grasses species (possi-
somewhat analogous to the host mesothetic rust resistance bly in excess of 350) infected by P. graminis are mainly all
response, whereby some cereal resistance genes engender a members of the Pooideae family while grasses from some
mixed response of sporulating pustules and hypersensitive le- other Gramineae subfamilies, such as Erhartoideae, of which
sions on the same leaf when challenged by the same pure race rice is a member, are not parasitized by this species (Leppik
of the rust. Thus, for largely unknown reasons, large variations 1961; Wahl et al. 1984). If this evolutionary model is correct,
in rust development can occur in both NHR and host resistance the active NHR response of rice to P. graminis has evolved in
responses on a single cereal leaf. the absence of this nonadapted pathogen. Therefore, the in-

Vol. 24, No. 10, 2011 / 1151

duced NHR responses of rice to P. graminis infection of rice Natural variation in basal resistance (defined as polygenic,
may be due to PAMP recognition rather than the recognition of non–race specific, nonhypersensitive, partial resistance) to fun-
specific P. graminis effector molecules. gal and bacterial pathogens has been well established (Aghnoum
In contrast to the above model, a number of reports have et al. 2010; Denby et al. 2004; Kover and Schaal 2002; Marcel
claimed that a few members of the Erhartoideae subfamily are et al. 2007; Perchepied et al. 2006) and variation in effector-
hosts for Puccinia rusts (Afshan et al. 2010; Cummins 1971). triggered immunity mediated by R proteins has been known
Reports from the early 20th century have also recorded rice as for many years to range from partial resistance to complete
being a host for P. graminis f. sp oryzae (Cummins 1971; Ou immunity. Therefore, it is unsurprising that NHR effectiveness
1985) and U. coronatus (Ou 1985). However, the absence of also shows natural variation, further reinforcing the established
subsequent identification of rust diseases on rice in the inter- continuum of possible plant–microbe outcomes that are de-
vening 70 years makes their proposed parasitism highly ques- pendent upon the genotypes of both interacting organisms.
tionable, particularly given the massive areas of cereal cultiva-
tion and increased diversification of cereals grown in the same MATERIALS AND METHODS
region.
In rice, both the OsCeBip chitin PAMP receptor and OsRAR1 Propagation of rust species.
chaperonin protein have demonstrated roles in basal defense Cereal rusts (Table 5) were propagated on host species by
(Takahashi et al. 2007; Thao et al. 2007; Wang et al. 2008). inoculation of seedlings at the three-leaf stage with an aqueous
The OsRAR1 protein has not been shown to function in NBS- suspension of rust urediospores. Inoculated seedlings were
LRR-mediated resistance in rice but homologous in wheat and incubated overnight at 16C in a humid chamber and subse-
barley are required for function of some R proteins (Scofield et quently transferred to the glasshouse for the development of
al. 2005; Shirasu and Schulze-Lefert 2003). The role of rust pustules. Wheat rusts (P. graminis, P. striiformis, and P.
OsEDS1 is unknown in rice but the equivalent Arabidopsis triticinia) were propagated on ‘Sonora’ wheat, barley leaf rust
protein plays a central role in a regulatory pathway that is (P. hordei) was grown on Golden Promise barley, while maize
required for basal resistance, SA-mediated signaling, TIR-NBS- rust (P. sorghi) was grown on ‘HiII’ maize. Flax rust (M. lini)
LRR R protein function, and NHR (Lipka et al. 2008, 2010; was grown as previously described by Lawrence (1988) on
Weirmer et al. 2005). Disruption of these genes in rice did not Hoshangabad flax. Rust urediospores were collected from host
increase the growth of WSR, arguing for a significant amount species and used immediately for inoculation of rice seedlings
of redundancy in the rice NHR response to this nonadapted in nonhost assays. Two WSR isolates, 326 and 21-0, were used
pathogen. In contrast, SA deficiency has previously been shown in this study and have the following pathotype designations.
