Aquaculture 483 (2018) 173–182

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Substituting fish meal with soybean meal in diets for Japanese seabass T
(Lateolabrax japonicus): Effects on growth, digestive enzymes activity, gut
histology, and expression of gut inflammatory and transporter genes
Chunxiao Zhanga,⁎, Samad Rahimnejada, Ya-ru Wanga, Kangle Lua, Kai Songa, Ling Wanga,
Kangsen Maib
a
Xiamen Key Laboratory for Feed Quality Testing and Safety Evaluation, Fisheries College, Jimei University, Xiamen 361021, China
b
Key Laboratory of Mariculture (Education Ministry of China), Ocean University of China, Qingdao 266003, China

A R T I C L E I N F O A B S T R A C T

Keywords: The aim of this study was to evaluate the effects of substituting fish meal (FM) with soybean meal (SM) on
Lateolabrax japonicus growth performance, digestive enzymes activity, gut histology, and intestinal pro-inflammatory and transporter
Fish meal replacement genes expression in Japanese seabass (Lateolabrax japonicus). Totally three test diets were prepared: a basal FM-
Soybean meal based diet and two SM diets by substituting 50 or 75% of FM with SM (FM, SM50 and SM75 diets). Each diet was
Digestive enzymes activity
fed to triplicate groups of fish (6.67 ± 0.03 g) to apparent satiation twice a day for eight weeks. The results
Gut health
Gene expression
showed no significant (P > 0.05) differences in growth performance between FM and SM50 groups while
further increment of replacement level to 75% led to a significantly (P < 0.05) reduced growth rate. However,
both SM50 and SM75 groups showed significantly lower feed efficiency and protein efficiency ratio than FM
group. Significantly lower digestibility coefficients of dry matter and protein were achieved in the group re-
ceived SM75 diet and digestibility coefficient of gross energy decreased in both SM50 and SM75 groups. Also,
SM75 fed fish exhibited remarkably lower survival rate than the other treatments. SM75 group had lower whole-
body protein and lipid contents than FM fed fish. Drastic decreases in protease, amylase and lipase activities
were found in foregut of SM groups compared to FM group. Offering SM75 diet resulted in significant reduction
of villus height, villus thickness, and muscular thickness in foregut and midgut. A remarkable increase in serum
D-lactate concentration was detected in SM groups, and serum diamine oxidase activity elevated in SM75 group.
Replacement of FM resulted in elevated expression of gut pro-inflammatory genes such as TNF-α, IL-1β, IL-2, IL-
8 while an opposed trend was observed for the anti-inflammatory gene IL-4. Expression of intestinal transporter
genes including PepT1, LAT1 and SLC1A5 were significantly up-regulated by SM replacement. To conclude,
replacing 50% of FM with SM did not significantly influence growth performance, but adverse effects were found
on feed utilization, digestive enzymes activity and gut health being more evident at the higher replacement level.

1. Introduction of its price (Faggio et al., 2014a, 2014b; Fazio et al., 2013). The re-
quisite for sustainable protein sources for aquafeeds production has
Fish meal (FM) has long been utilized as the best dietary protein urged aquaculture nutritionists to explore alternative protein sources to
source for aquafeeds production because apart from being a balanced replace for FM (Aragona et al., 2017; Carbone and Faggio, 2016; Faggio
source of indispensable amino acids, is a rich source of long-chain et al., 2015; Guardiola et al., 2016; Gatlin et al., 2007; Glencross,
omega-3 fatty acids, vitamins and minerals essential for normal animal 2009).
growth (Olsen and Hasan, 2012). However, its stagnant supply as well Terrestrial animal and plant proteins have been recognized as sus-
as increasing demand has resulted in higher prices for FM during the tainable protein sources to substitute FM (Bowyer et al., 2013; Burgos-
recent decades. Furthermore, roughly two-third of the total produced Aceves et al., 2016; Naylor et al., 2009; Tacon and Metian, 2008).
FM is used for aquafeeds production (FAO, 2012); thus considering the Soybean meal (SM) has been identified as one of the most promising
rapid expansion of aquaculture industry there are concerns over suffi- candidates for FM replacement mainly due to its compatible nutritional
cient FM supply to meet the industry's demand in the future regardless composition, relatively well-balanced amino acid profile, widespread

⁎
Corresponding author at: Fisheries College, Jimei University, No. 43 Yindou Road, Xiamen 361021, China.
E-mail address: [email protected] (C. Zhang).

http://dx.doi.org/10.1016/j.aquaculture.2017.10.029
Received 22 September 2017; Received in revised form 18 October 2017; Accepted 20 October 2017
Available online 21 October 2017
0044-8486/ © 2017 Elsevier B.V. All rights reserved.
C. Zhang et al. Aquaculture 483 (2018) 173–182

availability, and low cost (Gatlin et al., 2007; Storebakken et al., 2000; Table 1
Trushenski et al., 2006). However, digestibility, palatability and utili- Formulation and proximate composition of the experiment diets (% dry matter).
zation of feeds (particularly in carnivorous fish) could be negatively
FM SM50 SM75
influenced when SM is used as the primary protein source (Brown et al.,
1997; Davis et al., 1995; Refstie et al., 1998; Sitjà-Bobadilla et al., 2005; Ingredients
Watanabe and Pongmaneerat, 1993; Zhou et al., 2005). Standard SM Fish meala 42 21 10.5
Soybean mealb 0 30 45
can be incorporated only at relatively low levels in carnivorous fish feed
Wheat flour 41.4 24.92 15.13
due to its adverse effects on gut health (Krogdahl et al., 2010; Merrifield Wheat gluten 5.4 9.6 11.5
et al., 2011). The negative impacts of high dietary inclusion levels of SM Squid liver meal 1.5 1.5 1.5
are associated with its various antinutritional factors (ANFs) such as Fish oil 2.3 4 5.7
protease inhibitors, phytate, saponins, lectins, and oligosaccharides Soybean oil 3.5 3.1 2.7
Lecithin 2 2 2
(Francis et al., 2001). There are several reports indicating that ANFs
L-Ascorbyl polyphosphate 0.1 0.1 0.1
activate inflammatory signals in digestive tract of several fish species Vitamin premixc 0.3 0.3 0.3
(Bakke-McKellep et al., 2000; Krogdahl et al., 2010). Also, several re- Mineral premixd 0.5 0.5 0.5
searchers have reported the induction of inflammatory responses in the Choline chloride 0.5 0.5 0.5
Calcium dihydrogen phosphate 0 1.54 3.03
distal intestinal mucosa of cultured fish species following SM admin-
Yttrium oxide 0.5 0.5 0.5
istration (Baeverfjord and Krogdahl, 1996; Hedrera et al., 2013; Methionine 0 0.19 0.41
Rumsey et al., 1994; Urán et al., 2008; Van den Ingh et al., 1991; Lysine 0 0.25 0.63
Yamamoto et al., 2008). The severity of histopathological changes ob- Proximate composition (%)
served by SM application depends on the content of the soybean protein Dry matter (DM) 86.4 86.3 89.8
and level of inclusion (Barrows et al., 2007; Francis et al., 2001), and is In DM:
characterized by a shortening of the mucosal folds, a swelling of the Protein 42.63 43.24 43.04
Lipid 12.88 13.19 13.12
lamina propria and subepithelial mucosa, loss of supranuclear vacuo-
Ash 8.43 7.98 7.53
lization in the absorptive cells of the intestinal epithelium, infiltration
of a mixed leukocyte population in the lamina propria and submucosa, a
Xiamen ITG group Corp., Ltd., Xiamen, China, imported from Peru (crude protein:
and decreased numbers of absorptive vacuoles in the enterocytes 69.4%, crude lipid: 7.8%).
b
(Baeverfjord and Krogdahl, 1996; Bakke-McKellep et al., 2000; Bakke- Soybean meal, obtained from Quanzhou Fuhai cereals and oils industry Co., Ltd.
McKellep et al., 2007; Van den Ingh et al., 1991). However, it has been (crude protein: 46.5%, crude lipid: 1.6%).
c
Vitamin premix (mg or g kg− 1 diet): thiamin, 10 mg; riboflavin, 8 mg; pyridoxine
demonstrated that sensitivity to soy ANFs varies among different fish
HCl, 10 mg; vitamin B12, 0.2 mg, vitamin K3, 10 mg; inositol, 100 mg; pantothenic acid,
species, e.g., Atlantic salmon (Salmo salar) and rainbow trout (Oncor- 20 mg; niacin acid, 50 mg; folic acid, 2 mg; biotin, 2 mg; retinol acetate, 400 mg; cho-
hynchus mykiss) showed distinct morphological alternations in the in- lecalciferol, 5 mg; alpha-tocopherol, 100 mg; ethoxyquin, 150 mg; wheat middling,
testine (Krogdahl and Bakke-McKellep, 2001) while no apparent ad- 1.1328 g.
verse effects could be found in red drum (Sciaenops ocellatus) (Reigh and d
Mineral premix (mg or g kg− 1 diet): NaF, 2 mg; KI, 0.8 mg; CoCl2·6H2O (1%), 50 mg;
Ellis, 1992) and Japanese flounder (Paralichthys olivaceus) (Kikuchi, CuSO4·5H2O, 10 mg; FeSO4·H2O, 80 mg; ZnSO4·H2O, 50 mg; MnSO4·H2O, 25 mg;
MgSO4·7H2O, 200 mg; zoelite, 4.582 g.
1999) offered diets containing almost equal amounts of FM and SM.
Japanese seabass (Lateolabrax japonicus) is a carnivorous species
that has been largely cultured in East Asia, particularly in China (Islam 2.2. Experimental fish and feeding trial
et al., 2015; Li et al., 2012). Previous studies showed that FM can be
replaced up to 30% in seabass diet without suppressing growth or ne- Japanese seabass juveniles were purchased from a private farm
gative effects on gut integrity (Hu et al., 2013; Laporte and Trushenski, (Zhangpu Hui Feng farm, Xiamen, China) and transported to the
2012; Li et al., 2012). J. Wang et al. (2017) reported the incidence of aquaculture laboratory of Jimei University. The fish were stocked into
enteritis in Japanese seabass fed a diet in which 50% of FM was re- two 1000-L tanks supplied with filtered seawater in a recirculating
placed with SM. The aim of the present study was to examine the im- system and fed the basal diet twice daily for one month to adapt them to
pacts of replacing 50 and 75% of FM with SM on growth, digestive the experimental facilities and conditions. At the termination of the
enzymes activity, and gut health of Japanese seabass. In order to further acclimation period, 180 healthy fish averaging 6.67 ± 0.03 g were
elucidate the molecular mechanisms associated with intestine in- stocked into nine 150-L tanks (containing 120 L water) in a re-
flammation, expression of inflammatory genes was also examined circulating system at a density of 20 fish/tank. The recirculating system
which has not been explored in previous studies. consisted of a reservoir with a biological filter, a circulation pump and
an automatic temperature control device. The experiment was con-
2. Materials and methods ducted in triplicates and fish were fed their respective diets to apparent
satiation two times a day (8:30 and 17:30) for eight weeks. The fish
2.1. Experimental diets were fed feed of 1.5-mm diameter for the first 2 weeks and 2.5-mm
diameter feed for the following 6 weeks. Uneaten feed, if any, was si-
Formulation and proximate composition of the experimental diets phoned out 30 min after feeding, dried and weighted for subsequent
are presented in Table 1. Three experimental diets were formulated to calculation of feed intake, and then approximately two-third of the
be isonitrogenous (42% protein) and isolipidic (12% lipid). A basal diet water was replenished. The fish were fasted for 24 h prior to weighing
was formulated to contain 42% FM (FM diet), and two other diets were or sampling to minimize handling stress on fish. The average tem-
prepared by substituting 50 or 75% of FM by SM (SM50 and SM75 perature during the feeding trial was 28 ± 2 °C and the photoperiod
diets). The coarse dry ingredients were finely ground using a hammer was maintained on a 12:12 light:dark schedule.
mill and passed through a 60-μM mesh. All the dry ingredients were
thoroughly mixed and a mash was produced after adding fish oil, soy- 2.3. Sample collection
bean oil and deionized water. The resultant dough was conveyed into
multifunctional spiral extrusion machinery (CD4XITS, South China At the termination of the feeding period, all the fish in each tank
University of Technology, Guangzhou, China) with 1.5 and 2.5-mm were counted and bulk weighted for calculation of growth parameters
diameter. The pellets were dried overnight in a dry oven at 35 °C, then and survival. Fish were anesthetized in eugenol (1:10,000) prior to
sealed in bags and stored at −20 °C until used. dissection or blood sampling. Three fish per tank were randomly

