Received: 21 May 2018 | Revised: 29 August 2018 | Accepted: 4 September 2018

DOI: 10.1002/ame2.12034

ORIGINAL ARTICLE

Rehmannia glutinosa exhibits anti‐aging effect through

maintaining the quiescence and decreasing the senescence of
hematopoietic stem cells

Lin Bai | Gui‐ying Shi | Ya‐jun Yang | Wei Chen | Lian‐feng Zhang | Chuan Qin

Key Laboratory of Human Disease

Comparative Medicine, Ministry of Health, Abstract
Institute of Laboratory Animal Science, Background: The time‐related decline in regenerative capacity and organ homeosta-
Chinese Academy of Medical Sciences and
Comparative Medical Center, Peking Union sis is a major feature of aging. Rehmannia glutinosa and Astragalus membranaceus
Medical College, Beijing, China have been used as traditional Chinese herbal medicines for enhanced immunity and
Correspondence prolonged life. However, the mechanism by which this herbal medicine slows aging
Chuan Qin, Key Laboratory of Human is unknown. In this study, we investigated the mechanism of the herbal anti‐aging
Disease Comparative Medicine, Ministry of
Health, Institute of Laboratory Animal effect.
Science, Chinese Academy of Medical Methods: Mice were fed diets supplemented with R. glutinosa or A. membranaceus
Sciences and Comparative Medical Center,
Peking Union Medical College, Beijing, for 10 months; the control group was fed a standard diet. The phenotypes were
China. evaluated using a grading score system and survival analysis. The percentages of
Email: [email protected]
the senescence phenotypes of hematopoietic stem cells (HSCs) were determined by
Funding information fluorescence‐activated cell sorting analysis. The function and the mechanism
National Science Foundation for China,
Grant/Award Number: 31672374; PUMC of HSCs were analyzed by clonogenic assay and the real‐time polymerase chain
Youth Fund, Grant/Award Number: reaction.
2017310018; CAMS Innovation Fund for
Medical Sciences, Grant/Award Number: Results: The anti‐aging effect of R. glutinosa is due to the enhanced function of
2016-12M-1-012 HSCs. Mice fed with R. glutinosa displayed characteristics of a slowed aging process,
including decreased senescence and increased rate of survival. Flow cytometry anal-
ysis showed decreased numbers of Lin–Sca1+c‐kit– (LSK) cells, long‐term HSCs (LT‐
HSCs) and short‐term HSCs (ST‐HSCs) in the R. glutinosa group. In vitro, clonogenic
assays showed increased self‐renewal ability of LT‐HSCs from the R. glutinosa group
as well as maintaining LSK quiescence through upregulated p18 expression. The
R. glutinosa group also showed decreased reactive oxygen species levels and the
percentage of β‐gal+ cells through downregulation of the cellular senescence‐asso-
ciated protein p53 and p16.
Conclusion: Rehmannia glutinosa exerts anti‐aging effects by maintaining the quies-
cence and decreasing the senescence of HSCs.

KEYWORDS
anti-aging, hematopoietic stem cells, quiescence, Rehmannia glutinosa

----------------------------------------------------------------------------------------------------------------------------------------------------------------------
This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium,
provided the original work is properly cited.
© 2018 The Authors. Animal Models and Experimental Medicine published by John Wiley & Sons Australia, Ltd on behalf of The Chinese Association for Laboratory
Animal Sciences

194 | wileyonlinelibrary.com/journal/ame2 Animal Model Exp Med. 2018;1:194–202.