to reduce the NHR response of Arabidopsis to nonadapted Race 21-0 is recognized by resistance genes Sr5, Sr8a, Sr8b,
powdery mildews in a pen3/nahG mutant background (Stein et Sr9b, Sr9e, Sr11, Sr15, Sr17, Sr21, Sr24, Sr26, Sr27, Sr30,
al. 2006) and increase growth of a nonadapted bean rust patho- Sr31, Sr32, Sr35, Sr36, and Sr38 but is virulent on plants con-
gen (Mellersch and Heath 2003). Therefore, it is of interest taining Sr6, Sr7b, and Sr9g. Race 326 is recognized by resis-
that the levels of SA measured in three rice cultivars parallel tance genes Sr5, Sr7b, Sr8b, Sr9e, Sr9g, Sr15, Sr21, Sr24,
the observed extent of growth of both WSR and WLR in these Sr26, Sr27, Sr30, Sr31, Sr32, Sr35, Sr36, and Sr38 but is viru-
plants, although additional testing is required to confirm a co- lent on plants containing Sr6, Sr8a, Sr9b, Sr11, and Sr17.
relation between SA level and rust growth.
Genetic variation was observed between different rice culti- Rice lines and rust infection.
vars for the efficacy of NHR to both WSR and WLR. Natural Rice lines IR64, Kyeema, Namaga, Millin, Doongara, Opus,
variation in the NHR response of Arabidopsis to WLR has Amaroo, Langi, Koshihikara, Pelde, purple rice, and wild rice
been previously reported and co-related with increased levels were supplied by N. Upadhyaya (CSIRO, Canberra, Australia).
of camalexin, SA, and defense gene expression upon fungal Rice T-DNA insertion mutants were identified using the Salk
inoculation (Shafiei et al. 2007). Similar variation was observed Institute Rice Functional Genomic Express Database and seed
in Arabidopsis upon infection with bean leaf rust, where haus- of T-DNA insertion lines obtained from G. An, Pohang Bio-
toria formation occurred in only a single accession out of 17 tech Centre (Pohang, Korea) (Jeon et al. 2000; Jeong et al.
assayed (Mellersch and Heath 2003). In both these examples, 2006). Rice plants were grown under a growth regime of 21C
the extent of fungal colonization was far more restricted (i.e., for 16 h of light and 16C for 8 h of darkness. Seedlings were
less than 10 mesophyll cells) than what is observed at some inoculated with fresh rust spores at the three- to four-leaf stage
rice infection sites. The occurrence of near-NHR, as reported and incubated for 24 h in a humid chamber at 16C before
for the interaction between barley and WLR (Jaffary et al. transfer to the glasshouse.
2008), is presumably an extrapolation of variability within the
NHR response within a species. Screening rice mutants for enhanced susceptibility to blast.
To obtain rice mutants with enhanced susceptibility to rice
Table 5. Rust strains used in this study
blast disease, IR64 mutant collections were produced by chemi-
cal and irradiation mutagenesis (Wu et al. 2005). Individual
Rust species Common name Isolatea mutant lines (75 to 100 seeds) in the M4 generation were sown
Puccinia graminis Wheat stem rust 21-0 (PBIC 540129) in rows (15 to 20 cm long and 10 cm apart) in the blast screen-
f. sp. tritici ing nursery at IRRI Experimental Farm, Los Banos, Laguna,
P. graminis f. sp. Wheat stem rust 326 Philippines. Each nursery bed (15.7 by 1.17 m) was divided
tritici lengthwise into two subplots to accommodate 400 mutant
P. hordei Barley leaf rust 4653P+ (PBIC 990492)
P. striiformis Wheat stripe rust 104E137A-
lines, including susceptible ‘Co39’ and wild-type IR64 as
P. triticinia Wheat leaf rust 104-1236(7)11 (PBIC wild-type controls. Highly susceptible ‘IR50’, ‘IR72’, and
89172) ‘Co39’ were interplanted in the nursery bed as spreaders to
P. sorghi Common maize rust R1 ensure a diverse pathogen population. Ten days after sowing,
Melampsora lini Flax rust 228 the plots were covered by polyvinyl plastic in the afternoon
a
PBIC numbers indicate catalogue numbers at the cereal rust collection of and removed in the morning every day for 10 days to achieve
the University of Sydney, Plant Breeding Institute, Cobbitty, Australia. multiple cycles of infection. The seedlings were exposed to

1152 / Molecular Plant-Microbe Interactions

natural inoculum for over 20 days. The mutant lines were tion (Hood and Shew 1996), while hydrogen peroxide produc-
assessed for diseased leaf area (DLA) at 21 days after sowing tion was detected in plant tissue by staining with DAB stain
as previously described (Liu et al. 2011). Under this environ- (Sigma-Aldrich, St. Louis) (Thordal-Christensen et al. 1997).
ment, the wild-type IR64 exhibited 20 to 40% DLA. Mutant
lines that showed enhanced susceptibility relative to IR64 Measurements of rust infection site areas.