174
C. Zhang et al. Aquaculture 483 (2018) 173–182

captured for histological analyses. Prior to dissection, the fish were first kits (Nanjing Jiancheng Institute, Nanjing, China) according to the
disinfected with 75% alcohol. Foregut and midgut were collected, flu- manufacturer's instructions. The protein content of the homogenates
shed with ice-cold phosphate-buffered saline (PBS saline, pH 7.4), and was measured using Folin-phenol reagent (Lowry et al., 1951). Protease
then fixed in 10% formalin for morphological measurements. Also, activity was measured using casein as substrate as described by Pan and
another set of foregut and midgut samples were dissected from another Wang (1997). A typical assay was performed as follows: 2 ml of 0.5%
set of three fish/tank and immediately immersed in RNA keeper casein, 0.1 ml of 0.04 mol l− 1 EDTA-Na2, 0.4 ml of appropriate buffer,
(Vazyme Biotech Co., Ltd., NanJing) for 12 h at 4 °C and then preserved 0.2 ml of enzymatic extract and 0.8 ml distilled water were mixed and
at − 80 °C for analysis of Peptide Transporter 1 (PepT1), L-amino acid incubated for 15 min in specific conditions of pH, temperature and
transporter 1 (LAT1), solute carrier family 1 member A5 (SLC1A5), NaCI concentration. The reaction was terminated by adding 1 ml of
TNF-α, IL-1β, IL-2, IL-8 and IL-4 genes expression. For analysis of di- 30% chilled trichloroacetic acid (TCA). The mixture was centrifuged at
gestive enzymes activity, new sets of foregut and midgut samples were 2000 g for 15–20 min. One milliliter of clear supernatant, 5 ml of
collected from three fish per tank, immediately flash frozen in liquid 0.55 mol l− 1 Na2CO3 and 1 ml of Folin reagent were mixed and stayed
nitrogen and subsequently kept in − 80 °C. Three fish from each tank for 15 min, then OD was measured in a spectrophotometer at 680 nm
(nine fish per dietary treatment) were randomly captured, and blood against blanks in distilled water. Controls were made in which the
samples were collected from caudal vein with non-heparinized syringes enzymatic extracts were added at the end of the incubation period and
and allowed to clot at 4 °C for 24 h, then serum samples were separated just before the centrifugation. Enzymatic extracts were diluted if re-
by centrifuging at 3000 × g for 10 min at 4 °C. Serum samples were quired. One unit of the activity was defined as the amount of the hy-
used for determination of D-lactate concentration and diamine oxidase drolysis of casein that liberated 1 μg of tyrosine per min.
(DAO) activity. The same fish were used for determination of whole-
body proximate composition. After six weeks of feeding, in order to 2.4.4. Serum D-lactate concentration and DAO activity
determine the digestibility coefficients of protein, dry matter and gross Serum D-lactate concentration and DAO activity were determined
energy, feces were collected from bottom of the tanks, centrifuged for using Beckman CX4 Chemistry Analyser (Beckman Coulter, Brea, CA)
30 min at 2100 × g and the supernatant was discarded, and feces were with commercial assay kits (Nanjing Jiancheng Bioengineering
frozen at − 20 °C until analysis. Institute, Nanjing, Jiangsu, China). The quantification of D-lactate re-
quires two enzyme reactions. In the first reaction catalysed by D-lactate
2.4. Analytical methods dehydrogenase, D-lactate is oxidised to pyruvate and nicotinic acid
dehydrogenase (NADH) in the presence of nicotinamide-adenine dinu-
2.4.1. Chemical composition and diet digestibility cleotide (NAD+). However, since the equilibrium of reaction lies firmly
Analyses of moisture, crude protein, crude lipid and ash contents of in the favour of D-lactate and NAD+, a further reaction is required to
the experimental diets, feces and whole-body samples were performed trap the pyruvate product. This is achieved by the conversion of pyr-
by the standard procedures (AOAC, 2002). Moisture was determined by uvate to D-alanine and 2-oxoglutarate, with the enzyme D-glutamate-
drying the samples in an oven at 105 °C to constant weight; crude pyruvate transaminase in the presence of a large excess of D-glutamate.
protein was analyzed by the Kjeldahl method (N × 6.25) with a FOSS The amount of NADH formed in the above coupled reaction is stoi-
Kjeltec 8400 analyzer (Tecator, Höganäs, Sweden) after acid digestion chiometric with the amount of D-lactate. It is the NADH which is
in an auto-digester (FOSS; Tecator); crude lipid was determined by measured by the increase in absorbance at 340 nm. Activity of DAO was
Soxhlet extraction in ether; ash content was measured by the combus- measured by using histamine as the substrate and by monitoring the
tion method in a muffle furnace at 550 °C for 8 h. Gross energy content rate of ammonia formation following the cleavage of histamine. The
of diets was determined using an adiabatic bomb calorimeter (Parr rate of decrease in absorbance at 340 nm is proportional to activity of
6300; Parr Instruments Inc., Moline, IL, USA). Yttrium oxide in the diets DAO. The effect of endogenous ammonia present in the serum sample
and feces samples were determined by inductively coupled plasma- was eliminated by performing a 10 min incubation of the sample with
atomic emission spectrophotometer (ICP-OES, Prodigy7, Leeman Labs, 2-oxoglutarate. One unit of activity was defined as 1 mmol of ammonia
USA). The apparent digestibility coefficients (ADCs) of dry matter, formed per minute per ml of serum at 37 °C.
protein and energy for the test diets were calculated using the following
formula (NRC, 2011): 2.4.5. RNA extraction and real-time quantitative PCR (qPCR)
RNA was isolated from foregut and midgut samples (approximately
ADC of dry matter (%) = (1 − Y2O3 in diet/Y2O3 in feces) × 100%
80 mg) using TRIzol Reagent (Invitrogen, USA). The purity and con-
centration of RNA were measured using a ND-2000 spectrophotometer
ADC of nutrient (%) = [1 − (Y2O3 in diet/Y2O3 in feces) (NanoDrop 2000, Wilmington, DE, USA). RNA integrity was confirmed
× (nutrient in feces/nutrient in diet)] × 100% by running 1 μg RNA on an ethidium-bromide stained 1.5% agarose gel
with 1 × Tris Acetate EDTA (TAE) buffer. Gels were then observed
ADC of gross energy was calculated using gross energy data under ultraviolet light and photographed in a GS-800 Ultraviolet
(kJ g− 1) instead of nutrient data. Transilluminator (UVP, Upland, CA, USA).
For each sample, 3-μg (0.15 μg/μl) RNA was reverse-transcribed
2.4.2. Gut morphology into cDNA using a Revert Aid First-Strand Synthesis System (Thermo
The fixed foregut and midgut samples were dehydrated in a graded Scientific, Waltham, MA, USA) for quantitative reverse transcription
series of ethyl alcohol and embedded in paraffin. Three sections (7 μm PCR (RT-qPCR) with Oligo (dT) 18 primers according to the manufac-
thick) were cut from each sample and then stained with hematoxylin/ turer's protocol. The reaction was incubated using a Peltier Thermal
eosin. The villus height, villus thickness and muscular thickness of each Cycler 200 (MJ Research, Watertown, MA, USA). cDNA integrity was
slice were measured using the image analysis software Image-Pro Plus confirmed by running 1-μg cDNA on an ethidium-bromide stained 1.5%
6.0 (Media Cybernetics, Inc.). Histological alterations in intestinal agarose gel with 1 × TAE buffer. Gels were treated as reported before.
epithelia were evaluated based on the degree of changes in villi and the The PCR was performed in a total volume of 20 μL, containing 1 μL
absorptive epithelial cell area was examined using a light microscope of each primer (10 μM), 9 μL of the diluted single strand cDNA product
Olympus BX53 (Olympus, Japan). and 10 μL of AceQ® qPCR SYBR® Master Mix (Nanjing, China). The
primers' sequence is presented in Table 2. The RT-qPCR program was
2.4.3. Digestive enzymes activity 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for
Amylase and lipase activities were analyzed using commercial assay 15 s and an extension at °C for 60 s. At the end of each PCR reaction,

