Microb Ecol (2012) 63:804–812

DOI 10.1007/s00248-011-9973-x

ENVIRONMENTAL MICROBIOLOGY

Fungal Community Composition in Neotropical Rain

Forests: the Influence of Tree Diversity and Precipitation
Krista L. McGuire & Noah Fierer & Carling Bateman &
Kathleen K. Treseder & Benjamin L. Turner

Received: 30 May 2011 / Accepted: 20 October 2011 / Published online: 12 November 2011
# Springer Science+Business Media, LLC 2011

Abstract Plant diversity is considered one factor structur- fatty acid analysis to evaluate correlations between micro-
ing soil fungal communities because the diversity of bial community composition, precipitation, soil nutrients,
compounds in leaf litter might determine the extent of and plant richness. In soil, the number of fungal taxa
resource heterogeneity for decomposer communities. Low- increased significantly with increasing mean annual precip-
land tropical rain forests have the highest plant diversity per itation, but not with plant richness. There were no
area of any biome. Since fungi are responsible for much of correlations between fungal communities in leaf litter and
the decomposition occurring in forest soils, understanding plant diversity or precipitation, and fungal communities
the factors that structure fungi in tropical forests may were found to be compositionally distinct between soil and
provide valuable insight for predicting changes in global leaf litter. To directly test for effects of plant species
carbon and nitrogen fluxes. To test the role of plant richness on fungal diversity and function, we experimen-
diversity in shaping fungal community structure and tally re-created litter diversity gradients in litter bags with 1,
function, soil (0–20 cm) and leaf litter (O horizons) were 25, and 50 species of litter. After 6 months, we found a
collected from six established 1-ha forest census plots significant effect of litter diversity on decomposition rate
across a natural plant diversity gradient on the Isthmus of between one and 25 species of leaf litter. However, fungal
Panama. We used 454 pyrosequencing and phospholipid richness did not track plant species richness. Although
studies in a broader range of sites is required, these results
K. L. McGuire (*) : C. Bateman suggest that precipitation may be a more important factor
Barnard College, Columbia University, than plant diversity or soil nutrient status in structuring
3009 Broadway(
New York, NY 10027, USA
tropical forest soil fungal communities.
e-mail: [email protected]
C. Bateman
e-mail: [email protected] Introduction

N. Fierer Soil fungi are integral components to nutrient cycling in forest

University of Colorado,
ecosystems [1], but little is known about the ecological factors
Boulder, CO, USA
e-mail: [email protected] that structure their diversity and distribution in tropical rain
forests. While several recent studies in tropical rain forests
K. K. Treseder have used DNA sequencing technologies to assess microbial
University of California,
diversity [2–5], our knowledge of tropical soil fungi is mostly
Irvine, CA, USA
e-mail: [email protected] limited to sporocarp surveys and community profiling data
[6–8]. Most molecular-based investigations of soil fungi have
B. L. Turner been performed in temperate and boreal systems (e.g.,
Smithsonian Tropical Research Institute,
[9–11]), but the unique attributes of tropical ecosystems mean
Apartado 0843-03092,
Balboa, Ancon, Republic of Panama it might not be possible to generalize findings from higher
e-mail: [email protected] latitudes to soil microbes in tropical forests [12].
Fungi in Tropical Soils and Leaf Litter 805