BAI ET AL. | 195

1 | INTRODUCTION
2 | MATERIALS AND METHODS

Aging is defined as the time‐dependent functional decline that

2.1 | Animal grouping and treatment
affects most living organisms.1 The longevity of organisms is
mainly maintained by stem cells.2 Tissue‐specific stem cells have C57BL/6J female mice were maintained in a pathogen‐free environ-
the capacity for self‐renewal and differentiate into a variety of ment and fed with a standard diet. The use of animals in this study
3 was approved by the Animal Care and Use Committees of the Institute
effector cells. However, during the aging process, this self‐
renewal capacity declines, eventually leading to the accumulation of Laboratory Animal Science of Peking Union Medical College. The
of unrepaired, damaged tissues in aged organisms.4 Loss of the mice (aged 10 months) were randomly divided into three groups
ability to maintain a balance between quiescence and differentia- (n = 20/group). The control group was fed with a standard diet (Beijing
tion in the stem/progenitor cell compartment may result in death HFK Biosicence, Beijing, China). The diets of the other two groups
2 were supplemented with ground R. glutinosa and A. membranaceus
or age‐associated diseases. Furthermore, recent studies suggest
that stem cell rejuvenation may reverse the aging phenotype.5,6 In (Beijing Tong Ren Tang Chinese Medicine, Beijing, China), respectively,
the hematopoietic system, hematopoietic stem cells (HSCs) are at a dose of 200 mg/d for 10 months. This dose was selected using
responsible for blood cell production. In aged mice, the the body surface area normalization method to confirm the drug doses
hematopoietic system shows T‐ and B‐lymphoid cell impairment from human studies to mouse studies. The bodyweight was deter-
and the number of myeloid cells is increased. Aged HSCs showed mined every 2 months and survival was recorded daily.
reduced self‐renewal activity and reduced hematopoiesis recon-
structive ability. Notably, age‐related changes in the HSC compart-
2.2 | Evaluation of the degree of senescence
ment are manifested in the aging host as anemia, increased
propensity for myeloproliferative neoplasms, decreased immune A grading score system was adopted to evaluate the degree of
function and increased cancer incidence.7-9 However, the mecha- senescence according to criteria defined by Takeda et al.18 Each cat-
nism of HSC aging and the effects of herbal medicines on HSC egory listed in the protocol was selected from the clinical signs asso-
10 ciated with the aging process. Each mouse was scored at 18 months
aging are unknown.
People have been concerned with delaying the aging process of age and the score in each category was summed to determine the
and staying young from ancient times and anti‐aging is a current overall grading score.
focus of research. Traditional Chinese medicine has received increas-
ing attention for the treatment of various aging‐associated diseases.
2.3 | Flow cytometry
Many herbs used in traditional Chinese medicine are known to pro-
vide positive effects against aging through different mechanisms. Cells were harvested from the thymus, spleen, peripheral blood (PB)
Rehmannia glutinosa and Astragalus membranaceus have been widely and bone marrow (BM). The spleen and thymus were excised imme-
used in this way for thousands of years. diately, washed with saline and weighed. Spleens and thymuses were
Rehmannia glutinosa is used to treat various diabetic disorders, gently homogenized in a glass homogenizer and cells were sus-
enhance the bone metabolism in osteoporosis, and inhibit liver pended in sterile phosphate‐buffered saline (PBS). The cells from PB
inflammation and fibrosis. In addition, this herb has other effects were applied to blood red cell lysis (BD Biosciences, San Jose, CA,
including anti‐fatigue, antidepressant and neuroprotective proper- USA). The cells from BM were isolated by flushing both tibias and
ties. In the past few years, pharmacological studies on R. glutinosa femurs with sterile PBS. All the cells were isolated by filtration
and its active components have focused mainly on its broad actions across a sterile nylon mesh and stained for 30 minutes at 4°C with
on the blood, endocrine, cardiovascular and nervous systems.11-14 the following fluorophore‐conjugated antibodies: phycoerythrin (PE)‐
Thus, R. glutinosa was shown to possess strong immuno‐enhance- conjugated anti‐CD3 (G4.18), allophycocyanin (APC)‐conjugated anti‐
ment activity, which has provided the theoretical basis for further CD4 (OX35) and PE‐Cy7‐conjugated anti‐CD8a (OX8). For the BM
studies. cells, lineage markers were stained using biotin‐conjugated anti-
Astragalus membranaceus possesses tonic, hepatoprotective, mouse CD4 (RM4‐5), CD5 (53‐7.3) CD8a (53‐6.7), CD11b (M1/70),
15 B220 (RA3‐6B2), TER119 (TER‐119) and Gr1 (RB6‐8C5), followed by
diuretic and expectorant properties and has been shown to exhibit
16 17 staining with the antibody APC‐eFluor 780-conjugated streptavidin
immunomodulatory, anti‐inflammatory and antioxidant effects.
The elucidation of the molecular mechanisms underlying the effects was also obtained from eBioscience (San Diego, CA, USA). The fol-
of traditional Chinese medicines in clinical practice is a key step lowing antibodies were used for surface staining: APC immunoglobu-
toward their worldwide application, and this topic is currently a sub- lin (Ig)M (II/41), fluorescein isothiocyanate (FITC) IgD (11‐26), PE‐Cy7
ject of intense research interest. Sca‐1 (D7), PE Flt3 (A2F10), FITC B220 (RA3‐6B2), FITC CD34
Thus, in this study, we fed mice diets supplemented with R. gluti- (RAM34), PerCP‐Cy5.5 CD127 (A7R34), PE CD16/CD32 (93) and
nosa and A. membranaceus for 10 months to explore the mechanism PerCP‐Cy5.5 CD3e (145‐2C11). All antibodies were obtained from
underlying the ability of R. glutinosa to increase longevity. eBiosciences (San Diego, CA, USA). Data were acquired by a FACS
196 | BAI ET AL.