175
C. Zhang et al. Aquaculture 483 (2018) 173–182

Table 2
Sequence of the primers used for real-time PCR.

Target genes Forward primer (5′-3′) Reverse primer (5′-3′) Annealing temperature (°C)

β-Actin F:AACTGGGATGACATGGAGAAG R:TTGGCTTTGGGGTTCAGG 60

SLC1A5 F:GACGTGCGGTCCACAAAATG R:TCATCCTGGCTGTTGACTGG 60
LAT1 F:TGGCCTACTTCACCACCATT R:CGGAGTGAAGAGGTCTGTGT 60
PEPT1 F:GACTTCTGCAGCTGACTTCG R:TCGGCCCAAAGTCAAAAGTG 60
TNF-α F:GATCGTCATCCCACAAACCG R:GCTTTGCTGCCTATGGAGTC 60
IL-1β F:GTCAACTTACGTGCACCCTG R:AAATCGTACCATGTCGCTGC 60
IL-2 F:GGGAAAGTGTCACATGTCCG R:ACGGCCTGGTTTAAAGATGC 60
IL-4 F:ACCATGCATTACTACAGCACTG R:CACATTCAGGGGCGTTTGTC 60
IL-8 F:GGATCAGTTTCTTCACCCAGG R:CAGGTGGAGTCGAGGATCAT 60

melting curve analysis was performed to confirm that only one PCR However, both SM50 and SM75 groups had significantly lower feed
product was present in these reactions. Expression levels of the PepT1, efficiency (FE) and protein efficiency ratio (PER) than FM group. The
LAT1, SLC1A5, TNF-α, IL-1β, IL-2, IL-8 and IL-4 genes were normalized fish fed SM75 diet exhibited significantly lower apparent digestibility
to β-actin using the 2− ΔΔCT method (Schmittgen and Livak, 2008). Each coefficients (ADC) of dry matter and protein than the FM fed fish and
sample was analyzed via RT-qPCR in triplicate. PepT1, LAT1, SLC1A5, ADC of gross energy significantly decreased at both replacement levels.
TNF-α, IL-1β, IL-2, IL-8, IL-4 and β-actin genes were retrieved from SM75 group showed the lowest survival rate (78.8%) which sig-
NCBI (http://www.ncbi.nlm.nih.gov/) and primers were designed nificantly differed from those of the SM50 (98.3%) and FM (100%)
using Primer 5.0 (Table 2). groups.
The results of whole-body composition analysis revealed the sig-
2.5. Statistical analysis nificant reduction of protein and lipid contents in SM75 group com-
pared to the other treatments, and their values were inversely corre-
All the data were analyzed by one-way analysis of variance lated with whole-body moisture and ash contents (Table 4).
(ANOVA) using SPSS version 17.0 software (SPSS Inc., Chicago, IL, Activity of digestive enzymes including protease, amylase and lipase
USA). When ANOVA detected a difference among groups, Duncan's in foregut and midgut are presented in Table 5. The results revealed the
multiple range test was used to identify the difference in the means. drastic reduction in activity of all the three enzymes in foregut of SM
Data are presented as mean ± standard error of the mean (SE). fed groups compared to the FM group. In midgut, the highest lipase
Statistical significance was determined at P < 0.05. activity was observed in SM50 group which was significantly different
from that of the SM75 group.
Replacing 75% of FM with SM resulted in significant reduction of
3. Results
villus height, villus thickness, and muscular thickness in foregut and
midgut compared to the FM group (Table 6 and Fig. 1). Significant
No significant (P > 0.05) differences were found for final body
decreases in villus and muscular thicknesses were observed in foregut of
weight, weight gain (WG) and specific growth rate (SGR) between fish
SM50 group, also muscular thickness was significantly decreased in
fed FM and SM50 diets (Table 3), but increasing FM replacement level
midgut of the same group.
to 75% resulted in significantly (P < 0.05) reduced growth perfor-
The results showed that replacement of FM at both levels leads to
mance. The highest feed intake was observed in the group received
significant increase of serum D-lactate concentration (Fig. 2a). Also,
SM50 diet which significantly differed from that of the FM group.
SM75 fed fish exhibited significantly higher serum DAO activity than
the FM fed fish (Fig. 2b).
Table 3
Growth performance, feed utilization and apparent digestibility coefficients (ADC) of A significant enhancement in expression of PepT1 gene was ob-
Japanese seabass fed the experimental diets for 8 weeks. served in foregut of SM50 and SM75 groups compared to FM fed fish
(Fig. 3a). Expression of LAT1 gene was enhanced in foregut by SM re-
Item FM SM50 SM75 placement and a similar trend was observed for midgut (Fig. 3b). Also,
Final body weight (g) 59.10 ± 1.26 a
55.03 ± 2.06 a
38.83 ± 1.16b the results showed significant enhancement of SLC1A5 expression in
WGa (%) 1078 ± 24.9a 1018 ± 32.9a 799 ± 46.4b foregut of SM50 group and midgut of SM50 and SM75 groups (Fig. 3c).
SGRb (%/d) 4.40 ± 0.04a 4.32 ± 0.04a 3.74 ± 0.05b The results of pro-inflammatory genes expression showed sig-
Feeding ratec (%/d) 3.26 ± 0.07b 3.47 ± 0.04a 3.39 ± 0.03ab nificant enhancements in expression of TNF-α, IL-1β and IL-8 in foregut
FEd 0.92 ± 0.02a 0.86 ± 0.01b 0.82 ± 0.01b
PERe 2.17 ± 0.05a 1.98 ± 0.03b 1.91 ± 0.03b
of SM50 and SM75 (Fig. 4a, b, d). Also, expression of IL-2 was enhanced
ADCd (%)f 81.8 ± 0.21a 80.2 ± 1.54a 75.2 ± 0.95b in foregut of SM75 and midgut of SM50 and SM75 groups (Fig. 4c). An
ADCp (%)g 95.7 ± 0.25a 95.4 ± 0.66ab 94.4 ± 0.15b opposite trend to those of pro-inflammatory genes expression was ob-
ADCge (%)h 87.3 ± 0.07a 85.9 ± 0.21b 84.2 ± 0.08c served for the expression of the anti-inflammatory gene IL-4; in this
Survival (%) 100 ± 0.00a 98.3 ± 1.67a 78.8 ± 4.73b
case SM groups had significantly lower expression of this gene (Fig. 4e).
Values are presented as mean ± SE. Values in the same raw having different superscript
letters are significantly different (P < 0.05).
Table 4
a
Weight gain = [(final body weight − initial body weight) / initial body
Whole-body composition of Japanese seabass fed the experimental diets for 8 weeks (%
weight] × 100.
wet weight).
b
Specific growth rate = [(ln final body weight − ln initial body weight) /
days] × 100. Diets Moisture Protein Lipid Ash
c
Feeding rate = 100 × feed intake / (final weight (g) / 2 + initial weight (g) / 2) / t.
d b a a
Feed efficiency = weight gain/dry feed fed. FM 67.85 ± 0.22 17.62 ± 0.04 10.28 ± 0.18 4.71 ± 0.06b
e
Protein efficiency ratio = (total final weight (g) − total initial weight (g)) / total dry SM50 67.13 ± 0.11b 17.77 ± 0.04a 10.43 ± 0.19a 4.94 ± 0.03a
protein consumed (g). SM75 69.16 ± 0.34a 16.86 ± 0.28b 8.31 ± 0.06b 5.02 ± 0.04a
f
Apparent digestibility coefficient of dry matter.
g
Apparent digestibility coefficient of protein. Values are presented as mean ± SE. Values in the same column having different su-
h
Apparent digestibility coefficient of gross energy. perscript letters are significantly different (P < 0.05).