Lowland tropical rain forests often contain hundreds of differently to plant diversity and precipitation compared to
tree species per hectare [13, 14], which may have important fungi in mineral soil. Following field collection, samples
implications for soil fungi involved in litter decomposition. were immediately frozen at −20 °C. In addition to microbial
Leaf structure, chemistry, and elemental stoichiometry vary analyses (see following section), soils were analyzed for pH
markedly across plant taxa, and the quantity and quality of in a 1:2 water ratio using a glass electrode and Mehlich P,
plant-derived organic inputs can influence decomposition Ca, K, Mg, Al, Fe, Mn, and Zn using inductively coupled
rates [15–18]. Fungi degrade a large portion of the plant- plasma atomic emission spectroscopy [31]. To generate C/N
derived compounds [19], so the diverse mixtures of leaf ratios, total C and N were analyzed using dry combustion.
litter on the forest floor of tropical rain forests may enable To directly test for effects of plant species richness on
the coexistence of diverse fungal taxa via resource fungal diversity and function, we experimentally re-created
partitioning [20, 21]. Spatial differentiation and resource litter diversity gradients in 2-mm nylon screen litter bags
partitioning has been demonstrated for several groups of (20×20 cm) with 1, 25, and 50 species of plant leaf litter.
fungi [22–24], indicating that resource heterogeneity may Leaf litter was collected in traps on Barro Colorado Island
be important for supporting diverse fungal assemblages. over a period of 6 months (emptied every week), air-dried,
Nonetheless, field and laboratory experiments evaluating and identified to species when possible. Plant species were
links between plant diversity, fungal diversity, and ecosys- randomly selected from a pool of 72 species (supplemen-
tem function have yielded mixed results [1, 25, 26]. tary docs) and placed in three separate combinations for
Furthermore, the few studies that have been performed in each treatment. For single species treatments, we selected
tropical ecosystems have been conducted in experimental, Doliocarpus sp. (Dilleniaceae), Trichilia tuberculata
montane, or agricultural systems (e.g., [27–29]). Therefore, (Meliaceae), and Alseis blackiana (Rubiaceae) because
the applicability of those results to diverse lowland rain these species were abundant in litter traps and are well
forest is unknown. represented in a 50-ha permanent forest research plot that
In this study, we evaluated the effects of plant litter has been intensely studied since 1980 [32]. Leaf litter was
diversity on fungal diversity and function using a series of manually broken into pieces for every treatment in order to
plots in tropical rain forest across the Isthmus of Panama fit all species combinations into the litter bags. Litter bags
that varied in tree diversity [30]. Findings from the natural were filled with 15 g of leaf litter for each treatment and
diversity gradient were integrated with experimental manip- placed on the mineral soil surface in three sites in the
ulations of plant diversity in a litter decomposition primary rain forest on Barro Colorado Island outside of the
experiment. We tested the hypotheses that (1) fungal 50-ha research plot. All three of the litter decomposition
diversity and microbial biomass would be positively sites were of the same soil type (AVA soil; Typic Eutrudox
correlated with natural gradients in plant diversity and (2) [33]) and had similar mean annual precipitation. After
fungal diversity would be correlated with experimental 6 months, bags were collected and weighed to determine
manipulations of leaf litter diversity, mimicking patterns the effect of plant litter diversity on mass loss rates.
found across the natural plant diversity gradient.
Microbial Analyses

Methods DNA was extracted from 0.25 g sub-samples of the composite

soil and litter samples in each plot and from each litter bag
Field Work using the Powersoil DNA extraction kit (MoBio, Carlsbad, CA,
USA). Three DNA extractions from each sample were pooled
To assess the effects of natural variations in plant diversity, to obtain a better representation of the microbial community
we examined soil fungal diversity and microbial biomass in [34]. General fungal primers targeting the fungal 18S rRNA
pre-existing plots in Panama that contained between 63 and gene [35] were modified and successfully implemented to
165 tree species ha−1. All plots were 1 ha in size and amplify the general fungal community using a barcoded
characterized as old growth, primary forest [30]. These pyrosequencing procedure described previously [36–39]. The
plots also varied in mean annual precipitation and several forward primer consisted of the 454 Life Sciences Primer B
soil properties (Table 1), so all quantified biotic and abiotic attached to the SSU817f primer with an “AG” linker sequence
factors were included in the final analyses. From each plot, (GCCTTGCCAGCCCGCTCAGAGTTAGCATGGAA
15 composite soil cores (0–20 cm) were collected from TAATRR-AATAGGA). The reverse primer contained the 454
random locations within each plot. At the same point of soil Life Sciences Primer A, a unique 12 base-code barcode for
core collection, the leaf litter (O horizons) from the forest each PCR product, with an “AC” sequence linking it to the
floor was also collected, as we expected that fungi in SSU1196r primer (GCCTCCCTCGCGCCATCAG-12 bp bar-
freshly fallen and partially decomposed litter might respond code ACTCTGGACCTGGTGAGTTTCC). The 12-bp bar-
806 K. L. McGuire et al.

Table 1 Data for plots used in

microbial analyses that naturally Plot ID
varied in plant diversity and
other biotic and abiotic factors 7 B3 B1 B6 9 32
(plant data from Pyke et al. [30])
Annual ppt (mm) 2,438 2,579 2,589 2,589 2,889 3,293
# Species 93 99 84 76 107 165
Fisher’s alpha 39.21 41.59 31.41 23.1 41.6 81.35
Shannon (H′) 3.96 3.97 3.53 2.66 3.91 4.52
pH 4.5 6.4 6.3 5.6 4.9 5.8
−1
P (mg Pkg ) 2.1 1.5 3.6 7.0 1.5 1.3
Al (mg Al kg−1) 745.5 791.7 1,302.8 1,396.3 886.5 968.4
Total bases (Ca+K+Mg) 387.9 3,285.7 2,111.2 1,046.5 2,297.0 2,057.9
All data for plant communities
were derived from woody spe- NH4 (mg Nkg−1) 0.3 1.7 2.4 2.3 4.8 2.5
cies ≥10.0 cm dbh. Soils NO3 (mg Nkg−1) 1.8 2.9 2.3 2.5 1.0 1.6
analyses were derived from C/N ratio 6.7 8.0 8.5 8.9 5.1 10.4
mineral soil cores (0–20 cm)