Aria II (Becton Dickinson, Franklin Lakes, NJ, USA) and analyzed TTCACACCCATCACAAACAT‐3′, Tm = 60°C, 25 cycles). Real‐time
using FlowJo software (Three Star, Ashland, OR, USA). (RT)‐PCR was carried using SYBR Premix Ex Taq II (TaKaRa Shuzo,
Kyoto, Japan) on the ABI StepOne™ detection system (Applied
Biosystems, Foster City, CA, USA).
2.4 | Cell cycle analysis
For cell cycle analysis, total BM cells were stained for stem cell sur-
2.8 | Clonogenic assays
face markers (Lin–Sca‐1+c‐KitHigh; LSTKs), then fixed and permeabi-
lized (00‐5123‐43; Becton Dickinson) before staining with FITC Ki‐ Long‐term (LT)‐HSCs were sorted by fluorescence‐activated cell sort-
67 antibody and 7‐aminoactinomycin D (7‐AAD). Data acquisition ing (FACS) and then cultured in 96‐well cell plates using a methylcel-
was performed on FACS Aria II (Becton Dickinson). Data were ana- lulose‐base medium (HSC007; R&D Systems, Minneapolis, MN,
lyzed using FlowJo software. USA). Ten replicate wells were prepared for each sample. We used
96‐well cell culture plate, three cells per well. Two weeks after plat-
ing, the number and sizes of colonies were counted under a micro-
2.5 | Senescence‐associated β‐gal staining
scope.
Senescence‐associated (SA)‐β‐gal activity was also assayed by flow
cytometry using C12FDG as described by the manufacturer (Molecu-
2.9 | Statistical analysis
lar Probes, Eugene, OR, USA). Briefly, stem cells were first stained
for cell surface markers and then incubated with 100 nmol L−1 bafi- Data were analyzed by the one‐way ANOVA using Microsoft Excel
lomycin A1 for 1 hour at 37°C to induce lysosomal alkalinization. (Microsoft, Redmond, WA, USA) and GraphPad Prism (GraphPad
After washing with PBS, cells were incubated with a 2 mmol L−1 Software, La Jolla, CA, USA) software. Data were presented as the
C12FDG for 1‐2 hours at 37°C and then analyzed using a FACS Aria mean ± SD. P < 0.05 was considered to indicate statistical signifi-
I (Becton Dickinson). cance.

2.6 | Determination of reactive oxygen species 3 | RESULTS

(ROS) production
3.1 | R. glutinosa and A. membranaceus exerted anti‐
Cells were incubated with dichloro‐dihydro‐fluorescein diacetate
aging effects
(DCFH‐DA; Beyotime, Shanghai, China) at 37°C for 20 minutes.
DCFH‐DA diffuses passively into cells, where it is deacetylated by To confirm the anti‐aging effects of R. glutinosa and A. mem-
esterases to form non‐fluorescent 2′,7′‐dichlorofluorescein (DCFH). branaceus, we investigated the effects of administration as a
The amount of fluorescence emitted correlates with the quantity of dietary supplement (200 mg/d). Subsequently, we recorded the
ROS in the cell. Data were acquired on a FACS Aria I (Becton Dick- bodyweight, degree of senescence and survival rate of mice. The
inson) and analyzed using FlowJo software. bodyweight of mice feeding with R. glutinosa or A. membranaceus
was normal compared with those in the control group, although
there was a decrease in the bodyweight of the R. glutinosa and
2.7 | Real‐time polymerase chain reaction (PCR)
A. membranaceus group at 20 months (Figure 1A). Analysis of the
analysis
degree of senescence revealed a steady and irreversible increase
Total RNA was extracted from cells using TRIzol reagent (Invitrogen, in the grading score with advancing age in the R. glutinosa and
San Diego, CA, USA) according to the manufacturer's instructions. A. membranaceus groups compared with that in the control
Genes of interest were amplified from DNase I‐treated total RNAs group, although the increase was more marked in the A. mem-
using M‐MLV Reverse Transcriptase (Promega, Madison, WI, USA) branaceus group (Figure 1B). The high grading score was due to
and poly‐dT primers. The primers used for PCR were as follows: p21 an earlier onset of loss of passivity and reactivity, loss of skin
(5′‐TCCAGACATTCAGAGCCACA‐3′ and 5′‐CGAAGAGACAACGG- glossiness and increased coarseness, hair loss, periophthalmic
CACACT‐3′, Tm = 60°C, 30 cycles), p53 (5′‐CATGAACCGCCGACC- lesions, increased lordokyphosis of the spine and a more marked
TATC‐3′ and 5′‐TCCCGGAACATCTCGAGGC‐3′, Tm = 62°C, 35 increase in their severity.18 Mice in the A. membranaceus mice
cycles), p16 (5′‐CGAACTCTTTCGGTCGTACCC‐3′ and 5′‐ group showed more marked senescence phenotype characteris-
CGAATCTGCACCGTAGTTGAGC‐3′, Tm = 62°C, 35 cycles), p57 (5′‐ tics, including loss of skin glossiness and hair loss. The survival
AGGAGCAGGACGAGAATCAA‐3′ and 5′‐ TTCTCCTGCGCAGTTCTC curves showed that the lifespan of mice in the R. glutinosa and
TT‐3′, Tm = 61°C, 30 cycles), p19 (5′‐ATGGGTCGCAGGTTCTTGGT‐ A. membranaceus groups was slightly longer than that in the con-
3′ and 5′‐GTAGTGGGGTCCTCGCAGTT‐3′, Tm = 61°C, 35 cycles), trol group (Figure 1C). These data confirmed the anti‐aging
p18 (5′‐GGGACCTAGAGCAACTTACT‐3′ and 5′‐TGACAGCAAAAC- effects of both R. glutinosa and A. membranaceus, although
CAGTTCCA‐3′, Tm = 61°C, 30 cycles), glyceraldehyde 3‐phosphate R. glutinosa was found to be more efficient in slowing the aging
dehydrogenase (5′‐GAGCGAGACCCCACTAACAT‐3′ and 5′‐ process.
BAI ET AL. | 197