(with >50% DLA) were selected. In total, approximately Cereal rust infection site areas were calculated by micros-
14,000 mutant lines were screened. Selected mutant lines were copy of rust infection structures present within the leaf as de-
subjected to a second field evaluation to confirm the pheno- scribed above using WGA-alexa staining. Infection sites were
type. Seed of selected lines from the same M4 generation were photographed under ×20 magnification using a focal plane that
sent to CSIRO for rust infection assay. maximized the area of each infection site. Only those infection
sites that had produced infection hyphae within the plant were
Identification of homozygous rice T-DNA insertion lines. measured. Infections that produced only substomatal vesicles,
DNA extractions were undertaken as described by Ayliffe appressoria, or germ tubes were not included. The length (L)
and associates (2000). PCR analysis was used to identify and width (W) of each infection site was measured using the
plants homozygous for T-DNA insertions. A primer (Table 6) polyline facility of the AnalySIS Life Science Professional
specific for the T-DNA vector and a primer specific for the program (Olympus, Mt. Waverley, Australia). Each infection
flanking endogenous gene sequence were used to identify site was assumed to be approximately oval or circular in shape
those plants that contained at least one T-DNA insertion allele. and the infection site area was calculated by L/2 × W/2 × 3.14.
These DNAs were reamplified using gene-specific primers that Because rust infection site areas did not show a normal distri-
spanned the T-DNA insertion site. Those plants that were PCR bution, nonparametric statistical analyses were required;
positive for the DNA insertion allele and PCR negative for the hence, the Mann Whitney U test was used. The validity of this
endogenous gene sequence were considered to be homozygous statistical analysis for these datasets was supported by
for the insertion allele. The inability of these lines to produce Kruskal-Wallis one-way analysis of variance (data not shown).
endogenous transcripts was subsequently confirmed by RNA The Mann Whitney U test is based upon median values; hence,
blot analysis. median values are used for graphical presentation of data. Me-
dian values do not have a standard error associated with them.
Histological examination of fungal infection structures.
For microscopic visualization of spore germination and SA analysis.
appressoria formation, fresh infected leaf tissue was stained by SA content was determined essentially as described by
immersion in a 50 mM Tris (pH 7.5) solution containing Raskin and associates (1989, 1990). Leaf samples (150 mg)
0.05% Silwet L-77 (Lehle Seeds, Round Rock, TX, U.S.A.) were spiked with internal standard (o-anisic acid, 5 µg) and
and WGA at 20 µg/ml conjugated to the flurophore alexa 488 sequentially extracted with methanol (90 and 100%, vol/vol).