code allowed us to pool together all of the amplicons for Technologies). Total PLFAs were used as an index of living
sequencing with sequences ultimately assigned to individual microbial biomass. The mean for both PLFA extractions
samples. Amplifications were done according to a previously was used in the calculations for each sample.
described protocol [36] using 0.25 μl of each primer
(30 mM), 3 μl of DNA template, and 22.5 μl Platinum Statistical Analyses
PCR SuperMix (Invitrogen, Carlsbad, CA, USA). Fungal
amplicons were sequenced on a Roche 454 Gene Sequencer To determine the relationships between fungal community
at the Environmental Genomics Core Facility at the University composition (fungal phylotypes and total biomass), plant
of South Carolina (Columbia, SC, USA) running the titanium species richness, soil chemistry, and mean annual precipi-
chemistry. tation across the 1-ha plots, Spearman rank correlation
Following pyrosequencing, sequences were processed analyses were performed using SPSS (SPSS v. 17.0 for
through the Quantitative Insights Into Microbial Ecology Mac, Chicago, IL, USA). Compositional differences in
(QIIME) pipeline [40]. In QIIME, sequences were quality fungal communities across soil and litter horizons were
checked, aligned, and grouped into phylotypes at a 97% analyzed by analysis of similarity (ANOSIM). Data were
sequence similarity cutoff. While 97% sequence similarity rarified to 1,000 sequences prior to downstream analyses.
is an arbitrary delineation of fungal taxa, other ecological Proportional counts of rarified phylotypes were then
studies use this and similar cutoff values (e.g., [2, 11, 41]). square-root transformed minimizing the influence of rare
One phylotype representative from each group was chosen, taxa. Nonmetric multidimensional scaling plots were used
and a phylogenetic tree was constructed with the FastTree to visualize similarity in fungal community composition
algorithm [42]. The closest taxonomic identity for each across plots (Primer v6).
representative phylotype was determined by BLAST For the litter bag decomposition experiment, a general
comparison against sequences contained within the SILVA linear model was used to evaluate the effects of litter
database [43] and GenBank. diversity on fungal richness. Spearman rank correlation
Microbial biomass was measured on plot samples of soil analyses were used to test for relationships between fungal
and leaf litter using phospholipid fatty acid analysis richness, plant litter richness, and decomposition rate (k).
(PLFA). PLFA was not performed on litter bag samples,
as there was insufficient material. For PLFA analyses, two
samples (2 g each) of both organic and mineral soil were Results
lyophilized from each plot [44]. Lipids were extracted from
each sample with a single-phase, phosphate-buffered, Plot Analyses
CHCl3–CH3OH solvent and separated from neutral and
glycolipid fractions by silicic acid column chromatography. Four hundred fifty-four pyrosequencing yielded a total of
Phospholipids were transesterified to fatty acid methyl 57,560 sequences with 9,733 phylotypes and an average of
esters and quantified by mass spectrometry [45, 46] using 1,598 sequences per sample. Seventeen percent were non-
an Agilent 6980N gas chromatography system (Agilent fungal eukaryotes and 0.4% could not be identified to
Fungi in Tropical Soils and Leaf Litter 807

Table 2 Results of Spearman

ranked correlations for fungal Plant richness Precipitation
taxa and microbial biomass in Spearman’s ρ Spearman’s ρ
litter, mineral soil, and both
horizons combined Total fungal phylotypes (litter) 0.40 0.10
Total fungal phylotypes (soil) 0.39 0.75*
Total fungal phylotypes (litter+soil) 0.41 0.57*
Total microbial biomass (litter+soil) 0.38 0.10
Litter Total fungal orders 0.30 −0.20
Total fungal families −0.30 0.00
Total microbial biomass 0.31 0.09
Soil Total fungal orders 0.52 0.74*
N=12; one soil and one litter Total fungal families 0.37 0.90**
sample were analyzed per plot
Total microbial biomass 0.54 0.99**
*p<0.05; **p<0.01

domain. Prior to statistical analyses, non-fungal and of 945 sequences per sample and 367 unique phylotypes per
unclassifiable sequences were removed, leaving an average sample (soil and litter samples were counted separately).