the R. glutinosa and A. membranaceus groups (Figure 2B). The num-

bers of LT‐ and short‐term (ST)‐HSCs were reduced by approxi-
mately twofold in the R. glutinosa group compared with the number
in the control group (Figure 2C‐D). Greater numbers of common
lymphoid progenitors (CLPs) were detected in the R. glutinosa group
compared with the number in the control group (Figure 2I). There
were no differences in the numbers of multipotent progenitors
(MPPs), common myeloid progenitors (CMPs), granulocyte‐macro-
phage progenitors (GMPs) and megakaryocyte‐erythroid progenitors
(MEPs) in the R. glutinosa group compared with the number in the
control group. In the A. membranaceus group, there was no signifi-
cant difference in the numbers of LT‐ and ST‐HSCs compared with
the numbers in the control group (Figure 2C‐D). Furthermore, there
was no difference in the numbers of MPP, CMP, MEP and CLP cells
compared with the numbers in the control group (Figure 2E, 2F, 2H
and 2I); however, the number of GMPs was decreased in the
A. membranaceus group. Thus, mice fed diets supplemented with
R. glutinosa exhibited decreased numbers of hematopoietic stem and
progenitor cells.

3.3 | R. glutinosa enhanced the function and

maintained the quiescence of HSCs
To evaluate the function of HSCs, the clonogenic potential of LT‐
HSCs was examined in vitro. We sorted LT‐HSCs cells into a methyl-
cellulose‐base medium using FACS and counted the number and size
of colonies after 14 days. Compared with the number and size of
colonies produced by cells from mice in the control group, cells from
mice in the R. glutinosa group displayed an increase in the number of
colonies, especially for the small size (P = 0.0241) and large size
clone (P = 0.0418), while there was no difference in the number
F I G U R E 1 Rehmannia glutinosa and Astragalus membranaceus had
from mice in the A. membranaceus group (Figure 3). The increased
anti‐aging effects. Mice were fed diets supplemented with ground
R. glutinosa or A. membranaceus (200 mg/d); the control group was colony size and number in the R. glutinosa group suggested that this
fed a standard diet. A, Changes in bodyweight of mice measured herb enhances the self‐renewal potential of LT‐HSCs.
every 2 months. B, Changes in the senescence grading score of mice Most HSCs in adult mice remain quiescent;19 therefore, the
with age. C, Survival curves. Data represent the mean ± SD; n = 20 maintenance of cellular quiescence is an essential mechanism for
mice/group. Data represent the mean ± SD; n = 5 mice/group.
stem cell self‐renewal.20,21 The observed decreases in HSCs suggest
*P < 0.05, ***P < 0.001
diminished cell proliferation in the R. glutinosa and A. membranaceus
groups; therefore, we examined the cell cycle status of HSCs
through analysis of the proliferative cell marker Ki‐67 combined with
3.2 | R. glutinosa reduced the number of
determination of the DNA content 7‐AAD in the LSK population.
hematopoietic stem cells
We observed an increased number of LSK cells in the G0 phase in
Stem cell exhaustion is thought to be the integrative consequence of the R. glutinosa and A. membranaceus groups compared with that in
multiple types of aging‐associated damage and one of the major the control group (Figure 4A). These results indicated that R. gluti-
causes of tissue and organism aging.1 Recent studies suggest that nosa and A. membranaceus maintained the quiescence of HSCs.
stem cell rejuvenation may reverse the aging phenotype at the Real‐time PCR analysis of cell cycle regulators in LSK cells
organism level.5 We hypothesized that the anti‐aging effects of revealed that p18, p19 and p57 played critical roles in the main-
R. glutinosa are mediated by enhancing stem cell function. Therefore, tenance of HSC quiescence.22-24 There were no obvious changes
we performed flow cytometric analysis of the number of hematopoi- observed for p57 and p19 (Figure 4C‐D), and p18 was upregu-
etic stem/progenitor cells isolated from mice (aged 20 months) fed lated in the R. glutinosa group compared with that in the control
diets supplemented with R. glutinosa or A. membranaceus (200 mg/d) group, and slightly upregulated in the A. membranaceus group
for 10 months (Figure 2A). The percentage of LSKs was reduced in (Figure 4B).
198 | BAI ET AL.