(Invitrogen, San Diego, CA, U.S.A.). After 5 min of staining, Supernatants were dried, resuspended in 5% trichloroacetic
the tissue was rinsed in 50 mM Tris (pH 7.5) and mounted on acid, and extracted with cyclopentane/ethyl acetate/isopropanol
a glass slide for microscopy. WGA binds specifically to N-ace- (49.5:49.5:1, vol/vol). Samples were vortexed, sonicated, and
tyl-glucosamine (i.e., chitin) and has been used extensively in centrifuged at each step. The upper, organic layer was dried in
staining of fungal material (Allen et al. 1973; Bhavanandan an N2 stream, resuspended in HPLC mobile phase, and filtered
and Kaltic 1979; Meyberg 1988). The above method allows through 0.45-µm polytetrafluoroethylene filters prior to HPLC
good resolution of external infection structures but does not analysis. Each extraction procedure was performed in triplicate
allow internal structures to be observed. However, additional and included procedural blanks and control samples. Analyses
tissue-clearing steps can result in removal of infection struc- were performed using an Agilent 1200 Series reverse phase
tures from the leaf surface, particularly spore germ tubes that HPLC system consisting of a quaternary pump equipped with
have not produced an appressorium. a thermostat auto-sampler (injection volume: 20 µl) and a fluo-
For visualization of internal infection structures, we have de- rescence detector (8-µl flow cell; photomultiplier gain set at
veloped the following simple staining procedure. To clear leaf
samples, tissue was cut into 2-cm pieces and autoclaved in a 10-
ml screw cap tube containing 5 ml of 1 M KOH and 0.05% Sil- Table 6. Primers and probes used in this study
wet L-77 (Hood and Shew 1996). Following autoclaving, the
Primer, probe Sequence, description
KOH solution was gently poured off and replaced with 10 ml of
50 mM Tris (pH 7.5). The tissue is quite fragile after autoclav- Primer
ing. This solution was then replaced with another 10 ml of Tris CeBipA TTAGCGTTTTATCGTTCCGG
(pH 7.5) and the tissue left for 20 min. It is important for the CeBipB GCATCACGTTAGAGCCTTCC
tissue pH to be neutralized prior to staining. After 20 min, a ma- RAR1A GCATGCACCCACAACATAAG
RAR1B ATTTTGTTGCGTAGGGATGG
jority of the Tris solution was removed to leave the tissue in a EDS1A ACACTGGCTCCTACCTCT
minimum volume. A 1-mg/ml solution of WGA-alexa was then EDS1B CAAAGTTCATGCATATGG
added to the tissue to produce a final stain concentration of 20 RB GGGGTTTCTACAGGACGTAAC
µg/ml. Tissue was stained for 15 min prior to microscopy. Addi- Probe
tional staining times (e.g., overnight) did not result in increased CeBip probe A 100-bp XhoI/EcoRI fragment from rice cDNA clone
background. After staining, the tissue was removed from the J023146H06 (accession number AK073032) corre-
tube by rinsing it out with 50 mM Tris (pH 7.5) into a glass petri sponding to 5 untranslated leader sequence of the
dish and then gently placing it on a microscope slide using for- CeBip gene.
ceps. After placing the tissue on the slide, gently spraying it with RAR1 probe A 1.25-kb fragment encoding exons 1 to 3 of OsRAR1
and corresponding to nucleotides 55,003 to 56,262 of
50 mM Tris solution from a squeeze bottle caused the tissue to BAC clone OJ112_G07 (accession number
unravel prior to adding a coverslip. All WGA-alexa-stained tis- AP004156)
sue was examined under blue light excitation. EDS1 probe A 450-bp fragment corresponding to nucleotides 1,636
Callose deposition in rust-infected rice plants was visualized to 2,083 of cDNA clone J023007E18 (accession num-
under UV light after staining with a 0.005% aniline blue solu- ber AK100117)

Vol. 24, No. 10, 2011 / 1153

10). Online fluorescence detection was performed using a pro- 444:323-329.
grammed excitation and emission wavelength of 297 and 407 Kaku, H., Nishizawa, Y., Ishii-Minami, N., Akimoto-Tomiyama, C.,
Dohmae, N., Takio, K., Minami, E., and Shibuya, N. 2006. Plant cells
nm for SA and 235 and 362nm for o-anisic acid. Fluorescence recognize chitin fragments for defense signaling though a plasma mem-
spectra were collected to check similarities with spectrum brane receptor. Proc. Natl. Acad. Sci. U.S.A. 103:11086-11091.
from authentic standards (Sigma-Aldrich). Analyses were run Kover, P. X., and Schaal, B. A. 2002. Genetic variation for disease resis-
under a solvent gradient of 20 µM KH2PO4 buffered at pH 2.5 tance and tolerance among Arabidopsis thaliana accessions. Proc. Natl.
(solvent A) and 100% methanol (solvent B) at a flow rate of Acad. Sci. U.S.A. 99:11270-11274.
Lawrence, G. J. 1988. Melampsora lini, rust of flax and linseed. Adv. Plant
1.1 ml/min. A guard column (Security Guard C18 4 × 3.0 mm) Pathol. 6:313-331.
was used in combination with the analytical column (Alltima Leppik, E. E. 1961. IV. Stem rust genealogy. Mycologia 53:378-405.
C18 column; 150 mm by 4.6 mm by 5 µm), which was set at Lipka, U., Fuchs, R., and Lipka, V. 2008. Arabidopsis non-host resistance
40C. to powdery mildew. Curr. Opin. Plant Biol. 11:404-411.