Figure 1 Nonmetric multidi-

mensional scaling plots show- a
ing compositional separation of
fungal communities across litter
(O horizons; N=5) and mineral
soil (N=6) horizons for plots (a)
and all samples including litter
bags (b) (N=36)

b
808 K. L. McGuire et al.

Across plots, the total number of fungal phylotypes (soil+ A.

litter) was not significantly correlated with plant species 60 a

richness but was significantly correlated with mean annual

Percent mass remaining

50
precipitation (Table 2). When analyzed separately, soil and
litter fungi responded differently to precipitation; total soil 40 b
fungal phylotypes increased significantly with increasing b

mean annual precipitation, whereas precipitation had no 30

significant effect on litter fungi (Table 2).
20
When separated out by soil vs. litter horizons, ANOSIM
showed that fungal communities were distinct across horizons 10
(Fig. 1; R=0.96, p<0.001). In soils, there were significantly 0 10 20 30 40 50
more fungal sequences from the Chytridiomycota (Fig. 2; F Number of plant species
(1, 10)=16.1; p=0.003) and Glomeromycota (F (1, 10)=15.8;
p=0.003). By contrast, litter samples contained significantly B. 80
more Ascomycota (F (1, 10)=9.9; p=0.01). Total Basidiomy-
cota sequences did not differ significantly among soils
(F (1, 10)=1.5; p=0.2). 60

Percent mass remaining

Total microbial biomass (per gram of dry matter) showed
similar patterns across horizons as pyrosequencing results:
Microbial biomass was significantly correlated with mean 40
annual precipitation in soil samples (ρ=0.81, p<0.03), but
not with plant richness or stem number (Table 2). Microbial
biomass was not significantly correlated with any of the 20

plant metrics or precipitation in litter or when data for soil

and litter samples were combined. In soils, the mole
0
percentage of the 16:1ω5c PLFA, an indicator of arbuscular
Trichilia Doliocarpus Alseis
mycorrhizal biomass [47, 48], was significantly correlated
with mean annual precipitation (ρ=0.81, p=0.03) and tree Figure 3 Percent mass remaining in leaf litter bags (N=26) for all species
species richness (ρ=0.78; p=0.04). The mole percentage of treatments (a) and for single species treatments (b) after 6 months (mean
± SE). Different letters above error bars indicate significance at p<0.05
fungal biomass in litter was significantly correlated with the
number of tree stems (ρ=0.77; p=0.04), but not with any
other plot metric. Total microbial biomass per gram of dry samples (F (1, 10)=46.9, p<0.001), and the mole percent-
matter was significantly higher in litter compared to soil age of fungal PLFAs was also significantly higher in litter

Figure 2 Relative abundances 0.70

of fungal phyla found in litter *
(N=5) versus soil (N=6) frac- Litter
tions of 1-ha plots. For each 0.60 Soil
sample, abundances were calcu-
lated as the proportion of
sequences in each fungal 0.50
phylum. Asterisks indicate
Proportion of sequences

significance at p<0.05
0.40

0.30

0.20

0.10

*
0.00 *
Ascomycota Basidiomycota Chytridiomycota Glomeromycota Zygomycota
Fungi in Tropical Soils and Leaf Litter 809