F I G U R E 2 Rehmannia glutinosa and Astragalus membranaceus affected the hematopoietic stem/progenitor cells number. Mice (aged
20 months) were fed diets supplemented with R. glutinosa or A. membranaceus (200 mg/d) for 10 months (n = 5/group); the control group was
fed a standard diet. Freshly isolated bone marrow (BM) cells were stained with the indicated antibodies and analyzed by flow cytometry. A,
Representative staining profiles of BM hematopoietic stem cell and progenitor cell populations. B, The percentage of Lin–Sca1+c‐kit– cells
(LSKs) in BM cells. C‐I, Cell numbers of (C) long‐term (LT; Lin–, Sca‐1+, c‐Kit+, CD34–, Flt3–); D, short‐term (ST; Lin–, Sca‐1+, c‐Kit+, CD34+,
Flt3–); E, multipotent progenitor (MPP; Lin–, Sca‐1+, c‐Kit+, Flt3+); F, common myeloid progenitor (CMP; Lin–, Sca‐1–, c‐Kit–, CD34+, CD16/
CD32–); G, granulocyte‐macrophage progenitor (GMP; Lin–, Sca‐1–, c‐Kit–, CD34+, CD16/CD32+); H, megakaryocyte‐erythroid progenitor (MEP;
Lin–, Sca‐1–, c‐Kit–, CD34–, CD16/CD32–); and I, common lymphoid progenitor (CLP; Lin–, Sca‐1low, c‐Kitlow, CD127+). Data represent the
mean ± SD; n = 5 mice/group. *P < 0.05, **P < 0.01

Reactive oxygen species play a major role in HSC senescence,

3.4 | R. glutinosa delayed HSCs senescence
and loss of HSC quiescence is frequently correlated with increased
Long‐term dietary supplementation with R. glutinosa can extend the cellular ROS.26 Analysis of the intracellular ROS in LSKs showed that
lifespan of mice. Cellular senescence increases with age; therefore, the levels were decreased in the R. glutinosa group compared with
we investigated HSC senescence in the aging mice by flow cytomet- those in the control group (Figure 5B). These data indicated that
ric analysis of SA‐β‐gal stained HSCs using a fluorescent β‐gal sub- R. glutinosa may maintain HSC quiescence and enhance HSC func-
strate (C12FDG).25 The percentage of SA‐β‐gal‐positive cells was tion by decreasing ROS levels.
decreased in the R. glutinosa group, indicating that the R. glutinosa We then investigated the expression several genes involved in
delays LSK cell senescence (Figure 5A). cellular senescence by RT‐PCR analysis of LSK cells. Compared
BAI ET AL. | 199

and control group (Figure 5D‐E). Taken together, these data show
that several key cell cycle and cell senescence‐related genes regu-
late the function of HSCs in mice fed diets supplemented with
R. glutinosa.

3.5 | R. glutinosa enhanced B‐cell immunity

B and T lymphocytes are both important for immunological
responses. T lymphocytes play a critical role in the cellular immunity
and its regulation, while B lymphocytes participate mainly in humoral
immunity. Lymphocyte proliferation is the most immediate index
reflecting organic immunity. To investigate the role in immunological
enhancement, the effects of R. glutinosa and A. membranaceus on
lymphocyte proliferation were examined.
Mice in the R. glutinosa group exhibited decreased numbers of
HSCs and increased numbers of CLPs. Flow cytometric analysis
F I G U R E 3 Function of hematopoietic stem cells enhanced by
showed increased numbers of mature B cells (B220+) in the PB, BM
dietary Rehmannia glutinosa supplementation. In vitro clonogenic
and spleen of mice in the R. glutinosa group compared with the num-
potential of long‐term hepatic stellate cells from mice (n = 3)
bers detected in the control group (Figure 6A); however, there were
with the control group, the expression of cellular senescence‐asso- no significant differences in the numbers of T cells (CD4+ and
ciated proteins p53 and p16 was downregulated in the R. glutinosa CD8+), monocytes and granulocytes (CD11b+) between the two
group (Figure 5D‐E). But the expression of p53 and p16 was not groups (Figure 6B‐D). Thus, these results indicate that dietary
significantly downregulated between the A. membranaceus group R. glutinosa enhances B‐cell immunity.