Lipka, U., Fuchs, R., Kuhns, C., Petutschnig, E., and Lipka, V. 2010. Live
and let die—Arabidopsis nonhost resistance to powdery mildews. Eur.
ACKNOWLEDGMENTS J. Cell Biol. 89:194-199.
Lipka, V., Dittgen, J., Bednarek, P., Bhat, R., Wiermer, M., Stein, M.,
We thank the Bill and Melinda Gates Foundation for funding of this Landtag, J., Brandt, W., Rosahl, S., Scheel, D., Lllorente, F., Molina,
project as part of the Borlaug Global Rust Initiative, Durable Rust Resis- A., Parker, J., Somerville, S., and Schulze-Lefert, P. 2005. Pre- and
tance in Wheat project; L. Lake, S. Chakraborti, C. Jackson, and R. Poels postinvasion defenses both contribute to nonhost resistance in Arabi-
for technical assistance; S. Madamba for screening for blast susceptible dopsis. Science 310:1180-1183.
mutants; the University of Sydney, Plant Breeding Institute, Australia, for Liu, Y., Zhu, X. Y., Zhang, S., Bernardo, M., Edwards, J., Galbraith, D. W.,
kindly providing wheat rust cultures. Leach, J. E., Zhang, G., Liu, B., and Leung, H. 2011. Dissecting quanti-
tative resistance against blast disease using heterogeneous inbred family
lines in rice. Theor. Appl. Genet. 122:341-353.
LITERATURE CITED Marcel, T. C., Varshney, R. K., Barbieri, M., Jafary, H., de Kock, M. J. D,
Graner, A., and Niks, R. E. 2007. A high-density consensus map of bar-
Afshan, N.-S., Khalid, A. N., and Niazi, A. R. 2010. Three new species of ley to compare the distribution of QTLs for partial resistance to Puc-
rust fungi from Pakistan. Mycol. Prog. 9:485-490. cinia hordei and of defence gene homologues. Theor. Appl. Genet.
Aghnoum, R., Marcel, T. C., Johrde, A., Pecchioni, N., Schweizer, P., and 114:487-500.
Niks, R. E. 2010. Basal host resistance of barley to powdery mildew: Mellersch, D. G., and Heath, M. C. 2003. An investigation into the involve-
connecting quantitative trait loci and candidate genes. Mol. Plant- ment of defense signaling pathways in components of the nonhost resis-
Microbe Interact. 23:91-102. tance of Arabidopsis to rust fungi also reveals a model system for
Allen, A. K., Neuberger, A., and Sharon, N. 1973. The purification, com- studying rust fungal compatibility. Mol. Plant-Microbe Interact. 16:398-
position and specificity of wheat germ agglutinin. Biochem. J. 131:155- 404.
162. Meyberg, M. 1988. Selective staining of fungal hyphae in parasitic and
Atienza, S. G., Jafary, H., and Niks, R. E. 2004. Accumulation of genes for symbiotic plant-fungus associations. Histochemistry 88:197-199.
susceptibility to rust fungi for which barley is nearly a nonhost results Miya, A., Albert, P., Shinya, T., Desaki, Y., Ichimura, K., Shirasu, K.,
in two barley lines with extreme multiple susceptibility. Planta 220:71- Narusaka, Y., Kawakami, N., Kaku, H., and Shibuya, N. 2007. CERK1,
79. a LysM receptor kinase, is essential for chitin elicitor signaling in
Ayliffe, M. A., Collins, N. C., Ellis, J. G., and Pryor, A. J. 2000. The Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 104:19613-19618.
maize rp1 rust resistance gene identifies homologues in barley that Ou, S. H. 1985. Rice Diseases, 2nd ed. Commonwealth Mycological Insti-
have been subjected to diversifying selection. Theor. Appl. Genet. tute, Commonwealth Agricultural Bureau, Kew, U.K.
100:985-1154. Perchepied, L., Kroj, T., Tronchet, M., Loudet, O., and Roby D 2006.
Ayliffe, M., Singh, R., and Lagudah, E. 2008. Durable resistance to stem Natural variation in partial resistance to Pseudomonas syringae is con-
rust needed. Curr. Opin. Plant Biol. 11:187-192. trolled by two major QTLs in Arabidopsis thaliana. PLoS One 1:e123.