176
C. Zhang et al. Aquaculture 483 (2018) 173–182

Table 5
Digestive enzymes activity (U/mg prot) in foregut and midgut of Japanese seabass fed the experimental diets for 8 weeks.

Diets Foregut Midgut

Protease Amylase Lipase Protease Amylase Lipase

FM 82.94 ± 1.31a 1.13 ± 0.17a 492.25 ± 31.45a 26.60 ± 0.91a 0.51 ± 0.02a 118.26 ± 32.42ab
SM50 35.00 ± 6.65b 0.47 ± 0.01b 345.45 ± 45.26b 24.17 ± 3.52a 0.30 ± 0.06a 178.58 ± 24.89a
SM75 22.39 ± 0.92b 0.44 ± 0.01b 307.04 ± 32.19b 21.80 ± 1.08a 0.36 ± 0.12a 65.99 ± 6.75b

Values are presented as mean ± SE. Values in the same column having different superscript letters are significantly different (P < 0.05).

Table 6 energy, and presence of ANFs (Silva-Carrillo et al., 2012; Song et al.,
Foregut and midgut morphology of Japanese seabass fed the experimental diets for 2014; Tantikitti et al., 2005; Trushenski et al., 2014; Yaghoubi et al.,
8 weeks.
2016; Ye et al., 2011; Zhou et al., 2011). It has been earlier noted that
Diets Villus height (μm) Villus thickness Muscular thickness
increment of feed intake in response to increased dietary SM inclusion
(μm) (μm) enhances feed conversion ratio probably resulting from reduced total
diet digestibility (Hernández et al., 2007). In the present study, sig-
Foregut FM 443.22 ± 8.75a 49.22 ± 1.27a 152.72 ± 0.79a nificantly lower ADC of dry matter and protein were observed in SM75
SM50 430.42 ± 3.68a 36.25 ± 2.31b 80.19 ± 3.89b
SM75 287.83 ± 6.83b 29.63 ± 1.61c 77.95 ± 2.72b
group, and ADC of gross energy was significantly decreased in both
Midgut FM 368.95 ± 3.86a 52.26 ± 2.09a 119.56 ± 4.45a inclusion levels of SM. Additionally, significantly decreased digestive
SM50 352.83 ± 20.00a 47.50 ± 3.37ab 89.39 ± 2.73b enzymes activity were observed in foregut of SM groups. Theses al-
SM75 285.67 ± 4.56b 41.71 ± 2.86b 93.05 ± 5.80b terations could be the reason for reduced FE and PER in SM fed groups
in the current study.
Values are presented as mean ± SE. Values in the same column having different su-
perscript letters are significantly different (P < 0.05).
Replacement of FM with SM resulted in significantly reduced pro-
tease, amylase and lipase activity in foregut of Japanese seabass and
this was more evident in SM75 group. In agreement to our results,
4. Discussion Murashita et al. (2015) reported significantly reduced trypsin, chymo-
trypsin, lipase and amylase activity in intestinal content of red seab-
To date, several studies have been conducted on replacement of FM ream (Pagrus major) fed SM diet compared to FM fed fish. Similar
with different types of SM in formulated feeds for Japanese seabass. Li findings have also been shown in Atlantic cod (Gadus morhua) (Lemieux
et al. (2012) evaluated two types of SM including a commercial SM and et al., 1999), Atlantic salmon (Salmo salar L.) (Krogdahl et al., 2003),
a high-value SM as alternatives to FM in diets for Japanese seabass. and hybrid tilapia (Lin and Luo, 2011). In the current study, similar
Their results showed that FM can be replaced up to 30% with com- trends were observed for digestive enzymes activity, feed utilization
mercial SM while the high-value SM could successfully replace 45% of and growth performance suggesting that alterations in digestive en-
FM. Later, Zhang et al. (2014) examined the effects of replacing 25, 50 zymes activity affect digestion (as highlighted by lower ADCs) and
and 75% of FM with untreated, gamma-irradiated or fermented SM in nutrients absorption (Lemieux et al., 1999). There are an array of fac-
Japanese seabass feed. Their findings showed that dietary FM can be tors that impact digestive enzymes secretion in fish including feeding
only replaced up to 25% when untreated SM was used, while the re- habits, feed preferences, diet formulation, and ANFs (Escaffre et al.,
placement level could be increased up to 50% when the gamma-irra- 1997; Hidalgo et al., 1999; Pavasovic et al., 2007). Murashita et al.
diated SM was used. The results of a recent study by Zhang et al. (2016) (2015) reported lower gene expression levels of the digestive enzymes
showed that SM can substitute 60% of FM in Japanese seabass feed. in the hepatopancreas of red seabream fed SM diet compared with the
Similarly, in the current study substituting 50% of FM with SM did not FM fed fish. They demonstrated that FM diet stimulates secretion/
significantly impair growth performance of Japanese seabass. The ob- synthesis of pancreatic digestive enzymes to a larger extent than the SM
served variations in the optimum inclusion level of SM in diets for Ja- diet. Also, they suggested that a water-soluble fraction of FM is re-
panese seabass among the above studies could be associated with the sponsible for increased gene expression of trypsin, lipase, cholecysto-
differences in age, feeding strategy, rearing conditions, dietary com- kinin and cholecystokinin receptor (cck-1r) in FM fed fish. On the other
position, and varied amount of ANFs among different studies (Lin and hand, SM contains different ANFs such as protease inhibitors that may
Luo, 2011). reduce the activity of digestive enzymes in fish (Hendricks and Bailey,
It is still unclear how dietary inclusion of SM affects feed palat- 1989; Huisman and Tolman, 1992; Liener, 1989).
ability. In this study replacing 50% of FM with SM significantly en- In the present study, the group received SM75 diet exhibited sig-
hanced feed intake (as shown by feeding rate) while leading to sig- nificantly lower whole-body protein and lipid contents than the other
nificantly lower FE and PER. In agreement to our results, Zhang et al. treatments, while an opposite trend was observed for moisture and ash
(2016) reported the significant increase of feed intake in Japanese contents. Similarly, Zhang et al. (2014, 2016) found a decreasing ten-
seabass by increasing dietary SM level and this was associated with dency in body lipid content of Japanese seabass by increasing re-
elevated feed conversion ratio. However, in general the effects of FM placement level of FM with SM. However, Li et al. (2012) could not find
substitution with SM on fish feed intake have been contradictory, e.g. any specific changes in body composition of Japanese seabass when up
significantly reduced feed intake has been reported in Asian seabass to 60% of FM was replaced with SM. Reduced whole-body protein and/
(Tantikitti et al., 2005), spotted rose snapper (Lutjanus guttatus) (Silva- lipid contents by replacement of FM with SM have also been reported in
Carrillo et al., 2012) and silvery-black porgy (Sparidentex hasta) Asian seabass (Tantikitti et al., 2005), cuneate drum (Wang et al.,
(Yaghoubi et al., 2016), while significant enhancements in feed intake 2006), spotted rose snapper (Silva-Carrillo et al., 2012), and marbled
have been reported in cuneate drum (Nibea miichthioides) (Wang et al., spinefoot (Siganus rivulatus) (Monzer et al., 2017). The observed trend
2006), sharpsnout seabream (Diplodus puntazzo) (Hernández et al., for whole-body protein and lipid was consistent with the results of
2007) and hybrid tilapia (Oreochromis niloticus × O. aureus) (Lin and growth performance, diet digestibility and digestive enzymes activity,
Luo, 2011). The lower utilization of SM diets has been attributed to indicating that replacing FM with SM results in lower digestibility of
several factors such as reduced bioavailability or deficiencies of some nutrients leading to reduced growth performance (Zhang et al., 2014).
minerals and essential amino acids, low digestibility of protein and Epithelium of the intestinal mucosa acts as a physical barrier that