versus soil samples (F (1, 10)=29.6, p<0.001), resulting in communities. There was also no relationship among plant
higher fungal to bacterial ratios in litter (F (1, 10)=23.0, p< richness and fungal richness in the 1-ha forest plots, indicating
0.001). that relationships among fungal diversity and the plant species
Soil elemental analyses (Table 1) revealed that in soil in these forests are complex with no clear pattern of
samples, total microbial biomass was positively correlated correlation. Rather, our results from 454 pyrosequencing
with total inorganic N (ρ=0.77, p=0.04) but none of the showed that soil fungal richness was positively correlated with
other elemental data. NH4 was positively correlated with increasing precipitation, but not with increasing tree species
total fungal phylotypes (ρ=0.77, p=0.02) and total fungal richness or soil nutrients. However, since we only analyzed
families (ρ=0.83, p=0.02). C/N ratios were positively samples from six 1-ha plots, results should be interpreted with
correlated with total fungal orders (ρ=0.94, p=0.002). caution, as more intensive sampling across the precipitation
gradient may reveal different correlates of soil fungal
Litter Bag Experiment communities.
The fact that there was not a clear relationship between
After 6 months, decomposition of leaf litter in single fungal diversity and plant diversity is counter to expect-
species bags was significantly slower than decomposition ations, particularly in the litter decomposition experiment.
in 25 (p=0.03) and 50 species treatments (Fig. 3a; p=0.02). Based on our results, the observed increase in decomposi-
However, there was no difference in decomposition rates tion rates from one to 25 litter species in the litter bag
between 25 and 50 species treatments (p=0.96). There was experiment did not appear to result from parallel increases
also no difference in decomposition rates among single in fungal richness. Numerous studies have reported additive
species litter bags containing only Doliocarpus sp., Trichi- and synergistic effects of litter mixing in decomposition
lia, or Alseis (Fig. 3b). experiments [1, 49], and microbial community composition
Fungal richness was not significantly correlated with has been suggested as a plausible mechanism for these
plant litter diversity. In single species treatments, fungal patterns [25, 50]. However, relationships between plant
communities decomposing Doliocarpus sp. litter were diversity, microbial diversity, and ecosystem function have
significantly clustered (Fig. 4; R=0.94), but there were no been highly variable across studies [51, 52], and we only
detectable patterns in fungal communities for other single found significant relationships between litter diversity and
species litter bags. decomposition at the low end of the plant litter richness
continuum. Other experiments have found similar results, in
which a decelerating relationship between decomposition
Discussion rates and increasing microbial or plant litter species was
observed [53–55]. This type of relationship between
We found little support for the hypothesis that increasing the diversity and function implies some level of functional
number of leaf litter species decomposing on the forest floor overlap among decomposer microbes in their breakdown of
will result in greater diversity and abundance of fungal plant materials [53]. More detailed chemical analyses of the

Figure 4 Non-metric multidi-

mensional scaling plot of fungal
communities in single species
litter bag treatments (N=9).
There was no overall difference
in fungal communities between
the three litter types; however,
fungal communities in bags with
Doliocarpus litter were more
similar to each other (ANOSIM
p<0.05) when samples were
coded as Doliocarpus vs.
non-Doliocarpus
810 K. L. McGuire et al.