Bhavanandan V. P., and Katlic, A. W. 1979. The interaction of wheat germ Online publication. doi:10.1371/journal.pone.0000123
agglutinin with sialoglycoproteins. J. Biol. Chem. 254:4000-4008. Raskin, I., Turner, I. M., and Melander, W. R. 1989. Regulation of heat
Borlaug, N. E. 2000. Ending world hunger. The promise of biotechnology production in the inflorescences of an Arum lily by endogenous sali-
and the threat of anti-science zealotry. Plant Physiol. 124:487-490. cylic acid. Proc. Natl. Acad. Sci. U.S.A. 86:2214-2218.
Collins, N. C., Thordal-Christensen, H., Lipka, V., Bau, S., Kombrink, E., Raskin, I., Skubatz, H., Tang, W., and Meeuse, B. J. D. 1990. Salicylic
Qui, J. L., Huckelhoven, R., Stein, M., Freialdenhoven, A., Somerville, acid levels in thermogenic and nonthermogenic plants. Ann. Bot.
S. C., and Schulze-Lefert, P. 2003. SNARE-protein-mediated disease 66:363-373.
resistance at the plant cell wall. Nature 425:973-977. Roelfs, A. P., and Bushnell, W. R. 1985. The Cereal Rusts, vol. 2. Dis-
Cummins, G. B. 1971. The Rust Fungi of Cereals, Grasses and Bamboos. eases, Distributions, Epidemiology and Control. Academic Press,
Springer Verlag, New York. Orlando, FL, U.S.A.
Denby, K. J., Kumar, P., and Kliebenstein, D. J. 2004. Identification of Scofield, S. R., Huang, L., Brandt, A. S., and Gill, B. S. 2005. Develop-
Botrytis cinerea susceptibility loci in Arabidopsis thaliana. Plant J. ment of a virus-induced gene-silencing system for hexaploid wheat and
38:473-486. its use in functional analysis of the Lr21-mediated leaf rust resistance
Heath, M. C. 2000. Nonhost resistance and nonspecific plant defenses. pathway. Plant Physiol. 138:2165-2173.
Curr. Opin. Plant Biol. 3:3154-319. Schulze-Lefert, P., and Pangstruga, R. 2011. A molecular evolutionary
Hogenhout, S. A., van der Hoorn, R. A. L., Terauchi, R., and Kamoun, S. concept connecting nonhost resistance, pathogen host range and patho-
2009. Emerging concepts in effector biology of plant-associated organ- gen speciation. Trends Plant Sci. 16:117-125.
isms. Mol. Plant-Microbe Interact. 22:115-122. Shafiei, R., Hang, C., Kang, J.-G., and Loake, G. J. 2007. Identification
Hood, M. E., and Shew, H. D. 1996. Applications of KOH-aniline blue of loci controlling non-host disease resistance in Arabidopsis against
fluorescence in the study of plant fungal interactions. Phytopathology the leaf rust pathogen Puccinia triticina. Mol. Plant Pathol. 8:773-
86:704-708. 784.
Jafary, H., Albertazzi, G., Marcel, T. C., and Niks, R. E. 2008. High diver- Shirasu, K., Lahaye , T., Tan, M. W., Zhou, F., Azevedo, C., and Schulze-
sity of genes for nonhost resistance of barley to heterologous rust fungi. Lefert, P. 1999. A novel class of eukaryotic zinc-binding proteins is
Genetics 78:2327-2339. required for disease resistance signalling in barley and development in
Jeon, J. S., Lee, S., Jung, K.-H., Jun, S.-H., Jeong, D.-H., Lee, J., Kim, C., C. elegans. Cell 99:355-366.