177
C. Zhang et al. Aquaculture 483 (2018) 173–182

Fig. 1. Foregut (A: FM, B: SM50, C: SM75) and midgut (D: FM, E: SM50, F: SM75) structure of Japanese seabass fed the experimental diets for 8 weeks.

a: D-lactate b: DAO
1.0
Serum D-lactate concentration (nmol/ml)

b b 35
b
Serum diamin oxidase activity (U/L)

0.8 30

25
0.6 a a
20

0.4 15

10
0.2 a 5

0.0 0
FM SM50 SM75 FM SM50 SM75

Fig. 2. Effects of substituting fishmeal with soybean meal on serum D-lactate concentration (a) and diamine oxidase (DAO) activity (b) of Japanese seabass fed the experimental diets for
8 weeks.

178
C. Zhang et al. Aquaculture 483 (2018) 173–182

Fig. 3. Relative expression of PepT1 (a), LAT1 (b) and SLC1A5 (c) in foregut and midgut of Japanese seabass fed the experimental diets for 8 weeks.

allows nutrients to be absorbed while blocking the intrusion of patho- and transporters of the brush-border membrane is crucial for the final
gens (Faggio et al., 2011; Lauriano et al., 2016; Sun et al., 1998); stages of digestion and absorption of nutrients through the epithelial
therefore an intact intestinal mucosal barrier is important for proper luminal membrane of the intestine (Hakim et al., 2009). There are some
function of intestine. Intestinal mucosal barrier function is pre- reports indicating that activity and expression of PepT1 can be modu-
dominantly evaluated through indirect measures based on determina- lated by diet particularly the dietary protein source (Ostaszewska et al.,
tions of intestinal permeability, serum D-lactate concentration and DAO 2010a; Ostaszewska et al., 2010b). In the present study, replacing FM
activity. D-Lactate and DAO are considered as the two key indicators of with SM led to enhanced expression of transporters genes such as
intestinal mucosal integrity. Their values in serum are highly elevated PepT1, LAT1 and SLC1A5. Little information is available about the ef-
in cases of intestinal mucosal barrier damage (Luk et al., 1980; Vella fects of diet composition on the intestinal gene expression of PepT1 in
and Farrugia, 1998). DAO is the marker enzyme of intestinal mucosal fish. Hakim et al. (2009) showed that feed deprivation enhances ex-
cells that exists in low levels in serum under normal conditions, but it is pression of PepT1 mRNA in European sea bass (Dicentrarchus labrax). It
released into the blood stream when these cells are damaged. In the has been demonstrated that animals are able to adapt themselves to the
current study, serum D-lactate concentration increased in SM50 group, changes in feed composition and nutrients availability through altering
and both D-Lactate concentration and DAO activity were enhanced in the types and amounts of nutrient transporters (Humphrey et al., 2004).
SM75 group indicating increased intestinal permeability and impaired It seems that there is a homeostatic control at the gastrointestinal level
intestinal mucosal barrier function. To our knowledge, this is the first enabling the fish to maximize gastrointestinal function for maximum
report on the effects of plant proteins on intestinal barrier function in uptake of protein products. This includes the alterations in spatial ex-
fish and the underlying mechanism remains to be elucidated in the pression of transporters along the post-gastric canal in order to max-
future studies. imize absorption of di- and tripeptide and reduce protein loss (Bakke
To date, research on farmed fish species has mainly focused on the et al., 2010). Taking these into account, the increased expression of
performance and the activity of the brush border enzymes and less at- transporters genes in SM groups in the current study could be attributed
tention has been paid to the molecular aspects. The end products of to the lower availability of amino acids from SM compared to FM.
protein digestion in fish constitute a mixture of free amino acids and In the present study, replacing FM with SM resulted in shortening of
small peptides that are efficiently absorbed across the small intestinal villus height, and reduced villus and muscular thickness both in foregut
epithelium (Clements and Raubenheimer, 2006). PepT1 has been and midgut of Japanese seabass (as shown in Fig. 1), and increasing SM
identified as the key transporter of di- and tripeptides from the in- inclusion level aggravated the negative effects indicating likely occur-
testinal lumen into the enterocytes (Daniel, 2004). There are increasing rence of SM-induced enteritis. A recent study by J. Wang et al. (2017)
evidences showing that it plays a major role in fish nutrition showed the incidence of enteritis in Japanese seabass fed a diet in
(Dabrowski et al., 2005). A large amount of amino acids is transported which 50% of FM was substituted with SM. These authors reported
by PepT1 in peptide form providing essential nutrients for fish growth. reduced microvillus height and muscular thickness in distal intestine of
It has been demonstrated that expression of genes encoding enzymes Japanese seabass following SM administration. These results are also

179
C. Zhang et al. Aquaculture 483 (2018) 173–182

Fig. 4. Relative expression of TNF-α (a), IL-1β (b), IL-2 (c), IL-8 (d), and IL-4 (e) in foregut and midgut of Japanese seabass fed the experimental diets for 8 weeks.

consistent with previous findings in rainbow trout (Romarheim et al., combining with polysaccharides on gut epithelial cell surface could
2008), giant grouper (Epinephelus lanceolatus (García-Ortega et al., destruct gut microvillus leading to reduced absorption and digestion of
2016), and orange-spotted grouper (Epinephelus coioides) (Y.R. Wang nutrients. Recently, Krogdahl et al. (2015) declared that soya saponins
et al., 2017). It has been pointed out that up-regulated expression of alone are able to cause SM-induced enteritis in Atlantic salmon. Also,
inflammatory genes is a sign of dysfunction caused by the SM-induced there are several reports indicating that other ANFs in SM may ag-
enteritis (Gu et al., 2016). In the current study, expression of pro-in- gravate the saponins effects (Bureau et al., 1998; Knudsen et al., 2008).
flammatory genes such as TNF-α, IL-1β and IL-8 and IL-2 was enhanced Cytokines are categorized to pro-inflammatory or anti-inflammatory
by SM inclusion providing further evidence for incidence of SM-induced depending on their properties (Polińska et al., 2009; Sartor, 1995). It
enteritis in Japanese seabass. The negative impacts of high dietary SM has been noted that SM can cause intestinal inflammation by increasing
on intestinal structure have been ascribed to its ANFs content such as pro-inflammatory cytokines and decreasing anti-inflammatory cyto-
saponins (Chen et al., 2011), raffinose, stachyose and lectins (Peng kines level (Y.R. Wang et al., 2017). Up-regulated expression of pro-
et al., 2013; Venou et al., 2006). Buttle et al. (2001) reported that lectin inflammatory genes by SM administration has been reported in several