F I G U R E 4 Dietary supplements of Rehmannia glutinosa and Astragalus membranaceus maintained the quiescence of hematopoietic stem
cells. A, The percentage of cells in each phase of the cell cycle. Flow cytometric analysis of 7‐aminoactinomycin D (7‐AAD) and Ki‐67 staining
of Lin–Sca1+c‐kit– cells (LSKs). B, Real‐time polymerase chain reaction analysis of sorted LSK cell gene expression; GAPDH was used for
normalization. Data represent the mean ± SD of three experiments. *P < 0.05, **P < 0.01, ***P < 0.001
200 | BAI ET AL.

F I G U R E 5 Dietary Rehmannia glutinosa supplementation reduced the hepatic stellate cell (HSC) senescence. Mice (aged 20 months) were
fed diets supplemented with Rehmannia glutinosa or Astragalus membranaceus (200 mg/d) for 10 months (n = 5/group); the control group was
fed a standard diet. A, Flow cytometric analysis of SA‐β‐gal‐positive cells Lin–Sca1+c‐kit– (LSK) using a fluorescent β‐galactosidase substrate
(C12FDG). B, The percentage of reactive oxygen species (ROS)‐positive cells in LSKs. Flow cytometric analysis of ROS‐positive LSKs. Data
represent the mean ± standard deviation (SD). *P < 0.05, ***P < 0.001. C, The expression pattern of cellular senescence‐associated genes in
LSKs; GAPDH was used for normalization. Data represent the mean ± SD of three experiments. *P < 0.05, **P < 0.01, ***P < 0.001

4 | DISCUSSION that R. glutinosa extract enhances bone metabolism.29 Furthermore,

R. glutinosa inhibits inflammatory responses and syndromes,30,31 and
In this study, we investigated the mechanism of the anti‐aging protects against cell damage by scavenging free radicals.14,32 In this
effects of R. glutinosa or A. membranaceus by supplementing the study, we found that mice dietary supplementation with R. glutinosa
diets of mice with the herbs at a dose of 200 mg/d for 10 months. exerted anti‐aging effects and enhanced B‐cell immunity by increas-
R. glutinosa was found to exhibit anti‐aging effects, including ing the proliferative capacity of LT‐HSCs and decreasing the num-
decreased senescence and increased survival of HSCs as well as bers of SA‐β‐gal‐positive cells and ROS levels.
enhanced B‐cell immunity. In terms of the mechanism of the anti‐ The degree of oxidative damage has been found to increase with
aging effects, we found that the R. glutinosa decreased the number age in a variety of cells and tissues. Oxidative stress is a critical
of HSCs, while the proliferation capacity was increased. Further- determinant of HSC self‐renewal. Loss of LT‐HSC quiescence fre-
more, R. glutinosa maintained HSC quiescence and decreased the quently correlates with increased cellular ROS, which is negatively
numbers of SA‐β‐gal‐positive cells and ROS levels through regulation associated with HSCs self‐renewal.26 Catalpol is an iridoid glucoside,
of p18, p53 and p16. In combination, our results confirmed that the which has been found in the root of R. glutinosa. Catalpol showed
anti‐aging effects of R. glutinosa in mice are medicated by maintain- inhibiting oxidative stress, DNA damage and telomere shortening
ing the quiescence and enhancing the function of HSCs. through PGC‐1α/TERT pathway in a previous study.33 In our study,
Rehmannia glutinosa, which has been used as traditional Chinese the level of ROS was decreased in the LSK cells from the R. glutinosa
herbal medicine for thousands of years, can be used to treat hypo- group compared with the control group. Thus R. glutinosa prolongs
glycemia in various diabetic disorders.27,28 It has also been reported the survival of mice by inhibiting oxidative stress in the HSCs.
BAI ET AL. | 201