plant litter we used in the decomposition experiment may experiment. Collecting and export permits were granted from the
Autoridad Nacional del Ambiente of Panama. Jenny Talbot and Angela
reveal that the plant species were more similar chemically
Nguyen assisted with C and N measurements, and Steve Allison and
than would be expected taxonomically [56]. Focusing on Donovan German helped with extracellular enzyme assays and data
the litter chemistry, rather than the plant species composi- interpretation. We also thank two anonymous reviewers for helping to
tion per se, should be a priority for future studies. improve the quality and clarity of the manuscript. This work was funded
by NSF Ecosystems (DEB-0640666) and the Kearney Foundation.
Our results showing that fungal richness increases at the
high end of the precipitation gradient are different from a
recent manipulative rainfall study in California [57] and References
another experimental study in an old-field ecosystem [58].
In the California study, fungal diversity was the highest
1. Hattenschwiler S, Tiunov AV, Scheu S (2005) Biodiversity and
under low rainfall treatments [57], and in the old-field litter decomposition in terrestrial ecosystems. Annu Rev Ecol
experiment, fungal abundance was not affected by precip- Evol Syst 36:191–218
itation; however, fungal community composition was 2. McGuire KL, Zak DR, Edwards IP, Blackwood CB, Upchurch R
altered, although the responses were lineage-specific [58]. (2010) Slowed decomposition is biotically mediated in an
ectomycorrhizal, tropical rain forest. Oecologia 164:785–795
The manipulative nature of these experiments may account 3. Peay KG, Kennedy PG, Davies SJ, Tan S, Bruns TD (2010)
for the differences we observed across the gradient on the Potential link between plant and fungal distributions in a
Isthmus of Panama, as the experimental studies would dipterocarp rainforest: community and phylogenetic structure of
capture short-term dynamics, whereas climatic gradients tropical ectomycorrhizal fungi across a plant and soil ecotone.
New Phytol 185:529–542
result from the accumulation patterns and processes 4. Tedersoo L, Nilsson RH, Abarenkov K, Jairus T, Sadam A, Saar I,
integrated over centuries or longer. An alternative and Bahram M, Bechem E, Chuyong G, Koljalg U (2010) 454
more likely explanation for the disparate patterns is that it Pyrosequencing and Sanger sequencing of tropical mycorrhizal
may not be possible to generalize the findings from coastal fungi provide similar results but reveal substantial methodological
biases. New Phytol 188:291–301
grasslands and old-field ecosystems to tropical rain forests, 5. Fierer N, Jackson RB (2006) The diversity and biogeography of
particularly since mean annual precipitation ranges are soil bacterial communities. Proc Natl Acad Sci U S A 103:626–
much higher in Panama than in coastal grasslands and old- 631
field communities. There may also be annual variations and 6. Watling R (2001) The relationships and possible distributional
patterns of boletes in South-East Asia. Mycol Res 105:1440–1448
seasonal patterns that were not accounted for in our single 7. Lindblad I (2001) Diversity of poroid and some corticoid wood-
time point collections [59]. inhabiting fungi along the rainfall gradient in tropical forests,
Across all samples, we found that fungal communities Costa Rica. J Trop Ecol 17:353–369
were distinct in litter versus soil, indicating vertical 8. Lodge DJ (1997) Factors related to diversity of decomposer fungi
in tropical forests. Biodivers Conserv 6:681–688
segregation of microbial communities across these hori- 9. Buee M, Reich M, Murat C, Morin E, Nilsson RH, Uroz S, Martin
zons. Organic horizons contain greater quantities of labile F (2009) 454 Pyrosequencing analyses of forest soils reveal an
sugars and higher C/N ratios than deeper soil horizons [19, unexpectedly high fungal diversity. New Phytol 184:449–456
60], which may facilitate the proliferation of decomposer 10. Taylor DL, Herriott IC, Stone KE, McFarland JW, Booth MG,
Leigh MB (2010) Structure and resilience of fungal communities
taxa that are more competitive for these C substrates. Other in Alaskan boreal forest soils. Can J For Res-Rev Can Rech For
studies in boreal and temperate ecosystems have detected 40:1288–1301
vertical segregation of fungi [11, 23, 61] and differences in 11. O’Brien HE, Parrent JL, Jackson JA, Moncalvo JM, Vilgalys R
microbial biomass [62], suggesting broad generalizability (2005) Fungal community analysis by large-scale sequencing
of environmental samples. Appl Environ Microbiol 71:5544–
of this pattern. Whether or not the taxa found in litter vs. 5550
deeper horizons are functionally similar across ecosystems 12. Powers JS, Montgomery RA, Adair EC, Brearley FQ, DeWalt SJ,
remains to be tested. In addition to distinctive community Castanho CT, Chave J, Deinert E, Ganzhorn JU, Gilbert ME,
composition, fungi in litter versus mineral soil horizons Gonzalez-Iturbe JA, Bunyavejchewin S, Grau HR, Harms KE,
Hiremath A, Iriarte-Vivar S, Manzane E, de Oliveira AA, Poorter
showed different relationships to plant richness and L, Ramanamanjato JB, Salk C, Varela A, Weiblen GD, Lerdau
precipitation. It is difficult to draw strong inferences from MT (2009) Decomposition in tropical forests: a pan-tropical study
the data, as many of these fungal groups have not been of the effects of litter type, litter placement and mesofaunal
extensively studied, particularly in the tropics. Nonetheless, exclusion across a precipitation gradient. J Ecol 97:801–811
13. Gentry AH (1992) Tropical forest biodiversity—distributional
this study highlights the potential importance of precipita- patterns and their conservational significance. Oikos 63:19–28
tion as an abiotic factor structuring fungal communities and 14. Valencia RH, Balslev H, Paz H, Mino CG (1994) High tree alpha-
is one of the first studies to evaluate these relationships in diversity in Amazonian Ecuador. Biodivers Conserv 3:21–28
lowland tropical rain forests. 15. Aerts R (1997) Climate, leaf litter chemistry and leaf litter
decomposition in terrestrial ecosystems: a triangular relationship.
Oikos 79:439–449
Acknowledgments We thank Joe Wright and Osvaldo Calderon for 16. Couteaux MM, Bottner P, Berg B (1995) Litter decomposition,
collection and identification of all litter species in the decomposition climate and litter quality. Trends Ecol Evol 10:63–66
Fungi in Tropical Soils and Leaf Litter 811