180
C. Zhang et al. Aquaculture 483 (2018) 173–182

fish species including Atlantic salmon (Marjara et al., 2012), common Claiborne, J.B. (Eds.), The Physiology of Fishes, 3rd ed. CRC Press, Boca Raton, pp.
47–81.
carp (Cyprinus carpio L.) (Urán et al., 2008), zebra fish (Hedrera et al., Dabrowski, K., Terjesen, B.F., Zhang, Y., Phang, J.M., Lee, K.-J., 2005. A concept of
2013), turbot (Scophthalmus maximus) (Gu et al., 2016) and orange- dietary dipeptides: a step to resolve the problem of amino acid availability in the
spotted grouper (Y.R. Wang et al., 2017). Similarly, in the present study early life of vertebrates. J. Exp. Biol. 208, 2885–2894.
Daniel, H., 2004. Molecular and integrative physiology of intestinal peptide transport.
expression of pro-inflammatory genes including TNF-α, IL-1β, IL-8 and Annu. Rev. Physiol. 66, 361–384.
IL-2 was significantly enhanced by replacing FM with SM. IL-4 is con- Davis, D.A., Jirsa, D., Arnold, C., 1995. Evaluation of soybean proteins as replacements
sidered as an anti-inflammatory cytokine and its expression level for menhaden fish meal in practical diets for the red drum Sciaenops ocellatus. J.
World Aquacult. Soc. 26, 48–58.
changes in response to gut inflammation (Kołodziejska-Sawerska et al., Escaffre, A.M., Infante, J.Z., Cahu, C.L., Mambrini, M., Bergot, P., Kaushik, S.J., 1997.
2013). In the current study, expression of IL-4 was down-regulated by Nutritional value of soy protein concentrate for larvae of common carp (Cyprinus
SM inclusion; this is in agreement with Urán et al. (2008), who reported carpio) based on growth performance and digestive enzyme activities. Aquaculture
153, 63–80.
the up-regulation of pro-inflammatory IL-1β and TNF-α1 genes, and
Faggio, C., Torre, A., Pelle, E., Raffa, F., Villari, V., Trischitta, F., 2011. Cell volume
down-regulation of the anti-inflammatory IL-10 in common carp fed a regulation following hypotonic shock in hepatocytes isolated from Sparus aurata.
diet in which 20% of FM was replaced with SM. They suggested that IL- Comp. Biochem. Physiol. A Physiol. 158 (1), 143–149.
1β and TNF-α1 are both involved in the enteritis process as their ex- Faggio, C., Piccione, G., Marafioti, S., Arfuso, F., Fortino, G., Fazio, F., 2014a. Metabolic
response to monthly variations of Sparus aurata reared in Mediterranean off-shore
pression level in SM-fed fish was higher than FM fed fish after 1, 3 and tanks. Turk. J. Fish. Aquat. Sci. 14, 567–574.
5 weeks of feeding on the SM diet. Faggio, C., Piccione, G., Marafioti, S., Arfuso, F., Trischitta, F., Fortino, G., Fazio, F.,
In conclusion, the findings in this study showed that although re- 2014b. Monthly variations of haematological parameters of Sparus aurata and
Dicentrarchus labrax reared in Mediterranean land off-shore tanks. Cah. Biol. Mar. 55,
placing 50% of FM with SM did not significantly influence growth 437–443.
performance of Japanese seabass, it had adverse effects on digestive Faggio, C., Fazio, F., Marafioti, S., Arfuso, F., Piccione, G., 2015. Oral administration of
enzymes activity, and gut health. Further studies with lower replace- Gum Arabic: effects on haematological parameters and oxidative stress markers in
Mugil cephalus. Iran. J. Fish. Sci. 14 (1), 60–72.
ment levels than in this study are required for determination of op- FAO, 2012. The State of the World Fisheries and Aquaculture 2012. FAO Fisheries and
timum replacement level of FM with SM in diets for Japanese seabass. Aquaculture Department. Food and Agriculture Organization of the United Nations
(FAO), Rome, Italy (209 pp.).
Fazio, F., Marafioti, S., Filiciotto, F., Buscaino, G., Panzera, M., Faggio, C., 2013. Blood
Acknowledgements
hemogram profiles of farmed onshore and offshore gilthead sea bream (Sparus aurata)
from Sicily, Italy. Turk. J. Fish. Aquat. Sci. 13, 415–422.
This work was supported by the National Natural Science Francis, G., Makkar, H.P., Becker, K., 2001. Antinutritional factors present in plant-de-
rived alternate fish feed ingredients and their effects in fish. Aquaculture 199,
Foundation of China (Grant no. 31572625) and China Agriculture
197–227.
Research System (CARS-47). García-Ortega, A., Kissinger, K.R., Trushenski, J.T., 2016. Evaluation of fish meal and fish
oil replacement by soybean protein and algal meal from Schizochytrium limacinum in
References diets for giant grouper Epinephelus lanceolatus. Aquaculture 452, 1–8.
Gatlin, D.M., Barrows, F.T., Brown, P., Dabrowski, K., Gaylord, T.G., Hardy, R.W.,
Herman, E., Hu, G., Krogdahl, Å., Nelson, R., 2007. Expanding the utilization of
AOAC (Asociation of Official Analytical Chemists), 2002. Official Methods of Analysis of sustainable plant products in aquafeeds: a review. Aquac. Res. 38, 551–579.
Official Analytical Chemists International, 17th ed. Association of Official Analytical Glencross, B.D., 2009. Exploring the nutritional demand for essential fatty acids by
Chemists, Arlington, VA, USA. aquaculture species. Rev. Aquac. 1, 71–124.
Aragona, M., Lauriano, E.R., Pergolizzi, S., Faggio, C., 2017. Opuntia ficus-indica (L.) Gu, M., Bai, N., Zhang, Y., Krogdahl, Å., 2016. Soybean meal induces enteritis in turbot
Miller as a source of bioactivity compounds for health and nutrition. Nat. Prod. Res. Scophthalmus maximus at high supplementation levels. Aquaculture 464, 286–295.
http://dx.doi.org/10.1080/14786419.2017.1365073. (in press). Guardiola, F.A., Porcino, C., Cerezuela, R., Cuesta, A., Faggio, C., Esteban, M.A., 2016.
Baeverfjord, G., Krogdahl, Å., 1996. Development and regression of soybean meal in- Impact of date palm fruits extracts and probiotic enriched diet on antioxidant status,
duced enteritis in Atlantic salmon, Salmo salar L., distal intestine: a comparison with innate immune response and immune-related gene expression of European seabass
the intestines of fasted fish. J. Fish Dis. 19, 375–387. (Dicentrarchus labrax). Fish Shellfish Immunol. 52, 298–308.
Bakke, S., Jordal, A.E.O., Gómez-Requeni, P., Verri, T., Kousoulaki, K., Aksnes, A., Hakim, Y., Harpaz, S., Uni, Z., 2009. Expression of brush border enzymes and transporters
Rønnestad, I., 2010. Dietary protein hydrolysates and free amino acids affect the in the intestine of European sea bass (Dicentrarchus labrax) following food depriva-
spatial expression of peptide transporter PepT1 in the digestive tract of Atlantic cod tion. Aquaculture 290, 110–115.
(Gadus morhua). Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 156, 48–55. Hedrera, M.I., Galdames, J.A., Jimenez-Reyes, M.F., Reyes, A.E., Avendaño-Herrera, R.,
Bakke-McKellep, A., Press, C.M., Baeverfjord, G., Krogdahl, Å., Landsverk, T., 2000. Romero, J., Feijóo, C.G., 2013. Soybean meal induces intestinal inflammation in
Changes in immune and enzyme histochemical phenotypes of cells in the intestinal zebrafish larvae. PLoS One 8, e69983.
mucosa of Atlantic salmon, Salmo salar L., with soybean meal-induced enteritis. J. Hendricks, J.D., Bailey, G.S., 1989. Adventitious toxins. In: Halver, J.E. (Ed.), Fish
Fish Dis. 23, 115–127. Nutrition, 2nd ed. Academic Press, New York, pp. 605–651.
Bakke-McKellep, A., Frøystad, M., Lilleeng, E., Dapra, F., Refstie, S., Krogdahl, Å., Hernández, M., Martínez, F., Jover, M., García, B.G., 2007. Effects of partial replacement
Landsverk, T., 2007. Response to soy: T-cell-like reactivity in the intestine of Atlantic of fish meal by soybean meal in sharpsnout seabream (Diplodus puntazzo) diet.
salmon, Salmo salar L. J. Fish Dis. 30, 13–25. Aquaculture 263, 159–167.
Barrows, F.T., Stone, D.A., Hardy, R.W., 2007. The effects of extrusion conditions on the Hidalgo, M., Urea, E., Sanz, A., 1999. Comparative study of digestive enzymes in fish with
nutritional value of soybean meal for rainbow trout (Oncorhynchus mykiss). different nutritional habits. Proteolytic and amylase activities. Aquaculture 170,
Aquaculture 265, 244–252. 267–283.
Bowyer, J.N., Qin, J.G., Stone, D.A., 2013. Protein, lipid and energy requirements of Hu, L., Yun, B., Xue, M., Wang, J., Wu, X., Zheng, Y., Han, F., 2013. Effects of fish meal
cultured marine fish in cold, temperate and warm water. Rev. Aquac. 5, 10–32. quality and fish meal substitution by animal protein blend on growth performance,
Brown, P., Twibell, R., Jonker, Y., Wilson, K., 1997. Evaluation of three soybean products flesh quality and liver histology of Japanese seabass (Lateolabrax japonicus).
in diets fed to juvenile hybrid striped bass Morone saxatilis × M. chrysops. J. World Aquaculture 372, 52–61.
Aquacult. Soc. 28, 215–223. Huisman, J., Tolman, G.H., 1992. Antinutritional factors in the plant proteins of diets for
Bureau, D.P., Harris, A.M., Cho, C.Y., 1998. The effects of purified alcohol extracts from non-ruminants. In: Garnsworthy, P.C., Haresign, W., Cole, D.J.A. (Eds.), Recent
soy products on feed intake and growth of chinook salmon (Oncorhynchus tsha- Advances in Animal Nutrition. Butterworth–Heinemann, Oxford, pp. 3–31.
wytscha) and rainbow trout (Oncorhynchus mykiss). Aquaculture 161, 27–43. Humphrey, B.D., Stephensen, C.B., Calvert, C.C., Klasing, K.C., 2004. Glucose and cationic
Burgos-Aceves, M.A., Cohen, A., Smith, Y., Faggio, C., 2016. Estrogen regulation of gene amino acid transporter expression in growing chickens (Gallus gallus domesticus).
expression in the teleost fish immune system. Fish Shellfish Immunol. 58, 42–49. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 138, 515–525.
Buttle, L., Burrells, A., Good, J., Williams, P., Southgate, P., Burrells, C., 2001. The Islam, M.S., Ueno, M., Yamashita, Y., 2015. Recruitment in Japanese sea bass, Lateolabrax
binding of soybean agglutinin (SBA) to the intestinal epithelium of Atlantic salmon, japonicas (Cuvier, 1828): effects of timing on spawning and larval quality and
Salmo salar and rainbow trout, Oncorhynchus mykiss, fed high levels of soybean meal. quantity. J. Appl. Ichthyol. 31, 1064–1071.
Vet. Immunol. Immunopathol. 80, 237–244. Kikuchi, K., 1999. Use of defatted soybean meal as a substitute for fish meal in diets of
Carbone, D., Faggio, C., 2016. Importance of prebiotics in aquaculture as im- Japanese flounder (Paralichthys olivaceus). Aquaculture 179, 3–11.
munostimulants. Effects on immune system of Sparus aurata and Dicentrarchus labrax. Knudsen, D., Jutfelt, F., Sundh, H., Sundell, K., Koppe, W., Frøkiær, H., 2008. Dietary soya
Fish Shellfish Immunol. 54, 172–178. saponins increase gut permeability and play a key role in the onset of soyabean-
Chen, W., Ai, Q., Mai, K., Xu, W., Liufu, Z., Zhang, W., Cai, Y., 2011. Effects of dietary induced enteritis in Atlantic salmon (Salmo salar L.). Br. J. Nutr. 100, 120–129.
soybean saponins on feed intake, growth performance, digestibility and intestinal Kołodziejska-Sawerska, A., Rychlik, A., Depta, A., Wdowiak, M., Nowicki, M., Kander, M.,
structure in juvenile Japanese flounder (Paralichthys olivaceus). Aquaculture 318, 2013. Cytokines in canine inflammatory bowel disease. Pol. J. Vet. Sci. 16, 165–171.
95–100. Krogdahl, Å., Bakke-McKellep, A.M., 2001. Soybean in salmonid diets: antinutrients,
Clements, K.D., Raubenheimer, D., 2006. Feeding and nutrition. In: Evans, D.H., pathologies, immune responses and possible solutions. In: Book of Abstract.