Jang, S., Lee, S.-Y., Yang, K., Nam, J.-M., An, K., Han, M.-J., Sung, R.- Shirasu, K., and Schulze-Lefert, P. 2003. Complex formation, promiscuity
J., Choi, H.-S., Yu, J.-W., Choi, J.-H., Cho, S-Y., Cha, S.-S., and An, G. and multifunctionality: protein interactions in disease-resistance path-
2000. T-DNA insertional mutagenesis for functional genomics in rice. ways. Trends Plant Sci. 8:252-258.
Plant J. 22:561-570. Silverman, P., Seskar, M., Kanter, D., Scheizer, P., Metraux, J.-P., and
Jeong, D.-H., An, S., Park, S., Kang, H.-G., Park, G.-G., Kim, S.-R., Sim, Raskin, I. 1995. Salicylic acid in rice: biosynthesis, conjugation and
J., Kim, Y.-O., Kim, M.-K., Kim, S.-R., Kim, J., Shin, M., Jung, M., possible role. Plant Physiol. 108:633-639.
and An, G. 2006. Generation of flanking sequence-tag database for acti- Stein, M., Dittgen, J., Sanchez-Rodriguez, C., Hou, B.-H., Molina, A.,
vation-tagging lines in japonica rice. Plant J. 45:123-132. Schulze-Lefert, P., Lipka, V., and Somerville, S. 2006. Arabidopsis
Jones, J. D. G., and Dangl, J. L. 2006. The plant immune system. Nature PEN3/PDR8, an ATP binding cassette transporter, contributes to non-

1154 / Molecular Plant-Microbe Interactions

 host resistance to inappropriate pathogens that enter by direct penetra- function in rice basal disease resistance. Mol. Plant-Microbe Interact.
tion. Plant Cell 18:731-746. 21:294-303.
Stokstad, E. 2007. Deadly wheat fungus threatens world’s breadbaskets. Wiermer, M., Feys, B. J., and Parker, J. E. 2005. Plant immunity: the
Science 315:1786. EDS1 regulatory node. Curr. Opin. Plant Biol. 8:383-389.
Takahashi, A., Agrawal, G. K., Yamazaki, M., Onosato, K., Miyao, A., Wu, J.-L., Wu, C., Lei, C., Baraoidan, M., Bordeos, A., Madamba, M.,
Kawasaki, T., Shimamoto, K., and Hirochika, H. 2007. Rice Pti1a nega- Ramos-Pamplona, M., Mauleon, R., Potugal, A., Ulat, V. J.,
tively regulates RAR1-dependent defense responses. Plant Cell Bruskiewich, R., Wang, G., Leach, J., Khush, G., and Leung, H. 2005.
19:2940-2951 Chemical- and irradiation-induced mutants of indica rice IR64 for for-
Thao, N. P., Chen, L., Nakashima, A., Hara, S.-I., Umemura, K., Takahashi, ward and reverse genetics. Plant Mol. Biol. 59:85-97.
A., Shirasu, K., Kawasaki, T., and Shimamoto, K. 2007. RAR1 and Wynn, W. K. 1981. Tropic and taxic responses of pathogens to plants.
HSP90 for, a complex with Rac/Rop GTPase and function in innate- Annu. Rev. Phytopathol. 19:237-255.
immune responses in rice. Plant Cell 19:4035-4045. Zhao, B., Lin, X., Poland, J., Trick, H., Leach, J., and Hulbert, S. 2005. A
Thordal-Christensen, H., Zhang, Z., Wei, Y., and Collinge, D. B. 1997.. maize resistance gene functions against bacterial streak disease in rice.
Subcellular localistaion of H2O2 in plants. H202 accumulation in papil- Proc. Natl. Acad. Sci. U.S.A. 102:15383-15388.
lae and hypersensitive response during the barley powdery mildew Zipfel, C. 2008.. Pattern-recognition receptors in plant innate immunity.
interaction. Plant J. 11:1187-1194. Curr. Opin. Immunol. 20:10-16.
Wahl, I., Anikster, Y., Manisterski, J., and Segal, A. 1984. Evolution at the
center of origin. Pages 39-77 in: Origins, Specificity, Structure, and
Physiology. The Cereal Rusts, Vol. 1. W. R. Bushnell and A. P. Roelfs, AUTHOR-RECOMMENDED INTERNET RESOURCE
eds. Academic Press, Orlando, FL, U.S.A..
Wang, Y., Gao, M., Li, Q., Wang, L., Wang, J., Jeon, J.-S., Qu, N., Zhang, Salk Institute Rice Functional Genomic Express database:
Y., and He, Z. 2008. OsRAR1 and OsSGT1 physically interact and signal.salk.edu/cgi-bin/RiceGE

Vol. 24, No. 10, 2011 / 1155