17. Perez-Harguindeguy N, Diaz S, Cornelissen JHC, Vendramini F, soil bacterial community structure at the continental scale. Appl
Cabido M, Castellanos A (2000) Chemistry and toughness predict Environ Microbiol 75:5111–5120
leaf litter decomposition rates over a wide spectrum of functional 38. Hamady M, Walker JJ, Harris JK, Gold NJ, Knight R (2008)
types and taxa in central Argentina. Plant Soil 218:21–30 Error-correcting barcoded primers for pyrosequencing hundreds of
18. Sariyildiz T, Anderson JM (2002) Interactions between litter samples in multiplex. Nat Methods 5:235–237
quality, decomposition and soil fertility: a laboratory study. Soil 39. Rousk J, Baath E, Brookes PC, Lauber CL, Lozupone C,
Biol Biochem 35:391–399 Caporaso JG, Knight R, Fierer N (2010) Soil bacterial and fungal
19. Berg B, McClaugherty C (2003) Plant litter: decomposition, communities across a pH gradient in an arable soil. ISME J
humus formation, carbon sequestration. Springer, Berlin 4:1340–1351
20. McGuire KL, Bent E, Borneman J, Majumder A, Allison SD, 40. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K,
Treseder KK (2010) Functional diversity in resource use by fungi. Bushman FD, Costello EK, Fierer N, Pena AG, Goodrich JK,
Ecology. doi:10.1890/09-0654 Gordon JI, Huttley GA, Kelley ST, Knights D, Koenig JE, Ley
21. Hanson CA, Allison SD, Bradford MA, Wallenstein MD, Treseder RE, Lozupone CA, McDonald D, Muegge BD, Pirrung M,
KK (2008) Fungal taxa target different carbon sources in forest Reeder J, Sevinsky JR, Tumbaugh PJ, Walters WA, Widmann
soil. Ecosystems 11:1157–1167 J, Yatsunenko T, Zaneveld J, Knight R (2010) QIIME allows
22. Boddy L (1999) Saprotrophic cord-forming fungi: meeting the analysis of high-throughput community sequencing data. Nat
challenge of heterogeneous environments. Mycologia 91:13–32 Methods 7:335–336
23. Dickie IA, Xu B, Koide RT (2002) Vertical niche differentiation 41. Allison SD, McGuire KL, Treseder KK (2010) Resistance of
of ectomycorrhizal hyphae in soil as shown by T-RFLP analysis. microbial and soil properties to warming treatment seven years
New Phytol 156:527–535 after boreal fire. Soil Biol Biochem 42:1872–1878
24. Genney DR, Anderson IC, Alexander IJ (2006) Fine-scale 42. Price MN, Dehal PS, Arkin AP (2009) FastTree: computing large
distribution of pine ectomycorrhizas and their extramatrical minimum evolution trees with profiles instead of a distance
mycelium. New Phytol 170:381–390 matrix. Mol Biol Evol 26:1641–1650
25. Hooper DU, Chapin FS, Ewel JJ, Hector A, Inchausti P, Lavorel 43. Pruesse E, Quast C, Knittel K, Fuchs BM, Ludwig WG, Peplies J,
S, Lawton JH, Lodge DM, Loreau M, Naeem S, Schmid B, Setala Glockner FO (2007) SILVA: a comprehensive online resource for
H, Symstad AJ, Vandermeer J, Wardle DA (2005) Effects of quality checked and aligned ribosomal RNA sequence data
biodiversity on ecosystem functioning: a consensus of current compatible with ARB. Nucleic Acids Res 35:7188–7196
knowledge. Ecol Monogr 75:3–35 44. White DC, Stair JO, Ringelberg DB (1997) Quantitative compar-
26. Jonsson LM, Nilsson MC, Wardle DA, Zackrisson O (2001) isons of in situ microbial biodiversity by signature biomarker
Context dependent effects of ectomycorrhizal species richness on analysis. J Ind Microbiol 17:185–196
tree seedling productivity. Oikos 93:353–364 45. Bligh EG, Dyer WJ (1954) A rapid method of total lipid
27. Carney KM, Matson PA (2006) The influence of tropical plant extraction and purification. Can J Biochem Physiol 37:911–
diversity and composition on soil microbial communities. Microb 917
Ecol 52:226–238 46. Zelles L (1999) Fatty acid patterns of phospholipids and lip-
28. Waldrop MP, Balser TC, Firestone MK (2000) Linking microbial opolysaccharides in the characterisation of microbial communities
community composition to function in a tropical soil. Soil Biol in soil: a review. Biol Fertil Soils 29:111–129
Biochem 32:1837–1846 47. van Diepen LTA, Lilleskov EA, Pregitzer KS, Miller RM (2007)