181
C. Zhang et al. Aquaculture 483 (2018) 173–182

Aquaculture 2001, Lake Buena Vista, FL, USA, pp. 340. 2008. Lipid digestibility, bile drainage and development of morphological intestinal
Krogdahl, Å., Bakke-McKellep, A., Baeverfjord, G., 2003. Effects of graded levels of changes in rainbow trout (Oncorhynchus mykiss) fed diets containing defatted soybean
standard soybean meal on intestinal structure, mucosal enzyme activities, and pan- meal. Aquaculture 274, 329–338.
creatic response in Atlantic salmon (Salmo salar L.). Aquac. Nutr. 9, 361–371. Rumsey, G.L., Siwicki, A.K., Anderson, D.P., Bowser, P.R., 1994. Effect of soybean protein
Krogdahl, Å., Penn, M., Thorsen, J., Refstie, S., Bakke, A.M., 2010. Important anti- on serological response, non-specific defense mechanisms, growth, and protein uti-
nutrients in plant feedstuffs for aquaculture: an update on recent findings regarding lization in rainbow trout. Vet. Immunol. Immunopathol. 41, 323–339.
responses in salmonids. Aquac. Res. 41, 333–344. Sartor, R.B., 1995. Insights into the pathogenesis of inflammatory bowel diseases pro-
Krogdahl, Å., Gajardo, K., Kortner, T.M., Penn, M., Gu, M., Berge, G.M., Bakke, A.M., vided by new rodent models of spontaneous colitis. Inflamm. Bowel Dis. 1, 64–75.
2015. Soya saponins induce enteritis in Atlantic salmon (Salmo salar L.). J. Agric. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT
Food Chem. 63, 3887–3902. method. Nat. Protoc. 3 (6), 1101–1108. http://dx.doi.org/10.1038/nprot.2008.73.
Laporte, J., Trushenski, J., 2012. Production performance, stress tolerance and intestinal Silva-Carrillo, Y., Hernández, C., Hardy, R.W., González-Rodríguez, B., Castillo-
integrity of sunshine bass fed increasing levels of soybean meal. J. Anim. Physiol. Vargasmachuca, S., 2012. The effect of substituting fish meal with soybean meal on
Anim. Nutr. 96, 513–526. growth, feed efficiency, body composition and blood chemistry in juvenile spotted
Lauriano, E.R., Pergolizzi, S., Capillo, G., Kuciel, M., Alesci, A., Faggio, C., 2016. rose snapper Lutjanus guttatus (Steindachner, 1869). Aquaculture 364, 180–185.
Immunohistochemical characterization of Toll-like receptor 2 in gut epithelial cells Sitjà-Bobadilla, A., Peña-Llopis, S., Gómez-Requeni, P., Médale, F., Kaushik, S., Pérez-
and macrophages of goldfish Carassius auratus fed with a high-cholesterol diet. Fish Sánchez, J., 2005. Effect of fish meal replacement by plant protein sources on non-
Shellfish Immunol. 59, 250–255. specific defence mechanisms and oxidative stress in gilthead sea bream (Sparus
Lemieux, H., Blier, P., Dutil, J.-D., 1999. Do digestive enzymes set a physiological limit on aurata). Aquaculture 249, 387–400.
growth rate and food conversion efficiency in the Atlantic cod (Gadus morhua)? Fish Song, Z., Li, H., Wang, J., Li, P., Sun, Y., Zhang, L., 2014. Effects of fishmeal replacement
Physiol. Biochem. 20, 293–303. with soy protein hydrolysates on growth performance, blood biochemistry, gastro-
Li, Y., Ai, Q., Mai, K., Xu, W., Cheng, Z., 2012. Effects of the partial substitution of dietary intestinal digestion and muscle composition of juvenile starry flounder (Platichthys
fish meal by two types of soybean meals on the growth performance of juvenile stellatus). Aquaculture 426, 96–104.
Japanese seabass, Lateolabrax japonicus (Cuvier 1828). Aquac. Res. 43, 458–466. Storebakken, T., Refstie, S., Ruyter, B., 2000. Soy products as fat and protein sources in
Liener, I.E., 1989. Antinutritional factors in legume seeds: state of the art. In: Huisman, J., fish feeds for intensive aquaculture. In: Drackly, J.K. (Ed.), Soy in Animal Nutrition.
Van der Poel, T.F.B., Liener, I.E. (Eds.), Recent Advances of Research in Federation of Animal Science Societies, Savoy, IL, pp. 127–170.
Antinutritional Factors in Legume Seeds. Wageningen: Pudoc, pp. 6–13. Sun, Z., Wang, X., Andersson, R., 1998. Role of intestinal permeability in monitoring
Lin, S., Luo, L., 2011. Effects of different levels of soybean meal inclusion in replacement mucosal barrier function. Dig. Surg. 15, 386–397.
for fish meal on growth, digestive enzymes and transaminase activities in practical Tacon, A.G., Metian, M., 2008. Global overview on the use of fish meal and fish oil in
diets for juvenile tilapia, Oreochromis niloticus × O. aureus. Anim. Feed Sci. Technol. industrially compounded aquafeeds: trends and future prospects. Aquaculture 285,
168, 80–87. 146–158.
Lowry, O., Rosebrough, N., Farr, A., Randall, R., 1951. Protein measurement with the Tantikitti, C., Sangpong, W., Chiavareesajja, S., 2005. Effects of defatted soybean protein
Folin phenol reagent. J. Biol. Chem. 193, 265–275. levels on growth performance and nitrogen and phosphorus excretion in Asian sea-
Luk, G.D., Bayless, T.M., Baylin, S.B., 1980. Diamine oxidase (histaminase). A circulating bass (Lates calcarifer). Aquaculture 248, 41–50.
marker for rat intestinal mucosal maturation and integrity. J. Clin. Invest. 66, 66. Trushenski, J.T., Kasper, C.S., Kohler, C.C., 2006. Challenges and opportunities in finfish
Marjara, I.S., Chikwati, E.M., Valen, E.C., Krogdahl, Å., Bakke, A.M., 2012. nutrition. N. Am. J. Aquac. 68, 122–140.
Transcriptional regulation of IL-17A and other inflammatory markers during the Trushenski, J.T., Rombenso, A.N., Page, M., Jirsa, D., Drawbridge, M., 2014. Traditional
development of soybean meal-induced enteropathy in the distal intestine of Atlantic and fermented soybean meals as ingredients in feeds for white seabass and yellowtail
salmon (Salmo salar L.). Cytokine 60, 186–196. jack. N. Am. J. Aquac. 76, 312–322.
Merrifield, D., Olsen, R.E., Myklebust, R., Ringø, E., 2011. Dietary effect of soybean Urán, P., Gonçalves, A., Taverne-Thiele, J., Schrama, J., Verreth, J., Rombout, J., 2008.
(Glycine max) products on gut histology and microbiota of fish. In: El-Shemy, H. Soybean meal induces intestinal inflammation in common carp (Cyprinus carpio L.).
(Ed.), Agricultural and Biological Sciences: Soybean and Nutrition. INTECH Open Fish Shellfish Immunol. 25, 751–760.
Access Publisher. Van den Ingh, T., Krogdahl, Å., Olli, J., Hendriks, H., Koninkx, J., 1991. Effects of soy-