F I G U R E 6 Flow cytometric analysis of the percentage of mature immune cells in peripheral blood (PB), bone marrow (BM), spleen and
thymus. Mice (aged 20 months) were fed diets supplemented with Rehmannia glutinosa or Astragalus membranaceus (200 mg/d) for 10 months
(n = 5/group); the control group was fed a standard diet. A, Flow cytometric analysis of the percentage of B cells (B220+) in PB, BM and
spleen. B, Flow cytometric analysis of the percentage of monocyte and granulocyte cells (CD11b+) in PB and BM. C and D, Flow cytometric
analysis of the percentage of CD4+ and CD8+ cells in PB, spleen and thymus. Data represent the mean ± SD. *P < 0.05

Astragalus membranaceus is also used in traditional Chinese medi- experiments and wrote the main manuscript test. GYS performed
cine to promote immunity, reduce blood sugar and promote tumor and analyzed the data of FACS. YJY designed the experiment about
cell apoptosis, and also has antioxidation and anti‐aging properties. the Chinese traditional Medicine. WC managed the mice. All authors
In this study, we found that dietary supplementation with A. mem- have read and approved the manuscript.
branaceus for 10 months had no obvious effects compared with
those observed in the control mice, while the weight of mice was
ORCID
reduced at 20 months. Therefore, A. membranaceus may be unsuit-
able for LT treatment to fed mice. Lin Bai http://orcid.org/0000-0002-0646-0812
In conclusion, our results show that R. glutinosa can prolong the
lifespan of mice by maintaining the quiescence and enhancing the
function of HSCs. Furthermore, R. glutinosa can decrease the inter- REFERENCES
cellular levels of ROS and the number of SA‐β‐gal‐positive cells and
1. Lopez-Otin C, Blasco MA, Partridge L, Serrano M, Kroemer G. The
enhance B‐cell immunity.
hallmarks of aging. Cell. 2013;153:1194‐1217.
2. Cho J, Shen H, Yu H, et al. Ewing sarcoma gene Ews regulates
hematopoietic stem cell senescence. Blood. 2011;117:1156‐1166.
ACKNOWLEDGMENTS
3. Rando TA. Stem cells, ageing and the quest for immortality. Nature.
This study was supported partly by the National Science Foundation 2006;441:1080‐1086.
4. Sharpless NE, DePinho RA. How stem cells age and why this makes
for China (31672374), CAMS Innovation Fund for Medical Sciences
us grow old. Nat Rev Mol Cell Biol. 2007;8:703‐713.
(CIFMS) (2016‐12M‐1‐012) and the PUMC Youth Fund 5. Rando TA, Chang HY. Aging, rejuvenation, and epigenetic reprogram-
(2017310018). ming: resetting the aging clock. Cell. 2012;148:46‐57.
6. Florian MC, Dorr K, Niebel A, et al. Cdc42 activity regulates
hematopoietic stem cell aging and rejuvenation. Cell Stem Cell.
CONFLICTS OF INTEREST 2012;10:520‐530.
7. Morrison SJ, Wandycz AM, Akashi K, Globerson A, Weissman IL.
None. The aging of hematopoietic stem cells. Nat Med. 1996;2:1011‐1016.
8. Sudo K, Ema H, Morita Y, Nakauchi H. Age‐associated characteristics
of murine hematopoietic stem cells. J Exp Med. 2000;192:1273‐
AUTHOR CONTRIBUTIONS 1280.
9. Chambers SM, Shaw CA, Gatza C, Fisk CJ, Donehower LA, Goodell
All listed authors meet the requirements for authorship. CQ and LFZ MA. Aging hematopoietic stem cells decline in function and exhibit
conceived and designed the experiments. LB performed the epigenetic dysregulation. PLoS Biol. 2007;5:e201.
202 | BAI ET AL.