29. Ushio M, Wagai R, Balser TC, Litayama L (2008) Variations in Decline of arbuscular mycorrhizal fungi in northern hardwood
the soil microbial community composition of a tropical montane forests exposed to chronic nitrogen additions. New Phytol
forest ecosystem: does tree species matter? Soil Biol Biochem 176:175–183
40:2699–2702 48. Olsson PA (1999) Signature fatty acids provide tools for
30. Pyke CR, Condit R, Aguilar S, Lao S (2001) Floristic composition determination of the distribution and interactions of mycorrhizal
across a climatic gradient in a neotropical lowland forest. J Veg fungi in soil. FEMS Microbiol Ecol 29:303–310
Sci 12:553–566 49. Gartner TB, Cardon ZG (2004) Decomposition dynamics in
31. Turner BL, Romero TE (2009) Short-term changes in extractable mixed-species leaf litter. Oikos 104:230–246
inorganic nutrients during storage of tropical rain forest soils. Soil 50. Chapman SK, Newman GS (2010) Biodiversity at the plant–soil
Sci Soc Am J 73:1972–1979 interface: microbial abundance and community structure respond
32. Leigh EG, Loo de Lao S, Condit R, Hubbell SP, Foster RB, Pérez to litter mixing. Oecologia 162:763–769
R (2004) Barro Colorado Island forest dynamics plot, Panama. In: 51. Andren O, Balandreau J (1999) Biodiversity and soil
Losos EC, Leigh EG (eds) Tropical forest diversity and functioning—from black box to can of worms? Appl Soil
dynamism: findings from a large-scale plot network. The Ecol 13:105–108
University of Chicago Press, Chicago, pp 451–463 52. Zak DR, Holmes WE, White DC, Peacock AD, Tilman D (2003)
33. Dieter D, Elsenbeer H, Turner BL (2010) Phosphorus fraction- Plant diversity, soil microbial communities, and ecosystem
ation in lowland tropical rainforest soils in central Panama. Catena function: are there any links? Ecology 84:2042–2050
82:118–125 53. Bell T, Newman JA, Silverman BW, Turner SL, Lilley AK (2005)
34. Feinstein LM, Sul WJ, Blackwood CB (2009) Assessment of bias The contribution of species richness and composition to bacterial
associated with incomplete extraction of microbial DNA from services. Nature 436:1157–1160
soil. Appl Environ Microbiol 75:5428–5433 54. Setala H, McLean MA (2004) Decomposition rate of organic
35. Borneman J, Hartin RJ (2000) PCR primers that amplify fungal substrates in relation to the species diversity of soil saprophytic
rRNA genes from environmental samples. Appl Environ Micro- fungi. Oecologia 139:98–107
biol 66:4356–4360 55. Wohl DL, Arora S, Gladstone JR (2004) Functional redundancy
36. Fierer N, Hamady M, Lauber CL, Knight R (2008) The influence supports biodiversity and ecosystem function in a closed and
of sex, handedness, and washing on the diversity of hand surface constant environment. Ecology 85:1534–1540
bacteria. Proc Natl Acad Sci U S A 105:17994–17999 56. Meier CL, Bowman WD (2008) Links between plant litter
37. Lauber CL, Hamady M, Knight R, Fierer N (2009) chemistry, species diversity, and below-ground ecosystem func-
Pyrosequencing-based assessment of soil pH as a predictor of tion. Proc Natl Acad Sci U S A 105:19780–19785
812 K. L. McGuire et al.

57. Hawkes CV, Kivlin SN, Rocca JD, Huguet V, Thomsen MA, 60. Trumbore S (2000) Age of soil organic matter and soil respiration:
Suttle KB (2010) Fungal community responses to precipitation. radiocarbon constraints on belowground C dynamics. Ecol Appl
Glob Chang Biol 17:1637–1645 10:399–411
58. Castro HF, Classen AT, Austin EE, Norby RJ, Schadt CW 61. Lindahl BD, Ihrmark K, Boberg J, Trumbore SE, Hogberg P,
(2010) Soil microbial community responses to multiple exper- Stenlid J, Finlay RD (2007) Spatial separation of litter decompo-
imental climate change drivers. Appl Environ Microbiol sition and mycorrhizal nitrogen uptake in a boreal forest. New
76:999–1007 Phytol 173:611–620
59. Baath E, Soderstrom B (1982) Seasonal and spatial variation 62. Fierer N, Schimel JP, Holden PA (2003) Variations in microbial
in fungal biomass in a forest soil. Soil Biol Biochem 14:353– community composition through two soil depth profiles. Soil Biol
358 Biochem 35:167–176