Monzer, S., Nasser, N., Babikian, J., Saoud, I.P., 2017. Substitution of fish meal by soy- bean-containing diets on the proximal and distal intestine in Atlantic salmon (Salmo
bean meal in diets for juvenile marbled spinefoot, Siganus rivulatus. J. Appl. Aquac. salar): a morphological study. Aquaculture 94, 297–305.
29, 101–116. Vella, A., Farrugia, G., 1998. D-Lactic acidosis: pathologic consequence of saprophytism.
Murashita, K., Fukada, H., Takahashi, N., Hosomi, N., Matsunari, H., Furuita, H., Oku, H., In: Mayo Clinic Proceedings. Elsevier, pp. 451–456.
Yamamoto, T., 2015. Effect of feed ingredients on digestive enzyme secretion in fish. Venou, B., Alexis, M., Fountoulaki, E., Haralabous, J., 2006. Effects of extrusion and in-
Bull. Fish. Res. Agenda 40, 69–74. clusion level of soybean meal on diet digestibility, performance and nutrient utili-
Naylor, R.L., Hardy, R.W., Bureau, D.P., Chiu, A., Elliott, M., Farrell, A.P., Forster, I., zation of gilthead sea bream (Sparus aurata). Aquaculture 261, 343–356.
Gatlin, D.M., Goldburg, R.J., Hua, K., 2009. Feeding aquaculture in an era of finite Wang, Y., Guo, J.L., Li, K., Bureau, D.P., 2006. Effects of dietary protein and energy levels
resources. Proc. Natl. Acad. Sci. 106, 15103–15110. on growth, feed utilization and body composition of cuneate drum (Nibea miich-
NRC, 2011. Nutrient Requirements of Fish and Shrimp. The National Academic Press, thioides). Aquaculture 252, 421–428.
Washington, D.C. Wang, J., Tao, Q., Wang, Z., Mai, K., Xu, W., Zhang, Y., Ai, Q., 2017. Effects of fish meal
Olsen, R.L., Hasan, M.R., 2012. A limited supply of fishmeal: impact on future increases in replacement by soybean meal with supplementation of functional compound ad-
global aquaculture production. Trends Food Sci. Technol. 27, 120–128. ditives on intestinal morphology and microbiome of Japanese seabass (Lateolabrax
Ostaszewska, T., Dabrowski, K., Kamaszewski, M., Grochowski, P., Verri, T., Rzepkowska, japonicus). Aquac. Res. 48, 2186–2197.
M., Wolnicki, J., 2010a. The effect of plant protein-based diet supplemented with Wang, Y.R., Wang, L., Zhang, C.X., Song, K., 2017. Effects of substituting fishmeal with
dipeptide or free amino acids on digestive tract morphology and PepT1 and PepT2 soybean meal on growth performance and intestinal morphology in orange-spotted
expressions in common carp (Cyprinus carpio L.). Comp. Biochem. Physiol. A Mol. grouper (Epinephelus coioides). Aquac. Rep. 5, 52–57.
Integr. Physiol. 157, 158–169. Watanabe, T., Pongmaneerat, J., 1993. Potential of soybean meal is a protein source in
Ostaszewska, T., Kamaszewski, M., Grochowski, P., Dabrowski, K., Verri, T., Aksakal, E., extruded pellets for rainbow trout. Nippon Suisan Gakkaishi 59, 1415–1423.
Szatkowska, I., Nowak, Z., Dobosz, S., 2010b. The effect of peptide absorption on Yaghoubi, M., Mozanzadeh, M.T., Marammazi, J.G., Safari, O., Gisbert, E., 2016. Dietary
PepT1 gene expression and digestive system hormones in rainbow trout replacement of fish meal by soy products (soybean meal and isolated soy protein) in
(Oncorhynchus mykiss). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 155, silvery-black porgy juveniles (Sparidentex hasta). Aquaculture 464, 50–59.
107–114. Yamamoto, T., Goto, T., Kine, Y., Endo, Y., Kitaoka, Y., Sugita, T., Furuita, H., Iwashita,
Pan, I.Q.K., Wang, X., 1997. The experimental studies on activities of digestive enzyme in Y., Suzuki, N., 2008. Effect of an alcohol extract from a defatted soybean meal sup-
the larvae Penaeus chinensis. J. Fish. China 21, 26–31 (in Chinese). plemented with a casein-based semi-purified diet on the biliary bile status and in-
Pavasovic, A., Anderson, A.J., Mather, P.B., Richardson, N.A., 2007. Influence of dietary testinal conditions in rainbow trout Oncorhynchus mykiss (Walbaum). Aquac. Res. 39,
protein on digestive enzyme activity, growth and tail muscle composition in redclaw 986–994.
crayfish, Cherax quadricarinatus (von Martens). Aquac. Res. 38, 644–652. Ye, J., Liu, X., Wang, Z., Wang, K., 2011. Effect of partial fish meal replacement by
Peng, M., Xu, W., Ai, Q., Mai, K., Liufu, Z., Zhang, K., 2013. Effects of nucleotide sup- soybean meal on the growth performance and biochemical indices of juvenile
plementation on growth, immune responses and intestinal morphology in juvenile Japanese flounder Paralichthys olivaceus. Aquac. Int. 19, 143–153.
turbot fed diets with graded levels of soybean meal (Scophthalmus maximus L.). Zhang, Y., Wu, Y., Jiang, D., Qin, J., Wang, Y., 2014. Gamma-irradiated soybean meal
Aquaculture 392, 51–58. replaced more fish meal in the diets of Japanese seabass (Lateolabrax japonicus).
Polińska, B., Matowicka-Karna, J., Kemona, H., 2009. The cytokines in inflammatory Anim. Feed Sci. Technol. 197, 155–163.
bowel disease. Postepy Hig. Med. Dosw. 63, 389–394. Zhang, Y., Ji, W., Wu, Y., Han, H., Qin, J., Wang, Y., 2016. Replacement of dietary fish
Refstie, S., Storebakken, T., Roem, A.J., 1998. Feed consumption and conversion in meal by soybean meal supplemented with crystalline methionine for Japanese sea-
Atlantic salmon (Salmo salar) fed diets with fish meal, extracted soybean meal or bass (Lateolabrax japonicus). Aquac. Res. 47, 243–252.
soybean meal with reduced content of oligosaccharides, trypsin inhibitors, lectins and Zhou, Q.C., Mai, K.S., Tan, B.P., Liu, Y.J., 2005. Partial replacement of fishmeal by
soya antigens. Aquaculture 162, 301–312. soybean meal in diets for juvenile cobia (Rachycentron canadum). Aquac. Nutr. 11,
Reigh, R.C., Ellis, S.C., 1992. Effects of dietary soybean and fish-protein ratios on growth 175–182.
and body composition of red drum (Sciaenops ocellatus) fed isonitrogenous diets. Zhou, F., Song, W., Shao, Q., Peng, X., Xiao, J., Hua, Y., Owari, B.N., Zhang, T., Ng, W.K.,
Aquaculture 104, 279–292. 2011. Partial replacement of fish meal by fermented soybean meal in diets for black
Romarheim, O.H., Skrede, A., Penn, M., Mydland, L.T., Krogdahl, Å., Storebakken, T., sea bream, Acanthopagrus schlegelii, juveniles. J. World Aquacult. Soc. 42, 184–197.

182