10. Li J. Quiescence regulators for hematopoietic stem cell. Exp Hematol. toxic stress and through the microenvironment during aging. Stem
2011;39:511‐520. Cell Reports. 2014;3:1085‐1102.
11. Zhou J, Xu G, Yan J, et al. Rehmannia glutinosa (Gaertn.) DC. polysac- 24. Matsumoto A, Takeishi S, Kanie T, et al. p57 is required for quies-
charide ameliorates hyperglycemia, hyperlipemia and vascular inflam- cence and maintenance of adult hematopoietic stem cells. Cell Stem
mation in streptozotocin‐induced diabetic mice. J Ethnopharmacol. Cell. 2011;9:262‐271.
2015;164:229‐238. 25. Debacq-Chainiaux F, Erusalimsky JD, Campisi J, Toussaint O. Proto-
12. Bao XX, Ma HH, Ding H, Li WW, Zhu M. Preliminary optimization cols to detect senescence‐associated beta‐galactosidase (SA‐betagal)
of a Chinese herbal medicine formula based on the neuroprotective activity, a biomarker of senescent cells in culture and in vivo. Nat
effects in a rat model of rotenone‐induced Parkinson's disease. J Protoc. 2009;4:1798‐1806.
Integr Med. 2018;16:290‐296. 26. Pervaiz S, Taneja R, Ghaffari S. Oxidative stress regulation of stem
13. Huang Y, Jiang C, Hu Y, et al. Immunoenhancement effect of and progenitor cells. Antioxid Redox Signal. 2009;11:2777‐2789.
Rehmannia glutinosa polysaccharide on lymphocyte proliferation and 27. Lee BC, Choi JB, Cho HJ, Kim YS. Rehmannia glutinosa ameliorates
dendritic cell. Carbohyd Polym. 2013;96:516‐521. the progressive renal failure induced by 5/6 nephrectomy. J
14. Wang Y, Kwak M, Lee PC, Jin JO. Rehmannia glutinosa polysaccha- Ethnopharmacol. 2009;122:131‐135.
ride promoted activation of human dendritic cells. Int J Biol Macro- 28. Huang WJ, Niu HS, Lin MH, Cheng JT, Hsu FL. Antihyperglycemic
mol. 2018;116:232‐238. effect of catalpol in streptozotocin‐induced diabetic rats. J Nat Prod.
15. Chinese Pharmacopoeia Commission. Pharmacopoeia of the People’s 2010;73:1170‐1172.
Republic of China 2010 (Set of 3, Chinese edition). Beijing: China 29. Oh KO, Kim SW, Kim JY, et al. Effect of Rehmannia glutinosa Libosch
Medical Science and Technology Press; 2010. extracts on bone metabolism. Clin Chim Acta. 2003;334:185‐195.
16. Wang T, Sun Y, Jin L, et al. Enhancement of non‐specific immune 30. Baek GH, Jang YS, Jeong SI, et al. Rehmannia glutinosa suppresses
response in sea cucumber (Apostichopus japonicus) by Astragalus inflammatory responses elicited by advanced glycation end products.
membranaceus and its polysaccharides. Fish Shellfish Immunol. Inflammation. 2012;35:1232‐1241.
2009;27:757‐762. 31. Sung YY, Yoon T, Jang JY, Park SJ, Kim HK. Topical application of
17. Fu J, Wang Z, Huang L, et al. Review of the botanical characteristics, Rehmannia glutinosa extract inhibits mite allergen‐induced atopic der-
phytochemistry, and pharmacology of Astragalus membranaceus matitis in NC/Nga mice. J Ethnopharmacol. 2011;134:37‐44.
(Huangqi). Phytother Res. 2014;28:1275‐1283. 32. Yu HH, Seo SJ, Kim YH, et al. Protective effect of Rehmannia glutinosa
18. Takeda T, Hosokawa M, Takeshita S, et al. A new murine model of on the cisplatin‐induced damage of HEI‐OC1 auditory cells through
accelerated senescence. Mech Ageing Dev. 1981;17:183‐194. scavenging free radicals. J Ethnopharmacol. 2006;107:383‐388.
19. Cheshier SH, Morrison SJ, Liao X, Weissman IL. In vivo proliferation 33. Zhang Y, Wang C, Jin Y, et al. Activating the PGC‐1alpha/TERT pathway
and cell cycle kinetics of long‐term self‐renewing hematopoietic by catalpol ameliorates atherosclerosis via modulating ROS production,
stem cells. Proc Natl Acad Sci U S A. 1999;96:3120‐3125. DNA damage, and telomere function: implications on mitochondria and
20. Orford KW, Scadden DT. Deconstructing stem cell self‐renewal: telomere link. Oxid Med Cell Longev. 2018;2018:2876350.
genetic insights into cell‐cycle regulation. Nat Rev Genet. 2008;9:
115‐128.
21. Amrani YM, Gill J, Matevossian A, et al. The Paf oncogene is essen-
tial for hematopoietic stem cell function and development. J Exp How to cite this article: Bai L, Shi G, Yang Y, Chen W, Zhang
Med. 2011;208:1757‐1765. L, Qin C. Rehmannia glutinosa exhibits anti‐aging effect
22. Yuan Y, Yu H, Boyer MJ, et al. Hematopoietic stem cells are not the through maintaining the quiescence and decreasing the
direct target of spontaneous leukemic transformation in p18(INK4C)‐
senescence of hematopoietic stem cells. Animal Model Exp
null reconstituted mice. Cancer Res. 2006;66:343‐351.
23. Hilpert M, Legrand C, Bluteau D, et al. p19 INK4d controls
Med. 2018;1:194–202. https://doi.org/10.1002/ame2.12034
hematopoietic stem cells in a cell‐autonomous manner during geno-